EP1499737A1

EP1499737A1 - Method for the microbial production of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway

Info

Publication number: EP1499737A1
Application number: EP03732215A
Authority: EP
Inventors: Britta Anderlei; Georg Sprenger; Hermann Sahm; Johannes Bongaerts
Original assignee: Forschungszentrum Juelich GmbH; DSM Biotech GmbH; Holland Sweetener Co VOF
Current assignee: Forschungszentrum Juelich GmbH; DSM Verwaltungs GmbH; Holland Sweetener Co VOF
Priority date: 2002-05-02
Filing date: 2003-04-29
Publication date: 2005-01-26
Also published as: ZA200408826B; US20060234358A1; AU2003238347A8; DE10219714A1; WO2003093490A1; CA2484379A1; AU2003238347A1

Abstract

The invention relates to a method for the microbial production of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway. Microbially produced substances such as fine chemicals, particularly aromatic amino acids or metabolites of the aromatic biosynthetic pathway, are or great economic interest, and there is an increasing demand for amino acids, for example. According to the inventive method, a pyc gene sequence is introduced into microorganisms, whereupon aromatic amino acids and metabolites of the aromatic biosynthetic pathway can be produced in an improved manner. The inventive method is particularly suitable for producing L-Phenylalanine.

Description

Process for the microbial production of aromatic

Amino acids and other aromatic metabolites

amino acid biosynthetic

The invention relates to a method for the microbial production of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway.

Microbially produced substances, such as fine chemicals, in particular aromatic amino acids or metabolites of the aromatic biosynthetic pathway, are of great economic interest, the need for e.g. B. amino acids continues to increase. For example, L-phenylalanine is used for the manufacture of medicaments and in particular also for the manufacture of the sweetener Asparta (cc-L-aspartyl-L-phenylalanine methyl ester). L-tryptophan is required as a medication and additive to animal feed; L-tyrosine is also needed as a drug and as a raw material in the pharmaceutical industry. In addition to isolation from natural materials, biotechnological production is a very important method for obtaining amino acids in the desired optically active form under economically justifiable conditions. The biotechnological production takes place either enzymatically or with the help of microorganisms.

The latter, microbial production has the advantage that simple and inexpensive raw materials can be used. Since the biosynthesis of the amino acids in However, if the cell is checked in many ways, various attempts to increase product formation have already been made. So z. B. amino acid analogs used to switch off the regulation of biosynthesis. For example, by selection for resistance to phenylalanine analogs, mutants of Escherichia coli were obtained which enabled increased production of L-phenylalanine (GB-2,053,906). A similar strategy also led to overproducing strains of Corynebacterium (JP-19037/1976 and JP-39517/1978) and Bacillus (EP 0,138,526).

Furthermore, microorganisms constructed by recombinant DNA techniques are known, in which the regulation of the biosynthesis is likewise abolished by cloning and expressing the genes which code for key enzymes which are no longer feedback-inhibited. As a model, EP 0.077.196 describes a process for the production of aromatic amino acids, in which a 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHP synthase) which is no longer feedback-inhibited is overexpressed in E. coli. EP 0.145.156 describes an E. coli strain in which chorismate mutase / prephenate dehydratase is additionally overexpressed for the production of L-phenylalanine.

The strategies mentioned have in common that the intervention to improve production is limited to the biosynthetic pathway specific for the aromatic amino acids. However, production can also be increased further by improved provision of the primary metabolites phosphoenolpyruvate (PEP) and erythrose-4-phosphate (Ery4P) required for the production of aromatic amino acids. PEP is an activated precursor of the glycolysis product pyruvate (pyruvic acid); Ery4P is an intermediate of the pentose phosphate pathway. In the production of aromatic amino acids or other metabolites of the aromatic biosynthetic pathway, the primary metabolites phosphoenolpyruvate (PEP) and

Erythrose-4-phosphate (Ery4P) is required for the condensation to 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP). The effect of improved provision of the cellular primary metabolite phosphoenolpyruvate from glycolysis has already been investigated. It is known, for example, that the overexpression of transketolase achieved by recombinant techniques results in an increased supply of erythrose-4-P and consequently in an improved product formation of L-tryptophan, L-tyrosine or L-

Phenylalanine enables (EP 0,600,463). Flores et al. showed (Flores et al. 1996. Nature Biotechnology 14: 620-623) that a spontaneous glucose positive revertant of a sugar phosphotransferase system (PTS) negative mutant of Escherichia coli glucose via the galactose permease (GalP) system into the cells infiltrated and was able to grow on glucose. Additional expression of the transketolase gene (tktA) resulted in an increased formation of the intermediate DAHP (Flores et al. Nature Biotechnology 14

(1996) 620-623). Further improvements in the provision of precursor metabolites for the aromatic Amino acid biosynthesis path and improvements in the flow in the aromatic amino acid biosynthesis path are known to the person skilled in the art, for example, from Bongaerts et al. (Bongaerts et al. Metabolie Engineering 3 (2001) 289-300).

Several strategies for increasing the availability of PEP are also described in the literature, e.g. B. by a PEP-independent sugar intake system. B. the sugar phosphotransferase system (PTS) is completely inactivated and then replaced by a galactose permease or the genes gif (glucose facilitator protein) and glk (glucokinase) from Zymomonas mobilis (Frost and Draths Annual Rev. Microbiol. 49 (1995) , 557-579; Flores et al. Nature Biotechnology 14 (1996) 620-623; Bongaerts et al. Metabolie Engineering 3 (2001) 289-300)

It was also shown in earlier patent applications (DE 19644566.3; DE 19644567.1; DE 19818541 AI; US 6,316,232) that by increasing the enzyme activities of e.g. B. transketolase, transaldolase, glucose dehydrogenase or glucokinase in Escherichia coli or by combinations of the specified enzymes and a PEP-independent transport system, substances of the aromatic biosynthetic pathway could be provided to an increased extent.

In a number of microorganisms, pyruvate carboxylase plays an important role in the synthesis of the amino acids that are derived from the tricarboxylic acid cycle (TCA cycle).

The physiological role of pyruvate carboxylase lies in the anaplerotic reaction that starts from Py- ruvat and C0 ₂ (or hydrogen carbonate) achieved the provision of C4 bodies (oxaloacetate) (Jitrapakdee and Wallace, Biochemical Journal 340 (1999) 1-16). Oxaloacetate can be metabolized further by reaction with acetyl-CoA in the tricarboxylic acid cycle

(e.g. also to the amino acids glutamate and glutamine), or by transamination to aspartic acid, provide precursors of the aspartate amino acid family (aspartate, asparagine, homoserine, threonine, methionine, isoleucine and lysine) (Peters-Wendisch et al. J. Mol. Microbiol. Biotechnol. 3 (2001) 295-300). Various groups were able to show that the activity of a pyruvate carboxylase plays a role in the production of amino acids of the aspartate family in Corynebacteria (DE 19831609; EP 1,067,192; Peters-Wendisch et al.

Journal of. Molecular Microbiology and Biotechnology 3 (2001) 295-300; Sinskey et al. US 6,171,833 and WO 00/39305). WO 01/04325 describes, for example, a fermentative process for the production of L-amino acids from the aspartate amino acid family with coryneform microorganisms which are a go from the group dapA (dihydrodipicolinate synthase), lysC (aspartate kinase), gap (glycerol aldehyde-3 - Phosphate dehydrogenase), mqo (malate-quinone oxidoreductase), tkt (transketolase), gnd (6-phosphogluconate dehydrogenase), zwf (glucose-6-phosphate dehydrogenase), lysE (lysine export), zwal (unnamed protein product), eno (enolase), opcA (putative oxidative pentose phosphate cycle protein) and also a pyc gene sequence (pyruvate carboxylase). The aromatic amino acid L-

Tryptophan in addition to the amino acids of the aspartate amino acid family, also as a product of the in WO 01/04325 method described. However, no indication is given of which specific gene sequence or which specific enzyme is suitable for a specific production of aromatic amino acids and metabolites of the aromatic amino acid biosynthetic pathway.

Genes for a pyruvate carboxylase (pyc genes) have been isolated from a number of microorganisms, characterized and expressed in recombinant form. For example, genes for pyruvate carboxylase have already been found in bacteria such as Corynebacteria, Rhizobia, Brevibacteria, Bacillus subtilis, Mycobacteria, Pseudomonas, Rhodopseudomonas spheroides, Campylobacter jejuni, Methanococcus jannaschii, in the yeast Saccharomyces cereviserneae, and humans Payne & Morris J Gen. Microbiol. 59 (1969) 97-101; Peters-Wendisch et al. Microbiology 144 (1998) 915-927; Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195; Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414; Mukhopadhyay & Purwantini, Biochim. Biophys. Acta 1475 (2000) 191-206; Irani et al. Biotechnol. Bioengin. 66 (1999) 238-246; US 6,171,833 ; Dünn et al. Arch. Microbiol. 176 (2001) 355-363; Dünn et al. J. Bacteriol. 178 (1996) 5960-5970; Jitrapakdee et al. Biochem. Biophys. Res. Comm. 266 (1999) 512 -517; Velayudhan & Kelly Microbiology 148 (2002) 685-694; Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414; EP 1,092,776).

No pyruvate carboxylases have been described to date from Escherichia coli and other enterobacteria. It has recently been shown in recombinant cells from Escherichia coli or Salmonella typhimurium which carry the pyc gene from Rhizobium etli that the expression of the pyruvate carboxylase markedly changed the product spectrum of the cells, specifically in the direction of the C4 body (e.g. Succinate) while reducing substances derived from the pyruvate, such as lactate or acetate (Gokarn et al. Biotechnol. Letters 20 (1998) 795-798; Gokarn et al. Applied Environm. Microbiol. 66 (2000) 1844-1850; Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195; Xie et al. Biotechnol. Letters 23 (2001) 111-117). The formation of the L-amino acids threonine, glutamic acid, homoserine, methionine, arginine, proline and isoleucine was achieved by expression of a pyc gene from Bacillus subtilis in E. coli (EP 1,092,776). In the literature (Xie et al. Biotechnol. Letters 23 (2001) 111-117; Gokarn et al. Biotechnol. Letters 20 (1998) 795-798; Gokarn et al. Applied Environm. Microbiol. 66 (2000) 1844-1850 ; Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195; EP

1,092,776), no increased formation of aromatic amino acids or of metabolites from the aromatic biosynthetic pathway has been described.

It is therefore an object of the invention to provide a process which can be used to produce aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway. Starting from the preamble of claim 1, the object is achieved according to the invention with the features specified in the characterizing part of claim 1.

Advantageous developments of the invention are specified in the subclaims.

With the method according to the invention, it is now possible to microbially produce aromatic amino acids and metabolites of the aromatic amino acid biosynthetic pathway.

The process according to the invention is particularly suitable for the production of L-phenylalanine. Aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway in the sense of the invention, hereinafter also referred to as “substances”, are to be understood in particular to mean the aromatic amino acids L-phenylalanine, L-tryptophan and L-tyrosine. Metabolites from the aromatic amino acid biosynthetic pathway including 3-deoxy-D-

Arabino heptulosonate 7-phosphate (DAHP) derived compounds such as D-arabino heptulosonate (DAH), shikimic acid, chorismic acid and all their derivatives, cyclohexadiene transdiols, indigo, indole acetic acid, adipic acid, melanin, quinones, benzoic acid derivatives and their potential To understand follow-up products. It should be noted here that for the production of indigo, adipic acid and other non-natural secondary products, in addition to the interventions according to the invention, further genetic changes in the microorganisms producing the substances are necessary. However, all compounds should be included, their biochemical Synthesis is favored by the increased provision of PEP.

The inventors surprisingly found that after introducing a pyc gene sequence into microorganisms which naturally have no pyruvate carboxylase, or after amplifying an existing pyc gene sequence, aromatic amino acids and metabolites of the aromatic biosynthetic pathway could be produced in an improved manner.

In the context of the invention, all gene sequences which code for a pyruvate carboxylase are summarized below under the name “pyc gene sequence”.

In the context of this invention, the term “introduction” should therefore be understood to mean all process steps which result in a pyc gene sequence being inserted into microorganisms which do not have a pyc gene sequence. However, the term “introduction” can also include a Amplification of an existing pyc gene sequence can be understood.

A number of different detection methods have been described for the enzyme activity of pyruvate carboxylases. The test principle is the detection of oxalacetate formed from pyruvate. The enzyme pyruvate carboxylase catalyzes the carboxylation of pyruvate and thereby forms oxaloacetate. The activity of a pyruvate carboxylase depends on biotin as a prosthetic group on the enzyme and also depends on ATP and magnesium ions. In the first reaction step, ATP is split into ADP and inorganic phosphate. The enzyme Biotin complex carboxylated by hydrogen carbonate. In the second step, the carboxyl group is transferred from the enzyme-biotin complex to pyruvate. This creates oxaloacetate. The pyruvate carboxylase from Brevibacterium lactofermenum can be detected, for example, in crude extracts obtained by ultrasound treatment by carrying out coupled enzyme tests with malate dehydrogenase or citrate synthase, which each serve as evidence for the oxaloacetate formed (Tosaka et al. Agric. Biol. Che. 43 (1979) 1513-1519). The pyruvate carboxylase from Methanococcus jannaschii was detected by coupling with malate dehydrogenase (Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414).

In Corynebacterium glutamicum cells which had been permeabilized by hexadecyltrimethylammonium bromide (CTAB), pyruvate carboxylase activity was detected in a batch method by coupling to a glutamate oxaloacetate transaminase (Peters-Wendisch et al. Microbiology 143 (1997) 1095 - 1103).

Also in CTAB permeabilized cells from C. glutamicum used Uy et al. (Journal of Microbiological Methods 39 (1999) 91-96) a discontinuous method with determination of the remaining pyruvate concentration by lactate dehydrogenase and fluorometric determination of the conversion of pyruvate and NADH to lactate and NAD. In recombinant E. coli cells expressing the pyc gene sequence from Rhizobium etli, the pyruvate carboxylase activity in crude extracts by coupling with the enzyme citrate synthase and spectrophotometric detection of coenzyme A at 412 nm by formation of thio-nitrobenzoate (Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195; Payne & Morris J. Gen. Microbiol. 59 (1969) 97-101).

The activity of the human pyruvate carboxylase and the recombinant yeast pyruvate carboxylase was demonstrated by the fixation of radioactively labeled ¹⁴ C-carbonate (Jitrapakdee et al. Biochem. Biophys. Res. Commun. 266 (1999) 512-517; Irani et al. Biotechnol. Bioengin 66 (1999) 238-246).

Increased pyruvate carboxylase activity or the first-time provision of pyruvate carboxylase in microorganisms will presumably result in increased intracellular availability of phosphoenolpyruvate

(PEP) so that it is no longer used for anaplerotic reactions. This can then lead to an improved microbial synthesis of substances derived from PEP, especially aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway. As was shown by the inventors, the introduction of a pyc gene sequence into microorganisms has brought about an improved microbial synthesis of substances which are derived from the PEP. In particular, DAHP or its degradation product, DAH, was increasingly found in the culture supernatant when the second step of the aromatic biosynthetic pathway is blocked by a mutation in the aroB gene. DAHP, which is synthesized by condensation of PEP and Ery4P, forms the starting substance for aromatic amino acids and other metabolites of aromatic amino acid bio pathway. DAHP and DAH are discussed in the literature as signs of increased PEP availability (Frost and Draths Annual Rev. Microbiol. 49 (1995), 557-579; Flores et al. Nature Biotechnology 14 (1996) 620-623; Bongaerts et al. Metabolie Engineering 3 (2001) 289-300)

In the context of the present invention, the term “amplification” of the pyc gene sequence describes the increase in the activity of the pyruvate carboxylase. For this purpose, the following measures can be mentioned by way of example:

- Introduction of the pyc gene sequence z. B. by means of vectors or temperate phages;

- Increase in for pyruvate carboxylase (pyc-

Gene sequence) coding gene copy number z. B. by means of plasmids with the aim of the pyc gene sequence in an increased number of copies, from slightly (z. B. 2 to 5 times) to greatly increased number of copies (z. B. 15 to 50 times) in the microorganism bring in;

- Increasing the gene expression of the pyc gene sequence z. B. by increasing the transcription rate z. B. by

Use of promoter elements such. B. Ptac, Ptet or other regulatory nucleotide sequences and / or by increasing the translation rate z. B. by using a consensus ribosome binding site;

- Addition of biotin to the fermentation medium in order to

To better supply cells with the prosthetic group biotin, which is essential for pyruvate carboxylase, or to strengthen existing enzymes that are capable of biotin biosynthesis, or to introduce these enzymes into the microorganism. By using inducible promoter elements, e.g. B. lacl ^q / Ptac, there is the possibility of adding new functions (induction of the enzyme synthesis), z. B. by adding chemical inducers such as isopropylthiogalactoside (IPTG).

Alternatively, overexpression of the pyc gene sequence can also be achieved by changing the media composition and culture management. The addition of essential growth substances to the fermentation medium can also bring about an improved production of the substances in the sense of the invention.

Expression is also improved by measures to extend the life of the m-RNA. Furthermore, the enzyme activity is increased by preventing the breakdown of the enzyme protein. Increasing the endogenous activity of an existing pyruvate carboxylase (e.g. in Bacillus subtilis or Corynebacteria) e.g. B. by mutations that are generated undirected by classic methods, such as by

UV radiation or mutation-triggering chemicals, or by mutations that are generated in a targeted manner using genetic engineering methods such as deletion (s), insertion (s) and / or nucleotide exchange (s). Combinations of the above-mentioned and other, analogous methods can also be used to increase the pyruvate carboxylase activity.

The pyc gene sequence is preferably introduced by integrating the pyc gene sequence into one or more gene structures, the pyc gene sequence being introduced into the gene structure as a single copy or in an increased number of copies. A “gene structure” is to be understood as any gene or nucleotide sequence which carries a pyc gene sequence. Corresponding nucleotide sequences can be, for example, plasmids, vectors, chromosomes, phages or other, non-circularly closed, nucleotide sequences. For example, the pyc gene sequence can be a vector is introduced into the cell or is inserted into a chromosome or is introduced into the cell by a phage. Other combinations of gene distributions are not to be excluded from the invention by these examples. In the event that a pyc gene sequence already exists , the number of pyc gene sequences contained in the gene structure should exceed the natural number.

The pyc gene sequence used for the method according to the invention can, for. B. from Rhizobium (Gokarn et al. Appl. Microbiol. Biotechnol. 56 (2001) 188-195), Brevibacterium, Bacillus, Mycobacterium (Mukhopadhyay and Purwantini Biochimica et Biophysica Acta 1475 (2000) 191-206), Methanococcus ( Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414), Saccharomyces cerevisiae (Irani et al. Biotechnology and Bioengineering 66 (1999) 238-246) Pseudomonas, Rhodopseudomonas, Campylobacter or Methanococcus jannaschii (Mukhopadhyay et al. Arch. Microbiol. 174 (2000) 406-414). A pyc gene sequence from Corynebacterium strains, in particular from Corynebacterium glutamicum (Peters-Wendisch et al. Microbiology 144 (1998) 915-927; Peters-Wendisch et al. J. Mol. Microbiol. Biotech- nol. 3 (2001) 295-300). Genes for pyruvate carboxylases from other organisms are also suitable. The person skilled in the art knows that further pyc gene sequences can be identified from generally accessible databases (such as, for example, EMBL, NCBI, ERGO) and by techniques of gene cloning, e.g. B. PCR can be cloned from such other organisms using the polymerase chain reaction.

For the method according to the invention, microorganisms are used into which a pyc gene sequence has been introduced in a replicable form.

As microorganisms for the transformation with a pyc gene sequence, organisms from the family Enterobacteriaceae such as. B. Escherichia species, but also microorganisms of the genera Serratia, Bacillus, Corynebacterium or Brevibacterium and other strains known from classic amino acid processes. Escherichia coli is particularly suitable.

The following strain was deposited with the DSMZ in accordance with the terms of the Budapest Treaty on March 22, 2002: Escherichia coli K-12 LJ110 aroB / pF36 under the number DSM 14881.

The transformation of the microorganisms or host cells can be carried out by chemical methods (Hanahan D, J. Mol. Biol. 166 (1983) 557-580), and also by electroporation, conjugation, transduction or by subcloning from plasmid structures known in the literature. In the case of e.g. B. the cloning of pyruvate carboxylase from Corynebacterium glutamicum is suitable for example as the method of polymerase chain reaction (PCR) for the directed amplification of the pyc gene sequence with chromosomal DNA from Corynebacterium glutamicum strains. It is advantageous to use microorganisms for the transformation in which one or more enzymes, which are additionally involved in the synthesis of the aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway, are deregulated and / or their activity is increased. In particular, transformed cells are used which are able to produce an aromatic amino acid, the aromatic amino acid preferably being L-phenylalanine.

In a further advantageous embodiment of the method according to the invention, the genes which code for enzymes which compete with the pyruvate carboxylase for PEP, such as, for. B. the PEP carboxylase, the PEP-dependent sugar phosphotransferase system (PTS) or pyruvate kinases, individually or in combination in their expression can be lowered or inactivated or completely switched off and these microorganisms are used. In this way, the provision of PEP for the synthesis of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway can be further improved and thus the production of these compounds can be improved. This advantageous embodiment also includes that the activity of a transport protein for PEP-independent uptake of glucose in microorganisms with a PEP-dependent transport system for glucose, the are used in the method according to the invention is increased. The additional integration of a PEP-independent transport system allows an increased supply of glucose in the microorganism producing the substances. PEP as an energy donor is not required for these reactions and, based on a constant material flow in the glycolysis and the pentose phosphate pathway, is increasingly the primary condenser with erythrose-4-phosphate (Ery-4-P) Metabolites of the general biosynthetic pathway for aromatic compounds such as. B. deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) are available and subsequently for the production of, for example, aromatic amino acids, such as. B. L-phenylalanine, tyrosine or tryptophan.

The advantageous use of a PEP-independent sugar transport system, a glucose facilitator protein (Gif) and the genes for transketolase, transaldolase and glucokinase has already been shown in previous patent applications (DE 19644566.3, DE 19644567.1, DE 19818541 AI; US 6,316,232)

In a preferred embodiment, the process for the production of substances according to the invention can use microorganisms in which one or more enzymes, which are additionally involved in the synthesis of the substances, are deregulated and / or their activity is increased. These are in particular the enzymes of the aromatic amino acid metabolism and above all the DAHP synthase (eg in E. coli AroF or AroH), the shikimate kinase and the chorismate mutase / prephenate dehydratase (PheA). All other enzymes involved in the Synthesis of aromatic amino acids or metabolites of the aromatic amino acid biosynthetic pathway and their secondary products involved can be used.

For the production of aromatic metabolites

Amino acid biosynthetic pathways and their derivatives, such as adipic acid, bile acid and quinone compounds, and their derivatives, in addition to the pyc gene sequence, the deregulated and overexpressed DAHP synthase has proven to be particularly suitable. For the increased synthesis of, for example, L-tryptophan, L-tyrosine, indigo, derivatives of hydroxy- and aminobenzoic acid and naphtho- and anthroquinones, and their derivatives, the shikimate kinase should also be regulated and its activity increased. For the efficient production of phenylalanine, phenylpyruvic acid and their derivatives, a deregulated and overexpressed chorismate mutase / prephenate dehydratase is also of particular importance. However, this is also intended to encompass all other enzymes whose activities contribute to the microbial synthesis of metabolites other than those from the aromatic amino acid biosynthetic pathway, that is to say compounds whose production is favored by the provision of PEP, e.g. B. CMP-ketodeoxyoctulosonic acid,

UDP-N-acetylmuramic acid, or N-acetyl-neuraminic acid. The increased availability of PEP can not only have a positive effect on the synthesis of DAHP, but can also favor the introduction of a pyruvate group in the synthesis of 3-enolpyruvoylshikimate-5-phosphate as a precursor of chorismate. For the production of indigo, adipic acid, cyclohexadiene transdi oils and other non-natural secondary products, in addition to the process features according to the invention, further genetic changes to the substances producing microorganisms are necessary.

The materials and methods used are to be stated below, and the invention is illustrated by experimental and comparative examples:

FIG. 1 shows the links between the central metabolism and the aromatic amino acid biosynthetic pathway of bacteria, emphasizing the reactions of the phosphoenolpyruvate and pyruvate.

Reaction 1 denotes the pyruvate carboxylase reaction, reaction 2 the phosphoenolpyruvate carboxylase reaction and reaction 3 the PEP-dependent sugar phosphotransferase system (PTS).

CHD = Cyclohexadiencarboxylattransdiole DAHP = 3-Deoxy-Arabino-Heptulosonat-7-Phosphate DAH = 3-Deoxy-Arabino-Heptulosonat DHAP = Dihydroxyacetone Phosphate 2,3-DHB = 2, 3-Dihydroxybenzoate

EPSP = enol-pyruvoyl-shikimate phosphate GA3-P = glyceraldehyde-3-phosphate pABA = para-aminobenzoate PEP = phosphoenol pyruvate 2 shows exemplary experimental data from the pyruvate carboxylase activity detection. The abscissa X represents the time in seconds and the ordinate Y the extinction at a wavelength of 412 nm. The measurement points represented by black diamonds are results obtained with E. coli cells which were transformed with a pyc vector were. The measuring points shown with a blank square represent the results of the E. coli cells which were transformed with an empty vector without a pyc gene sequence. The gray solid line shows the regression line.

Tab. 1. Plasmids and bacterial strains used

Example 1: Cloning of the pyc gene sequence, expression in Escherichia coli strains

The first cloning of the pyc gene sequence from Corynebacteriu glutamicum ATCC13032 is described under Peters-Wendisch et al. Microbiology 144 (1998) 915-927. The subcloning of the pyc gene sequence into the expression vector pVWExl -pyc is described in Peters-Wendisch et al. J. Mol. Microbiol. Biotechnol. 3 (2001) 295-300. A 3.7 kb DNA fragment with the pyc gene sequence from C. glutamicum was obtained from the vector pVWExl-pyc by restriction with the enzymes SphI and Hindlll. This 3.7 kb fragment was ligated with the vector pACYCPtac (SphI plus Hind III-restricted). The transformation took place in the E. coli strain DH5α. The selection was made on LB plates with chloramphenicol (25 mg / 1). Plasmids with the correct insert were named pF36. Defect mutations in the biosynthesis of aromatic amino acids were introduced by Pl-mediated transduction. The defects for the two Shikimate kinases {aroL and aroK) were determined by successive PI transduction from strain DV80 (aroK:: kan, aroL :: Tnl0, Vinella et al. Journal of Bacteriology 178 (1996) 3818-3828) generated. For this purpose, the wild-type strain E. coli K-12 LJ110 was first selected for kanamycin resistance (obtaining the aroK:: Kan marker). In a second PI transduction, selection was then made to obtain the tetracycline resistance marker (obtain the aroL:: Tnl0 marker). Cells showing both resistances were then tested for auxotrophy for the aromatic amino acids L-phenylalanine, L-tyrosine, L- Tryptophan (40 mg / 1 each) and checked for auxotrophy for p-aminobenzoic acid, p-hydroxybenzoic acid and 2, 3-dihydroxybenzoic acid (20 mg / l each). Mutants with a defect in aroB were obtained by Pl transduction from the donor strain AB2847 rpe :: Km aroB into the strain LJ110. The first step was to select kanamycin resistance. Bacteria that were also auxotrophic for aromatic amino acids and for shikimate (aroB negative) were used further. In a second Pl transduction (with a Pl lysate from the wild-type strain LJ110), selection was made for the use of pentose sugars on minimal medium. The rpe:: Km defect leads to pentose-negative phenotype, preservation of rpe leads to pentose utilization. Cells that became pentose-positive but remained aromatic-exotrophic (aroB) were further used as LJ110 aroB (Marco Krämer, dissertation, University of Düsseldorf, 1999, p.34). The strain LJ110 Δppc was determined by the cross-over-PCR method from Link et al. (Link et al. J. Bacteriol. 179 (1997) 6228-6237). The oligonucleotide primer pairs used for the PCR amplification were: external primer Nin 5 'GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGCATATTACCCCAGACACCCC ATCTTATCG 3 "(Seq. ID. No. 1) and inner primer Nout

5'TTGGGCCCGGGCTCAATTAATCAGGCTCATC 3 "(Seq. ID. No. 2) for the 5 'area before the ppc gene. As well as for the 3' area behind the ppc gene: Outside primer Cout 5'GAGGCCCGGGTATCCAACGTTTTCTCAAACG 3 No. (Seq 3) and interior primer Cin

5 'CACGCAATAACCTTCACACTCCAAATTTATAACTAATCTTCCTCTTCTGCAAA CCCTCGTGC 3' (Seq. ID. No 4). The one generated by PCR DNA fragment contained specially inserted interfaces for the restriction enzyme XmaCI. An in-frame deletion of the ppc gene was generated by cloning into the XmaCI site of the vector pK03 and then using the method described (Link et al. J. Bacteriol. 179

(1997) 6228-6237) into strain LJ110. After selection for sucrose resistance, strains were obtained which are auxotrophic for the addition of C4 substrates such as succinate or malate. The correct chromosomal deletion (Appc) was confirmed by PCR with chromosomal DNA from these mutants. The correct mutants were

«Referred to as the LJ110 Appc.

Example 2: Detection of pyruvate carboxylase activity

The implementation of the enzymatic pyruvate carboxylase test in recombinant Escherichia coli cells is described below by way of example. Cells from Escherichia coli LJ110 Appc, which had been transformed either with the empty vector (control vector without pyc gene sequence) pACYCtac or with the pyc-containing vector pF36, were in a minimal medium (see preculture medium Table 2) with 0.5% glucose and chloramphenicol (25 mg / 1). Biotin (200 μg / l) was added to the medium to meet the biotin needs of pyruvate carboxylase. Since the cells have a PEP carboxylase defect, 0.5 g / 1 sodium succinate was added to the minimal medium. The cultures were incubated in shaking flasks (500 ml Erlenmeyer flasks with 100 ml filling volume) at 37 ° C. for 6 hours on a rotary shaker (200 revolutions per minute) until they had an optical density at 600 nm (OD ₆₀₀ ) of 1 to 1, 5 reached had (late exponential growth phase). To induce pyruvate carboxylase, IPTG was added to the culture media to a final concentration of 100 μM. After reaching the specified optical density, the cultures were harvested by centrifugation. The sediments thus obtained were washed twice with 100 mM TrisHCl buffer (pH 7.4). The cells were then resuspended in the same buffer, and it was adjusted a cell concentration, the ₆ oo had an OD of 5 in 1 ml buffer. Such samples were mixed with 10 ul toluene / ml and mixed on a vortex for 1 minute. This was followed by incubation at 4 ° C (on ice) for 10 minutes. This allowed the cells to be permeabilized. The cells were used in 100 μL aliquots for the subsequent pyruvate carboxylase test.

The test principle is the detection of the oxaloacetate (OAA) formed from pyruvate and hydrogen carbonate via a coupling with the auxiliary enzyme citrate synthase and acetyl-coenzyme A (acetyl-CoA) after the following reactions:

Pyruvate + HC0 ₃ ^' + ATP-> OAA + ADP + V ± (1)

OAA + Acetyl-CoA → Citrate + HS-CoA ^" (2)

HS-CoA + DTNB - CoA derivative + TNB ^2- (3) OAA = oxaloacetate

DTNB = dithionitrobenzoic acid

TNB ^{2 "} = 5-thio-2-nitrobenzoate

CoA derivative = mixed disulfide from CoA and thio-nitrobenzoic acid

Pyruvate is converted to oxaloacetate (OAA) by pyruvate carboxylase Pyc with ATP hydrolysis (1). The OAA formed is reacted with acetyl-CoA via the citrate synthase reaction (2) to citrate and coenzyme A (HS-CoA). The Pyc activity detection is based on the reaction (3) of the released coenzyme A (HS-CoA) with dithionitrobenzoic acid to a mixed disulfide of CoA and thionitrobenzoic acid and a molar equivalent of yellow-colored 5-thio-2-nitrobenzoate (TNB ^{2 ~} ). This has a molar extinction coefficient of 13.6 rrϋYT ¹ cm ^"1 and can be verified photometrically at a wavelength of 412 nm. The formation rate of TNB ^2" correlates directly with the acetylation of OAA and thus with the conversion of pyruvate to OAA by pyruvate carboxylase. The test mixture contained in 1 mL: NaHC0 ₃ (25 mM), MgCl ₂ (ImM), acetyl-CoA (0.2 πiM), DTNB (0.2mM), ATP (4mM), citrate synthase (1U = 1 unit), Cell suspension (0.5 OD ₆₀₀ ), test buffer (100 mM Tris-HCl pH 7.3). The batches were preheated to 25 ° C. in a 2 ml Eppendorf reaction vessel for 2 minutes. The reaction was started by adding pyruvate

(5mM).

To stop the reaction at the appropriate times, the reaction vessels were transferred to liquid nitrogen and, during the thawing process, the biomass was removed by centrifugation at 4 ° C. and 15,300 rpm. The absorbance at 412 nm was determined photometrically in the clear supernatants. Approaches without pyruvate served as a reference.

The data shown in FIG. 2 result in an increase in extinction [E412] of 0.029 per minute and thus an absolute pyruvate carboxylase activity of 210 mU / mL. Based on the cell number of OD ₆₀ o = 0.5 used, this results in a specific Pyc activity of 42 mU / θD ₆ oo. No Pyc activity was found in the controls.

Example 3: Fermentation to obtain PAH with recombining pyruvate carboxylase.

As the first metabolite for the aromatic biosynthetic pathway, the accumulation of DAH (degradation product of DAHP) can be detected by an aroB mutation. The strains E. coli K-12 LJ110 aroB / pF36 (= DSM14881, "PYC") and the control strain E. coli K-12 LJ110 aroB / pACYCtac (blank vector, "LV") were used. The process was carried out in 6 Sixfors Vario laboratory fermenters (2 liters) connected in parallel with a filling volume of 1.5 L.

The investigations were carried out with the following media compositions and under the following fermentation conditions:

Media:

Tab. 2: Pre-culture medium:

Tab. Fermentation medium:

Feed medium: glucose: 454 g / L

Fermentation conditions and experimentation

■ Fedbatch (6-fold parallel batch in the stirred and gassed bioreactor "Sixfors-Vario" from Infors, with exhaust gas analysis from Rosemount) ■ Duration: 30 h

^■ Temperature [° C]: 37 (regulated)

■ pH: 6.5 (regulated)

^■ p0 ₂ : 30% (regulated)

^■ Titration agent: 25% NH ₃ "induction agent: IPTG (100 μmol / L) is presented

^■ Initial volume: 1.5 L

■ Starting conditions:

Stirrer speed: 500 rpm, flow rate 0.5 L / min - In the growth phase, gradually increase the stirrer speed and flow rate (max. 1.5 L / min), when 900 to 1000 rpm is reached, switch on the p0 ₂ control via the stirrer speed

Sampling every 2 hours (determination of: OD ₅₂ o, glucose concentration using "Accutrend" from the company Röche, pH offline, dry biomass BTM), storage of the fermentation supernatant and pellet (control of the plasmid stability over the entire process time). - Starting concentration of glucose in the fermenter : 13.64 g / L, no regulation of the glucose concentration in the fermentation ter, but offline determination and corresponding start of the dosing system Fed-batch-Pro from DASGIP, Jülich with a residual quantity of approx. 4 g / L and manual adjustment of the dosing rate so that 5 g / L is not exceeded if possible.

Process data acquisition via LabView (National Instruments) ■ Strains: E. coli K-12 LJ110 aroB / pF36 ("PYC")

E. coli K-12 LJ110 aroB / pACYCtac ("LV")

Table 4 below shows the results of the fermentations.

Table 4: Fermentation results for the recovery of DAH with recombinant pyruvate carboxylase

Yields (based on the glucose consumed; [mol product / mol glucose]) of the strains: J110 aroB- / pF36 (Pyc strain) and LJ110 aroB- / pACYCtac (control with empty vector)

It can be seen from the fermentation results that the introduction of the pyc gene sequence into E. coli resulted in a significant increase in the yield of DAH. The organisms transformed with the pyc gene sequence showed an at least 2.5-fold increase in the yield of DAH compared to the control organisms which were transformed with the empty vector (control vector without pyc gene sequence) or whose pyruvate carboxylase was not induced by the addition of IPTG has been .

Claims

Patent claims

1. A method for the microbial production of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway, characterized by introducing a pyc gene sequence into a microorganism and using this microorganism.

2. The method according to claim 1, characterized in that the pyc gene sequence is amplified in a microorganism.

3. The method according to any one of claims 1 to 2, characterized in that the number of copies of the pyc gene sequence is increased in a microorganism.

4. The method according to any one of claims 1 to 3, characterized in that the gene expression of the pyc gene sequence is increased in a microorganism.

5. The method according to any one of claims 1 to 4, characterized in that a pyc gene sequence is used which consists of an organism from the group of Corynebacteria, Rhizobia, Brevibacteria, Bacillus, Mycobacteria, Pseudomonas, Rhodopseudomonas, Ca pylobacter, Methanococcus or Saccharomyces strains.

6. The method according to any one of claims 1 to 5, characterized in that a pyc gene sequence is used which comes from Corynebacterium glutamicum.

7. The method according to any one of claims 1 to 6, characterized in that the preparation relates to substances from the group of aromatic amino acids and other metabolites of the aromatic amino acid biosynthetic pathway.

8. The method according to any one of claims 1 to 7, characterized in that the preparation relates to the substances L — phenylalanine, L-tryptophan and L-tyrosine.

9. The method according to any one of claims 1 to 8, characterized in that microorganisms from the group of Enterobacte- riaceae, Serratia strains, Bacillus strains, Coryne- bacterium strains and Brevibacterium strains are used.

10. The method according to any one of claims 1 to 9, characterized in that Escherichia coli is used.

11. The method according to any one of claims 1 to 10, characterized in that the method relates to a fermentation of the microorganisms in a medium containing components from the group of biotin, IPTG and essential growth substances.

12. The method according to any one of claims 1 to 11, characterized in that the pyc gene sequence is incorporated into gene structures which are introduced into host cells.

13. The method according to any one of claims 1 to 12, characterized in that at least one enzyme consuming PEP in a microorganism is switched off or inactivated.

14. The method according to any one of claims 1 to 13, characterized in that at least one enzyme from the group PEP carboxylases, PEP-dependent sugar phosphotransferases (PTS) and pyruvate kinases is switched off or inactivated in a microorganism.

15. The method according to any one of claims 1 to 14, characterized in that a PEP-independent transport system for glucose uptake is introduced into a microorganism and this microorganism is used.

16. The method according to any one of claims 1 to 15, characterized in that a glucose facilitator protein (Gif) is introduced into a microorganism and this microorganism is used.

17. The method according to any one of claims 1 to 16, characterized in that a glucose facilitator protein from Zymomonas mobilis is introduced into a microorganism and this microorganism is used.

18. The method according to any one of claims 1 to 17, characterized in that sugar transport genes are introduced into a microorganism and this microorganism is used.

19. The method according to any one of claims 1 to 18, characterized in that a transaldolase and / or transketolase is introduced into a microorganism.

20. The method according to any one of claims 1 to 19, characterized in that a transketolase A and / or transketolase B from E. coli is introduced into a microorganism.

21. The method according to any one of claims 1 to 20, characterized in that a deregulation and / or amplification of the enzymes from the group DAHP synthase, shikimate kinase, chorismate mutase or prephenate dehydratase is carried out in a microorganism.