KR100850853B1 - - - a microorganism whose enzyme activity for nrfe is inactivated and the process for producing l-tryptophan using the microorganism - Google Patents

Abstract

The present invention relates to a L-tryptophan producing microorganism and a method for producing L-tryptophan using the same. More specifically, the present invention provides a recombinant microorganism having increased production efficiency of L-tryptophan by inactivating the nrfE gene encoding formate-dependent nitrite reductase derived from E. coli and L-tryptophan using the same. It relates to a manufacturing method of.

L-Tryptophan, nrfE, Escherichia coli, Inactivation

Description

L-Tryptophan-producing microorganisms in which the Nr gene is inactivated and L-Tryptophan production method using the same

The present invention relates to a L-tryptophan producing microorganism and a method for producing L-tryptophan using the same. More specifically, the present invention provides a recombinant microorganism having increased production efficiency of L-tryptophan by inactivating the nrfE gene encoding formate-dependent nitrite reductase derived from E. coli and L-tryptophan using the same. It relates to a manufacturing method of.

L-tryptophan is a kind of essential amino acid and has been widely used as a feed additive or a sleep effect or a mental stability effect, such as pharmaceutical raw materials and health food materials such as sap.

The production method of L-tryptophan includes a chemical synthesis method, an enzyme reaction method and a fermentation method with a microorganism, but in the case of the chemical synthesis method, the conditions of high temperature and high pressure are required, and since the D and L forms are mixed in the product, the purification process is performed. Uneasy. In the case of the enzyme reaction method, for example, in the Matsui Toatsui patent (Korean Patent Publication 90-005773) published in Japan, the enzyme reaction method is only expensive for indole and serine used as substrates. But there was a problem that the enzyme is not safe.

On the other hand, the production of L-tryptophan by conventional microbial fermentation has been carried out in a variety of microorganisms and regulatory mutations of various microorganisms, such as E. coli and Corynebacterium, and excellent recombinant strains using genetic recombination technology in the 1980s They have made great strides in developing them, which has resulted in high productivity gains. Domestic patents for the production of L-tryptophan by direct fermentation using microorganisms include the case of using L-tryptophan resistant or mutant strains with nutritional requirements (Korean Patent Publications 87-1813, 90-8251, 92-7405) and In case of using a recombinant strain (Korean Patent Publication No. 90-5772, 91-5627). In the case of using L-tryptophan analog-resistant strains, the main goal was to overcome feedback inhibition by metabolites during tryptophan biosynthesis, and tryptophan productivity / amplification of important enzymes in recombinant strains. The goal was to improve yield, and in fact it was remarkable.

However, in the case of the conventional method for producing L-tryptophan using E. coli mutant strain, there was a problem that the productivity of L-tryptophan is low. Therefore, the present inventors determined that it is necessary to maximize L-tryptophan productivity through genetic recombination technology.

Accordingly, the present inventors have found that the productivity of L-tryptophan increases by inactivating the nrfE gene in Escherichia coli, as a result of conducting a study for increasing L-tryptophan productivity, thereby completing the present invention.

It is an object of the present invention to provide a L-tryptophan producing recombinant microorganism in which the nrfE gene is inactivated.

Still another object of the present invention is to provide a method for producing L-tryptophan in high yield by culturing the recombinant L-tryptophan-producing microorganism.

In order to achieve the above object, the present invention is a microorganism having a production capacity of L- tryptophan, preferably a microorganism characterized in that the production efficiency of L- tryptophan is increased by inactivating the nrfE gene in the microorganism to provide.

Hereinafter, the present invention will be described in detail.

In the present invention, L-tryptophan-producing microorganisms are E. coli , Corynebacterium sp. , Serraita sp. , Providencia sp. Any microorganism capable of producing L-tryptophan is possible, preferably E. coli. More preferably, L-tryptophan-producing E. coli CJ285 (Korean Patent Publication 10-2005-0059685), which is a tryptophan hydroxamate resistance, can be used.

The nrfE gene (NCBI gene ID: 16131900, SEQ ID NO: 7) in the present invention is known to be involved in the synthesis, binding and secretion of cytochrome c under anaerobic conditions of Escherichia coli. The nrfE gene, along with the nrfG gene, is also known to be required for formate-dependent nitrite reduction.

In the present invention, "inactivation" means that the nrfE gene with activity in the cell is lacking or that the level of the protein encoded by the nrfE gene is reduced. Therefore, when the nrfE gene is inactivated, the expression of nrfE is increased.

The microorganism of the present invention can be prepared by inactivating the nrfE gene present in the chromosome of a microorganism having the ability of producing L-tryptophan. In this inactivation method, a mutation is induced using light or a chemical such as ultraviolet light, and a strain in which a gene encoding nrfE is inactivated can be selected from the obtained mutant. In addition, the inactivation method includes a method by DNA recombination technology. The DNA recombination technique may be performed, for example, by injecting a nucleotide sequence or vector comprising a nucleotide sequence homologous to the gene encoding the nrfE to the microorganism to cause homologous recombination. In addition, the injected nucleotide sequence or vector may include a dominant selection marker.

In the method of the present invention, the inactivated nrfE gene or DNA fragment thereof comprises a polynucleotide sequence having sequence homology with the nrfE gene in the host, but the polynucleotide sequence is a cleavage resulting from cleavage of a double helix ( truncation, deletions caused by bases falling off, substitutions caused by one base changing to another base, insertions caused by addition of bases, and inversions caused by inverted ends A mutation such as) refers to a sequence that cannot express a product encoded by the nrfE gene.

The process of introducing the inactivated nrfE gene or DNA fragment thereof into the host cell may be performed by, for example, transformation, conjugation, transduction or electroporation. It is not limited to these examples.

When the inactivated nrfE gene or DNA fragment thereof is introduced into the host cell by transformation, the inactivation process may be performed by mixing the polynucleotide sequence with the culture of the strain. In this case, the strain may naturally be suitable for DNA influx and may be transformed, but it is desirable to make the strain suitable for influx of DNA by appropriate methods in advance (LeBlanc et al., Plasmid 28, 130-145, 1992). Pozzi et al., J. Bacteriol. 178, 6087-6090, 1996). Specifically, strains cultured in LB medium until the beginning of the logarithmic phase are washed with purified water and 10% glycerol, and the strains are concentrated to a high concentration to make them suitable for DNA inflow. For homologous recombination, the nrfE gene or DNA fragment thereof removes a portion of the nrfE gene in genomic DNA, introduces a foreign DNA fragment, and replaces the wild-type chromosome copy of this sequence with an inactivated state. The inactivated polynucleotide sequence introduced into the host cell by transformation can inactivate the wild type genomic sequence by homologous recombination with a tail sequence in genomic DNA. Whether inactivated recombination has been performed can be easily confirmed by, for example, Southern blotting, and more conveniently, by PCR.

The present invention also provides a method for culturing microorganisms in which nrfE gene is inactivated and producing L-tryptophan in high yield.

In the method for producing L-tryptophan of the present invention, the culturing process of the microorganism may be made according to suitable media and culture conditions known in the art. This culture process can be used by those skilled in the art can be easily adjusted according to the strain selected.

Examples of the culture method include, but are not limited to, batch, continuous and fed-batch cultures. Such various culture methods are disclosed, for example, in "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pp 138-176).

The medium used for the cultivation should suitably meet the requirements of the particular strain. The medium contains various carbon sources, nitrogen sources and trace element components. Examples of carbon sources that can be used include glucose, sucrose, lactose, fructose, maltose, carbohydrates such as starch and cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, fatty acids such as palmitic acid, stearic acid and linoleic acid Alcohols such as glycerolol and ethanol, and organic acids such as acetic acid. These carbon sources may be used alone or in combination. Examples of nitrogen sources that can be used include organic nitrogen sources and urea such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL) and soybean wheat, inorganics such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate Nitrogen sources are included. These nitrogen sources may be used alone or in combination. The medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and the corresponding sodium-containing salts as a person. It may also include metal salts such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins, appropriate precursors, and the like can be included. These media or precursors may be added batchwise or continuously to the culture.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during the culture, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation. In addition, to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas (eg, air) is injected into the culture. The temperature of the culture is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. The incubation period can continue until the desired amount of L-tryptophan production is obtained, preferably 10 to 160 hours.

Isolation of L-tryptophan from the culture can be separated by conventional methods known in the art. In such a separation method, methods such as centrifugation, filtration, ion exchange chromatography, and crystallization may be used. For example, the supernatant obtained by removing the biomass by centrifugation of the culture at low speed can be separated by ion exchange chromatography.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1 Preparation of Recombinant L-Tryptophan Production Strains Inactivated nrfE

In this example, the nrfE gene of Escherichia coli was inactivated by homologous recombination. The nrfE gene (NCBI gene ID: 16131900) (SEQ ID NO: 7) is known to be involved in the synthesis, binding and secretion of cytochrome C in anaerobic conditions of Escherichia coli, and is not expected to be necessary in culture conditions producing L-tryptophan. In order to reduce the waste of energy due to the synthesis of unnecessary protein was selected as the target gene for inactivation, and shows the nucleotide sequence of SEQ ID NO: 7.

To this end, a one-step inactivation method, a mutation production technique using lambda red recombinase developed by Datsenko KA, was used (One-step inactivation of chromosomal genes in Escherichia coli K-). 12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci USA.2000 Jun 6; 97 (12): 6640-5). As a marker for confirming the insertion into the gene, the chloramphenicol gene of pKD3 was used. Polymerase chain reaction method (PCR method) using pKD3 as a template using primers 1 and 2 of Table 1 having a part of the nrfE gene and a partial sequence of Chloramphenicol resistance gene of pKD3 gene [Sambrook et al. , Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories (PCR conditions: Denaturing = 94 ° C., 30 sec / Annealing = 55 ° C., 30 sec / Polymerization = 72 ° C., 1 min, 30 times) 1100 pairs of gene fragments were amplified.

Primer 1 5'- ggtcttatctttcatccaccgctgctttaccttggctatggcggtttgatgtgtaggctggagctgcttc -3 '(SEQ ID NO: 1) Primer 2 5'- caccagcacgatcagtagcactgcgcaaaacagcaacagcgtagcgaggacatatgaatatcctccttag -3 '(SEQ ID NO: 2)

In addition, in order to obtain a 5 'DNA fragment of the E. coli nrfE gene, E. coli W3110 was used as a template using primers 3 and 4 in Table 2 [Sambrook et al, Molecular Cloning, a Laboratory Manual]. (1989), amplification of about 500 pairs of gene fragments by Cold Spring Harbor Laboratories (PCR conditions: Denaturing = 95 ° C., 30 sec / Annealing = 55 ° C., 30 sec / Polymerization = 72 ° C., 30 sec, 30 times). It was.

Primer 3 5'-tgctcgcctttggcgtactgac -3 '(SEQ ID NO: 3) Primer 4 5'- atcaaaccgccatagccaaggt -3 '(SEQ ID NO: 4)

In addition, E. coli W3110 was used as a template using primers 5 and 6 in Table 3 to obtain 3'DNA fragments of the E. coli nrfE gene. [Sambrook et al., Molecular Cloning, a Laboratory Manual] (1989), amplification of about 500 pairs of gene fragments by Cold Spring Harbor Laboratories (PCR conditions: Denaturing = 95 ° C., 30 sec / Annealing = 55 ° C., 30 sec / Polymerization = 72 ° C., 30 sec, 30 times). It was.

Primer 5 5'- tcctcgctacgctgttgctgtt -3 '(SEQ ID NO: 5) Primer 6 5'- cagcgaattgacggttccatca -3 '(SEQ ID NO: 6)

Here, the 20 pairs of base sequences of Primer 1 and Primer 4 are complementary, and the 20 pairs of base sequences of Primer 2 and Primer 5 are complementary, resulting in fragments obtained using Primers 1 and 2, and primers 3 and 4 obtained. The fragments and fragments obtained with primers 5 and 6 can be linked into one fragment. The obtained PCR fragments were amplified by 5 times of chain polymerization without primers, followed by addition of primers 3 and 4, followed by 25 times of chain amplification (PCR conditions: Denaturing = 95 ° C., 30 seconds / Annealing = 55 ° C., 30 seconds / Polymerization = 72 ° C., 2 minutes). As a result, gene fragments of about 2100 base pairs were amplified.

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko KA, Wanner BL., Proc NA, Acad Sci USA. 2000 Jun 6; 97 (12): 6640- 5) L-Tryptophan-producing E. coli CJ285 (Korean Patent Publication 10-2005-0059685) transformed according to 5) was prepared in a competent state, followed by influx of a 2100 base pair sized gene fragment obtained by PCR. . The obtained strain was again confirmed that the nrfE was inactivated by the 2100 base pair size obtained by the chain reaction method using primers 3 and 6. The resulting recombinant strain was named "E. coli CO01-0013" and was entrusted to the Korea Microbial Conservation Center, an international depository organization located at 361-221 Hongje 1-dong, Seodaemun-gu, Seoul, Korea, on November 28, 2006. Deposited with the number KCCM 10805P.

Example 2 Comparison of L-Tryptophan Production Capacity of Recombinant Microorganisms with Inactivation of nrfE

In this example, the recombinant strain CO01-0013 (KCCM 10805P) prepared in Example 1 was incubated at 30 ^° C. for 48 hours at 200 rpm using a L-tryptophan flask titer medium having the composition shown in Table 4 below. . The tryptophan concentration obtained therefrom was compared with the tryptophan concentration obtained in CJ285. The obtained L-tryptophan concentration used the average value of three flask results.

Furtherance Concentration (g / L) Glucose 60 Yeast extract 2.5 Ammonium sulfate 20 Magnesium sulfate One Sodium citrate 5 Sodium chloride One Tyrosine 0.1 Calcium carbonate 40 Potassium dihydrogenphosphate 2

As a result, the obtained L- tryptophan concentration was confirmed that the L- tryptophan concentration of transformant CO01-0013 (KCCM 10805P) was increased by 15.2% than in E. coli CJ285 as shown in Table 5.

Strain L-Tryptophan (g / L) CJ285 7.9 CO01-0013 9.1

As described in detail above, it was confirmed that the L-tryptophan production ability can be increased by inactivating nrfE of the L-tryptophan producing microorganism according to the present invention. Specifically, recombinant E. coli CO01-0013 (KCCM 10805P) in which nrfE is inactivated is produced in Escherichia coli CJ285 having L-tryptophan production ability, and its productivity can be increased by producing L-tryptophan at a high concentration. .

Attach sequence list electronic file  

Claims (5)

A microorganism having an ability to produce L-tryptophan, wherein the nrfE gene is inactivated by homologous recombination. The method of claim 1, L-tryptophan producing E. coli, characterized in that the nrfE gene is a gene encoding formate-dependent nitrite reductase involved in the nitrite reduction function (nitrite reduction function). delete The method of claim 1, E. coli L-tryptophan production, characterized in that the nrfE gene is inactivated E. coli CO01-0013 (KCCM 10805P). Method for producing L-tryptophan, characterized in that E. coli of any one of claims 1, 2 and 4.