CN109929015A - Thuringiensis killing gene cry79Aa1, expression albumen and its application - Google Patents

Abstract

The present invention relates to thuringiensis killing gene cry79Aa1, expression albumen and its applications, belong to technical field of biological control.The insecticidal proteins Cry79Aa isolated from thuringiensis LTS290 (its deposit number are as follows: CGMCC No.10232), with the amino acid sequence as shown in SEQ ID NO.2, and the gene of the insecticidal proteins is encoded, the nucleotide sequence of the preferably described gene is as shown in SEQ ID NO.1.Said gene has certain poisoning power to lepidoptera pest, to be applied to microbial and plant, is allowed to show the toxicity to related pest, and overcomes, pest is delayed to generate the drug resistance of engineering bacteria and genetically modified plants.

Description

Thuringiensis killing gene cry79Aa1, expression albumen and its application

Technical field

The present invention relates to technical field of biological control, and especially the present invention relates to have high virulence to Lepidoptera agricultural pests Bt killing gene and protein by the coded by said gene.

Background technique

Thuringiensis (Bacillus thuringiensis, abbreviation Bt) is a kind of widely distributed gram sun Property bacterium, be that a kind of pair of pest virulence is strong and to the avirulent entomopathogen of natural enemy, it is non-toxic to higher mammal and people. It is current research microbial insecticide the most deep, the most widely used, active to 16 3000 various pests of mesh.Bt Insecticidal crystal protein (Insecticidal CrystalProteins, ICPs), also referred to as δ-endogenous toxic material can be formed in the sporulation phase Plain (delta-endotoxin), its shape, structure and size with its virulence close relation [Schnepf.E, Crickmore. N,Van Rie.J.,Lereclus.D,Baum.J,Feitelson.J,Zeigler.D.R., Dean.D.H.Bacillus thuringiensis and its pesticidal crystal proteins.Microbiol.Mol.Biol.Rev,1998, 62(3):775-806.].It is cloned from Schnepf in 1981 etc. First ICPs gene of Bt, and having delivered in 1985 its DNA base sequence and its having encoded the amino acid sequence of albumen, (in April, 2019) cry mode gene 312 at present, cyt mode gene 11.Now, using spraying chemical pesticide control hand Section can no doubt mitigate pest and cause harm to crops, but chemical pesticide causes environmental pollution, for a long time, largely spray chemistry Insecticide can not only enhance the drug resistance of pest, so that beneficial insect and other ecosystems is wrecked, and seriously pollute environment, Production cost is improved, the ecological balance is destroyed.Thuringiensis insecticidal crystal protein is because of its good disinsection effect, safe and efficient The advantages that and be widely used in pest control.Thuringiensis is other than directly as biological pesticide, and 1996 years The transgenic anti-insect plants that beat the world are approved to apply in the U.S., and the gene that it is used comes from Bt cry1Ac.Next In several years, turn the pest-resistant corn of cry1Ab gene, turns pest-resistant potato of cry3Aa gene etc. at a distance of appearance.In China, from 1998 Since starting formal Insect Resistant Cotton of the popularization containing cry1Ac/cry1Ab gene year, it has been widely planted.In genetically modified crops quotient In first 12 years (1996-2007) of industry, due to that can obtain continual and steady income, peasant planting genetically modified crops amount by Year increases.2017,27 18,000,000 national peasant plantings, 1.89 hundred million hectares of genetically modified crops, genetically modified crops business Change and all brings economy and environmental benefit to the peasant of industrialized country and developing country.Thuringiensis and its gene Excavation has become important topic in Agricultural Sustainable Development.

Since the anti insect gene type for the insect-resistant transgenic crops being commercialized at present is relatively simple, it is so widely applied kind Plant the risk reduced there are pest sanctuary with pest resistance to insecticide rising.Therefore need constantly to separate high virulence or new base The risk for avoiding pest resistance to insecticide to rise because of combination.Therefore, the Bt killing gene of new, high virulence is cloned in screening separation, can To enrich killing gene resource, new gene source is provided for genetically modified crops and engineered strain, improves Bt transgenic product Insect resistant effect, and pest can be reduced to the resistance risk of Bt toxalbumin, it avoids new ecocatastrophe from coming, has important Economic, society and ecological benefits.

Summary of the invention

The present invention is from isolated Bacillus thuringiensis bacterial strain in soil near Wuchang City, Heilongjiang Province town La Lin LTS290, to lepidoptera pest diamondback moth, beet armyworm, bollworm etc. has insecticidal activity, and clone obtains new base from the bacterial strain Because cry79Aa1 and its crystal insecticidal proteins are allowed to show the poison to related pest to be applied to microbial and plant Property, and overcome, pest is delayed to generate the drug resistance of engineering bacteria and genetically modified plants.

Thuringiensis insecticidal proteins Cry79Aa1, amino acid sequence is as shown in SEQ ID NO.2.

Killing gene cry79Aa1, encoding insecticidal proteins Cry79Aa1.

Killing gene cry79Aa1, nucleotide sequence is as shown in SEQ ID NO.1.

A kind of expression vector, it is characterized in that containing cry79Aa1 gene.

The expression vector is pEB-cry79Aa1, skeleton carrier pET21b, and structure is as shown in Figure 3.

A kind of microbial transformant, it is characterized in that containing cry79Aa1 gene.

Killing gene cry79Aa1 is killing the application in Lepidoptera agricultural pests.

The application is that killing gene cry79Aa1 is transformed into plant, and plant is made to express the resistance to agricultural pests, The albumen that either killing gene cry79Aa1 is expressed kills agricultural pests as the effective component of biological insecticides.

The agricultural pests are beet armyworm.

The present invention is from isolated thuringiensis strain bacterial strain of bacillus in soil near Wuchang City, Heilongjiang Province town La Lin LTS290, deposit number are CGMCC No.10232, see patent " thuringiensis LTS290, killing gene Cry57Ab, expression albumen and its application " (ZL2015100098273), which is can be in growth cycle Brood cell is generated, and at the same time having poisoning lepidoptera pest diamondback moth, beet armyworm, corn borer, the effect and suppression of bollworm The parasporal crystal of the effect of Fusariumsp processed；Obtain the positive colony of a new gene from the bacterial strain, i.e. pEB-cry79Aa1 (see Fig. 3), sequencing analysis is carried out to it, is analyzed on the website NCBI using the biosoftwares such as BLAST and application DNAMAN, it should Gene encoder block encodes amino acid quantity 729 by 2190 base compositions.The albumen and Cry19Bb1 egg of gene coding White amino acid identity highest, consistency 42% belong to the first estate new gene, through international delta-endotoxin naming committee It is officially named cry79Aa1.

Cry79Aa1 gene can be shown by the conventional method microbial of biotechnology, plant to related Lepidoptera Beet armyworm, bollworm, the toxicity of diamondback moth pest.

Said gene is converted into bacterial strain, biological pesticide can be made for killing lepidoptera pest in the albumen expressed. Meanwhile plant building insect-resistant transgenic plants, the prevention and treatment for pest can be transferred to.

The present invention separates the Bt cry79Aa1 gene order of clone and its gene expression product can be to Lepidoptera agricultural evil Worm beet armyworm, bollworm, diamondback moth have certain poisoning power, and cry79Aa1 can expand the insecticidal spectrum to lepidoptera pest.It is logical It crosses and is applied to microbial and plant, so that them is shown the toxicity to related pest, can overcome or delay insect to engineering The generation of bacterium and genetically modified plants drug resistance.

Detailed description of the invention

Fig. 1 cry79Aa1 full length gene PCR as a result,

Fig. 2 cry79Aa1 gene expression in escherichia coli albumen SDS-PAGE,

Wherein: M: high-molecular-weight protein Marker 1:pEB empty carrier component；2:Cry57 protein component,

The structure chart of Fig. 3 recombinant vector pEB-cry79Aa1.

Specific embodiment

The present invention will be further described in detail below with reference to the embodiments.

Bacterial strain has preservation, and also there is preservation in the laboratory of applicant, can externally provide.

Embodiment 1. obtains new gene

By genome sequencing, find high with cry19Bb similarity containing one on bacterial strain BtLTS290 genome Cry gene, design overall length primer

5cry79Aa f TTATTTCGGATAGTTATTGTTATA

Cry79Aa r TTGGATTCATATCCTAAAAAGAATG,

With pfuDNA polymerase, PCR amplification is carried out with following system.

Ultrapure water is mended to 50 μ L, and centrifugation is mixed.

Amplification cycles: 94 DEG C are denaturalized 1 minute, and 54 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 25 circulations, and last 72 DEG C Extend 10 minutes.As shown in Figure 1.

1.2 connection scheme

Volume is supplied to 10 μ L with ultrapure water, is mixed well, and 4h or 4 DEG C of connection of 16 DEG C of connections is overnight.

Design the overall length primer of cry79Aa1 genoid, amplification obtains full-length gene, by its with carrier pEB (open carrier, There is preservation in this institute laboratory, can be with external disclosure granting) carrier is attached, is transformed into competence JM109, sieves through resistance Choosing, PCR identification and analysis, filter out the positive recombinant plasmid containing cry79Aa1 gene.Fig. 1 PCR qualification result.Piece will be purified Section connect conversion e. coli jm109 with carrier pET21b, obtains positive transformant.Sequencing analysis is carried out to insertion, is obtained To sequence SEQ ID NO.1, amino acid sequence is shown in SEQ ID NO.2.The correct purpose of size has been obtained by PCR amplification Purpose band is purified and is sequenced by band.Sequencing result shows that the cry79Aa1 gene size in BtLTS290 bacterial strain is 2190bp encodes 729 amino acid residues, and the amino acid similarity with cry19Bb1 is 42%, by Bt delta-endotoxin genes state Border naming committee is officially named cry79Aa1.

1.3 conversion schemes

1.3.1 Escherichia coli convert

1. picking single bacterium falls within 5ml LB shake culture and stays overnight；

2. being inoculated in LB liquid medium by 1% inoculum concentration, 37 DEG C, 230rpm cultivates 2-2.5hr, (OD₆₀₀=0.5- 0.6)；

3.4 DEG C, 4,000rpm centrifugation 10min；

4. abandoning supernatant, the 0.1M CaCl of pre-cooling is added₂50ml suspension cell is placed in 30min or more on ice；

5.4 DEG C, 4,000rpm centrifugation 10min recycle cell；

6. the 0.1M CaCl being pre-chilled with 2-4ml ice₂Cell is resuspended, is distributed into 200 μ l/0.5mL centrifuge tubes, is protected in 4 DEG C It deposits and (can be reserved for one week).

7. taking 200 μ l competent cells to mix well with 5 μ L connection products, ice bath 30min.

8.42 DEG C of heat shock 1.5min, ice bath 3min.

9. 800 μ l LB culture medium, 37 DEG C of culture 45min are added.

10. taking 200 μ l coated plates, corresponding antibiotic and IPTG, X-gal, 37 DEG C of cultures are added.

Embodiment 2, gene expression and determination of activity

2.1.1 Plasmid DNA is extracted in above-mentioned clone, be transferred in recipient bacterium Rosetta (DE3), obtain expression bacterial strain.

After IPTG inducing expression, the detection of SDS-PAGE protein electrophoresis is carried out.

Inducing expression process is as follows:

1) activated spawn (37 DEG C, 12hr)；

2) 10% (37 DEG C, 2hr) are inoculated in LB culture medium；

3) inducer IPTG, 150rpm, 18-22 DEG C of low temperature induction 4-20h is added；

4) thalline were collected by centrifugation, and 10mM TrisCl (pH 8.0) is added and suspends；

5) it is crushed thallus (ultrasonic disruption is complete)；

4 DEG C of 12,000rpm 10min of centrifugation；

Supernatant and each 10-15 μ L of precipitating are collected, respectively electrophoresis detection.

Polyacrylamide gel configuration is as follows.

Loading: loading 10-15 μ l, electrophoresis: 130-150V constant pressure.

Dyeing and decoloration: taking out gel, after distilled water flushing, be put into dyeing liquor after electrophoresis, 60rpm oscillation dyeing 1hr or so, decolourize in destainer 2hr or so, decoloration to gel background transparent, and rinsing is clear to protein band in clear water.

Recombinant plasmid pEB-cry79Aa1, (see Fig. 3) are transformed into E.coli Rosetta (DE3), IPTG induces table It reaches, SDS-PAGE (12%) gel electrophoresis.The result shows that cry79Aa1 gene can be transferred through expression vector pEB in Escherichia coli Middle high efficient expression is about 84kDa albumen, and the pEB empty carrier for being transferred to Rosetta (DE3) induced through IPTG is not special Purpose band generates (Fig. 2).

The insecticidal activity assay of 2.2cry79Aa1 gene coded protein

By cry79Aa1 gene expression albumen, it is diluted with water to various concentration, to the insecticidal activity of lepidoptera pest, specifically Method is as follows, carries out insecticidal bioactivity measurement using feed mixing method.The expression albumen sample of various concentration gradient will be prepared Product are simultaneously sub-packed in the culture dish by disinfection, are stirred and evenly mixed respectively with feed, are selected active newly hatched larvae and are connected on feed, Each processing is repeated 3 times, and diamondback moth, bollworm, each repetition of beet armyworm agricultural pests are 30 test worms.Negative control is 10mmol/L Tris-Cl solution is made.The rearing conditions of test worm are the illumination training that relative humidity is 70%-80%, temperature is 27 DEG C It supports and is cultivated in case, investigate number of dead and live insects amount after raising 48h, calculate the death rate.

This experiment as shown in Table 1 has carried out preliminary insecticidal activity assay to the Cry79Aa1 albumen of expression, to beet night The concentration of moth and bollworm is set to 100 μ g/mL, is set to 50 μ g/mL to diamondback moth concentration, and each processing is repeated 3 times, and with 10 Mmol/LTris-Cl solution has certain insecticidal activity to beet armyworm as negative control, Cry79Aa1 albumen.To diamondback moth It is weaker with bollworm insecticidal activity.Specific raw survey result is as shown in Table 1.

1 Cry79Aa1 protein biological activity result of table

Tab.1 The bioassay results of Cry79Aa1 proteins

Beneficial effects of the present invention: the present invention separates the Bt cry79Aa1 gene order and its gene expression product of clone Virulence can be generated to Lepidoptera, have certain toxic action especially for beet armyworm, can expand and lepidoptera pest is killed Worm spectrum makes them show the toxicity to related pest, can overcome or delay insect by being applied to microbial and plant Generation to engineering bacteria and genetically modified plants drug resistance.

Sequence table

<110>Northeast Agricultural University

<120>thuringiensis killing gene cry79Aa, expression albumen and its application

<141> 2019-04-17

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2190

<212> DNA

<213>bacillus thuringiensis (Bacillus thuringiensis)

<400> 1

atgactaata attatccccg gtatccagta gctaataact cacaaacttc tatgcaaaat 60

acgaattata aggatcggat gaatatgtgg gattcaaata ctattaatta tagaaggatt 120

gattctagtc ctgaagctta tgtttcagcc aaatctgcaa tttccactgg gattagtatt 180

ttctctaaac tattaagtta tttaggccta ggacttgtgg cagactcaat taacataacg 240

atgtctcttg taaatacact ctggaatgag cagaataata tatgggacaa cttattaagg 300

catgtagagg atcttatgaa tcaaaaaata tcagatttag tattatctaa tgcaaatgta 360

gaattgaccg ctttaaaaag gagtttaaac gaatatgccg cctctttaga gaattggaaa 420

aaaaatcctg gtaatccaaa tgctatagag catatcaaat cacaatttac aattactcat 480

aatttttttg tggatcgtct ggctgttttc gcacatccag gctatgaagt attattatta 540

tctgtatatg tacaagcagc aaatcttcat ttactcttat taagagatgc aagcatctat 600

ggaaatcaat gggggctagc tcgaagcaat agtaattatt attatgggag gcaattgtat 660

tatacaaatg aatacacgaa tcattgtgtg aattggtatc acaatggttt aaatcgctta 720

agaggcacaa caggggcaca ttggttgaat tttaatcgat tccgtacaga aatgacatta 780

acagtattag atattattgc attatttcca acttatgatt atcgaaaata tccagcattc 840

acaaaagtag aattatctag ggtaatttat accgatccag taatttatga tgggttttca 900

caactaccta gtaataatgc tggtaatttc aatgattttg aaagagaagc aataggtatt 960

ccttctttaa ccaagtggtt aaagaaaatt gaaatatcta ctggagaaat tagatttgct 1020

acgaatccac atacaggtga ttgggtaaca aatgtatgga acggtaatac taatacgttc 1080

gcatttacag aatcatcatc tgaagtagtt gaaagccatg gaataatgac aaataatcgt 1140

acttctctaa atatgaataa ttttgataac tttagagtag atttacgttc gcattgtttt 1200

agtcaagggg cacctttcta cgatgttttt gggataggtc gctctcaatt ctttaatgga 1260

agaacaaaca taatctatga taacgaaatc ggaataacag atcgttataa tcgtcatcgt 1320

catcaaacta caacgataag tttgccagga gcaaattcgg aacaagcaac tgcaaatgat 1380

tatagtcata ggctagcgga tgtaagaaac ctcacagggg gacttcgtca aaatcctcca 1440

cagcagaata tgggacgttc ctctttaata ggacatgggt ggacacatgt aagtatgaaa 1500

cgcgagaata tattagaatt agataaaatt actcaaattc ctgcggtgaa aagtaatgga 1560

tggatgtttt ctggtgactt attaagaggt cctggtcata caggtggaga cttagtgact 1620

cttggtaatg gggatagata tacactaaat attattttcc cagcacaagc ttatcgcatt 1680

cgcgttcggt atgcttctaa tggcgacggc gagatgggta tcgatgtaaa tggggtagga 1740

tatacccgtt ttagtataaa gtgcactttt tctcataata attataataa tttaaattcc 1800

caagatttct gtttagtgga tacatctttt atttacaatg caacttatac aggatcaaag 1860

actatatggt tatacagtta ttcaacaaca cgagtgatta tagataaaat tgaatttata 1920

ccagttggga tttttgcaaa tcaatcattt gaagaaacag aaggatataa tcaaaactat 1980

agccattacg acccaaacat ggatactaca taccaaccaa actatgacaa tgggtatgaa 2040

caaaataact atgatagtta tgatcaaagt tgtaataata cttacgaatc caaccatgac 2100

tgtaattgta atcaagaata taccaacaac tataatcaaa actctggttg tacgtgcaac 2160

caaaagtata acaataacta tccgaaataa 2190

<210> 2

<211> 729

<212> PRT

<213>bacillus thuringiensis (Bacillus thuringiensis)

<400> 2

Met Thr Asn Asn Tyr Pro Arg Tyr Pro Val Ala Asn Asn Ser Gln Thr

1 5 10 15

Ser Met Gln Asn Thr Asn Tyr Lys Asp Arg Met Asn Met Trp Asp Ser

20 25 30

Asn Thr Ile Asn Tyr Arg Arg Ile Asp Ser Ser Pro Glu Ala Tyr Val

35 40 45

Ser Ala Lys Ser Ala Ile Ser Thr Gly Ile Ser Ile Phe Ser Lys Leu

50 55 60

Leu Ser Tyr Leu Gly Leu Gly Leu Val Ala Asp Ser Ile Asn Ile Thr

65 70 75 80

Met Ser Leu Val Asn Thr Leu Trp Asn Glu Gln Asn Asn Ile Trp Asp

85 90 95

Asn Leu Leu Arg His Val Glu Asp Leu Met Asn Gln Lys Ile Ser Asp

100 105 110

Leu Val Leu Ser Asn Ala Asn Val Glu Leu Thr Ala Leu Lys Arg Ser

115 120 125

Leu Asn Glu Tyr Ala Ala Ser Leu Glu Asn Trp Lys Lys Asn Pro Gly

130 135 140

Asn Pro Asn Ala Ile Glu His Ile Lys Ser Gln Phe Thr Ile Thr His

145 150 155 160

Asn Phe Phe Val Asp Arg Leu Ala Val Phe Ala His Pro Gly Tyr Glu

165 170 175

Val Leu Leu Leu Ser Val Tyr Val Gln Ala Ala Asn Leu His Leu Leu

180 185 190

Leu Leu Arg Asp Ala Ser Ile Tyr Gly Asn Gln Trp Gly Leu Ala Arg

195 200 205

Ser Asn Ser Asn Tyr Tyr Tyr Gly Arg Gln Leu Tyr Tyr Thr Asn Glu

210 215 220

Tyr Thr Asn His Cys Val Asn Trp Tyr His Asn Gly Leu Asn Arg Leu

225 230 235 240

Arg Gly Thr Thr Gly Ala His Trp Leu Asn Phe Asn Arg Phe Arg Thr

245 250 255

Glu Met Thr Leu Thr Val Leu Asp Ile Ile Ala Leu Phe Pro Thr Tyr

260 265 270

Asp Tyr Arg Lys Tyr Pro Ala Phe Thr Lys Val Glu Leu Ser Arg Val

275 280 285

Ile Tyr Thr Asp Pro Val Ile Tyr Asp Gly Phe Ser Gln Leu Pro Ser

290 295 300

Asn Asn Ala Gly Asn Phe Asn Asp Phe Glu Arg Glu Ala Ile Gly Ile

305 310 315 320

Pro Ser Leu Thr Lys Trp Leu Lys Lys Ile Glu Ile Ser Thr Gly Glu

325 330 335

Ile Arg Phe Ala Thr Asn Pro His Thr Gly Asp Trp Val Thr Asn Val

340 345 350

Trp Asn Gly Asn Thr Asn Thr Phe Ala Phe Thr Glu Ser Ser Ser Glu

355 360 365

Val Val Glu Ser His Gly Ile Met Thr Asn Asn Arg Thr Ser Leu Asn

370 375 380

Met Asn Asn Phe Asp Asn Phe Arg Val Asp Leu Arg Ser His Cys Phe

385 390 395 400

Ser Gln Gly Ala Pro Phe Tyr Asp Val Phe Gly Ile Gly Arg Ser Gln

405 410 415

Phe Phe Asn Gly Arg Thr Asn Ile Ile Tyr Asp Asn Glu Ile Gly Ile

420 425 430

Thr Asp Arg Tyr Asn Arg His Arg His Gln Thr Thr Thr Ile Ser Leu

435 440 445

Pro Gly Ala Asn Ser Glu Gln Ala Thr Ala Asn Asp Tyr Ser His Arg

450 455 460

Leu Ala Asp Val Arg Asn Leu Thr Gly Gly Leu Arg Gln Asn Pro Pro

465 470 475 480

Gln Gln Asn Met Gly Arg Ser Ser Leu Ile Gly His Gly Trp Thr His

485 490 495

Val Ser Met Lys Arg Glu Asn Ile Leu Glu Leu Asp Lys Ile Thr Gln

500 505 510

Ile Pro Ala Val Lys Ser Asn Gly Trp Met Phe Ser Gly Asp Leu Leu

515 520 525

Arg Gly Pro Gly His Thr Gly Gly Asp Leu Val Thr Leu Gly Asn Gly

530 535 540

Asp Arg Tyr Thr Leu Asn Ile Ile Phe Pro Ala Gln Ala Tyr Arg Ile

545 550 555 560

Arg Val Arg Tyr Ala Ser Asn Gly Asp Gly Glu Met Gly Ile Asp Val

565 570 575

Asn Gly Val Gly Tyr Thr Arg Phe Ser Ile Lys Cys Thr Phe Ser His

580 585 590

Asn Asn Tyr Asn Asn Leu Asn Ser Gln Asp Phe Cys Leu Val Asp Thr

595 600 605

Ser Phe Ile Tyr Asn Ala Thr Tyr Thr Gly Ser Lys Thr Ile Trp Leu

610 615 620

Tyr Ser Tyr Ser Thr Thr Arg Val Ile Ile Asp Lys Ile Glu Phe Ile

625 630 635 640

Pro Val Gly Ile Phe Ala Asn Gln Ser Phe Glu Glu Thr Glu Gly Tyr

645 650 655

Asn Gln Asn Tyr Ser His Tyr Asp Pro Asn Met Asp Thr Thr Tyr Gln

660 665 670

Pro Asn Tyr Asp Asn Gly Tyr Glu Gln Asn Asn Tyr Asp Ser Tyr Asp

675 680 685

Gln Ser Cys Asn Asn Thr Tyr Glu Ser Asn His Asp Cys Asn Cys Asn

690 695 700

Gln Glu Tyr Thr Asn Asn Tyr Asn Gln Asn Ser Gly Cys Thr Cys Asn

705 710 715 720

Gln Lys Tyr Asn Asn Asn Tyr Pro Lys

725

Claims (9)

1. insecticidal proteins Cry79Aa1, amino acid sequence is as shown in SEQ ID NO.2.

2. killing gene cry79Aa1 encodes insecticidal proteins Cry79Aa1 described in claim 1.

3. killing gene cry79Aa1 as claimed in claim 2, nucleotide sequence is as shown in SEQ ID NO.1.

4. a kind of expression vector, it is characterized in that containing cry79Aa1 gene as claimed in claim 2.

5. expression vector according to claim 4 is pEB-cry79Aa1, skeleton carrier pET21b, structure such as Fig. 3 It is shown.

6. a kind of microbial transformant, it is characterized in that containing cry79Aa1 gene as claimed in claim 2.

7. killing gene cry79Aa1 of any of claims 1 or 2 is killing the application in Lepidoptera agricultural pests.

8. application according to claim 7 is that killing gene cry79Aa1 is transformed into plant, make plant expression to agriculture The resistance of industry pest, or the albumen that killing gene cry79Aa1 is expressed kill agriculture as the effective component of biological insecticides Industry pest.

9. application according to claim 7, the agricultural pests are beet armyworm.