Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/52—Genes encoding for enzymes or proenzymes

Definitions

• the present invention relates to modified phytases.
• Phytate is abundant in plants as a storage form of phosphate. Monogastric animals are not able to liberate phosphate from phytate and therefore require supplementation of phosphate to their feed.
• the enzyme phytase is supplemented to animal feed to liberate phosphate from phytate.
• phytase is added to animal feed during the process of feed preparation. In some stages of the animal feed production process, phytase is subjected to conditions of relatively high temperature and relatively high humidity. These conditions have a negative influence on the activity of labile compounds like enzymes.
• the phytase derived from Aspergillus niger is commonly used for feed applications due to favourable properties of this phytase.
• thermostability of Aspergillus niger phytase is relatively low. Therefore, there is a need for a phytase with the same favourable properties as Aspergillus niger phytase combined with a high stability and activity at high temperatures.
• the present invention discloses modified phytases with favourable properties, for - instance with respect to resistance to high temperature and humidity. Description of the Figures
• a phytase is an enzyme which catalyses the hydrolysis of phytate (myoinositol hexakisphosphate) to one or more of the following compounds: myoinositol penta-, tetra-, tri-, di- and mono-phosphate and/or myoinositol. It is thereby generally known that some phytases are not able to substantially hydrolyse myoinositol monophosphate to myoinositol.
• Phytase enzymes can be 3-phytases or 6- phytases (EC 3.1.3.8 or EC 3.1.3.26, respectively), referring to the position of the first ester bond that is hydrolysed.
• a first aspect of the present invention relates to a polypeptide that is a modified phytase.
• the polypeptide according to the invention is modified as compared to a model phytase in such a way that the polypeptide according to the invention, when aligned to the model phytase, contains a modification selected from the group consisting of: a substitution of an amino acid as present in the model phytase for a different amino acid, a deletion of an amino acid as present in the model phytase, or an insertion of an amino acid.
• the alignment of the polypeptide according to the invention to a model phytase is done in such a way as to obtain a maximal amount of homologous (identical) residues between the polypeptide according to the invention and the model phytase.
• the ' modification is a substitution.
• the number of modifications may be at least one, preferably at least 10, more preferably at least 20, more preferably at least 30, more preferably at least 40, more preferably at least 50, more preferably at least 70, more preferably at least 80.
• a denotation like e.g. "5QS” means that the amino acid in position 5 of the model phytase in question is substituted with either Q or S.
• the nature of the original amino acid residue may depend on the model phytase that is used.
• a denotation like e.g. "Q5S” means that a specific amino acid residue present in the model phytase, e.g. Q, is substituted with a different amino acid, e.g. S.
• the modified phytase is modified as compared to the model phytase in preferably at least one of the following positions: 5, 6, 13, 19, 21 , 29, 31 , 36, 39, 43, 53, 69, 78, 81 , 85, 87, 99, 112, 113, 122, 125, 126, 128, 137, 147, 148, 157, 160, 163, 165, 169, 172, 176, 178, 180, 181 , 182, 183, 189, 194, 197, 201 , 203, 211 , 213, 215, 218, 222, 223, 225, 232, 233, 242, 246, 247, 248, 249, 250, 251 , 252, 254, 269, 291 , 296, 310, 312, 315, 322, 330, 342, 346, 362, 365, 367, 368, 372, 374, 375, 382, 384, 395, 414, 417, 425, 428,
• the modified phytase is modified as compared to the model phytase in at least one of the following positions 31 , 78, 163, 180, 182, 194, 211 , 215, 242, 254, 269, 414, 428, 440.
• the modified phytase contains at least one of the following modifications as compared to the model phytase: 5QS, 6SH, 13G, 19P, 211, 29S, 31 FY, 36D, 39A, 43D, 53V, 69S, 78EA, 81 K, 85A, 87K, 99T, 112Q, 113M, 122R, 125K, 126A, 128A, 137A, 147A, 148E, 157A, 160A, 163RG, 165N, 169A, 172V, 1761, 178P, 180AG,
• the modified phytase contains at least one of the following modifications as compared to the model phytase: 31 Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E, 440E.
• the position numbering as used throughout the present invention is according to the position numbering of SEQ ID NO:1.
• the model phytase as used in the present invention is a phytase obtainable from a filamentous fungus from the genus Aspergillus, preferably from the species
• Aspergillus niger or a variant phytase derived from any of these phytases. It is thereby known that phytases within individual strains of the species Aspergillus niger show a low degree of variation, i.e. the homology of these phytases is at least 90%. It is also known that the species Aspergillus niger comprises species formerly known as Aspergillus ficuum and Aspergillus awamori. Most preferably, the model phytase is the phytase obtainable from Aspergillus niger NRRL 3135, as indicated in SEQ ID NO:1.
• An especially preferred model phytase is a phytase containing a combination of specific amino acid residues that are uniquely present in Aspergillus niger phytase.
• the especially preferred model phytase contains the same amino acid residues in the active site as the amino acids present in Aspergillus niger phytase at the corresponding positions.
• the present invention discloses a method to define those residues in the active site of Aspergillus niger phytase that are present within a certain distance of bound phytate.
• the amino acid residues which form the active site of Aspergillus niger phytase and which are relevant for the catalytic properties in the degradation of phytic acid by Aspergillus niger phytase were identified using the 3D structure of the Aspergillus niger phytase which is available from the Protein Data Bank (PDB) as entry 11HP (Kostrewa et al. Nature Structural Biology, 1997, 4, 185).
• PDB Protein Data Bank
• the Aspergillus niger 3D structure does not contain the substrate phytic acid (myo-inositol hexakisphosphate).
• the substrate phytic acid was taken from the E.coli phytase active site and transferred to the corresponding site in Aspergillus niger phytase. Subsequently the Aspergillus niger phytase complexed with the phytic acid was subjected to energy minimization allowing substrate and active site residues to shift while keeping the remainder of the structure fixed. The energy minimizations were conducted with the Insight & Discover program (Accelrys, San Diego CA) with the forcefield CVFF using a SGI Octane workstation. The resulting model for Aspergillus niger phytase complexed with phytic acid was coded IHP-S.
• the active site amino acid residues of Aspergillus niger phytase are those amino acid residues that are within a certain distance from phytic acid when bound in the active site.
• said distance is 6 Angstrom, more preferably 7 Angstrom.
• the especially preferred model phytase contains the amino acids Q27, Y28, R58, H59, R62, P64, T65, S67, K68, Y72, D103, S140, R142, V143, E179, D188, F243, KN277, K278, H282, S337, H338, D339, N340, F380 (within 6 Angstrom distance), preferably the amino acids Q27, Y28, R58, H59, G60, R62, Y63, P64, T65, DE66, S67, K68, K71 , Y72, D103, S140, R142, V143, E179, D188, E196, D239, F243,
• the especially preferred model phytase additionally contains the following amino acids as present in Aspergillus niger phytase: A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381.
• non-specified position it is not critical to the invention which amino acid residue may be present.
• a non-specified position is a position that is not within the active site of Aspergillus niger phytase and that is not an Aspergillus niger amino acid as additionally specified above and that is not subjected to specific modifications as specified above.Alignment of phytases using a commonly known alignment program will reveal which amino acid(s) typically will occur at a certain position. At a corresponding non-specified position in the polypeptide of the invention, any one of such an amino acid may be present.
• a preferred polypeptide according to the invention is a phytase that contains the same amino acid residues in the active site as the amino acids present in Aspergillus niger phytase at the corresponding positions, as well as the additionally specified Aspergillus niger amino acids (i.e. A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381), and that further contains a modification as specified above.
• Aspergillus niger amino acids i.e. A35, A46, N130, S141 , G167, Q168, D174, T191 , E199, E205, L220, T235, D244, I268, H306, G341 , K356, A381
• An especially preferred polypeptide according to the invention is a phytase that further contains at least one of the following amino acid residues: 31 Y, 78A, 163G, 180G, 182G, 194A, 211L, 215A, 242P, 254E, 269Q, 414A, 428E and/or 440E.
• Another especially preferred polypeptide according to the invention contains at least one of the following amino acid residues: 180G, 182G, 242P and/or 440E; or preferably at least 180G, 182G and/or 242P.
• the present invention discloses a polypeptide that is a modified phytase according to SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.
• a polypeptide of the invention may comprise all of the modifications set out above.
• the polypeptide of the invention may comprise additional modifications that concern positions in the polypeptide wherein a modification does not affect the folding or activity of the polypeptide.
• modifications may be conservative substitutions, i.e. substitutions wherein a non-polar, polar uncharged, polar charged or aromatic amino acid is substituted for a different amino acid from the same category.
• the polypeptide of the invention may comprise a polypeptide with at least 91 , preferably at least 92, more preferably at least 93, more preferably at least 94, more preferably at least 95, more preferably at least 96, more preferably at least 97, more preferably at least 98 or most preferably at least 99% sequence homology (identity) to SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.
• the polypeptide according to the invention is modified to increase thermostability and/or to modify specific activity and/or to modify specificity for a certain substrate and/or to modify the pH optimum of the enzyme and/or to improve pelleting stability and/or to improve bioefficacy, and/or to improve expression, transport, maturation, and the like, in the host organism used to produce the modified phytase, when compared with the model phytase.
• the polypeptide according to the invention has retained several of the biochemical properties of Aspergillus niger phytase, in particular of the phytase obtainable from Aspergillus niger NRRL 3135.
• the biochemical property that is retained is the Km value and/or the pH optimum at two pH values of about 5.5 and 2.5 and/or the specific activity and/or the high activity at a physiological temperature.
• the polypeptide according to the invention is obtained an increased thermostability.
• An increased thermostability of a modified phytase according to the invention as compared to a model phytase may be expressed by a longer life-time at a given elevated temperature and/or improved refolding / reactivation characteristics and/or an unfolding at a higher temperature.
• polypeptide according to the invention combines several favourable properties of Aspergillus niger phytase with an increased thermostability.
• Amino acids important for e.g. thermostability or activity of the polypeptide of the invention, and therefore potentially subject to substitution may be identified and modified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis. In the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (e.g phytase activity) to identify amino acid residues that are critical to the activity of the molecule.
• Sites of enzyme-substrate interaction can also be determined by analysis of crystal structure as determined by such techniques as nuclear magnetic resonance, crystallography or photo-affinity labelling or molecular modelling.
• Polypeptides of the invention may be produced by synthetic means although usually they will be made recombinantly by expression of a polynucleotide sequence encoding the polypeptide in a suitable host organism.
• yeast and fungal host cells is expected to provide for such post- translational modifications (e.g. proteolytic processing, myristilation, glycosylation, truncation, and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention.
• Polypeptides of the invention may be provided in a form such that they are outside their natural cellular environment. Thus, they may be substantially isolated or purified, as discussed above, or produced in a cell in which they do not occur in nature, e.g. a cell of other fungal species, animals, yeast or bacteria.
• Polypeptides of the invention may be analysed by any suitable assay known to the skilled person to measure an improvement as compared to a model phytase known in the art.
• the present invention provides an (e.g. isolated and/or purified) polynucleotide comprising a polynucleotide sequence encoding the polypeptide of the first aspect.
• the present invention provides a polynucleotide comprising a polynucleotide sequence encoding the amino acid sequence set out in SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7 or a polynucleotide comprising SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.
• the polynucleotides of the second aspect further include any degenerate versions of a polynucleotide sequence encoding the polypeptide of the first aspect.
• the skilled person may, using routine techniques, make nucleotide substitutions that do not affect the protein sequence encoded in the polynucleotides of the invention to reflect the codon usage of any particular host organism in which the polypeptides of the invention are to be expressed.
• the polynucleotide sequence of the second aspect may be RNA or DNA and includes genomic DNA, synthetic DNA or cDNA.
• the polynucleotide is a DNA sequence.
• Polynucleotides of the invention can be synthesized according to methods well known in the art. They may be produced by combining oligonucleotides synthesized according to and along the nucleotide sequence of the polynucleotide of the invention. Alternatively, they may be synthesized by mutagenising a parental polynucleotide at any desired position.
• the polynucleotide of the invention is constructed from a series of synthetic oligonucleotides with a length of 80 nucleotides, having an overlap of about 20 nucleotides.
• a PCR typically of 10 steps, is performed with a polymerase with proofreading activity on all 80-mer oligonucleotides to anneal and extend the oligonucleotides.
• a further PCR with a proofreading polymerase is performed with PCR primers situated at the 5' and 3' end of the desired fragment, to synthesise the complete desired fragment.
• the complete fragment is cloned in a suitable vector and sequenced to establish whether or not a correct sequence is obtained.
• sequence errors may be corrected, for instance using the QuickChange kit from Stratagene according to the Manufacturer's instructions.
• Polynucleotides of the invention may be used to obtain polynucleotides encoding a further modified polypeptide, e.g. by subjecting polynucleotides of the invention to mutagenesis techniques. Site-directed mutagenesis may be used to alter the polynucleotides of the invention at one or more specific positions.
• Gene shuffling technology for instance as disclosed in WO95/22625, WO98/27230, WO98/01581 and/or WO00/46344
• the invention also provides vectors comprising a polynucleotide of the invention, including cloning and expression vectors.
• the vector into which the expression cassette or polynucleotide of the invention is inserted may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of the vector will often depend on the host cell into which it is to be introduced.
• the vector may be an autonomously replicating vector, i.e. a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid, cosmid, virus or phage vector, usually provided with an origin of replication.
• the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
• the vector may be a circular, e.g. a plasmid, or a linear, e.g. an expression cassette, polynucleotide.
• the polynucleotide of the invention may be inserted into an expression cassette.
• the polynucleotide of the invention is operably linked to a regulatory sequence that is capable of providing for the expression of a polypeptide from its coding sequence by the host cell, i.e. the vector is an expression vector.
• operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
• a regulatory sequence such as a promoter, an enhancer or another expression regulatory signal "operably linked" to a coding sequence is positioned in such a way that expression of a polypeptide from its coding sequence is achieved under conditions compatible with the regulatory sequences.
• An expression cassette for a given host cell may comprise the following elements operably linked to each other in a consecutive order from the 5'-end to 3'-end relative to the coding strand of the sequence encoding the polypeptide of the first aspect: a promoter sequence capable of directing transcription of the DNA sequence encoding the polypeptide in the given host cell; optionally, a signal sequence capable of directing secretion of the polypeptide from the given host cell into a culture medium; a DNA sequence encoding a mature and preferably active form of the polypeptide; and preferably also a transcription termination region (terminator) capable of terminating transcription downstream of the DNA sequence encoding the polypeptide.
• promoters may be used to direct expression of the polypeptide of the invention.
• the promoter may be selected for its efficiency in directing the expression of the polypeptide of the invention in the desired expression host.
• Promoters/enhancers and other expression regulatory signals may be selected to be compatible with the host cell for which the expression cassette or vector is designed.
• the promoter sequence is derived from a highly expressed gene.
• a highly expressed gene is a gene whose mRNA can make up at least 0.01% (w/w) of the total cellular mRNA, e.g. under induced conditions, or alternatively, a gene whose gene product can make up at least 0.2% (w/w) of the total cellular protein, or, in case of a secreted gene product, can be secreted to a level of at least 0.05g/l.
• Examples of preferred highly expressed genes from which promoters are preferably derived and/or which are comprised in preferred predetermined target loci for integration of expression cassettes include but are not limited to genes encoding glycolytic enzymes such as triose-phosphate isomerases (TPI), glyceraldehyde- phosphate dehydrogenases (GAPDH), phosphoglycerate kinases (PGK), pyruvate kinases (PYK), alcohol dehydrogenases (ADH), as well as genes encoding amylases, glucoamylases, proteases, glucanases, cellobiohydrolases, ⁇ -galactosidases, alcohol (methanol) oxidases, elongation factors and ribosomal proteins.
• TPI triose-phosphate isomerases
• GPDH glyceraldehyde- phosphate dehydrogenases
• PGK phosphoglycerate kinases
• suitable highly expressed genes include e.g. the LAC4 gene from Kluyveromyces sp., the methanol oxidase genes (AOX and MOX) from Hansenula and Pichia, respectively, the glucoamylase (glaA) genes from A.niger and A.awamori, the A.oryzae TAKA- amylase gene, the A.nidulans gpdA gene and the T.reesei cellobiohydrolase genes.
• LAC4 gene from Kluyveromyces sp.
• AOX and MOX methanol oxidase genes
• glaA glucoamylase
• glaA glucoamylase
• A.oryzae TAKA- amylase gene the A.nidulans gpdA gene
• T.reesei cellobiohydrolase genes e.g. the LAC4 gene from Kluyveromyces sp.
• prokaryotic promoters may be used, in particular those suitable for use in E.coli strains.
• strong bacterial promoters are the -amylase and SPo2 promoters as well as promoters from extracellular protease genes.
• Yeast promoters include S. cerevisiae GAL4 and ADH promoters, the S. pombe nmt 1 and adh promoter.
• strong yeast promoters are those obtainable from the genes for alcohol dehydrogenase, lactase, 3-phosphoglycerate kinase and triosephosphate isomerase.
• strong constitutive and/or inducible promoters which are preferred for use in fungal expression hosts are those which are obtainable from the fungal genes for xylanase (xlnA), phytase, ATP-synthetase, subunit 9 (o//C), triose phosphate isomerase (tpi), alcohol dehydrogenase (AdhA), ⁇ -amylase (amy), amyloglucosidase (AG - from the glaA gene), acetamidase (amdS) and glyceraldehyde-3-phosphate dehydrogenase (gpd) promoters.
• xylanase xylanase
• phytase ATP-synthetase
• subunit 9 o//C
• triose phosphate isomerase tpi
• Alcohol dehydrogenase AdhA
• ⁇ -amylase ⁇
• Promoters suitable for plant cells include nopaline synthase (nos), octopine synthase (ocs), mannopine synthase (mas), ribulose small subunit (rubisco ssu), histone, rice actin, phaseolin, cauliflower mosaic virus (CMV) 35S and 19S and circovirus promoters. All these promoters are readily available in the art. If the polypeptide is produced as a secreted protein, the polynucleotide sequence encoding a mature form of the polypeptide in the expression cassette is operably linked to a polynucleotide sequence encoding a signal peptide.
• the signal sequence is native (homologous) to the polynucleotide sequence encoding the polypeptide.
• the signal sequence is obtained from the Aspergillus niger phytase gene, in particular the signal sequence as disclosed in EP 0 420 358.
• the signal sequence is foreign (heterologous) to the polynucleotide sequence encoding the polypeptide, in which case the signal sequence is preferably endogenous to the host cell in which the DNA sequence is expressed.
• the signal sequence may be used in combination with the promoter driving expression of the coding sequence wherefrom the signal sequence is obtained, e.g.
• Aspergillus (niger) amyloglucosidase also called (gluco)amylase
• AG amyloglucosidase
• Hybrid signal sequences may also be used within the context of the present invention.
• suitable signal sequences for yeast host cells are the signal sequences derived from yeast ⁇ -factor genes.
• a suitable signal sequence for bacteria is derived from the ⁇ -amylase gene (Bacillus).
• the cleavage of the signal peptide during passage of a polypeptide through the secretory pathway may occur at more than one position, implicating a mature polypeptide with a variable N-terminus.
• the present invention encompasses polypeptides with such variable N-termini.
• the origin of the terminator is less critical.
• the terminator can e.g. be native to the polynucleotide sequence encoding the polypeptide.
• a yeast terminator is used in yeast host cells and a filamentous fungal terminator is used in filamentous fungal host cells. More preferably, the terminator is endogenous to the host cell (in which the polynucleotide sequence encoding the polypeptide is to be expressed).
• the vector may contain one or more selectable marker genes, to enable selection of transformed cells from the majority of untransformed cells.
• Preferred selectable markers include but are not limited to those that complement a defect in the host cell or confer resistance to a drug. They include e.g. versatile marker genes that can be used for transformation of most filamentous fungi and yeasts such as acetamidase genes or cDNAs (the amdS, niaD, facA genes or cDNAs from A.nidulans, A.oryzae, or A. niger), or genes providing resistance to antibiotics like G418, hygromycin, bleomycin, kanamycin, phleomycin or benomyl resistance (benA). Alternatively, specific selection markers can be used such as auxotrophic markers which require corresponding mutant host strains: e.g.
• the selection marker is deleted from the transformed host cell after introduction of the expression construct so as to obtain transformed host cells capable of producing the polypeptide which are free of selection marker genes.
• markers include ATP synthetase, subunit 9 (o//C), orotidine-5'-phosphate- decarboxylase (pvrA), the bacterial G418 resistance gene (this may also be used in yeast, but not in fungi), the ampicillin resistance gene (£. coli), the neo ycin resistance gene (Bacillus) and the E. coli uidA gene, coding for ⁇ -glucuronidase (GUS).
• Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.
• the DNA sequence encoding the polypeptide is preferably introduced into a suitable host as part of an expression cassette.
• transformation procedures are available which are well known to the skilled person.
• the expression cassette can be used for transformation of the host as part of a vector carrying a selectable marker, or the expression cassette may be co-transformed as a separate molecule together with the vector carrying a selectable marker.
• the vector may comprise one or more selectable marker genes.
• the vector or expression construct is preferably integrated in the genome of the host cell in order to obtain stable transformants. However, for certain yeasts also suitable episomal vectors are available into which the expression construct can be incorporated for stable and high level expression.
• Examples thereof include vectors derived from the 2 ⁇ and pKD1 plasmids of Saccharomyces and Kluyveromyces, respectively, or vectors containing an AMA sequence (e.g. AMA1 from Aspergillus).
• the expression constructs are integrated in the host cells genome, the constructs are either integrated at random loci in the genome, or at predetermined target loci using homologous recombination, in which case the target loci preferably comprise a highly expressed gene.
• suitable highly expressed genes are provided earlier.
• host cells comprising a polynucleotide or vector of the invention.
• the polynucleotide may be heterologous to the genome of the host cell.
• heterologous means that the polynucleotide does not naturally occur in the genome of the host cell or that the polypeptide is not naturally produced by that cell.
• Suitable host cells are preferably prokaryotic microorganisms such as bacteria, or more preferably eukaryotic organisms, for example fungi, such as yeasts or filamentous fungi, or plant cells.
• Bacteria from the genus Bacillus are very suitable as heterologous hosts because of their capability to secrete proteins into the culture medium.
• Other bacteria suitable as hosts are those from the genera Streptomyces and Pseudomonas.
• a preferred yeast host cell for the expression of the DNA sequence encoding the polypeptide of the invention is of the genera Saccharomyces, Kluyveromyces, Hansenula, Pichia, Yarrowia, and Schizosaccharomyces. More preferably a yeast host cell is selected from the group consisting of the species Saccharomyces cerevisiae, Kluyveromyces lactis (also known as Kluyveromyces marxianus var. lactis), Hansenula polymorpha, Pichia pastoris, Yarrowia lipolytica,and Schizosaccharomyces pombe. Most preferred are filamentous fungal host cells. Preferred filamentous fungal host cells are selected from the group consisting of the genera Aspergillus,
• a filamentous fungal host cell is of the species Aspergillus oyzae, Aspergillus sojae, Aspergillus nidulans, or a species from the Aspergillus niger Group (as defined by Raper and Fennell, The Genus Aspergillus, The Williams & Wilkins Company,
• fungi such as Aspergillus species and Trichoderma species
• bacteria such as Bacillus species e.g. Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Pseudomonas species
• yeasts such as Kluyveromyces species e.g. Kluyveromyces lactis and Saccharomyces species, e.g. Saccharomyces cerevisiae.
• Host cells according to the invention further include plant cells, and the invention therefore extends to transgenic organisms, such as plants and parts thereof, which contain one or more cells of the invention.
• the transgenic (or genetically modified) plant may therefore have inserted (e.g. stably) into its genome a sequence encoding one or more of the polypeptides of the invention.
• the transformation of plant cells can be performed using known techniques, for example using a Ti or a Ri plasmid from Agrobacterium tumefaciens.
• the plasmid (or vector) may thus contain sequences necessary to infect a plant, and derivatives of the Ti and/or Ri plasmids may be employed.
• a part of a plant such as a leaf, root or stem
• the plant to be infected can be wounded, for example by cutting the plant with a razor or puncturing the plant with a needle or rubbing the plant with an abrasive. The wound is then innoculated with the Agrobacterium.
• the plant or plant part can then be grown on a suitable culture medium and allowed to develop into a mature plant.
• Regeneration of transformed cells into genetically modified plants can be achieved by using known techniques, for example by selecting transformed shoots using an antibiotic and by sub-culturing the shoots on a medium containing the appropriate nutrients, plant hormones and the like.
• a further aspect of the invention thus provides host cells transformed or transfected with or comprising a polynucleotide or vector of the invention.
• the polynucleotide is carried in a vector for replication of the polynucleotide and expression of the polypeptide.
• the cells will be chosen to be compatible with the said vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells.
• a heterologous host may also be chosen wherein the polypeptide of the invention is produced in a form which is substantially free from other polypeptides with a similar activity as the polypeptide of the invention. This may be achieved by choosing a host which does not normally produce such polypeptides with similar activity.
• the vector may be used to replicate the polynucleotide in a compatible host cell.
• the invention provides a method of producing a polynucleotide according to the invention by introducing a polynucleotide according to the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
• the vector containing the polynucleotide according to the invention may be recovered from the host cell. Suitable host cells include bacteria such as E. coli.
• the invention provides a process for preparing a polypeptide according to the invention by cultivating a host cell (e.g. transformed or transfected with an expression vector as described above) under conditions to provide for expression (by the vector) of the polypeptide according to the invention, and optionally recovering the expressed polypeptide.
• a host cell e.g. transformed or transfected with an expression vector as described above
• the polypeptide is produced as a secreted protein in which case the polynucleotide sequence encoding a mature form of the polypeptide in the expression construct is operably linked to a polynucleotide sequence encoding a signal peptide.
• the recombinant host cells according to the invention may be cultured using procedures known in the art. For each combination of a promoter and a host cell, culture conditions are available which are conducive to expression of the polypeptide of the invention. After reaching the desired cell density or titre of the polypeptide the culture is stopped and the polypeptide is recovered using known procedures.
• the fermentation medium may comprise a known culture medium containing a carbon source (e.g. glucose, maltose, molasses), a nitrogen source (e.g. ammonium sulphate, ammonium nitrate, ammonium chloride, organic nitrogen sources e.g. yeast extract, malt extract, peptone), and other inorganic nutrient sources (e.g. phosphate, magnesium, potassium, zinc, iron, etc.).
• a carbon source e.g. glucose, maltose, molasses
• a nitrogen source e.g. ammonium sulphate, ammonium nitrate, ammonium chloride
• organic nitrogen sources e.g. yeast extract, malt extract, peptone
• an inducer may be included.
• the selection of the appropriate medium may be based on the choice of expression host and/or based on the regulatory requirements of the expression construct. Such media are known to those skilled in the art.
• the medium may, if desired, contain additional components favouring the
• the fermentation can be performed over a period of 0.5-30 days. It may be a batch, continuous or fed-batch process, suitably at a temperature in the range of between 0 and 45°C and, for example, at a pH between 2 and 10.
• Preferred fermentation conditions are a temperature in the range of between 20 and 37°C and/or a pH between 3 and 9. The appropriate conditions are usually selected based on the choice of the expression host and the protein to be expressed.
• the cells can be removed from the fermentation broth by means of centrifugation or filtration. After fermentation has stopped or after removal of the cells, the polypeptide of the invention may then be recovered and, if desired, purified and isolated by conventional means.
• the polypeptide of the invention is combined with suitable (solid or liquid) carriers or diluents including buffers to produce a polypeptide composition.
• the polypeptide may be attached to or mixed with a carrier, e.g. immobilized on a solid carrier.
• a carrier e.g. immobilized on a solid carrier.
• the present invention provides in a further aspect a composition comprising a polypeptide of the invention. This may be in a form suitable for packaging, transport and/or storage, preferably where the activity of the polypeptide is retained.
• Compositions may be of paste, liquid, emulsion, powder, flake, granulate, pellet or other extrudate form.
• the composition may further comprise additional ingredients such as one or more (additional) enzymes.
• the polypeptide is typically stably formulated either in liquid or dry form.
• the product is made as a composition which will optionally include, for example, a stabilising buffer and/or preservative.
• the invention additionally relates to foodstuffs or an animal feed composition or additive comprising one or more polypeptides of the invention.
• the polypeptide may be present in the feed at a concentration different from its natural concentration. Preferred amounts are from 0.1 to 100, such as 0.5 to 50, preferably 1 to 10, mg per kg feed.
• the invention also relates to a process for the preparation of an animal feed composition, the process comprising adding to one or more edible feed substance(s) or ingredient(s), a polypeptide of the invention.
• the polypeptides can be added to the animal feed composition separately from the feed substances or ingredients, individually or in combination with other feed additives.
• the polypeptide can be an integral part of one of the feed substances or ingredients.
• the polypeptides of the invention may also be added to animal feeds to improve the breakdown of plant constituents, e.g. phytate, leading to improved utilisation of the plant nutrients by the animal.
• the polypeptides of the invention may continue to degrade phytate in the feed in vivo.
• Fungal based polypeptides of the invention in particular generally have lower pH optima and are capable of releasing important nutrients in such acidic environments as the stomach of an animal.
• the polypeptides of the invention may also be used during the production of milk substitutes (or replacers) from soybean. These milk substitutes can be consumed by humans and/or animals.
• the composition may additionally comprise (particularly when being formulated for use in animal feed) one or more ionophores, oxidising agents, surfactants, rumen protected amino acids, enzyme enhancers or enzymes which may be produced naturally in the gastro-intestinal tract of the animals to be fed.
• feeds including silage
• monogastric animals eg.
• the feeds may comprise cereals such as barley, wheat, maize, rye or oats or cereal by-products such as wheat bran or maize bran, or other plant materials such as soy beans and other legumes.
• the enzyme(s) may significantly improve the break-down of plant material which leads to better utilisation of the plant nutrients by the animal. As a consequence, growth rate and/or feed conversion may be improved.
• the polypeptides of the invention are particularly applicable to animal feeds as they may still be active under highly acidic conditions, such as in the stomach of animals.
• One method for the (exogenous) addition of the polypeptide of the invention is to add the polypeptide as transgenic plant material and/or (e.g. transgenic) seed.
• the polypeptide may thus have been synthesized through heterologous gene expression, for example the gene encoding the desired enzyme may be cloned in to a plant expression vector, under control of the appropriate plant expression signals, e.g. a tissue-specific promoter, such as a seed-specific promoter.
• the expression vector containing the gene encoding the polypeptide can be subsequently transformed into plant cells, and transformed cells can be selected for regeneration into whole plants.
• transgenic plants can be grown and harvested, and those parts of the plants containing the heterologous (to the plant) polypeptide can be included in one of the compositions, either as such or after further processing.
• the heterologous polypeptide may be contained in the seed of the transgenic plants or it may be contained in other plant parts such as roots, stems, leaves, wood, flowers, bark and/or fruit. Suitable plants include cereals, such as oats, barley, wheat, maize and rice.
• the addition of the polypeptide in the form of transgenic plant material, e.g. in transgenic seed may require the processing of the plant material so as to make the polypeptide available, or at least improve its availability.
• processing techniques may include various mechanical (eg. milling and/or grinding) techniques or thermomechanical treatments such as extrusion or expansion.
• the present invention thus also relates to a process for promoting growth and/or feed conversion in a monogastric or non-ruminant animal, the process comprising feeding the animal the polypeptide of the invention.
• Suitable animals include farm, monogastric and/or non-ruminant animals such as pigs (or piglets), poultry (such as chickens, turkeys), calves or veal or aquatic (e.g. marine) animals (for example fish).
• pigs or piglets
• poultry such as chickens, turkeys
• calves or veal or aquatic (e.g. marine) animals for example fish.
• DNA fragments having a sequence according to SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6 were made synthetically. After verifying the DNA sequence, these synthetic gene fragments were fused to the A. niger phytase signal sequence using PCR and cloned under the control of the glucoamylase promoter. To this end, the phyA gene as present in the expression vector pGBTOPFYTI as described in international patent application WO 98/46772 was replaced with the modified phytase genes described above, yielding the vectors pTHFYT2, pTHFYT4 and pTHFYT6, respectively.
• the expression vectors pTHFYT2, pTHFYT4 and pTHFYT ⁇ were introduced into Aspergillus niger CBS 646.97 (described in WO 98/46772). Using PCR, transformants containing pTHFYT2, pTHFYT4 or pTHFYT6 were selected. In order to determine whether these transformants were able to secrete active phytase, the transformants were grown on plates containing phytate as described by Chen (1998, Biotechnol. Techniques, 759-761). In this assay halo's around the Aspergillus colonies become visible if active phytase is secreted, due to the degradation of phytate.
• niger fermentation medium containing per liter: 70 g maltodextrines; 25 g hydrolyzed casein; 12.5 g yeast extract; 1 g KH 2 PO 4 ; 2 g K 2 SO 4 ; 0.5 g MgSO 4 .7H 2 O; 0.03 g ZnCI 2 ; 0.02 g CaCI 2 ; 0.01 g MnS0 4 .4H 2 O; 0.3 g FeSO 4 .7H 2 O; 10 ml penicillin (5000 IU/ml)/Streptomycin (5000 UG/ml); adjusted to pH 5.6 with 4 N H 2 S0 4 . These cultures were grown at 34°C for about 6 days. Samples taken from the fermentation broth were centrifuged (10', 5.000 rpm in a swinging bucket centrifuge) and supernatants collected.
• T50 (in °C) is the temperature at which 50% of the activity is lost after having heated the samples for 20 minutes.
• the activity of the phytases was determined during heating. When carried out as a function of the heating temperature, the experiment gives the optimal temperature (Topt) of the enzyme with regard to the productivity. The incubation is carried out over a fixed time span of 30 minutes. The amount of substrate converted is dependent on the enzymatic activity as well as the inactivation. Therefore preferably the term productivity is used instead of activity.
• FYT2 as well as FYT4 are most effective with respect to catalytic productivity at 75°C where the wild type control has lost its catalytic activity completely. Although activity starts to decrease above 75°C, Figure 3 shows that FYT2 as well as FYT4 are catalytically competent up to about 85°C. The behaviour of FYT6 is in between that of wild type and FYT2 or FYT4.
• thermostability of the phytases was also determined directly by determining the temperature at which the 3-dimensional structure of the phytase enzyme unfolds.
• the heat effect that accompanies the unfolding can be measured directly by Differential Scanning Calorimetry (DSC).
• Table 1 It can be seen that the structure of the native enzyme is maintained at a temperature that is about 9°C higher for the modified phytases FYT2 and FYT4 than for the wild type phytase.
• All granulates were made by mixing / kneading culture filtrate with the required amount of corn starch (C-gel from Cerestar) and water. See Tables 2 and 3 for composition of the wet mix. After mixing and kneading, the mixture was extruded with a Nica E-220 extruder and spheronised with a Fuji Paudal QJ-400G spheroniser. The obtained particles were dried in a Glatt GPCG 1.1 fluid bed dryer. Activity of the granules was between 2500 and 3000 FTU/g.
• Table 4 Composition of the poultry feed used in the RDS 05 and RDS A1 pelleting trials
• thermostable phytases RDS 05
• the hot meal temperature was 80°C.
• the pellet temperature reached was about 82-83 °C. Yields are based on activity measurement before and after pelleting using the standard phytase assay (van.Engelen et al., Journal of AOAC International 1994, 77:760-764).
• Table 6 Pelleting yields of the thermostable phytases (RDS 01). The hot meal temperature was 80°C. The pellet temperature reached was about 92-93 °C. Yields are determined as in Table 5.
• the pelleting trials show a similar increase in thermostability of FYT2, FYT4 and FYT6 as compared to wild type at 82°C, whereas at 92°C FYT2 and FYT4 show a higher stability as compared to FYT6.
• the specific activity of the phytases was determined after purification of the phytases from filtrates which were obtained after filtration of fermentation broth. Purification of phytase was done by ion-exchange chromatography or affinity chromatography or a combination of both methods.
• the OD 280 , 1C m at 1 mg/ml corresponds with 0.995, 0.995 and 0.963, respectively.
• the activity was determined in FTU as described by van Engelen et al.
• the Km values for phytic acid were determined by measuring the initial reaction rate as a function of the substrate concentration.
• the enzyme reaction was stopped with 15 % TCA (1:1).
• the liberated inorganic phosphate was determined by mixing stopped reaction mixture with 0.6M H2SO4-2% ascorbic acid- 0.5% ammonium molybdate (1:1), incubating the mixture for 20 minutes at 50 °C and measuring the adsorbance at 820nm (Wyss et al. Appl Env Microbiol 1999, 65 : 367- 373). Results are shown in Table 7.
• Table 7 Catalytic properties of phytases using phytic acid as a substrate
• Table 7 shows that as compared to the wild type the specific activity as well as the high affinity for phytic acid is not affected by the modifications made.
• the following buffers were used to set the pH of the experiment: 250mM glycine in the pH range 2.8 to 3.2; 250mM NaAc in the pH range 3.6 to 5.6; 250mM imidazol in the pH range 6 to 7 and 250mM Tris in the pH range 7.5 to 9. The results are shown in Table 8.
• the pH dependence of the activity of the modified phytases is very similar as that of wild type.
• the feature that the wild type phytase exhibits two pH optima is maintained.
• Table 8 shows that this particular feature of wild type Aspergillus niger phytase is not affected by the modifications resulting in FYT2, FYT4 and FYT6.
• modified phytases behave very similar to wild type phytase in liberating phosphate from phytic acid. After one hour the progress curves reach a plateau at about 80-85% of the phosphates released. All phytase reach this plateau at a similar rate, which indicates that the efficacy of wild type phytase in releasing phosphates from phytic acid is not affected by the modifications in the modified phytases.
• thermostable phytases were performed using them in a liquid formulation applied to the pellets after pelleting.
• the enzymes were applied in such doses that the added phytase activity would be 100, 200 or 300 FTU/kg feed.
• the test was performed in broilers (5-33 days) fed a maize-soy based diet (one feed for the first 14 days of the trial, and one, slightly different, diet during the last 14 days).
• the absorbable phosphorus content of the basal diets was 2.2 g/kg feed (day 5-19) and 1.7 g/kg feed (day 19-33). These values are well below the estimated requirement of the animals.
• Animals were housed in six floor pens per treatment, each pen containing 14 birds. The results were calculated on the basis of the analyzed phytase contents (FTU/kg), using the methods outlined by Finney (1964: Statistical method in biological assay. Charles Griffin, London.). The results for body weight are presented in Table 10.
• thermostable phytases were put through the pelleting process.
• pelleting was performed at really high temperatures: pellets were approximately 92 °C. Because the aim was to obtain additions of 100, 200 or 300 FTU/kg to the feed as offered to the animals, a pre- pelleting trial was performed to estimate the activity loss during this process, and the products were overdosed to such an extent that the activities mentioned were realized.
• the phytase FYT2 performed best in this trial, followed by FYT6, FYT4 and wild type.
• FYT-2 (SEQ ID NO:2) or FYT6 (SEQ ID NO:6) was amplified by PCR in a total volume of 50 ⁇ l using 2.5 U Pwo polymerase (Roche diagnostics, GmbH, Mannheim, Germany), 100 ng DNA template, 0.5 mM dNTP, 1 x Pwo buffer, 10 pmol DSM-1 F and 10 pmol DSM-1 R under the following conditions 5' 94 °C, 30x (.30" 94 °C 1" 60 °C 2' 72 °C), 5' 72 °C
• the amplified fragment was cloned into the PCR ® -Blunt-TOPO (Invitrogen life technologies, Carlsbad, CA, USA) vector and mutations were introduced using the QuickChange kit from Stratagene (Stratagene, La Jolla, CA, USA) according to the recommendations of the supplier.
• the sequence of the primers DSM-1 F and DSM-1 R was as follows:
• DSM-1 R 5' GTCATCGCGATTAATTAATCTAAGCAAAACACTCCTCCCAGTT 3'
• the sequence of the resulting phytase DNA fragments was checked by sequence analysis.
• the phytase sequences were cloned in pGBTOPFYTI and culture supernatants were prepared as described in Example 1.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Enzymes And Modification Thereof (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Fodder In General (AREA)

Priority Applications (1)

Applications Claiming Priority (4)

Publications (1)

Family

ID=29595046

Family Applications (1)

Country Status (16)

Families Citing this family (7)

Family Cites Families (1)

• 2003
  • 2003-05-28 BR BR0311287-0A patent/BR0311287A/pt not_active IP Right Cessation
  • 2003-05-28 CA CA002485513A patent/CA2485513A1/en not_active Abandoned
  • 2003-05-28 JP JP2004510416A patent/JP2005533492A/ja not_active Withdrawn
  • 2003-05-28 RU RU2004139054/13A patent/RU2329301C2/ru not_active IP Right Cessation
  • 2003-05-28 PL PL03372824A patent/PL372824A1/xx not_active Application Discontinuation
  • 2003-05-28 KR KR1020047019401A patent/KR20050038593A/ko not_active Application Discontinuation
  • 2003-05-28 CN CNA03812470XA patent/CN1656217A/zh active Pending
  • 2003-05-28 EP EP03732516A patent/EP1513931A2/en not_active Withdrawn
  • 2003-05-28 AU AU2003238448A patent/AU2003238448A1/en not_active Abandoned
  • 2003-05-28 WO PCT/EP2003/005729 patent/WO2003102174A2/en active Application Filing
  • 2003-05-28 MX MXPA04011224A patent/MXPA04011224A/es not_active Application Discontinuation
  • 2003-05-30 AR ARP030101936A patent/AR039938A1/es not_active Application Discontinuation
  • 2003-05-30 PE PE2003000534A patent/PE20040537A1/es not_active Application Discontinuation
  • 2003-05-30 TW TW092114745A patent/TW200401033A/zh unknown
  • 2003-05-30 AR ARP030101937A patent/AR039939A1/es not_active Application Discontinuation
  • 2003-05-30 TW TW092114788A patent/TW200403341A/zh unknown
• 2004
  • 2004-11-04 NO NO20044802A patent/NO20044802L/no not_active Application Discontinuation
  • 2004-12-23 ZA ZA200410369A patent/ZA200410369B/xx unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events