KR100838036B1 - - - a microorganism producing l-tryptophan having an inactivated yjeo gene and the method for producing l-tryptophan using the same - Google Patents

Abstract

A recombinant microorganism is provided to show increased production efficiency of L-tryptophan by deleting an yjeO gene encoding an inner membrane protein required for synthesizing an inner bio-membrane. An Escherichia coli CA04-0015 is deposited as a deposition no. KCCM 10814P and is characterized in that it has an inactivated yjeO gene having a sequence of SEQ ID : NO. 7. The Escherichia coli having the inactivated yjeO gene is cultured in order to produce L-tryptophan.

Description

L-Tryptophan-producing microorganisms lacking xxxy O genes and L-Tryptophan production method using the same

The present invention relates to a L-tryptophan producing microorganism and a method for producing L-tryptophan using the same. More specifically, the present invention provides a recombinant microorganism having an increased production efficiency of L-tryptophan and L- using the same, by deleting the yjeO gene encoding a protein necessary for synthesizing an inner membrane protein derived from E. coli. It relates to a method for producing tryptophan.

L-Tryptophan is a kind of essential amino acid and has been widely used as a feed additive or a sleep effect or a mental stability effect as a raw material for pharmaceuticals and health foods such as sap. The production method of L-tryptophan includes a chemical synthesis method, an enzyme reaction method and a fermentation method with a microorganism, but in the case of the chemical synthesis method, the conditions of high temperature and high pressure are required, and since the D and L forms are mixed in the product, the purification process is performed. Uneasy. In the case of the enzyme reaction method, for example, in the case of the enzyme reaction method in the Matsui Toatsui patent (Korean Patent Publication No. 90-005773) published in Japan, the price of indole and serine used as a substrate is high. The only problem was that the enzyme was not stable.

On the other hand, the production of L-tryptophan by the conventional microbial fermentation has been made in the nutrient-forming strains and regulatory variants of various microorganisms, such as E. coli and Corynebacterium. Entering the 1980s, it has made great progress in developing excellent recombinant strains using genetic recombination technology, resulting in a high level of productivity improvement. Domestic patents for producing L-tryptophan by direct fermentation using microorganisms include the case of using a mutant strain having L-tryptophan resistance or nutritional requirements (Korean Patent Publication 87-1813, 90-8251, 92-7405) and In case of using a recombinant strain (Korean Patent Publication No. 90-5772, 91-5627). In the case of using these L-tryptophan analogue resistant strains, the main goal was to overcome feedback inhibition by metabolites during tryptophan biosynthesis, and tryptophan productivity / yield through amplification of important enzymes in recombinant strains. The goal was to improve, and in fact it was a remarkable achievement. However, the conventional method for producing L-tryptophan using E. coli artificial mutants has a problem in that L-tryptophan productivity is low. Therefore, the present inventors determined that it is necessary to maximize L-tryptophan productivity through genetic recombination technology.

Accordingly, the present inventors have conducted studies to increase L-tryptophan productivity. As a result, the present inventors have found that L-tryptophan productivity increases by deleting the yjeO gene in Escherichia coli, thereby completing the present invention.

An object of the present invention is to provide a recombinant microorganism capable of producing L-tryptophan lacking the yjeO gene.

Still another object of the present invention is to provide a method of producing L-tryptophan by culturing the recombinant L-tryptophan producing ability.

In order to achieve the above object, the present invention provides a microorganism having a production capacity of L-tryptophan, by increasing the production efficiency of L- tryptophan by deleting the yjeO gene in the microorganism.

Hereinafter, the present invention will be described in detail.

The L-tryptophan producing microorganism usable in the present invention may use microorganisms belonging to Gram negative bacteria, and it is preferable to use microorganisms belonging to the genus Escherichia . More preferably, L-tryptophan-producing E. coli CJ285 (Korean Patent Publication 10-2005-0059685) having a tryptophan hydroxamate resistance, which is a tryptophan analog, may be used.

The yjeO gene (NCBI gene ID: 16131983) (SEQ ID NO: 7) of the present invention encodes a protein necessary for constructing the inner membrane of E. coli, and its exact function is not known yet. However, YjeO protein contains a lot of aromatic amino acid and is not needed in the culture condition to produce tryptophan, so it lacks the yjeO gene encoding this protein to reduce energy waste due to unnecessary protein synthesis. I was.

The microorganism of the present invention can be produced by deleting the yjeO gene present in the chromosome of a microorganism capable of producing L-tryptophan. In this deletion method, mutations can be induced using light or chemicals such as ultraviolet rays, and a strain lacking the gene encoding YjeO can be selected from the obtained mutant. In addition, the deletion method includes a method by DNA recombination technology. In the DNA recombination technique, for example, homologous recombination may occur by injecting a nucleotide sequence or a vector comprising a nucleotide sequence homologous to the gene encoding YjeO to the microorganism. In addition, the injected nucleotide sequence or vector may include a dominant selection marker.

In the method of the present invention, the deleted yjeO gene or DNA fragment thereof comprises a polynucleotide sequence having sequence homology with the yjeO gene in the host, but the nucleotide sequence is a truncation caused by cleavage of a double helix. Such as deletions caused by bases falling off, substitutions caused by one base being replaced by another base, insertions caused by the addition of bases, and insertions caused by insertion of ends inverted to one another. By a mutation is introduced a sequence that cannot express the product encoded by the yjeO gene.

The process of introducing the deleted yjeO gene or fragment thereof into a host cell may be performed, for example, by transformation, conjugation, transduction or electroporation, but these examples It is not limited to.

If the deleted yjeO gene or DNA fragment thereof is introduced into the host cell by transformation, the deletion procedure may be performed by mixing the polynucleotide sequence with the culture of the strain. In this case, the strain may naturally be transformed to be suitable for DNA influx, but it is desirable to make the strain suitable for DNA influx by appropriate methods in advance (LeBlanc et al., Plasmid 28, 130-145). , 1992; Pozzi et al., J. Bacteriol. 178, 6087-6090, 1996). Specifically, strains cultured in LB medium until the beginning of the logarithmic phase are washed with purified water and 10% glycerol, and the strains are concentrated to a high concentration to make them suitable for DNA inflow. For the homologous recombination fragment of yjeO gene and removing or introducing a foreign DNA fragment to yjeO gene portion in the genomic DNA, thus replacing the wild-type chromosomal copy of the sequence to the defect state.

The present invention is also yjeO To provide a method for culturing a microorganism lacking the gene and using it to produce L-tryptophan in high yield.

In the method for producing L-tryptophan of the present invention, the culturing process of the microorganism may be made according to suitable media and culture conditions known in the art. This culture process can be used by those skilled in the art can be easily adjusted according to the strain selected.

Examples of the culture method include, but are not limited to, batch, continuous and fed-batch cultures. Such various culture methods are disclosed, for example, in "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pp 138-176).

The medium used for the cultivation should suitably meet the requirements of the particular strain. The medium contains various carbon sources, nitrogen sources and trace element components. Examples of carbon sources that can be used include glucose, sucrose, lactose, fructose, maltose, carbohydrates such as starch and cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, fatty acids such as palmitic acid, stearic acid and linoleic acid, Alcohols such as glycerol and ethanol and organic acids such as acetic acid. These carbon sources may be used alone or in combination. Examples of nitrogen sources that can be used include organic nitrogen sources and urea such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL) and soybean wheat, inorganics such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate Nitrogen sources are included. These nitrogen sources may be used alone or in combination. The medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and the corresponding sodium-containing salts as a person. It may also include metal salts such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins, appropriate precursors, and the like can be included. These media or precursors may be added batchwise or continuously to the culture.

In addition, during the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during the culture, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation. In addition, to maintain the aerobic state of the culture, oxygen or oxygen-containing gas (eg, air) is injected into the culture. The temperature of the culture is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. The incubation period can continue until the desired amount of L-tryptophan production is obtained, preferably 10 to 160 hours.

Isolation of L-tryptophan from the culture can be separated by conventional methods known in the art. In such a separation method, methods such as centrifugation, filtration, ion exchange chromatography, and crystallization may be used. For example, the supernatant obtained by removing the biomass by centrifugation of the culture at low speed can be separated by ion exchange chromatography.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example  One : yjeO end Missing  Construction of Recombinant L-Tryptophan Production Strains

In this example, the yjeO gene was deleted by homologous recombination in E. coli.

The yjeO gene (NCBI gene ID: 16131983) (SEQ ID NO: 7) is known to encode the proteins necessary to make up the inner membrane of Escherichia coli, and is not expected to be necessary in culture conditions producing L-tryptophan. In order to reduce the waste of energy due to the synthesis of unnecessary protein was selected as a target gene for deletion.

One-step inactivation of chromosomal genes in Escherichia coli K- was used to develop a mutation using lambda red recombinase developed by Datsenko KA. 12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci US A. 2000 Jun 6; 97 (12): 6640-5). As a marker for confirming the insertion into the gene, chloramphenicol gene of pKD3 was used.

In order to obtain a DNA fragment containing a part of the above yjeO gene and having a chloramphenicol resistance gene in the middle, a polymerase chain was carried out using a pKD3 plasmid as a template using a PCR HL premix kit (PCR HL premix kit, manufactured by BIONEER). A polymerase chain reaction (hereinafter referred to as PCR) was performed by Sambrook et al., Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories. The primers used were primer 1 and primer 2 of Table 1 having a part of the yjeO gene and some nucleotide sequences of the chloramphenicol resistance gene of pKD3 gene, and the conditions were denaturation 94 ° C. 30 sec, annealing 55 ° C. 30 seconds, 30 minutes of stretching (polymerization) 1 minute was performed. The PCR product was obtained by eluting a band (about 1100 base pairs) of a desired size after electrophoresis on a 0.8% agarose gel.

Primer 1 5'- tgcgcgcatgtttgtcttatgctgcatctggtttattgtggcgttcctctgtgtaggctggagctgcttc -3 '(SEQ ID NO: 1) Primer 2 5'- atagcgcagaaaaaactgccacagccagtagccgaaaatagccagcgcggcatatgaatatcctccttag -3 '(SEQ ID NO: 2)

In addition, E. coli yjeO In order to obtain a 5 'DNA fragment of the gene, PCR was performed using a chromosome of E. coli W3110 as a template using a PCR HL premix kit (manufactured by BIONEER). The primers used at this time were the primers 3 and 4 in Table 2, and the conditions were repeated 30 times of denaturation 94 ℃ 30 seconds, annealing 55 ℃ 30 seconds, elongation 72 ℃ 30 seconds. This PCR result was obtained by eluting a band (approximately 500 base pairs) of desired size after electrophoresis on 0.8% agarose gel.

Primer 3 5'- cagccgggacccggcaataacc -3 '(SEQ ID NO: 3) Primer 4 5'- agaggaacgccacaataaacca -3 '(SEQ ID NO: 4)

In addition, E. coli yjeO To obtain a 3 'DNA fragment of the gene, PCR was performed using the PCR HL premix kit with the chromosome of E. coli W3110 as a template. At this time, the primers used were primers 5 and 6 in Table 3, and the conditions were repeated 30 times for denatured 94 ° C 30 seconds, annealing 55 ° C 30 seconds, and extension 72 ° C 30 seconds. This PCR result was obtained by eluting a band (approximately 500 base pairs) of desired size after electrophoresis on 0.8% agarose gel.

Primer 5 5'- ccgcgctggctattttcggcta -3 '(SEQ ID NO: 5) Primer 6 5'- acccggcaccggaagtcttcct -3 '(SEQ ID NO: 6)

Here, since the 20 pairs of base sequences of Primer 1 and Primer 4 are complementary, and the 20 pairs of base sequences of Primer 2 and Primer 5 are complementary, fragments obtained using Primers 1 and 2, Primer 3 , Fragments obtained with 4, fragments obtained with primers 5, 6 can be linked into one fragment. Each of the obtained PCR fragments was amplified five times by PCR using a PCR HL premix kit without a primer, and then amplified again by PCR 25 times after adding primers 3 and 6. The PCR conditions used at this time were repeatedly performed at 94 DEG C for 30 seconds, annealing 55 DEG C for 30 seconds, and 72 DEG C for 1 minute. This PCR result was obtained by eluting a band (approximately 1600 base pairs) of desired size after electrophoresis on 0.8% agarose gel.

According to the method developed by Datsenko KA, et al., The production of L-tryptophan-producing E. coli CJ285 (Korean Patent Publication No. 10-2005-0059685) transformed with pKD46 was carried out in a competent state, and then a gene fragment of 2100 base pair size obtained by PCR was transformed. Switched. The solid medium containing chloramphenicol (15 mg / L) was plated and incubated overnight at 30 ° C. The obtained colony was confirmed to have been deficient in yjeO by PCR (2100 base pairs). The primers used at this time were primers 3 and 6, and the conditions were repeatedly performed for 30 minutes of denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, and extension at 72 ° C for 2 minutes. The resulting recombinant strain was named Escherichia coli CA04-0015 and was entrusted to the Korea Microbial Conservation Center, an international depository organization located at 361-221 Hongje 1-dong, Seodaemun-gu, Seoul, Korea, dated December 8, 2006. Deposited as number KCCM 10814P.

Example  2 : yjeO end Missing  L-Tryptophan of Recombinant Microorganisms Productivity  compare

In the present embodiment, the colonies of the recombinant strain CA04-0015 (KCCM 10814P) prepared in Example 1 were prepared using LB (Lurina-Bertani. Composition: bacto tryptone 10 g / l, bacto yeast extract 5 g / l, sodium chloride using platinum teeth. 10 g / l) After incubation overnight in solid medium, the grown strains were inoculated one platinum into the flask titer medium having the composition shown in Table 4. After strain inoculation, the cells were incubated at 37 ° C. and 200 rpm for 48 hours, and the tryptophan concentration obtained therefrom was compared with the tryptophan concentration obtained in CJ285. The obtained L-tryptophan concentration used the average value of three flask results.

Furtherance Concentration (g / L) Glucose 60 Yeast extract 2.5 Ammonium Sulfate ((NH ₄ ) ₂ SO ₄ ) 10 Magnesium sulfate (MgSO _{4 ·} H ₂ 0) One Sodium citrate 5 Sodium Chloride (NaCl) One Tyrosine (L-tyrosine) 0.1 Phenylalanine (L-phenylalanine) 0.15 Calcium Carbonate (CaCO ₃ ) 40 Potassium Dihydrogenphosphate (K ₂ HPO ₄ ) One

As a result, the obtained L- tryptophan concentration was confirmed that the L- tryptophan concentration of transformant CA04-0015 (KCCM 10814P) 12.7% increased than in E. coli CJ285 as shown in Table 5 below.

Strain L-Tryptophan (g / L) CJ285 7.9 CJ 8.9

As described in detail above, yjeO of L-tryptophan according to the present invention It was confirmed that the deletion of the gene can increase the ability to produce L-tryptophan. Specifically yjeO in E. coli CJ285 with L- tryptophan-producing ability E. coli CA04-0015 (KCCM 10814P) lacking a gene may be prepared, and its culture may be increased to produce high concentrations of L-tryptophan through its culture.

Attach sequence list electronic file  

Claims (5)

E. coli, characterized in that the yjeO gene having a nucleotide sequence of SEQ ID NO: 7 is missing. delete delete The method of claim 1, Escherichia coli, wherein the yjeO gene is deleted, E. coli CA04-0015 (KCCM 10814P). Method for producing L-tryptophan, characterized in that the E. coli of claim 1 or 4.