EP1499737A1 - Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosyntheseweges - Google Patents
Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosynthesewegesInfo
- Publication number
- EP1499737A1 EP1499737A1 EP03732215A EP03732215A EP1499737A1 EP 1499737 A1 EP1499737 A1 EP 1499737A1 EP 03732215 A EP03732215 A EP 03732215A EP 03732215 A EP03732215 A EP 03732215A EP 1499737 A1 EP1499737 A1 EP 1499737A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- microorganism
- aromatic amino
- gene sequence
- amino acids
- metabolites
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01001—Pyruvate carboxylase (6.4.1.1)
Definitions
- the invention relates to a method for the microbial production of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway.
- Microbially produced substances such as fine chemicals, in particular aromatic amino acids or metabolites of the aromatic biosynthetic pathway, are of great economic interest, the need for e.g. B. amino acids continues to increase.
- L-phenylalanine is used for the manufacture of medicaments and in particular also for the manufacture of the sweetener Asparta (cc-L-aspartyl-L-phenylalanine methyl ester).
- L-tryptophan is required as a medication and additive to animal feed;
- L-tyrosine is also needed as a drug and as a raw material in the pharmaceutical industry.
- biotechnological production is a very important method for obtaining amino acids in the desired optically active form under economically justifiable conditions. The biotechnological production takes place either enzymatically or with the help of microorganisms.
- EP 0.077.196 describes a process for the production of aromatic amino acids, in which a 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHP synthase) which is no longer feedback-inhibited is overexpressed in E. coli.
- DAHP synthase 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase
- EP 0.145.156 describes an E. coli strain in which chorismate mutase / prephenate dehydratase is additionally overexpressed for the production of L-phenylalanine.
- Erythrose-4-phosphate (Ery4P) is required for the condensation to 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP).
- DAHP 3-deoxy-D-arabino-heptulosonate-7-phosphate
- Phenylalanine enables EP 0,600,463. Flores et al. showed (Flores et al. 1996. Nature Biotechnology 14: 620-623) that a spontaneous glucose positive revertant of a sugar phosphotransferase system (PTS) negative mutant of Escherichia coli glucose via the galactose permease (GalP) system into the cells infiltrated and was able to grow on glucose. Additional expression of the transketolase gene (tktA) resulted in an increased formation of the intermediate DAHP (Flores et al. Nature Biotechnology 14
- pyruvate carboxylase plays an important role in the synthesis of the amino acids that are derived from the tricarboxylic acid cycle (TCA cycle).
- pyruvate carboxylase lies in the anaplerotic reaction that starts from Py- ruvat and C0 2 (or hydrogen carbonate) achieved the provision of C4 bodies (oxaloacetate) (Jitrapakdee and Wallace, Biochemical Journal 340 (1999) 1-16). Oxaloacetate can be metabolized further by reaction with acetyl-CoA in the tricarboxylic acid cycle
- WO 01/04325 describes, for example, a fermentative process for the production of L-amino acids from the aspartate amino acid family with coryneform microorganisms which are a go from the group dapA (dihydrodipicolinate synthase), lysC (aspartate kinase), gap (glycerol aldehyde-3 - Phosphate dehydrogenase), mqo (malate-quinone oxidoreductase), tkt (transketolase), gnd (6-phosphogluconate dehydrogenase), zwf (glucose-6-phosphate dehydrogenase), lysE (lysine export), zwal (unnamed protein product), eno (enolase), opcA (put
- genes for a pyruvate carboxylase have been isolated from a number of microorganisms, characterized and expressed in recombinant form.
- genes for pyruvate carboxylase have already been found in bacteria such as Corynebacteria, Rhizobia, Brevibacteria, Bacillus subtilis, Mycobacteria, Pseudomonas, Rhodopseudomonas spheroides, Campylobacter jejuni, Methanococcus jannaschii, in the yeast Saccharomyces cereviserneae, and humans Payne & Morris J Gen. Microbiol. 59 (1969) 97-101; Peters-Wendisch et al.
- the object is achieved according to the invention with the features specified in the characterizing part of claim 1.
- Aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway in the sense of the invention are to be understood in particular to mean the aromatic amino acids L-phenylalanine, L-tryptophan and L-tyrosine.
- Metabolites from the aromatic amino acid biosynthetic pathway including 3-deoxy-D-
- Arabino heptulosonate 7-phosphate (DAHP) derived compounds such as D-arabino heptulosonate (DAH), shikimic acid, chorismic acid and all their derivatives, cyclohexadiene transdiols, indigo, indole acetic acid, adipic acid, melanin, quinones, benzoic acid derivatives and their potential
- D-arabino heptulosonate (DAH) D-arabino heptulosonate
- shikimic acid chorismic acid and all their derivatives
- chorismic acid cyclohexadiene transdiols
- indigo indole acetic acid
- adipic acid melanin
- quinones benzoic acid derivatives
- benzoic acid derivatives and their potential
- the inventors surprisingly found that after introducing a pyc gene sequence into microorganisms which naturally have no pyruvate carboxylase, or after amplifying an existing pyc gene sequence, aromatic amino acids and metabolites of the aromatic biosynthetic pathway could be produced in an improved manner.
- introduction should therefore be understood to mean all process steps which result in a pyc gene sequence being inserted into microorganisms which do not have a pyc gene sequence.
- introduction can also include a Amplification of an existing pyc gene sequence can be understood.
- the test principle is the detection of oxalacetate formed from pyruvate.
- the enzyme pyruvate carboxylase catalyzes the carboxylation of pyruvate and thereby forms oxaloacetate.
- the activity of a pyruvate carboxylase depends on biotin as a prosthetic group on the enzyme and also depends on ATP and magnesium ions.
- ATP is split into ADP and inorganic phosphate.
- the carboxyl group is transferred from the enzyme-biotin complex to pyruvate.
- the pyruvate carboxylase from Brevibacterium lactofermenum can be detected, for example, in crude extracts obtained by ultrasound treatment by carrying out coupled enzyme tests with malate dehydrogenase or citrate synthase, which each serve as evidence for the oxaloacetate formed (Tosaka et al. Agric. Biol. Che. 43 (1979) 1513-1519).
- the pyruvate carboxylase from Methanococcus jannaschii was detected by coupling with malate dehydrogenase (Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414).
- CAB Corynebacterium glutamicum cells which had been permeabilized by hexadecyltrimethylammonium bromide (CTAB), pyruvate carboxylase activity was detected in a batch method by coupling to a glutamate oxaloacetate transaminase (Peters-Wendisch et al. Microbiology 143 (1997) 1095 - 1103).
- PEP polypeptide
- DAH DAHP or its degradation product
- DAHP which is synthesized by condensation of PEP and Ery4P, forms the starting substance for aromatic amino acids and other metabolites of aromatic amino acid bio pathway.
- DAHP and DAH are discussed in the literature as signs of increased PEP availability (Frost and Draths Annual Rev. Microbiol. 49 (1995), 557-579; Flores et al. Nature Biotechnology 14 (1996) 620-623; Bongaerts et al. Metabolie Engineering 3 (2001) 289-300)
- the term “amplification” of the pyc gene sequence describes the increase in the activity of the pyruvate carboxylase.
- the following measures can be mentioned by way of example:
- Gene sequence coding gene copy number z. B. by means of plasmids with the aim of the pyc gene sequence in an increased number of copies, from slightly (z. B. 2 to 5 times) to greatly increased number of copies (z. B. 15 to 50 times) in the microorganism bring in;
- promoter elements such.
- overexpression of the pyc gene sequence can also be achieved by changing the media composition and culture management.
- the addition of essential growth substances to the fermentation medium can also bring about an improved production of the substances in the sense of the invention.
- Expression is also improved by measures to extend the life of the m-RNA.
- the enzyme activity is increased by preventing the breakdown of the enzyme protein.
- UV radiation or mutation-triggering chemicals or by mutations that are generated in a targeted manner using genetic engineering methods such as deletion (s), insertion (s) and / or nucleotide exchange (s). Combinations of the above-mentioned and other, analogous methods can also be used to increase the pyruvate carboxylase activity.
- the pyc gene sequence is preferably introduced by integrating the pyc gene sequence into one or more gene structures, the pyc gene sequence being introduced into the gene structure as a single copy or in an increased number of copies.
- a “gene structure” is to be understood as any gene or nucleotide sequence which carries a pyc gene sequence.
- Corresponding nucleotide sequences can be, for example, plasmids, vectors, chromosomes, phages or other, non-circularly closed, nucleotide sequences.
- the pyc gene sequence can be a vector is introduced into the cell or is inserted into a chromosome or is introduced into the cell by a phage. Other combinations of gene distributions are not to be excluded from the invention by these examples.
- the number of pyc gene sequences contained in the gene structure should exceed the natural number.
- the pyc gene sequence used for the method according to the invention can, for. B. from Rhizobium (Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195), Brevibacterium, Bacillus, Mycobacterium (Mukhopadhyay and Purwantini Biochimica et Biophysica Acta 1475 (2000) 191-206), Methanococcus ( Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414), Saccharomyces cerevisiae (Irani et al.
- pyc gene sequences can be identified from generally accessible databases (such as, for example, EMBL, NCBI, ERGO) and by techniques of gene cloning, e.g. B. PCR can be cloned from such other organisms using the polymerase chain reaction.
- microorganisms are used into which a pyc gene sequence has been introduced in a replicable form.
- organisms from the family Enterobacteriaceae such as. B. Escherichia species, but also microorganisms of the genera Serratia, Bacillus, Corynebacterium or Brevibacterium and other strains known from classic amino acid processes. Escherichia coli is particularly suitable.
- the transformation of the microorganisms or host cells can be carried out by chemical methods (Hanahan D, J. Mol. Biol. 166 (1983) 557-580), and also by electroporation, conjugation, transduction or by subcloning from plasmid structures known in the literature.
- the cloning of pyruvate carboxylase from Corynebacterium glutamicum is suitable for example as the method of polymerase chain reaction (PCR) for the directed amplification of the pyc gene sequence with chromosomal DNA from Corynebacterium glutamicum strains.
- microorganisms for the transformation in which one or more enzymes, which are additionally involved in the synthesis of the aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway, are deregulated and / or their activity is increased.
- transformed cells are used which are able to produce an aromatic amino acid, the aromatic amino acid preferably being L-phenylalanine.
- the genes which code for enzymes which compete with the pyruvate carboxylase for PEP such as, for. B. the PEP carboxylase, the PEP-dependent sugar phosphotransferase system (PTS) or pyruvate kinases, individually or in combination in their expression can be lowered or inactivated or completely switched off and these microorganisms are used.
- PEP PEP-dependent sugar phosphotransferase system
- pyruvate kinases individually or in combination in their expression
- This advantageous embodiment also includes that the activity of a transport protein for PEP-independent uptake of glucose in microorganisms with a PEP-dependent transport system for glucose, the are used in the method according to the invention is increased.
- the additional integration of a PEP-independent transport system allows an increased supply of glucose in the microorganism producing the substances.
- PEP as an energy donor is not required for these reactions and, based on a constant material flow in the glycolysis and the pentose phosphate pathway, is increasingly the primary condenser with erythrose-4-phosphate (Ery-4-P) Metabolites of the general biosynthetic pathway for aromatic compounds such as. B.
- deoxy-D-arabino-heptulosonate-7-phosphate are available and subsequently for the production of, for example, aromatic amino acids, such as. B. L-phenylalanine, tyrosine or tryptophan.
- the process for the production of substances according to the invention can use microorganisms in which one or more enzymes, which are additionally involved in the synthesis of the substances, are deregulated and / or their activity is increased.
- enzymes which are additionally involved in the synthesis of the substances, are deregulated and / or their activity is increased.
- these are in particular the enzymes of the aromatic amino acid metabolism and above all the DAHP synthase (eg in E. coli AroF or AroH), the shikimate kinase and the chorismate mutase / prephenate dehydratase (PheA). All other enzymes involved in the Synthesis of aromatic amino acids or metabolites of the aromatic amino acid biosynthetic pathway and their secondary products involved can be used.
- Amino acid biosynthetic pathways and their derivatives such as adipic acid, bile acid and quinone compounds, and their derivatives, in addition to the pyc gene sequence, the deregulated and overexpressed DAHP synthase has proven to be particularly suitable.
- the shikimate kinase should also be regulated and its activity increased.
- chorismate mutase / prephenate dehydratase is also of particular importance.
- this is also intended to encompass all other enzymes whose activities contribute to the microbial synthesis of metabolites other than those from the aromatic amino acid biosynthetic pathway, that is to say compounds whose production is favored by the provision of PEP, e.g. B. CMP-ketodeoxyoctulosonic acid,
- UDP-N-acetylmuramic acid or N-acetyl-neuraminic acid.
- the increased availability of PEP can not only have a positive effect on the synthesis of DAHP, but can also favor the introduction of a pyruvate group in the synthesis of 3-enolpyruvoylshikimate-5-phosphate as a precursor of chorismate.
- adipic acid, cyclohexadiene transdi oils and other non-natural secondary products in addition to the process features according to the invention, further genetic changes to the substances producing microorganisms are necessary.
- FIG. 1 shows the links between the central metabolism and the aromatic amino acid biosynthetic pathway of bacteria, emphasizing the reactions of the phosphoenolpyruvate and pyruvate.
- Reaction 1 denotes the pyruvate carboxylase reaction
- reaction 2 the phosphoenolpyruvate carboxylase reaction
- reaction 3 the PEP-dependent sugar phosphotransferase system (PTS).
- EPSP enol-pyruvoyl-shikimate phosphate
- GA3-P glyceraldehyde-3-phosphate
- pABA para-aminobenzoate
- PEP phosphoenol pyruvate 2 shows exemplary experimental data from the pyruvate carboxylase activity detection.
- the abscissa X represents the time in seconds and the ordinate Y the extinction at a wavelength of 412 nm.
- the measurement points represented by black diamonds are results obtained with E. coli cells which were transformed with a pyc vector were.
- the measuring points shown with a blank square represent the results of the E. coli cells which were transformed with an empty vector without a pyc gene sequence.
- the gray solid line shows the regression line.
- Example 1 Cloning of the pyc gene sequence, expression in Escherichia coli strains
- the first cloning of the pyc gene sequence from Corynebacteriu glutamicum ATCC13032 is described under Peters-Wendisch et al. Microbiology 144 (1998) 915-927.
- the subcloning of the pyc gene sequence into the expression vector pVWExl -pyc is described in Peters-Wendisch et al. J. Mol. Microbiol. Biotechnol. 3 (2001) 295-300.
- a 3.7 kb DNA fragment with the pyc gene sequence from C. glutamicum was obtained from the vector pVWExl-pyc by restriction with the enzymes SphI and Hindlll.
- the wild-type strain E. coli K-12 LJ110 was first selected for kanamycin resistance (obtaining the aroK:: Kan marker). In a second PI transduction, selection was then made to obtain the tetracycline resistance marker (obtain the aroL:: Tnl0 marker). Cells showing both resistances were then tested for auxotrophy for the aromatic amino acids L-phenylalanine, L-tyrosine, L- Tryptophan (40 mg / 1 each) and checked for auxotrophy for p-aminobenzoic acid, p-hydroxybenzoic acid and 2, 3-dihydroxybenzoic acid (20 mg / l each).
- LJ110 aroB Cells that became pentose-positive but remained aromatic-exotrophic (aroB) were further used as LJ110 aroB (Marco Krämer, dissertation, University of Düsseldorf, 1999, p.34).
- the strain LJ110 ⁇ ppc was determined by the cross-over-PCR method from Link et al. (Link et al. J. Bacteriol. 179 (1997) 6228-6237).
- the oligonucleotide primer pairs used for the PCR amplification were: external primer Nin 5 'GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGCATATTACCCCAGACACCCC ATCTTATCG 3 "(Seq. ID. No. 1) and inner primer Nout
- the cells were then resuspended in the same buffer, and it was adjusted a cell concentration, the 6 oo had an OD of 5 in 1 ml buffer.
- Such samples were mixed with 10 ul toluene / ml and mixed on a vortex for 1 minute. This was followed by incubation at 4 ° C (on ice) for 10 minutes. This allowed the cells to be permeabilized.
- the cells were used in 100 ⁇ L aliquots for the subsequent pyruvate carboxylase test.
- test principle is the detection of the oxaloacetate (OAA) formed from pyruvate and hydrogen carbonate via a coupling with the auxiliary enzyme citrate synthase and acetyl-coenzyme A (acetyl-CoA) after the following reactions:
- OOA oxaloacetate
- acetyl-CoA acetyl-CoA
- CoA derivative mixed disulfide from CoA and thio-nitrobenzoic acid
- Pyruvate is converted to oxaloacetate (OAA) by pyruvate carboxylase Pyc with ATP hydrolysis (1).
- OAA formed is reacted with acetyl-CoA via the citrate synthase reaction (2) to citrate and coenzyme A (HS-CoA).
- the Pyc activity detection is based on the reaction (3) of the released coenzyme A (HS-CoA) with dithionitrobenzoic acid to a mixed disulfide of CoA and thionitrobenzoic acid and a molar equivalent of yellow-colored 5-thio-2-nitrobenzoate (TNB 2 ⁇ ).
- TNB 2 This has a molar extinction coefficient of 13.6 rr ⁇ YT 1 cm “1 and can be verified photometrically at a wavelength of 412 nm.
- the formation rate of TNB 2" correlates directly with the acetylation of OAA and thus with the conversion of pyruvate to OAA by pyruvate carboxylase.
- reaction vessels were transferred to liquid nitrogen and, during the thawing process, the biomass was removed by centrifugation at 4 ° C. and 15,300 rpm.
- the absorbance at 412 nm was determined photometrically in the clear supernatants. Approaches without pyruvate served as a reference.
- Example 3 Fermentation to obtain PAH with recombining pyruvate carboxylase.
- DAH degradation product of DAHP
- the process was carried out in 6 Sixfors Vario laboratory fermenters (2 liters) connected in parallel with a filling volume of 1.5 L.
- Feed medium glucose: 454 g / L
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10219714A DE10219714A1 (de) | 2002-05-02 | 2002-05-02 | Verfahren zur mikrobielien Herstellung von aromatischen Aminosäuren und anderen Metaboliten des aromatischen Aminosäurebiosyntheseweges |
| DE10219714 | 2002-05-02 | ||
| PCT/DE2003/001380 WO2003093490A1 (de) | 2002-05-02 | 2003-04-29 | Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosyntheseweges |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1499737A1 true EP1499737A1 (de) | 2005-01-26 |
Family
ID=29285068
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03732215A Withdrawn EP1499737A1 (de) | 2002-05-02 | 2003-04-29 | Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosyntheseweges |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20060234358A1 (de) |
| EP (1) | EP1499737A1 (de) |
| AU (1) | AU2003238347A1 (de) |
| CA (1) | CA2484379A1 (de) |
| DE (1) | DE10219714A1 (de) |
| WO (1) | WO2003093490A1 (de) |
| ZA (1) | ZA200408826B (de) |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006042666A1 (de) * | 2004-10-18 | 2006-04-27 | Meda Pharma Gmbh & Co. Kg | R-(+)-α-LIPONSÄURE ZUR PRÄVENTION VON DIABETES |
| EP1907529A1 (de) | 2005-07-25 | 2008-04-09 | Ajinomoto Co., Inc. | EINE METHODE ZUR HERSTELLUNG EINES L AMINO ACID DURCH DIE VERWENDUNG VON BACTERIEN AUS DER ENTEROBACTERIACEA FAMILIE MIT EINER ATTENUIERTEN EXPRESSION VOM cpxR GEN |
| RU2006129690A (ru) | 2006-08-16 | 2008-02-27 | Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО АГРИ) (RU) | СПОСОБ ПОЛУЧЕНИЯ L-АМИНОКИСЛОТЫ С ИСПОЛЬЗОВАНИЕМ БАКТЕРИЙ СЕМЕЙСТВА Enterobacteriaceae, В КОТОРОЙ ОСЛАБЛЕНА ЭКСПРЕССИЯ ГЕНА ydiN, ГЕНА ydiB ИЛИ ИХ КОМБИНАЦИИ |
| KR100850853B1 (ko) * | 2006-12-13 | 2008-08-06 | 씨제이제일제당 (주) | nrfE 유전자가 불활성화된 L-트립토판 생산 미생물 및이를 이용한 L-트립토판 제조방법 |
| US8647642B2 (en) | 2008-09-18 | 2014-02-11 | Aviex Technologies, Llc | Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment |
| US9637746B2 (en) * | 2008-12-15 | 2017-05-02 | Greenlight Biosciences, Inc. | Methods for control of flux in metabolic pathways |
| EP2566953B1 (de) | 2010-05-07 | 2019-01-02 | Greenlight Biosciences, Inc. | Verfahren zur flusssteuerung bei stoffwechselwegen druch enzymumpositionierung |
| EP2611922A1 (de) | 2010-08-31 | 2013-07-10 | Greenlight Biosciences, Inc. | Verfahren zur flusssteuerung bei stoffwechselwegen durch proteasemanipulation |
| CN104093848A (zh) | 2011-09-09 | 2014-10-08 | 绿光生物科学公司 | 碳青霉烯(carbapenem)的无细胞制备 |
| HK1216547A1 (zh) | 2012-12-21 | 2016-11-18 | Greenlight Biosciences Inc. | 用於將甲烷轉化成燃料、丙酮酸或異丁醇的無細胞系統 |
| AU2014306074B2 (en) | 2013-08-05 | 2018-08-30 | Greenlight Biosciences, Inc. | Engineered proteins with a protease cleavage site |
| BR112017020690A2 (pt) | 2015-03-30 | 2018-06-26 | Greenlight Biosciences Inc | produção livre de células de ácido ribonucleico |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| CA3020312A1 (en) | 2016-04-06 | 2017-10-12 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| EP3565892A4 (de) | 2017-01-06 | 2020-10-07 | Greenlight Biosciences, Inc. | Zellfreie herstellung von zuckern |
| KR102894284B1 (ko) | 2017-10-11 | 2025-12-03 | 그린라이트 바이오사이언시스, 아이엔씨. | 뉴클레오시드 트리포스페이트 및 리보핵산 생산을 위한 방법 및 조성물 |
| CN112251476B (zh) * | 2020-09-25 | 2022-11-15 | 天津科技大学 | 一种l-苯丙氨酸的生产方法 |
| CN115806926B (zh) * | 2022-11-11 | 2024-07-26 | 天津科技大学 | 一种生产假尿苷的基因工程菌株及其构建方法与应用 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19644566A1 (de) * | 1996-10-26 | 1998-04-30 | Forschungszentrum Juelich Gmbh | Mikrobielle Herstellung von Substanzen aus dem aromatischen Stoffwechsel / I |
| DE19831609B4 (de) * | 1997-10-04 | 2009-11-12 | Evonik Degussa Gmbh | Verfahren zur Herstellung von Aminosäuren der Aspartat- und/oder Glutamatfamilie und im Verfahren einsetzbare Mittel |
| US6171833B1 (en) * | 1998-12-23 | 2001-01-09 | Massachusetts Institute Of Technology | Pyruvate carboxylase from corynebacterium glutamicum |
| US6797509B1 (en) * | 1999-07-09 | 2004-09-28 | Degussa-Huls Ag | Nucleotide sequences which code for the tal gene |
| AU1206801A (en) * | 1999-10-13 | 2001-04-23 | University Of Georgia Research Foundation, Inc., The | High yield protein expression system and methods |
| DE10047866A1 (de) * | 2000-09-27 | 2002-04-11 | Degussa | Neue für das dep67-Gen kodierende Nukleotidsequenzen |
| DE10063314A1 (de) * | 2000-12-20 | 2002-07-04 | Degussa | Neue für das ilvE-Gen kodierende Nukleotidsequenzen |
-
2002
- 2002-05-02 DE DE10219714A patent/DE10219714A1/de not_active Ceased
-
2003
- 2003-04-29 CA CA002484379A patent/CA2484379A1/en not_active Abandoned
- 2003-04-29 EP EP03732215A patent/EP1499737A1/de not_active Withdrawn
- 2003-04-29 WO PCT/DE2003/001380 patent/WO2003093490A1/de not_active Ceased
- 2003-04-29 AU AU2003238347A patent/AU2003238347A1/en not_active Abandoned
- 2003-04-29 US US10/513,424 patent/US20060234358A1/en not_active Abandoned
-
2004
- 2004-11-01 ZA ZA200408826A patent/ZA200408826B/en unknown
Non-Patent Citations (1)
| Title |
|---|
| See references of WO03093490A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2003093490A1 (de) | 2003-11-13 |
| AU2003238347A1 (en) | 2003-11-17 |
| AU2003238347A8 (en) | 2003-11-17 |
| DE10219714A1 (de) | 2003-11-27 |
| CA2484379A1 (en) | 2003-11-13 |
| ZA200408826B (en) | 2006-04-26 |
| US20060234358A1 (en) | 2006-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2003093490A1 (de) | Verfahren zur mikrobiellen herstellung von aromatischen aminosäuren und anderen metaboliten des aromatischen aminosäurebiosyntheseweges | |
| DE60025976T2 (de) | DNA die für eine mutierte Isopropylmalatsynthase kodiert, Microorganismus, das L-Leucin produziert, und Verfahren zur Herstellung von L-Leucin | |
| EP2102337B1 (de) | Mikroorganismus des genus corynebacterium mit verstärkter l-lysin-produktivität und verfahren zur herstellung von l-lysin damit | |
| EP1382684B1 (de) | Verfahren zur fermentativen Herstellung von Aminosäuren und Aminosäure-Derivaten der Phosphoglycerat-Familie | |
| EP3108015B1 (de) | Rekombinanter stamm zur herstellung von o-aminobenzoat und fermentativer herstellung von anilin aus erneuerbaren ressourcen mittels 2-aminobenzoesäure | |
| EP1015621B1 (de) | Verfahren zur mikrobiellen herstellung von aminosäuren der aspartat- und/oder glutamatfamilie und im verfahren einsetzbare mittel | |
| EP2121899A1 (de) | Verfahren zur fermentativen herstellung von cadaverin | |
| KR19990077974A (ko) | L-글루타민산을생산하는박테리아및l-글루타민산을생산하는방법 | |
| EP2354235B1 (de) | Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien | |
| WO2011124477A2 (de) | VERFAHREN ZUR HERSTELLUNG VON L- ORNITHIN UNTER VERWENDUNG VON LysE ÜBEREXPRIMIERENDEN BAKTERIEN | |
| DE69735192T2 (de) | Mikrobische herstellung von substanzen aus dem aromatischen metabolismus / i | |
| WO2014007273A1 (ja) | 有用微生物および目的物質の製造方法 | |
| DE19818541C2 (de) | Mikrobielle Herstellung von Substanzen aus dem aromatischen Stoffwechsel / III | |
| JP2002512802A6 (ja) | 芳香族代謝/iii物質の微生物による製造 | |
| EP2089525B1 (de) | Allele des oxyr-gens aus coryneformen bakterien | |
| KR101059380B1 (ko) | L-트레오닌의 생산 방법 | |
| DE10258127A1 (de) | Verfahen zur fermentativen Herstellung von R-α-Liponsäure | |
| EP1924694B1 (de) | Verfahren zur produktion von aminosäuren mit mikroorganismen | |
| CN118302521A (zh) | 特别适合用于发酵制备邻氨基苯甲酸的3-脱氧阿拉伯庚酮糖酸-7-磷酸合酶 | |
| EP3820999A1 (de) | D-xylose-dehydrogenase aus coryneformen bakterien und verfahren zur herstellung von d-xylonat | |
| WO2004007705A1 (de) | Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin | |
| WO2009053489A1 (de) | Fermentative herstellung von alpha-ketoglutarsäure | |
| DE10220574A1 (de) | Verfahren zur Herstellung von Aminosäuren mit coryneformen Bakterien unter Verwendung von Phosphoglucose-Isomerasen aus coryneformen Bakterien |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20041108 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: BONGAERTS, JOHANNES Inventor name: SAHM, HERMANN Inventor name: SPRENGER, GEORG Inventor name: ANDERLEI, BRITTA |
|
| DAX | Request for extension of the european patent (deleted) | ||
| 17Q | First examination report despatched |
Effective date: 20070118 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20081101 |