EP1112359A2 - Expression fonctionnelle amelioree des recepteurs couples a la proteine g - Google Patents

Expression fonctionnelle amelioree des recepteurs couples a la proteine g

Info

Publication number
EP1112359A2
EP1112359A2 EP99944033A EP99944033A EP1112359A2 EP 1112359 A2 EP1112359 A2 EP 1112359A2 EP 99944033 A EP99944033 A EP 99944033A EP 99944033 A EP99944033 A EP 99944033A EP 1112359 A2 EP1112359 A2 EP 1112359A2
Authority
EP
European Patent Office
Prior art keywords
protein
host cell
receptor
heterologous
cell according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99944033A
Other languages
German (de)
English (en)
Inventor
Mark Henry Pausch
Margaret American Cyanamid Company LAI
Sanford American Cyanamid Company SILVERMAN
Camelia American Cyanamid Company BIRSAN
William American Cyanamid Company BAUMBACH
Eugene American Cyanamid Company TSENG
Eileen Marie Kajkowski
Bradley Alton Ozenberger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1112359A2 publication Critical patent/EP1112359A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722G-proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • This invention relates to mutant G protein-coupled receptors with constitutively activating mutations that permit detection of the receptors' functional activity in the absence of activating ligands, host cells that contain mutations that promote the functional activity of the G protein-coupled receptors, host cells expressing such receptors, vectors useful for making such cells and methods of making and using the same.
  • This invention also relates to modified G alpha proteins, and particularly to chimeric yeast-mammalian G alpha proteins, host cells expressing these modified G alpha proteins, vectors for making such cells and methods of making and using the same.
  • G protein-coupled receptors G protein-coupled receptors
  • the regulatory G proteins are comprised of three subunits: a guanylnucleotide binding ⁇ subunit; a ⁇ subunit; and a ⁇ subunit.
  • G proteins cycle between two forms, depending on whether GDP or GTP is bound to the a subunit. When GDP is bound, the G protein exists as a heterotrimer, the G ⁇ complex. When GTP is bound, the ⁇ subunit dissociates, leaving a G ⁇ complex.
  • G ⁇ complex operatively associates with an activated G protein coupled receptor in a cell membrane
  • rate of exchange of GTP for bound GDP is increased and, hence, the rate of disassociation of the bound G ⁇ subunit from the G ⁇ complex increases.
  • the free G ⁇ subunit and G ⁇ complex are capable of transmitting a signal to downstream elements of a variety of signal transduction pathways. Examples of these downstream cellular effector proteins include, among others, adenylate cyclases, ion channels, and phospholipases. This fundamental scheme of events forms the basis for a multiplicity of different cell signaling phenomena. H.G. Dohlman et al. (1991).
  • HTS high-throughput screening
  • G protein- coupled receptors In these screening assays depend on functional expression of the G protein- coupled receptors in the desired host cell. Functional expression of wild type G protein-coupled receptors was developed in a Saccharomyces cerevisiae cell system based on the observation that yeast utilizes G protein-coupled receptors and heterotrimeric G proteins to regulate the mating process. M. Pausch (1997). Haploid yeast cells detect the presence of peptide mating pheromones secreted by potential mating partners through binding to G protein-coupled pheromone receptors encoded by the STE2 and STE3 genes.
  • Activated pheromone receptors catalyze dissociation of a heterotrimeric G protein, encoded by the GPA1 (a), STE4 ( ⁇ ), and STE18 ( ⁇ ) genes. Gpalp-mediated negative regulation is thereby relieved, allowing the complex of Ste4p and Stel ⁇ p to activate a signal transduction pathway composed elements of a mitogen activated protein kinase (MAP kinase) pathway.
  • MAP kinase mitogen activated protein kinase
  • the pathway is composed of MAP kinase homologs encoded by the FUS3 and KSS1 genes, and upstream regulatory protein kinases encoded by the STE7, (MAP kinase kinase or MEK) and STE11 (MEK kinase) genes.
  • MAP kinase kinase or MEK upstream regulatory protein kinases encoded by the STE7, (MAP kinase kinase or MEK) and STE11 (MEK kinase) genes.
  • the result of activation of this pathway is cell cycle arrest and transcriptional induction of pheromone-responsive genes. Mutations in elements of the MAP kinase pathway abolish these responses.
  • the product of the FARl gene mediates cell cycle arrest in response to pheromone.
  • FARl encodes a negative regulator of Gl cyclins and is thought to serve as the primary interface between the pheromone response pathway and cell cycle regulatory machinery.
  • Detecting the yeast cells that respond to agonist requires an additional modification, the addition of pheromone responsive reporter genes.
  • the protein-coding segment of the HIS3 gene which encodes an enzyme required for histidine biosynthesis, was used to replace the FUS1 protein- coding region.
  • expression of this enzyme necessary for growth on medium lacking histidine is made dependent on activation of the pheromone response pathway.
  • Agonist activation of this FUS1-HIS3 reporter gene in his3 cells would be expected to produce a growth response on medium lacking in histidine.
  • the FUS1-HIS3 reporter gene In the absence of agonist activation, the FUS1-HIS3 reporter gene is largely inactive, little His3 gene product is produced, the cells make insufficient histidine and therefore cannot grow.
  • a reporter gene that confers inducible G418 resistance may be included.
  • Other reporter genes functional in this system include E. coli LacZ, which encodes beta- galactosidase, and green fluorescence protein. Direct screening for antagonists may be accomplished using the stably integrated FUS2-CAN1 reporter gene.
  • GPCRs transformed with wild-type receptors may perform poorly in growth assays, exhibiting, for example, the inability to interact with the heterotrimeric G protein, inappropriate localization and/or desensitization.
  • Many GPCRs are phosphorylated in response to chronic and persistent agonist stimulation which often leads to desensitization followed by sequestration or internalization of the receptors.
  • Desensitization of GPCRs causes uncoupling from interaction with heterotrimeric G proteins. This process is mediated by a variety of regulatory receptor protein kinases, including G protein-coupled receptor kinases (GRK), protein kinase A (PKA), protein kinase C (PKC), and casein kinases (CK).
  • GRK G protein-coupled receptor kinases
  • PKA protein kinase A
  • PKC protein kinase C
  • CK casein kinases
  • Internalized receptors may be recycled back to the cell surface, or delivered to a lysosomal/vacuolar compartment for degradation.
  • the ubiquitin-mediated degradative pathway is also involved in this process.
  • the ultimate result of receptor phosphorylation and sequestration/internalization is often cell growth arrest, which significantly reduces the utility of the genetically modified microorganism in screening assays.
  • the ability of the GPCR to functionally interact with the intracellular heterotrimeric G proteins is determined via activation of the GPCR with its cognate agonist and subsequent measurement of resulting G protein-mediated activation of effector enzyme activity. Successful activation of effector activity validates the screening assay, permitting the drug discovery scientist to have confidence that the GPCR is appropriately expressed and functional.
  • the difficulty with the orphan GPCR lies in the fact that, since no cognate agonist is known for the orphan GPCR, its expression and functional activity cannot be verified.
  • a first aspect of the present invention is directed to nucleotide sequences encoding a G protein-coupled receptor which has been modified to improve the function of the GPCR by causing the receptor to couple more efficiently with the heterotrimeric G protein and/or to fail to interact with the cell desensitization and/or sequestration/internalization machinery, and/or to appropriately localize to the plasma membrane.
  • modifications lead to improved agonist-stimulated growth-promoting ability.
  • nucleotide sequence encoding a G protein-coupled receptor encompassed by this invention is a mutation in any intracellular domain or membrane region proximal to internal domains. It is a another object of this invention to provide modified orphan G protein- coupled receptors that can function in high throughput screening assays even though its specific cognate ligand in unknown.
  • the nucleotide sequence encoding a GPCR encompassed by this invention encodes a modification of the amino acids involved in receptor activation resulting in production of a constitutively active GPCR. Such mutations may occur throughout the GPCR sequence.
  • mutations in regions proximal to and within the second and third intracellular loops and within the transmembrane domains are particularly interesting.
  • One specific modification is a mutation in a conserved motif found in rhodopsin family GPCRs that is involved in GPCR activation and known as the DRY box, i.e., the domain proximal to the second intracellular loop encoding amino acid residues Asp- Arg-Tyr.
  • This invention is also directed to chimeric GPCRs in which intracellular domains of heterologous GPCRs that provide favorable G protein coupling properties or domains not subject to the yeast cell desensitization and/or sequestration/internalization machinery are used to replace comparable domains in GPCRs of interest.
  • This invention also relates to expression vectors comprising the modified nucleotide sequences and to host cells transformed therewith.
  • host cells such as yeast cells
  • One such modification of the host cells according to this invention involves a mutation that affects the ratio or nature of sterols in the membrane.
  • Other examples of modifications to host cells according to this invention include (1) mutations in host cell genes encoding the heterotrimeric G protein that improve coupling with heterologous GPCRs; (2) mutation of genes encoding regulatory receptor protein kinases, including G protein-coupled receptor kinases, protein kinase A, protein kinase C and/or casein kinases, that cause a reduction in receptor phosphorylation; and (3) mutations in genes encoding components of the endocytic and/or degradative pathways including ubiquitin mediated pathways that reduce receptor sequestration/internalization and/or degradation. The result of these mutations is a host cell that exhibits improved capacity to support functional expression of heterologous GPCRs.
  • One preferred chimeric G protein is composed of sequences from Gpal, the yeast G alpha protein, in which the five carboxy-terminal amino acids have been replaced with those from various heterologous G protein alpha subunits, including those from mammals and other vertebrate species, insects and other invertebrate species, and various fungal species.
  • Other examples include chimeric G protein alpha subunits composed of an amino-terminal G protein beta and gamma subunit binding domain from Gpal fused to carboxy-terminal receptor binding domains from heterologous G alpha proteins.
  • Additional aspects of this invention include methods of functionally expressing an orphan GPCR in a host cell with activation by agonist.
  • Constitutively active GPCRs can promote growth in the absence of agonist, thus, demonstrating that they are functionally expressed.
  • Functional expression may be further enhanced by expressing constitutively active GPCRs in host cells that contain a chimeric G alpha protein, thereby improving GPCR-G alpha protein coupling selectivity.
  • positive results from both types of experiments provide convincing evidence that a GPCR may be functionally expressed in a host cell. With this evidence in hand, HTS assays using the wild type GPCR may be pursued with confidence that the GPCR is functionally expressed and capable of responding to the presence of ligands.
  • host cells containing expressed constitutive GPCRs may be used in an improved method of assaying compounds to determine the effects of ligand binding.
  • Compounds that promote growth over that attributable to the action of the constitutive GPCR may be agonists, those that inhibit growth may be antagonists or inverse agonists.
  • FIGURE 1A depicts the results of liquid culture assays on yeast cells containing the rat M3 muscarinic acetylcholine receptor (MAR) using MAR agonist carbachol (CCh).
  • MAR muscarinic acetylcholine receptor
  • CCh third intracellular loop
  • FIGURE IB depicts the results of liquid culture fluorescence induction assays on yeast cells containing the rat M3 MAR IC3 ⁇ and the FUS2-GFP reporter plasmid using the MAR agonist carbachol (CCh).
  • a dose-dependent increase in the expression of the green fluorescent protein is observed in response to CCh activation of the M3 MAR IC3 ⁇ expressed in yeast.
  • FIGURE 2 depicts the results of liquid culture assays on yeast cells containing the Drosophila muscarinic acetylcholine receptor using the MAR agonist carbachol (CCh).
  • yeast cells containing a mutated Drosophila MAR containing the M3 MAR IC3 ⁇ produced an agonist-dependent growth response while the wild type Drosophila MAR lacked an agonist-dependent yeast cell growth response.
  • FIGURE 3 depicts the results of an agar-based plate bioassay.
  • FIGURE 3 A shows a robust growth response of yeast cells containing the IC3 ⁇ cholecystokinin CCKB receptor.
  • FIGURE 3B shows only limited growth by yeast cells containing the wild type CCKB receptor, indicating that the deletion of a portion of the third intracellular loop of the CCKB receptor improves its function in yeast.
  • FIGURE 4 depicts yeast cells transformed with rSSTR3 and with rSSTR3 ⁇ IC3.
  • FIGURE 4 A demonstrates that yeast cells containing p426GPD- rSSTR3 show a weak response to somatostatin (S-14).
  • FIGURE 4B demonstrates a much stronger response by yeast cells containing p426GPD-rSSTR3 ⁇ IC3 assayed under similar conditions.
  • FIGURE 5 depicts the results of liquid culture assays on yeast cells containing wild type IC3 ⁇ and a constitutively active mutant (CAM) IC3 ⁇ human alpha2A adrenergic receptor using the alpha adrenergic receptor full agonist UK14304.
  • Yeast cells containing the wild type and CAM IC3 ⁇ human alpha 2A adrenergic receptor produced a dose-dependent growth response, indicating that the
  • IC3 deletion is functional.
  • FIGURE 6A depicts the results of liquid culture assays on yeast cells containing wild type IC3 ⁇ and a constitutively active mutant (CAM) IC3 ⁇ human alpha2A adrenergic receptor using the alpha adrenergic receptor full agonist UK 14304 in the presence of AT (3-aminotriazole).
  • FIGURE 6B depicts the results of liquid culture assays on yeast cells containing wild type IC3 ⁇ and a constitutively active mutant (CAM) IC3 ⁇ human alpha2A adrenergic receptor using the alpha adrenergic receptor partial agonist clonidine in the presence of AT.
  • CAM constitutively active mutant
  • FIGURE 7 depicts the results of an agar-based plate bioassay on yeast cells containing modified (CAM) M3-MAR compared to unmodified M3-MAR in the presence of MAR agonist, carbachol, and inverse agonist, atropine.
  • FIGURE 7A shows that the CAM M3-MAR promotes an elevated yeast growth rate in the absence of agonist and a reversal of agonist-independent growth in the presence of inverse agonist, atropine.
  • FIGURE 7B shows that atropine had no effect on the basal growth of the CAM M3-MAR in the presence of histidine.
  • FIGURE 8 depicts the results of liquid culture assays on yeast cells containing wildtype and carboxy terminally truncated rat NTl-neurotensin receptors using the neurotensin receptor agonist AcNT8-13. Truncation of the rat NT1- neurotensin receptor produces an agonist-dependent growth response that is more sensitive than that observed with the wildtype receptor.
  • FIGURE 9 depicts yeast cells containing the vasopressin receptor plasmids, embedded in agar in the absence (left) and presence (right) of 1 mM aminotriazole.
  • FIGURE 9A depicts strain MPY578fc (ERG6) transformed with V2 receptor.
  • FIGURE 9B depicts strain YML103 (ergo) transformed with V2 receptor.
  • FIGURE 9A depicts strain MPY578fc (ERG6) transformed with V2 receptor.
  • FIGURE 9B depicts strain YML103 (ergo) transformed with V2 receptor.
  • FIGURE 9C depicts strain MPY578fc (ERG6) transformed with Via receptor.
  • FIGURE 9D depicts strain YML103 (ergo) transformed with Via receptor.
  • FIGURE 10 depicts yeast cells containing receptor plasmids, embedded in agar in the absence (left) and presence (right) of 1 mM aminotriazole.
  • FIGURE 10A depicts strain MPY578fc (ERG6) transformed with melanocortin MC4 receptor.
  • FIGURE 10B depicts strain YML103 (erg ⁇ ) transformed with melanocortin MC4 receptor. These results demonstrate that the changes in membrane properties caused by the ergo mutation results in improved responses by vasopressin V2, and Via receptors, and melanocortin MC4 receptors.
  • FIGURE 11 depicts the results of experiments in which heterologous GPCRs have been assayed in yeast strains bearing the chimeric G alpha proteins. For each indicated GPCR, + indicates that a dose-dependent growth response to cognate agonist was observed when assayed in the liquid format; - indicates no detectable agonist dose-dependent growth response. These results demonstrate the functional activity of chimeric G proteins coupled to heterologous GPCRs expressed in yeast.
  • FIGURE 12 depicts the agonist-independent growth response to high and low level adenosine A2a receptor expression in yeast cells containing various chimeric G alpha proteins.
  • adenosine A2a receptors When expressed at high levels, adenosine A2a receptors promote growth of only a subset of yeast cells containing chimeric G proteins, indicating that this receptor retains G alpha protein coupling selectivity when expressed in yeast cells.
  • the growth promoting activity is greatest when the adenosine A2a receptor is expressed at high levels and less when adenosine A2a receptor expression is reduced.
  • Nucleotide sequences encoding G protein-coupled receptors may be modified to improve the function of the GPCR by causing the receptor to couple more efficiently with the heterotrimeric G protein and/or to fail to interact with the cell desensitization and/or sequestration/internalization machinery, leading to activation of downstream signal transduction pathways.
  • these pathways may include the stimulation or inhibition of adenylyl cyclase leading to changes in intracellular cyclic AMP concentrations, stimulation of phospholipase C ⁇ , leading to increases in intracellular inositol trisphosphate and/or calcium ion concentrations as well as changes in the activities of G protein regulated potassium and calcium channels, sodium/hydrogen exchangers and other membrane localized signaling proteins.
  • such modifications lead to improved agonist- stimulated yeast cell growth-promoting ability.
  • the improvement of GPCR-G protein coupling and/or elimination of receptor phosphorylation and/or sequestration/internalization in the host cell provides a means to improve the function of wildtype heterologous GPCRs that fail to stimulate a useful yeast cell growth response.
  • GPCRs that fail to function in their wild type form may be made to work by the methods of this invention.
  • the improvement of GPCR-G protein coupling and or elimination of receptor phosporylation and/or sequestration/internalization in the host cell may be assessed by using routine techniques, such as those described in the Examples set forth below or known to those of skill in the art.
  • improvement of the function of a mutated GPCR over wildtype may be quantified as a statistically significant increase in the signal-to-noise ratio and/or in the sensitivity of the liquid bioassay.
  • the signal-to-noise ratio is determined by comparing the agonist-induced growth rate to the growth rate observed in the absence of agonist.
  • a statistically-significant increase in the signal-to-noise ratio resulting from agonist-stimulation of a mutated GPCR over similar values obtained from cells containing a wildtype receptor indicates that the function of the mutated GPCR has been improved.
  • the sensitivity of the liquid bioassay is defined as the agonist concentration necessary to produce a half-maximal growth rate (ED50 or EC50).
  • the sensitivity of the bioassay is increased if a mutated GPCR produces a half-maximal growth rate at an agonist concentration that is statistically significantly less than that required by the wildtype GPCR.
  • the more qualitative agar based bioassay will reflect increases in signal-to-noise ratio and/or sensitivity due to agonist stimulation of mutated GPCRs.
  • signal-to-noise ratio increases are determined by comparing the extent of growth within the agonist induced growth zone resulting from stimulation of mutated and wildtype receptor.
  • the sensitivity of the bioassay is proportional to the radius of the growth zone. Since applied compounds diffuse radially from the site of application to the agar, agonist concentration varies with the square of the radius of the growth zone. Thus, a larger zone of growth in response to agonist activation of mutated GPCRs reflects an increase in sensitivity.
  • any G protein-coupled receptor may be employed in practicing this invention.
  • Examples of such receptors include, but are not limited to, adenosine receptors, somatostatin receptors, dopamine receptors, cholecystokinin receptors, muscarinic cholinergic receptors, ⁇ -adrenergic receptors, ⁇ -adrenergic receptors, opiate receptors, cannabinoid receptors, histamine receptors, growth hormone releasing factor, glucagon, serotonin receptors, vasopressin receptors, melanocortin receptors, and neurotensin receptors.
  • the receptor is a muscarinic acetylcholine receptor and more preferably, the muscarinic acetylcholine receptor is of the M3 subtype.
  • any suitable host cell may be transformed with the modified G protein-coupled receptors of this invention.
  • suitable host cells are yeast cells, mammalian cells, insect cells, and bacterial cells.
  • the host cells are yeast cells, mammalian cells, or insect cells.
  • One generalizable method for improving the function of a GPCR expressed in a host cell is by modification or elimination of portions of the intracellular domains of the GPCR, such as the third intracellular loop (IC3) sequences of the G protein- coupled receptor.
  • IC3 intracellular loop
  • the desensitization and internalization machinery acts upon the intracellular domains of the GPCR, elimination of the intracellular domains of the GPCRs produces a more stable receptor expression. This has been demonstrated in experiments conducted in mammalian cells. Muscarinic acetylcholine receptors, including the M3 subtype, lacking a domain of their third intracellular loop thought to be involved in receptor internalization, are maintained in the plasma membrane to a greater extent than their wildtype counterparts. Mow et al. (1993).
  • this invention also provides modified orphan GPCRs whose functional activity can be verified even though its cognate ligand is unknown.
  • Investigation into the mechanism of GPCR activation has lead to the proposal of a ternary model which accounts for the cooperative interactions between GPCR, G proteins and ligands. Gether andB.K. Kobilka (1998).
  • the unliganded GPCR may find itself in a unique state, R, that can undergo transition to at least two other equilibrium states: R*, an active state which is stabilized by agonists, and R°, an inactive state which is stabilized by inverse agonists.
  • the active state is the form that is capable of stimulating heterotrimeric G proteins and subsequent effector enzyme activity.
  • GPCRs in the R state find themselves in equilibrium between other states and therefore may undergo spontaneous transition to either R* or R° states in the absence of ligand.
  • Experimental analysis of GPCR activation has led to the discovery of constitutively active GPCR mutants (CAMs).
  • the CAM GPCRs have elevated intrinsic activity compared to wild type receptors consistent with a shift in the R to R* equilibrium towards R*, resulting in a CAM GPCR that is far more active in the absence of agonist than wild type. This permits the CAM GPCRs to interact with and activate intracellular heterotrimeric G proteins in an agonist-independent manner.
  • Effector enzymes activated downstream can be used as an indirect measure of the intrinsic activity of the GPCR.
  • the CAM GPCRs may be shown to be functional without resort to activation using cognate agonists.
  • Due to the equilibrium nature of the R* state of the CAM GPCRs, inverse agonists are capable of reversing the activation and stabilizing the R° state, effectively inactivating the CAM GPCR.
  • Neutral antagonists, drugs that block the binding of agonists and inverse agonists without affecting the level of constitutive activity of GPCR have no effect on the activation state of the receptor.
  • Several distinct domains of GPCRs play a role in the activation process. U.
  • the third intracellular loop also plays a role in GPCR activation. Leflowitz et al (1993). Mutations in the C-terminal portion of this domain have the effect of producing CAMs. Site-directed mutations in both the alphala adrenergic receptor and alpha2a adrenergic receptor in the third intracellular loop have the effect of producing constitutive activity, perhaps due to release of constraints on activation that are maintained in this domain. Accordingly, this invention encompasses GPCRs that have been modified to produce constitutive activity. Preferred modifications are made to the DRY box or the third intracellular loop of the GPCR and result in a constitutively active receptor. The membrane spanning helices also play a crucial role in ligand binding and activation of GPCRs.
  • Additional amino acid residues within the third transmembrane domain may be mutated to cause constitutive activity.
  • mutations in two conserved amino acids in the third transmembrane helix of the C5a receptor cause constitutive activity. Baranski et al. (1999).
  • the mutations exchanged the hydrophobic amino acids residues for those with hydrophilic character (1124 N, L127Q). Since hydrophobic character is conserved in similar positions in most GPCRs, modification of these residues to those with hydrophilic properties may be a generalized method for activating GPCRs.
  • Mutations in the sixth transmembrane domain have also been demonstrated to cause constitutive activity.
  • systematic mutagenesis of the sixth transmembrane domain has revealed a hot spot for constitutive mutations. Spalding et al, (1998).
  • a cluster of amino acid residues that line one face of the sixth transmembrane domain appear to be involved in the formation of a ligand-dependent switch involved in GPCR activation. Identification of this hot spot suggests that mutagenesis of other receptors in the sixth transmembrane domain may lead to generalized method for activating GPCRs.
  • mutations in receptors that affect ubiquitin-mediated or ubiquitin- independent degradation would be desirable for increasing signaling. More specifically, mutations analogous to those in STE2 or S7E5 which alter P ⁇ ST degradation signals would be most useful.
  • Modified Host Cells This invention also encompasses modifications to a host cell by mutation of host cell genes or manipulation of the host cell environment in such a way as to allow G protein-coupled receptors to be expressed more efficiently.
  • suitable host cells include yeast cells, mammalian cells, insect cells, and bacterial cells.
  • Cholesterol in mammalian membranes can modulate the function of G-protein coupled receptors by at least two mechanisms: changes in membrane fluidity and/or specific receptor-sterol interactions.
  • G. Gimpl et al (1997). More specifically, it is known that receptor- mediated endocytosis is a major mechanism for recycling of G protein-coupled receptors, leading to desensitization to the continued presence of ligand.
  • yeast yeast
  • Saccharomyces cerevisiae mutations in the erg6 gene, which alter the nature of membrane sterols, suppress defects in endoplasmic reticulum-golgi sorting. K.G. Hardwick and H.R.B. Pelham (1994). Finally, yeast sterol mutants are reported to be defective in endocytosis and mating efficiency. H. Riezman et al. (1997); R. Gaber et al. (1989). Changes in the ratio or nature of sterols in host cell membranes may be affected in several ways and are within the scope of the invention. As noted above, one such mechanism to affect this change in sterol ratio is by mutation of host cell genes. Alternatively, changes in the environment may also alter the nature of ratio of sterol in the plasma membrane to permit the G protein-coupled receptors to be expressed more efficiently and are encompassed within the ambit of this invention.
  • suitable host cell modifications include, but are not limited to: (1) using other sterol yeast mutants, such as erg2, erg3, erg4, and erg5, resulting in cells with different sterol alterations that can affect GPCR signaling; and (2) using a mutant of yeast, allowing the cells to grow in the presence of exogenously added sterols.
  • alterations in the SUT1, PDX3, UPC1, or (UPC2 (UPC20) genes will provide useful mutants that allow the host cells to grow in the presence of exogenously added sterols.
  • any heme (hem) mutant can be used, particularly he ml and hem3 mutants will allow the host cells to grow in the presence of exogenously added sterols.
  • Suitable exogenously added sterols include, but are not limited to, cholesterol, and are added to the medium in which the cells are growing.
  • the cells incorporate such sterols into their membranes and in the same manner as described in the examples below, heterologously expressed GPCR signal transduction is assayed in these cells.
  • modifications to host cells include mutations in host cell genes encoding the heterotrimeric G protein that improve coupling with heterologous GPCRs; mutation of genes encoding regulatory receptor protein kinases, including G protein-coupled receptor kinases, protein kinase A, protein kinase C and/or casein kinases, that cause a reduction in receptor phosphorylation; and mutations in genes encoding components of the endocytic and/or degradative pathways including ubiquitin mediated pathways that reduce receptor sequestration/internalization and/or degradation.
  • regulatory receptor protein kinases including G protein-coupled receptor kinases, protein kinase A, protein kinase C and/or casein kinases, that cause a reduction in receptor phosphorylation
  • mutations in genes encoding components of the endocytic and/or degradative pathways including ubiquitin mediated pathways that reduce receptor sequestration/internalization and/or degradation.
  • conditional, or gain-of-function, or loss-of-function mutations in many genes can lead to increased signaling through the pheromone pathway.
  • Such mutations affect endocytosis either directly or indirectly by affecting sorting of endosomic vesicles that may contain recycling receptors.
  • This invention also encompasses chimeric G alpha proteins that improve the coupling efficiency between G proteins and G protein-coupled receptors and, therefore, can be used to enhance the functional expression of G protein-coupled receptors in a host cell.
  • the chimeric G alpha protein is a yeast-mammalian G alpha protein encoded by a modified GPAl allele.
  • the types of G proteins to which a GPCR couples determines the effector output in response to agonist activation.
  • Present methods for determination of the G protein coupling specificity of GPCRs are laborious and time-consuming since they require construction of multiple mammalian cell lines and assays of several effector protein activities.
  • the present invention simplifies and accelerates the process of determining GPCR G protein coupling specificity by using host cells that express a single chimeric G alpha protein. These host cells can be constructed by integrative replacement of a chromosomal locus, such as the GPAl locus in yeast, which encodes a G alpha protein.
  • the object of the integrative replacement is to create a chimeric gene that encodes a G alpha protein in which the endogenous amino-terminal G ⁇ and effector molecule interaction domain is fused to a carboxy terminal GPCR interaction domain encoded by DNA sequences from a mammalian G alpha subunit gene.
  • the chimeric genes are preferably integrated into the GPAl locus.
  • GPAl mRNA and protein levels are determined by the degree of activation of the mating signal transduction pathway. G.F. Sprague et al. (1992), C. Dietzel et al. (1997), I. Miyajima et al. (1987), M. Nakafuku et al. (1987). In the absence of pheromone activation, the GPAl allele maintains a low basal level of expression. Upon activation of the pathway, GPAl mRNA and protein levels increase several fold leading to an immediate increase in sensitivity of the response. Further increases in Gpal levels in excess of that necessary to interact with the G ⁇ subunits of the heterotrimeric complex, lead to down-regulation of the pathway.
  • the chimeric GPAl genes according to the present invention may contain a sequence that codes for the amino terminal G ⁇ and effector molecule domain of GPAl, which is fused to another sequence encoding the carboxy-termini from a mammalian G protein alpha subunit, including but not limited to G ⁇ i2, G ⁇ i3, G ⁇ o, Gas, Gaq, Gaz, Gal 1, Gal 2, Gal 3, Gal 4, Gal 5, and Gal 6.
  • sequence encoding the 5 carboxy-terminal amino acids may be replaced with an equivalent coding sequence from a mammalian G protein alpha subunit, including but not limited to G ⁇ i2, G ⁇ i3, G ⁇ o, G s, Gaq, Gal l, Gaz, Gal2, Gal3, Gal4, Gal5, and Gal 6.
  • Chimeric G alpha proteins can be used to analyze the G protein coupling specificity of different GPCRs, including but not limited to the rat somatostatin
  • rat adenosine A2a rat muscarinic acetylcholine M2 and M3, D. melanogaster muscarinic acetylcholine Ml, rat neurotensin NT-1, human vasopressin V2, rat cholecystokinin CCK-A and CCK-B, human gonadotropin releasing hormone GnRH, human melanocortin MCR4, human adrenergic ⁇ 2A, Aplysia californica octopamine OAl, human bombesin receptor related sequence 3 (BRS3), human histamine H3, and human ⁇ 2-adrenergic receptors.
  • BRS3 bombesin receptor related sequence 3
  • yeast cells containing the chimeric GPAl genes discussed above can be transformed with plasmids conferring expression of a heterologous GPCR. The activities of cognate GPCR agonists can then be detected through dose-dependent induction of a pheromone-responsive H/S5 reporter gene.
  • host cells that express a chimeric G alpha protein provide a generally useful means of characterizing the G protein-coupling selectivity of G protein coupled receptors.
  • Example 1 Functional Expression of A Mutated Rat M3 Muscarinic Acetylcholine Receptor (MAR) in Yeast
  • the third intracellular loops of GPCRs are thought to interact with and participate in the activation of G proteins upon agonist binding. J Wess (1997). Mutations in IC3 of the yeast mating pheromone receptors, Ste2 and Ste3 have profound effects on coupling the G proteins. C. Boone et al. (1993) and C. Clark et al. (1994). Importantly, deletion of a portion of the IC3 of mammalian MARs, in particular the rat M3 MAR, is correlated with improved functional expression in mammalian cells with retention of full ability to couple to the heterotrimeric G protein, Gq (G ⁇ ). The mutated M3 MAR retains all external loops.
  • Transmembrane domains TMDs
  • internal domains other than the IC3 are unchanged.
  • the third intracellular loop of the MAR containing the IC3 deletion IC3 ⁇
  • the improvement in functional expression may due to elimination of domains known to interact with cellular desensitization mechanisms, allowing more functional MAR to be retained at the cell surface.
  • An amino-terminal coding fragment was amplified using oligonucleotides containing 5' Rglll (AAAAGATCT AAA ATG TAC CCC TAC GAC GTC CCC) (SEQ ID NO: 1) and 3' Agel (ATAGTCATGATGGTG ACCGGT ATGTAAAAGGCAGCGATC) (SEQ ID NO: 3) sites.
  • a carboxy-terminal coding fragment was amplified using oligonucleotides containing 5' Pmll (GCCTTCATCAT CACGTG GACCCCCTACACC) (SEQ ID NO: 4) and 3' Xhol (AAA CTCGAG CTA CAA
  • Yeast cells containing the MARs were assayed in liquid culture using the MAR agonist carbachol (CCh). The cells were cultured overnight in 2 ml SC- glucose-ura medium. The cells were diluted 500 fold in SC-glucose-ura-his, pH 6.8 medium containing 5 mM 3 -aminotriazole to decrease basal growth rate. Samples of the cell suspension (180 ⁇ l) were dispensed to wells of sterile 96 well microtiter dishes containing 20 ⁇ l of serially-diluted samples (lO '-lO 8 M) of the muscarinic receptor agonists. The plates were incubated at 30°C for 18 hours with agitation (600 rpm).
  • M3 MAR IC3 ⁇ produced an agonist-dependent growth response, demonstrating that the M3 MAR IC3 ⁇ is functional, while the wild type MAR is non-functional, as indicated by the lack of agonist-dependent yeast cell growth.
  • the growth response of the M3 MAR IC3 ⁇ containing cells was dose-dependent giving an EC 50 for carbachol (CCh) equal to 3 ⁇ M. This value matches the K D for CCh obtained in HEK cells (7.9 ⁇ M) and the EC 50 for CCh induced IP 3 (inositol triphosphate) accumulation (4.0 ⁇ M), suggesting that the M3 MAR IC3 ⁇ retains the expected pharmacological properties when expressed in yeast cell membranes. Further, the growth response is blocked by the MAR-specific antagonist, atropine (At).
  • the response to CCh by yeast cells containing the M3 MAR IC3 ⁇ may be observed by measuring the agonist-induced increase in fluorescent emission from a green fluorescent protein reporter gene whose expression is stimulated by MAR agonists.
  • Green fluorescent protein (GFP) is a protein from Aequorea that is intrinsically fluorescent when expressed in yeast cells. The fluorescence from GFP is detectable in live yeast calls, making it possible to measure the level of its expression without any deleterious treatment of the yeast cells. This feature is particularly advantageous in the reporter gene assays that do not require additional steps to permit its detection.
  • An inducible reporter gene that is useful in detecting the agonist-activation of heterologous GPCRs expressed in yeast utilizes transcriptional promoters that are activated by the mating signal transduction pathway.
  • FUS2 promoter One such promoter is the FUS2 promoter.
  • FUS2 promoter In the absence of agonist stimulation, little or no expression of the Fus2 protein or any other protein whose expression is directed by the FUS2 promoter is detectable.
  • transcription from the FUS2 promoter After treatment with agonist, transcription from the FUS2 promoter is induced up to 700 fold, leading to substantial increases in Fus2 expression or in the expression of any gene product whose expression is placed under control of the FUS2 promoter.
  • yeast cell fluorescence resulting from GFP expression under the control of the FUS2 promoter from a FUS2-G ⁇ V reporter gene is only observed after agonist activation of a heterologous GPCR.
  • DNA sequences encoding the enhanced GFP (EGFP, Clonetech), FUS2 promoter and FUS2 transcriptional terminator sequences were amplified by PCR.
  • the fragments were assembled into the centromere containing plasmid pRS414 so as to place EGFP expression under control of the pheromone responsive EL7S2 promoter in the centromere containing plasmid pRS414, producing plasmid pMP241.
  • the resulting plasmids were introduced into yeast cells of the kind described in United States Patent 5,691,188, that are useful for performing assays of GPCR agonist-stimulated growth of cells containing the M3 MAR IC3 ⁇ .
  • Yeast cells containing the M3 MAR IC3 ⁇ and the E ⁇ 7S2- ⁇ GFP reporter plasmid were assayed in liquid culture using the MAR agonist carbachol (CCh).
  • the cells were cultured overnight in 2 ml SC-glucose-ura medium.
  • the cells were washed and diluted 5 fold in SC-glucose-ura-his, pH 6.8 medium containing 5 mM 3- aminotriazole to decrease basal growth rate.
  • Samples of the cell suspension 180 ⁇ l were dispensed to wells of sterile 96 well microtiter dishes containing 20 ⁇ l of serially-diluted samples (10 " '-10 "8 M) of CCh.
  • the plates were incubated at 30°C for 6 hours with agitation (600 rpm). Stimulation of the FUS2-EGF? reporter gene expression was monitored by recording increases in emission at 530 run after excitation with 480 nm light using a fluorescence microplate reader. Assays were conducted in duplicate and measurements obtained during the logarithmic phase of yeast cell growth. Fluorescence emission measurements were analyzed using GraphPad Prism and were presented as the mean ⁇ SEM and were plotted vs. agonist concentration. As shown in Figure IB, the yeast cells containing the M3 MAR IC3 ⁇ produced a dose dependent increase in fluorescence emission, consistent with increased expression of the EGFP from the agonist inducible FUS2-GFP reporter gene construct. The EC50 for CCh stimulation of fluorescence emission is 4 ⁇ M, identical to values obtained in the growth assay.
  • Agonist of the G protein-coupled insect muscarinic acetylcholine receptors possess substantial insecticidal and miticidal activity. M.R. Dick et al.
  • the DMAR interacts with the heterotrimeric Gq protein leading to an increase in intracellular calcium in response to muscarinic agonists.
  • One potential explanation for the inactivity of the DMAR in yeast is an inability to efficiently couple to the yeast heterotrimeric G protein.
  • Fragment 1 consisted of the amino terminal coding portion of the Drosophila MAR up to an Agel site within the 5th TMD, amplified by PCR using oligonucleotides (AAA AGATCT AAA ATG TACGGAAACCAGACGAAC) (SEQ ID NO: 7) and (CCA GTA GAG GAA
  • the second fragment of the DMAR was composed of carboxy terminal coding sequences starting with a Pmll site in the 6th TMD, amplified by PCR using oligonucleotides (TTCATCATCACGTGGACTCCGTACAACATC) (SEQ ID NO: 9) and (AAA CTCGAG TTATCTAATTGTAGACGCGGC) (SEQ ID NO: 10).
  • MAR IC3 ⁇ domain was amplified as an Agel-Pm ⁇ l fragment with coding sequence in frame with fragments 1 and 2, described in Example 1. These fragments were assembled in plasmid p426GPD to place the mutated DMAR under control of the GPD promoter.
  • the wild type DMAR was cloned into the expression vector, pMP3, described in United States Patent 5,691,188.
  • the resulting plasmids were introduced into yeast cells of the kind described in United States Patent 5,691,188 that are useful for performing assays of GPCR agonist-stimulated growth, including, specifically, the MPY578fc cells described in Pausch et al. (1998) and Table 3 of Example 9.
  • Yeast cells containing the DMAR and the plasmid containing the wild type DMAR were assayed in liquid culture using the MAR agonist carbachol (CCh). The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were diluted
  • Optical density measurements were analyzed using GraphPad Prism and are presented as the mean ⁇ SEM and were plotted vs. agonist concentration.
  • the yeast cells containing the mutated DMAR i.e., the M3 MAR IC3 ⁇
  • produced an agonist-dependent growth response demonstrating that the DMAR-M3 MAR IC3 ⁇ is functional.
  • the wild type DMAR is non-functional, as indicated by the lack of agonist-dependent yeast cell growth.
  • the DNA sequences encoding the rat wild type and IC3 ⁇ cholecystokinin CCKB receptor were amplified by PCR and cloned into proximity to the glycerol-phosphate dehydrogenase promoter in yeast expression plasmid, p426GPD, by standard methods.
  • the wild type CCKBR was amplified by PCR using oligonucleotides (ACTTAGATC AAAAAATGGAGCGCTCAAGCTGAACCG) (SEQ ID NO: 11 ) and
  • Fragment 1 contained amino terminal coding sequences including 22 amino acids proximal to the 5th TMD, amplified by PCR using oligonucleotides (GGCCAGGATCCAAAAATGGGCTCCCTGCAGCCGGACGC) (SEQ ID NO: 13) and (CGGGCCCCGCGGGCGCTCGGGGCCCAGACCGTTGGGC) (SEQ ID NO: 14).
  • Fragment 2 contained carboxy terminal coding sequences including 22 amino acids proximal to the 6th TMD, amplified by PCR using oligonucleotides (CGGGCGACAGCCTGCCGCGGC) (SEQ ID NO: 15) and (AGCGGTCGACTCACACGATCCGCTTCCTGTCCCC) (SEQ ID NO: 16). The two fragments were fused by amplification by PCR using oligos at 5' and 3' ends of the full length CCKB receptor.
  • the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, including, specifically, the MPY578fc cells described in Pausch et al. (1998) and Table 3 of Example 9..
  • Yeast strains containing wild type and IC3 ⁇ cholecystokinin CCKB receptor were grown overnight in 2 ml synthetic complete liquid medium containing glucose (2%) and lacking uracil (SCD-ura) medium.
  • SCD-ura synthetic complete liquid medium containing glucose (2%) and lacking uracil (SCD-ura) medium.
  • molten (50°C) SCD-ura-his agar medium 35 ml, adjusted to pH 6.8 by addition of concentrated KOH or NH 4 OH prior to autoclaving
  • 0.5 mM AT (3- aminotriazole) was inoculated with the overnight culture (2 x 10 4 cells/ml) and poured into square (9 x 9 cm) petri plates.
  • Figure 3 A demonstrates the robust growth response of yeast cells containing the IC3 ⁇ cholecystokinin CCKB receptor
  • Figure 3B shows only limited growth by yeast cells containing the wild type CCKB receptor, indicating that the deletion of portion of the third intracellular loop of the CCKB receptor improves its function in yeast.
  • the third intracellular loop participates in many GPCR functions, including G protein coupling, desensitization and interaction with diverse modifying proteins.
  • Somatostatin receptors are encoded in five subtypes, labeled SSTRl-5.
  • SSTRl-5 Several amino acids are found in the third intracellular loop of the SSTR3 subtype, but not in the equivalent region of SSTR2 subtype. Since SSTR2 functions efficiently in yeast, deletion of those amino acids from IC3 may impart this functional efficiency upon SSTR3.
  • 8 amino acids, Gln-Trp-Val-Gln- Ala-Pro- Ala-Cys (SEQ ID NO: 17), were deleted from the third intracellular loop of the rSSTR3 cDNA, enabling more efficient receptor signaling in yeast.
  • Rat SSTR3 sequences were amplified by PCR using oligonucleotides containing 5' Bglll and 3' Xhol sites.
  • the resulting PCR product of approximately 1.3 kb was digested with Bglll and Xhol, purified and inserted between the BamHI and Xhol sites in p426GPD to generate the plasmid p426GPD-rSSTR3.
  • Recombinant plasmids were confirmed by restriction endonuclease digestion and DNA sequencing.
  • PCR insert A of approximate size 750 bp was generated using the 5' Bgl oligonucleotide (AAAAAGATCT AAAATGGCCA CTGTTACCTA T) (SEQ ID NO: 18) and the 3' oligonucleotide CTCAGAGCGG CGTCGCCGCT GACACGAGGG CGCCCG (SEQ ID NO: 19).
  • PCR insert B of approximate size 530 bp was generated using the 5' oligonucleotide GCGCCCTCGT GTCAGCGGCG ACGCCGCTCT GAG
  • PCR fragments A and B were gel purified, annealed and amplified by PCR using the flanking 5' Bglll and 3' Xhol oligonucleotides to yield the approximately 1.3 kb rSSTR3 ⁇ IC3 PCR product.
  • the rSST3 ⁇ IC3 insert was ligated into BamHl-Xhol sites of p426GPD to generate the plasmid p426GPD- rSSTR3 ⁇ IC3. Restriction mapping and DNA sequencing confirmed correct reading frame and sequence.
  • Yeast cells of the type useful for expression of GPCRs described in United States Patent 5,691,188, specifically, the MPY578fc cells described in Pausch et al. (1998) and Table 3 of Example 9, were transformed with p426GPD-rSSTR3 and p426GPD-rSSTR3 ⁇ IC3, using standard procedures. The cells were assayed using the agar-based bioassay format described in Example 3. Samples (10 ⁇ l) of Somatostatin
  • deletion of portion of the IC3 of mammalian GPCRs is correlated with improved functional expression in mammalian and yeast cells with retention of full ability to couple to the heterotrimeric G protein.
  • the mutated MARs, CCKBR, and SSTR3 retain all external loops. Transmembrane domains and internal domains other than the IC3 are unchanged.
  • IC3 of the GPCRs containing the IC3 deletion is 44 amino acids in length.
  • the improvement in functional expression may be due to elimination of domains known to interact with cellular desensitization mechanisms, allowing more functional MAR to be retained at the cell surface.
  • DNA sequences encoding an IC3 ⁇ human alpha2A adrenergic receptor were amplified by PCR and cloned into proximity to the glycerol-phosphate dehydrogenase promoter in yeast expression plasmid, p426GPD, by standard methods.
  • the IC3 ⁇ human alpha2A adrenergic receptor was prepared by fusing two overlapping fragments.
  • Fragment 1 contained amino terminal coding sequences including 39 amino acids proximal to the 5th TMD, amplified by PCR using oligonucleotides (GGCCAGGATCCAAAAATGGGCTCCCTGCAGCCGGACGC) (SEQ ID NO: 13) and (CGGGCCCCGCGGGCGCTCGGGGCCCAGACCGTTGGGC) (SEQ ID NO: 14).
  • Fragment 2 contained carboxy terminal coding sequences including 41 amino acids proximal to the 6th TMD, amplified by PCR using oligonucleotides (CGGGCGACAGCCTGCCGCGGC) (SEQ ID NO: 15) and (AGCGGTCGACTCACACGATCCGCTTCCTGTCCCC) (SEQ ID NO: 16).
  • the two fragments were fused by amplification by PCR using oligos at 5' and 3' ends of the full length alpha2A adrenergic receptor.
  • the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691 , 188, specifically, the MP Y578fc cells described in Pausch et al. (1998) and Table 3 of Example 9.
  • CAM constitutively active mutant
  • the CAM IC3 ⁇ human alpha2A adrenergic receptor was prepared by fusing two overlapping fragments.
  • Fragment 1 contained amino terminal coding sequences including 38 amino acids proximal to the 5th TMD.
  • Fragment 2 contained carboxy terminal coding sequences including 33 amino acids proximal to the 6th TMD. The two fragments were fused by amplification by PCR using oligos at 5' and 3' ends of the full length alpha2A adrenergic receptor.
  • the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, specifically, the MPY578fc cells described in Pausch et al. (1998) and Table 3 of Example 9.
  • Yeast cells containing the wild type IC3 ⁇ and CAM IC3 ⁇ human alpha2A adrenergic receptor were assayed in liquid culture using the alpha adrenergic receptor full agonist UK 14304 (RBI) and partial agonist clonidine.
  • the cells were cultured overnight in 2 ml SC-glucose-ura medium.
  • the cells were diluted 500 fold in SC- glucose-ura-his, pH 6.8 medium.
  • Samples of the cell suspension were dispensed to wells of sterile 96 well microtiter dishes containing 20 ⁇ l of serially- diluted samples of the adrenergic receptor agonist, UK 14304 (10 3 - 10" 10 M) and partial agonist clonidine (10 "3 - 10 "9 M).
  • the plates were incubated at 30°C for 18 hours with agitation (600 rpm). Growth was monitored by recording increases in OD620 using a microplate reader.
  • Assays were conducted in duplicate and growth rate measurements obtained during the logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean ⁇ SEM and were plotted vs. agonist concentration.
  • the yeast cells containing the wild type IC3 ⁇ and CAM IC3 ⁇ human alpha 2A adrenergic receptor produced a dose-dependent growth response, indicating that this IC3 deletion is functional ( Figure 5).
  • the basal growth rate of the CAM receptor-containing cells is greater than that of the cells containing the wild type receptor, indicating that the CAM receptor is more active in the absence of agonist.
  • the IC3 ⁇ ⁇ 2A adrenergic receptor was found to be functional, indicating that modification of the third intracellular loop in the manner described results in a functional GPCR.
  • the CAM version of the IC3 ⁇ ⁇ 2A adrenergic receptor possessed the capacity to induce yeast cell growth independent of applied agonist, suggesting that the constitutive activity of any CAM GPCR may be measured simply by assessing the level of yeast cell growth that occurs in the absence of agonist. This effect of CAMs in GPCRs may be particularly useful in the testing of orphan GPCRs, for which no cognate agonist is known.
  • an orphan GPCR may be mutated in its third intracellular loop to make it a CAM GPCR and tested for its ability to stimulate a yeast growth response in the absence of agonist. If the CAM orphan GPCR is capable of stimulating a yeast cell growth response, then it must be functional and therefore suitable for inclusion in a drug screening assay.
  • Example 6 Expression of a CAM M3 Muscarinic Acetylcholine Receptor (M3 MAR) in Yeast
  • Example 5 a CAM ⁇ 2A adrenergic receptor was shown to be able to stimulate a yeast cell growth response in the absence of added agonist.
  • the CAM was in the third intracellular loop, a domain known to be involved in both activation of
  • the second intracellular loop and regions proximal to it is also known to be involved in GPCR activation.
  • a conserved tripeptide motif, Asp-Arg-Tyr known as the DRY box, has been shown to be involved in activation of rhodopsin family GPCRs.
  • Site-directed mutants of the ⁇ l -adrenergic receptor in which the Asp residue was modified to hydrophobic amino acids, including He, were correlated with high constitutive activity.
  • a CAM MS- MAR produced by mutation of a site in sixth transmembrane domain proximal the carboxy terminus of the third intracellular loop was evaluated in mammalian cell culture. Spauldin et al. (1995). The elevated basal signaling due to the CAM was reversed by a variety of inverse agonists, including atropine, confirming the increased intrinsic activity of the CAM M5-MAR.
  • the rat M3 MAR was modified to replace the Asp residue in the DRY box with an He residue.
  • the rat M3-MAR yeast expression plasmid described in Example 1 was used as template for the D (Asp) to I (He) change in the DRY box, which was accomplished by site-directed mutagenesis using a Stratagene QuikChange kit according to manufacturers instructions.
  • yeast cells containing the DRY box mutated MS- MAR expression plasmid were compared to those containing the unmodified MS- MAR in the agar-based bioassay format.
  • Yeast cells were cultured overnight in 2 ml synthetic complete liquid medium containing glucose (2%) and lacking uracil (SCD- ura) medium.
  • molten (50 °C) SCD-ura-his agar medium 35 ml, adjusted to pH 6.8 by addition of concentrated KOH prior to autoclaving
  • molten (50 °C) SCD-ura-his agar medium 35 ml, adjusted to pH 6.8 by addition of concentrated KOH prior to autoclaving
  • 0.5 mM AT was inoculated with the overnight culture (2xl0 4 cells/ml) and poured into square (9x9 cm) petri plates.
  • the CAM M3-MAR promotes an elevated yeast cell growth rate in the absence of agonist which may be observed by comparison of the areas of the plate that were not treated with either agonist or antagonist with similar portions of the non- CAM M3-MAR plate. That the elevated growth response is due to a CAM M3-MAR is confirmed by the reversal of agonist-independent growth by the inverse agonist, atropine (Figure 7A). Atropine had no toxic effect on the growth yeast cells expressing the CAM M3-MAR when grown in the presence of histidine. The non- CAM M3-MAR retained the ability to be agonist-stimulated, while the CAM MS- MAR was no longer responsive to agonist.
  • CAMs introduction of CAMs into the DRY box of GPCRs results in a measurable increase in agonist-independent yeast cell growth due to its elevated constitutive activity.
  • the increased growth rate indicates the mutated GPCR is functionally active in the absence of agonist.
  • This effect of DRY box CAMs in GPCRs may be particularly useful in the testing of orphan GPCRs, since the DRY box is widely conserved and thus, should be present in most orphan receptors.
  • an o ⁇ han GPCR may be mutated in its DRY box to make it a CAM GPCR and tested for its ability to stimulate a yeast growth response in the absence of agonist. If the CAM o ⁇ han GPCR is capable of stimulating a yeast cell growth response, then it must be functional and therefore suitable for inclusion in a drug screening assay.
  • modification of the third intracellular loop leads to improvement in functional expression of a variety of heterologous GPCRs expressed in yeast.
  • Agonist induced desensitization of the GPCRs is also mediated in part by
  • GPCR internal domains other than the third intracellular loop such as the intracellular carboxy-terminal tail.
  • the rat NTR1 was modified by deleting the 52 amino acids that constitute the carboxy terminal tail, leaving a shortened receptor 372 amino acids in length.
  • the coding sequences of the wild type and truncated neurotensin NT1 receptor were amplified by PCR using a 5' oligonucleotide primer that specified a common amino-terminal coding sequence (AGTCAGATCTAAGCTT AAAA ATG CAC CTC AAC AGC TCC) (SEQ ID NO: 22) and separate oligos that define the wild type (AGTC AGATCT CTA GTA CAG GGTCTCCC) (SEQ ID NO: 23) and truncated carboxy termini (AGAG AGATCT TTAGCGCCACCCAGGACAAAGGC) (SEQ ID NO: 24).
  • a 5' oligonucleotide primer that specified a common amino-terminal coding sequence (AGTCAGATCTAAGCTT AAAA ATG CAC CTC AAC AGC TCC) (SEQ ID NO: 22) and separate oligos that define the wild type (AGTC AGATCT CTA GTA CAG GGTCTCCC) (SEQ ID
  • Yeast cells containing the NTRls were assayed in liquid culture using the NT receptor agonist acetyl neurotensin 8-13 (AcNt8-13).
  • the cells were cultured overnight in 2 ml SC-glucose-ura medium.
  • the cells were diluted 500 fold in SC- glucose-ura-his, pH 6.8 medium containing 2 mM 3 -aminotriazole to decrease basal growth rate.
  • Samples of the cell suspension 180 ⁇ l were dispensed to wells of sterile 96 well microtiter dishes containing 20 ⁇ l of serially-diluted samples (10 "3 -10 " '° M) of AcNT8-13.
  • the plates were incubated at 30 °C for 18 hours with agitation (600 rpm). Growth was monitored by recording increases in OD 620 using a microplate reader. Growth rate measurements were obtained during the logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean ⁇ SEM and were plotted against, agonist concentration.
  • the yeast cells containing the NTRls produced an agonist-dependent growth response demonstrating that both the wildtype and carboxy terminally truncated NTRls were functional.
  • the growth response of the rNTRl C-term ⁇ containing cells was dose-dependent giving an EC50 for AcNT8-13 equal to 520 nM. This value is five fold lower than observed for cells expressing the wildtype NTR1 (2.1 ⁇ M).
  • the carboxy terminal deletion has produced a rNTRl that responds to a lower concentration of NTR agonist improving the sensitivity of the yeast bioassay.
  • deletion of a portion of the carboxy terminal intracellular domain of the rat NTR1 has produced a functional GPCR with increased agonist sensitivity when expressed in yeast, suggesting that modification of this internal domain is a generalizable method for improving the function of heterologous GPCRs expressed in yeast.
  • heterologous G protein-coupled receptors were expressed in ergo mutants constructed from MPY578fc giving an agonist-dependent growth response.
  • the strain was constructed by transformation of MPY578fc (M. Pausch et al, (1998)) with DNA containing an erg6 deletion cassette which deletes the endogenous ERG6 gene.
  • the cassette is constructed by using the following DNA oligonucleotides as primers in a PCR reaction:
  • This PCR reaction using plasmid pRS404 (Stratagene company) DNA results in the synthesis of a DNA fragment containing sequences homologous to the 5' and 3' sequences surrounding the ERG6 gene but with the entire TRP1 gene intervening and replacing ERG6 sequences.
  • the strain that results from the transformation of the cassette is named YML103.
  • GPCR genes including the human Via and V2 vasopressin receptors, the human melanocortin receptor (MC4), the rat somotostatin SSTR2 receptor, the rat M3 MAR and the rat CCKB receptor, were inserted into plasmid p426GPD in the manner described in the preceding examples.
  • the Via and V2 receptor-transformed strains demonstrate vasopressin-dependent growth responses in the ergtf-deleted YML103 strain. Such a response is not detected in the wild type MPY578fc strain ( Figure 9A-D).
  • Example 9 Functional activity of heterologous GPCRs expressed in yeast strains containing chimeric G alpha proteins.
  • Yeast cells containing various chimeric G alpha proteins were rendered dependent on agonist-stimulated activation of coexpressed heterologous GPCRs and downstream elements of the pheromone response pathway for growth on selective medium.
  • the technology was exploited to examine aspects of ligand-receptor and receptor-G protein interactions. Plasmid constructions
  • rat somatostatin SSTR2 and rat adenosine A2a receptor expression plasmids were described elsewhere (L.A. Price et al (1995), L.A. Price et al. (1996)).
  • the protein-coding region of the rat NTR1 was modified by PCR for efficient expression in yeast.
  • Oligonucleotides that add a 5 ' Hindlll site and a yeast translational initiation consensus sequence to the 5' end (TCTC AAGCTT AAAA ATG CGC CTC AAC AGC TCC GCG)(SEQ ID NO: 27) and a Bglll site to the 3' end after the termination codon (ACAC AGATCT CTA GTA CAG CGT CTC GCG GG)(SEQ ID NO: 28) were used to amplify the NTR1 sequences.
  • the resulting fragment was purified, digested with the appropriate restriction endonucleases and inserted between Hindlll and BamHl sites in the phospho-gly cerate kinase (PGK1) promoter containing expression vector, pPGKH (Y.S. Kang et al (1990)), forming pMP198.
  • PGK1 phospho-gly cerate kinase
  • the protein-coding region of the human MCR4 (I. Gantz et al. (1993)) was modified by PCR for efficient expression in yeast. Oligonucleotides that add a 5 ' Hindlll site and a yeast translational initiation consensus sequence to the 5' end (TCTC AAGCTT AAAA ATG CGC CTC AAC AGC TCC GCG)(SEQ ID NO: 27) and a Bglll site to the 3' end after the termination codon (ACAC AGATCT CTA GTA CAG CGT CTC GCG GG)(SEQ ID NO: 28) were used to amplify the MCR4 sequences.
  • the resulting fragment was purified, digested with the appropriate restriction endonucleases and inserted between Hindlll and BamHl sites in the phospho-glycerate kinase (PGK1) promoter containing expression vector, pPGKH (Y.S. Kang et al. (1990)), forming pMP223.
  • the wild type rat CCK-B-R expression plasmid pMP203 was constructed by amplifying the protein-coding region of the rat CCK-B-R (S.A. Wank et al. (1992)) by PCR.
  • Oligonucleotides that add a 5' Hindlll site and a yeast translational initiation consensus sequence to the 5' end (ATTT AAGCTT AAAA ATG GAG CTG CTC AAG CTG AAC CG)(SEQ ID NO: 29) and a Bglll site to the 3' end after the termination codon (TCCC AGATCT TCA GCC AGG CCC CAG TGT GCTG)(SEQ ID NO: 30) were used to amplify the rat CCK-B-R sequences.
  • the resulting fragment was purified, digested with the appropriate restriction endonucleases and inserted between Hindlll and BamHl sites in the phosphogly cerate kinase (PGK1) promoter containing expression vector, pPGKH (Y.S. Kang et al, (1990)), forming pMP203.
  • PGK1 phosphogly cerate kinase
  • a second rat CCK-B-R expression plasmid, pMP258, was constructed using oligos that add a 5' Bglll site and a yeast translational initiation consensus sequence to the 5 ' oligo (ATTT AGA TCT AAAA ATG GAG CTG CTC AAG CTG AAC CG)(SEQ
  • the 3' oligonucleotide specified the 3' end after the termination codon by adding a Sail site (TCCC GTC GAC TCA GCC AGG CCC CAG TGT GCTG) (SEQ ID NO: 12).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and ⁇ Tr ⁇ l sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et al. (1995)).
  • GPD glycerolphosphate dehydrogenase
  • the protein-coding region of the human CCK-A receptor (A. de Weerth et al. (1993)) was modified by PCR for efficient expression in yeast. Oligonucleotides that add a Hindlll site and a yeast translational initiation consensus sequence to the 5 ' end (AAAA AAGCTT AAAA ATG GAT GTG GTT GAC AGC CTT)(SEQ ID NO: 32) and a Bglll site to the 3' end after the termination codon (AAAA AGATCT TCA GAC CCC ACC GTG GCT)(SEQ ID NO: 33) were used to amplify the CCK-A receptor sequences.
  • the resulting fragment was purified, digested with the appropriate restriction endonucleases and inserted between Hindlll and BamHl sites in the phospho-gly cerate kinase (PGK1) promoter containing expression vector, pPGKH (Y.S. Kang et al (1990)), forming pMP209.
  • PGK1 phospho-gly cerate kinase
  • a rat M3-muscarinic acetylcholine receptor (T.I. Bonner et al. (1987)) expression plasmid, pEK290 was constructed using oligos that add a 5' Bglll site and a yeast translational initiation consensus sequence to the 5 ' oligo (GTC A AGATCT AAAA ATG ACC TTG CAC AGT AAC)(SEQ ID NO: 34).
  • the 3 ' oligonucleotide specified the 3 ' end after the termination codon by adding aXhol site (TACC CTCGAG CTA CAA GGC CTG CTC CGG C)(SEQ ID NO: 35).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between B ⁇ mHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et ⁇ l. (1995)).
  • GPD glycerolphosphate dehydrogenase
  • expression plasmid pEK289
  • oligos that add a 5' Bglll site and a yeast translational initiation consensus sequence to the 5' oligo (ATCC AGATCT AAAA ATG TAC GGA AAC CAG ACG AAC GG)(SEQ ID NO: 36).
  • the 3 ' oligonucleotide specified the 3 ' end after the termination codon by adding a Xhol site
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et al. (1995)).
  • GPD glycerolphosphate dehydrogenase
  • the 3' oligonucleotide specified the 3 ' end after the termination codon by adding a Sail site (TCCC GTC GAC
  • the 3' oligonucleotide specified the 3 ' end after the termination codon by adding a Sail site (TCCC GTC GAC
  • expression plasmid, pET19 was constructed using oligos that add a 5' Bglll site and a y east translational initiation consensus sequence to the 5 ' oligo (ATTT AGA TCT AAAA ATG GAG CTG CTC AAG CTG AAC CG)(SEQ ID NO: 31).
  • the 3' oligonucleotide specified the 3' end after the termination codon by adding a Sail site (TCCC GTC GAC TCA GCC AGG CCC CAG TGT GCTG)(SEQ ID NO: 12).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et al. (1995)).
  • GPD glycerolphosphate dehydrogenase
  • a human adrenergic ⁇ 2A receptor (CA. Guyer et al. (1990)) expression plasmid, pMP249 was constructed using oligos that add a 5' Bglll site and a yeast translational initiation consensus sequence to the 5' oligo (ATTT AGA TCT AAAA ATG GAG CTG CTC AAG CTG AAC CG)(SEQ ID NO: 31 ).
  • the 3 ' oligonucleotide specified the 3 ' end after the termination codon by adding a Sail site (TCCC GTC GAC TCA GCC AGG CCC CAG TGT GCTG)(SEQ ID NO: 12).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et ⁇ l. (1995)).
  • GPD glycerolphosphate dehydrogenase
  • the 3 ' oligonucleotide specified the 3 ' end after the termination codon by adding a Sail site (TCCC GTC GAC TCA GCC AGG CCC CAG TGT GCTG)(SEQ ID NO: 12).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (K Tanaka et al. (1990)).
  • GPD glycerolphosphate dehydrogenase
  • the 3' oligonucleotide specified the 3' end after the termination codon by adding a Sail site (TCCC GTC GAC TCA GCC AGG CCC CAG TGT GCTG)(SEQ ID NO: 12).
  • the fragment obtained using the above oligos was purified, digested with the appropriate restriction endonucleases and inserted between BamHl and Xhol sites in the glycerolphosphate dehydrogenase (GPD) promoter containing expression vector p426GPD (D. Mumberg et al. (1995)).
  • a vector suitable for replacing the chromosomal GPAl sequences with chimeric genes encoding the mammalian C-terminal amino acids was produced.
  • the base vector was produced as follows. A fragment of the GPAl gene (C. Dietzel et al. (1987), I. Miyajima et al. (1987), M. Nakafuku et al. (1987)) comprising the promoter and coding sequence was isolated from pPGKH-SCGl ( S. Kangetal (1990)). The silent mutation that formed the BamHl site was placed within the GPAl open reading frame at a position at which a conserved BamHl site is often found in G protein alpha subunit coding sequences.
  • GPAl fragment was amplified from sequences composed of the 3' regulatory sequences using oligos that added BamHl and Xbal (AAA GGATCC AGG AAC TGT ATA ATT AAA GTA (SEQ ID NO: 38); and ATG TCTAGA AAT TAA
  • CAA CAA TAA AGA (SEQ ID NO: 39).
  • a second 0.5 kb GPAl fragment W ⁇ hXbal and Sail sites (ATT TCTAGA CAT TGT TTC ATT AAT TGA (SEQ ID NO: 40); and TTT GTCGAC TTA TCT CAT CAC TGG CAT TTA)(SEQ ID NO: 41) was produced.
  • the fragments were inserted sequentially into conesponding sites in YIp5 (M.F. Rose et al. (1990)), a URA3 -containing integrating vector, forming pLP136.
  • the resulting construct may be linearized using the artificial Jf ⁇ l site inserted between 3' fragments.
  • Chimeric G protein integrating vectors were constructed by adding to pLP136
  • BamHl fragments encoding the carboxy terminus of Gpal with the 5 carboxy terminal amino acids of mammalian G proteins.
  • the BamHl fragments were amplified using oligos that placed BamHl sites in frame at both ends as indicated below in Table 1.
  • Table 1 Oligonucleotides used to construct with chimeric GPAl alleles containing modified carboxy termini coding sequences.
  • GGA TGA TTA G (SEQ ID NO: 51) al5,16: 5' AGC TGG ATC CTC ACA ACA AAT TAA TTT CTT TAA GGT TTT GCT GGA TGA TTA G (SEQ ID NO: 52)
  • the 3' oligos specified the coding sequences for the 5 carboxy-terminal amino acids from each of the mammalian G ⁇ proteins.
  • the fragments were digested with BamHl and inserted in the correct orientation into the sole B ⁇ mHl site in pLP136, producing the integrating plasmids identified below in Table 2.
  • Table 2 Plasmids used to replace the GPAl gene with chimeric GPAl alleles containing modified carboxy termini coding sequences.
  • DNA fragments encoding the carboxy termini of mammalian G alpha proteins were obtained from existing expression plasmids (Y.S. K ⁇ ng et ⁇ l. (1990)). The fragments were inserted in the correct orientation into the sole B ⁇ mHl site in pLP136.
  • a FUSl-LacZ reporter gene bearing plasmid (pMP283) was constructed by transferring the Pstl-SallEr ⁇ i-LacZ fragment frompSL307 (G. McCaffrey et ⁇ l. (1987)) to corresponding sites in the multicopy TRP1 containing vector, pRS426 (T.W. Christiansen et al).
  • Yeast strains were constructed, and growth media and culture conditions formulated according to standard procedure (M.F. Rose et al. (1990)).
  • Yeast strains containing chimeric G proteins were constructed by two step integrative replacement of the GPAl locus. In order to target this construct to integrate at the GPAl locus, the chimeric G protein expression plasmids were digested with Xbal. DNA-mediated transformation of MPY578fc cells to uracil prototrophy using the linear fragment was carried out using the lithium acetate method (A. St. Jean et al. (1991)). Selection for replacement of the GPAl locus was accomplished by plating on FOA medium (M.F. Rose et al. (1990)). Yeast cells surviving this procedure were examined by PCR to demonstrate the presence of the altered GPAl allele.
  • yeast shuttle vectors containing chimeric GPAl genes In order to construct yeast shuttle vectors containing chimeric GPAl genes, a 3' fragment of the GPAl gene was amplified using the oligonucleotides shown in Table 1.
  • the 3' coding fragment contained coding sequences for the carboxy-terminal GPCR binding domain of GPAl in which the five carboxy-terminal amino acids were replaced with those of mammalian G alpha proteins.
  • the resulting fragments were subcloned into pLP 136, a URA3, integrating shuttle vector based on YIp5 (M. F. Rose et al. (1990)) .
  • the resulting constructs were linearized with Xbal to promote integration at the GPA 1 locus and used to transform MPY578fc cells (M.H Pausch et al. (1998)), resulting in the yeast strains identified below in Table 3.
  • the Ura+ transformants were passaged on FOA medium and replacement of the GPAl locus with the chimeric alleles confirmed.
  • the resulting strains (Table 3) were then transformed with plasmids conferring expression of various heterologous GPCRs.
  • the yeast strains were assayed in the agar or liquid formats using appropriate cognate agonists.
  • the ability of each GPCR G protein alpha subunit strain to transduce a growth- promoting signal was determined and the results displayed in Figure 11.
  • the GPCRs assayed in yeast displayed G protein alpha subunit coupling selectivity expected from their behavior in their native contexts. For example, the neurotensin NTRl , a Gq coupled receptor in mammalian cells (K. Tanaka et al.
  • vasopressin V2 receptor a Gs coupled receptor in mammalian cells (M. Birnbaumer et al (1992)), promotes growth in Gpal-Gs containing yeast strains, while failing to promote growth in Gpal -Gq/11 strains.
  • these data indicate that GPCRs expressed in yeast retain G protein alpha subunit coupling selectivity.
  • the yeast strains described here represent a convenient tool useful for demonstrating the G protein alpha subunit coupling selectivity of GPCRs.
  • Example 10 Agonist-independent growth stimulated by the adenosine A2a receptor overexpressed in yeast strains containing chimeric G alpha proteins.
  • the phenomenon may be explained by increased accumulation of GPCRs that have switched spontaneously to the active state.
  • the receptor exists in equilibrium between a unique state R, the active state R*, and the inactive state R° states, with the inactive state predominant in the absense of agonist.
  • the GPCR may switch spontaneously between R and the active and inactive configurations. Agonists stabilize the active configuration, permitting GPCRs to stimulate downstream signaling molecules.
  • spontaneous conversion to the active configuration does not permit accumulation of GPCRs to a level that is sufficient to produce detectable activation of downstream signaling pathways above basal levels.
  • GPCRs are overexpressed, more of the receptors are present and capable of transforming spontaneously into the active configuration, thus activating downstream signaling pathways by mass action.
  • rat adenosine A2a receptor expression plasmids conferring high pLPl 16, a multicopy plasmid, described in Price L. A., StrnadJ., Pausch M. H, and Hadcock J R, Pharmacological characterization of the rat A2a adenosine receptor functionally coupled to the yeast pheromone response pathway, Mol. Pharmacol. 50, 829-837, 1996) and low (pMP145, a low-copy number, centromere containing plasmid, described in Pausch et al.) levels of receptor were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188.
  • MPY578fc cells described in Pausch et al. (Pausch, M. H, Price, L. A., Kajkowski, E. M., Strnad, J., Delacruz, F, Heinrich, J. A., Ozenberger, B. A., andHadcock, J.
  • MPY578fc and related chimeric G protein containing strains expressing the adenosine A2a receptor were assayed in liquid culture.
  • Eight individual transformants of each plasmid-containing strain were cultured overnight in 0.2 ml SC-glucose-ura medium.
  • the cells were diluted 500 fold into 0.2 ml cultures of SC-glucose-ura-his, pH 6.8 medium containing 2, 5 or 10 mM 3 -aminotriazole in 96 well plates.
  • Adenosine deaminase is added (0.13 mg/ml) to degrade and inactivate any adenosine produced by the yeast cells. Growth was monitored by recording increases in OD570 using a microplate reader.
  • the yeast cells containing the adenosine A2a receptor produced an agonist-independent growth response, demonstrating that the functional activity of the adenosine A2a receptor may be detected in the absense of agonist.
  • the adenosine A2a receptor produced the highest growth rate when expressed at high levels in cells which contain G alpha proteins to which it is able to couple efficiently, e. g. Gpal and Gpal-s5 and Gpal- ⁇ l6.
  • the agonist-independent growth response is also proportional to the amount of adenosine A2a receptor produced, i. e. cells containing the multicopy adenosine A2a receptor expression plasmid, pLPl 16, grew faster than cells containing the low copy number plasmid, pMP145.
  • o ⁇ han GPCRs may be detected in the absence of agonist by overexpression in yeast cells that contain various chimeric G protein constructs.
  • an o ⁇ han GPCR may be overexpressed in yeast cells that contain various chimeric G protein constructs in the absence of agonist. If the o ⁇ han GPCR is capable of stimulating yeast cell growth, and does so selectively via coupling to a subset of chimeric G proteins, then it must be function and, therefore, is suitable for inclusion in a drug screening assay.
  • Such screening assay would be performed under empirically determined receptor expression condition in which the stimulatory effect of agonist would be detected over the basal growth rate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Neurology (AREA)
  • Engineering & Computer Science (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des récepteurs mutants couplés à la protéine G, lesquels exercent une action constitutive. L'invention concerne également des cellules de levure exprimant ces récepteurs, des vecteurs convenant à la fabrication de ces cellules et des méthodes de fabrication et d'utilisation associées.
EP99944033A 1998-09-01 1999-09-01 Expression fonctionnelle amelioree des recepteurs couples a la proteine g Withdrawn EP1112359A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US9870498P 1998-09-01 1998-09-01
US98704P 1998-09-01
PCT/US1999/020011 WO2000012704A2 (fr) 1998-09-01 1999-09-01 Expression fonctionnelle amelioree des recepteurs couples a la proteine g

Publications (1)

Publication Number Publication Date
EP1112359A2 true EP1112359A2 (fr) 2001-07-04

Family

ID=22270543

Family Applications (2)

Application Number Title Priority Date Filing Date
EP99944035A Withdrawn EP1123391A2 (fr) 1998-09-01 1999-09-01 Methodes permettant d'ameliorer la fonction des recepteurs heterologues couples a la proteine g
EP99944033A Withdrawn EP1112359A2 (fr) 1998-09-01 1999-09-01 Expression fonctionnelle amelioree des recepteurs couples a la proteine g

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP99944035A Withdrawn EP1123391A2 (fr) 1998-09-01 1999-09-01 Methodes permettant d'ameliorer la fonction des recepteurs heterologues couples a la proteine g

Country Status (5)

Country Link
EP (2) EP1123391A2 (fr)
JP (2) JP2002523091A (fr)
AU (2) AU5700999A (fr)
CA (2) CA2344591A1 (fr)
WO (2) WO2000012705A2 (fr)

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6528271B1 (en) 1997-06-05 2003-03-04 Duke University Inhibition of βarrestin mediated effects prolongs and potentiates opioid receptor-mediated analgesia
AU2001255613B2 (en) 2000-04-24 2005-08-04 Wyeth Transgenic animal
EP1337852A1 (fr) * 2000-10-26 2003-08-27 The University of British Columbia Essai fonctionnel a base de cellules d'insectes concernant les recepteurs coupl s aux proteines g
ATE357457T1 (de) * 2000-11-01 2007-04-15 Astellas Pharma Inc Verfahren zum screenen eines plättchenhemmers
US7018812B2 (en) 2000-11-03 2006-03-28 Duke University Modified G-protein coupled receptors
US7163800B2 (en) 2000-11-03 2007-01-16 Molecular Devices Corporation Methods of screening compositions for G protein-coupled receptor desensitization inhibitory activity
DE10056899A1 (de) 2000-11-16 2002-05-29 Aventis Pharma Gmbh Promotor zur funktionellen Charakterisierung von G-Protein gekoppelten Rezeptoren in der Hefe Saccharomyces cerevisiae
WO2002045503A2 (fr) * 2000-12-06 2002-06-13 Deltagen, Inc. Souris transgeniques contenant des disruptions geniques ciblees
GB0030038D0 (en) * 2000-12-08 2001-01-24 Univ Warwick Yeast-based assay
US7279324B2 (en) 2001-01-23 2007-10-09 Duke University Nucleic acid encoding G-protein coupled receptor with modified DRY motif
EP1336655A1 (fr) * 2002-01-12 2003-08-20 Aventis Pharma Deutschland GmbH Méthode pour l'identification des mutants ayant une actività constitutive
DE10233516A1 (de) * 2002-07-23 2004-02-12 Aventis Pharma Deutschland Gmbh Verfahren zur Identifizierung von Substanzen
JP4977012B2 (ja) * 2005-03-29 2012-07-18 Bio−energy株式会社 レセプター結合性物質のスクリーニング方法
EP1871362A2 (fr) 2005-04-27 2008-01-02 Arena Pharmaceuticals, Inc. Polytherapie pour le traitement, d'une part, de l'obesite et de diabetes et des troubles associes et, d'autre part, de troubles ameliores par l'augmentation d'un niveau glp-1 sanguin
BRPI0613505A2 (pt) 2005-06-30 2011-01-11 Prosidion Ltd agonistas de gpcr
MEP27308A (en) 2006-04-11 2010-06-10 Arena Pharm Inc Methods of using gpr119 receptor to identify compounds useful for increasing bone mass in an individual
AR064735A1 (es) 2007-01-04 2009-04-22 Prosidion Ltd Agonistas de gpcr y composicion farmaceutica en base al compuesto
DK2114933T3 (da) 2007-01-04 2012-01-02 Prosidion Ltd Piperidin-GPCR-agonister
AR064736A1 (es) 2007-01-04 2009-04-22 Prosidion Ltd Agonistas de gpcr
EP3926045A1 (fr) * 2007-03-22 2021-12-22 Heptares Therapeutics Limited Protéines mutantes et leurs procédés de sélection
JP2010539152A (ja) 2007-09-10 2010-12-16 プロシディオン・リミテッド 代謝障害の治療のための化合物
GB0720390D0 (en) 2007-10-18 2007-11-28 Prosidion Ltd G-Protein coupled receptor agonists
GB0720389D0 (en) 2007-10-18 2008-11-12 Prosidion Ltd G-Protein Coupled Receptor Agonists
EP2108960A1 (fr) 2008-04-07 2009-10-14 Arena Pharmaceuticals, Inc. Procédés d'utilisation d'un récepteur couplé à protéine G pour identifier les secrétagogues de peptide YY (PYY) et composés utiles dans le traitement des conditions modulées de secrétagogues BY (PYY) et composés utiles dans le traitement des conditions par PYY
GB0904285D0 (en) 2009-03-12 2009-04-22 Prosidion Ltd Compounds for the treatment of metabolic disorders
GB0904284D0 (en) 2009-03-12 2009-04-22 Prosidion Ltd Compounds for the treatment of metabolic disorders
GB0904287D0 (en) 2009-03-12 2009-04-22 Prosidion Ltd Compounds for the treatment of metabolic disorders
JP7422498B2 (ja) * 2019-07-25 2024-01-26 芳武 村山 ペプチド、細胞遊走抑制剤、細胞浸潤抑制剤、がん細胞転移抑制剤、及び医薬

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5691188A (en) * 1994-02-14 1997-11-25 American Cyanamid Company Transformed yeast cells expressing heterologous G-protein coupled receptor
JPH10502245A (ja) * 1994-06-29 1998-03-03 メルク エンド カンパニー インコーポレーテッド 改変g−蛋白質結合リセプタ
WO1998038217A1 (fr) * 1997-02-27 1998-09-03 Milt Teitler Recepteurs de serotonine actives par constitution

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0012704A3 *

Also Published As

Publication number Publication date
CA2344591A1 (fr) 2000-03-09
AU5700999A (en) 2000-03-21
JP2002523090A (ja) 2002-07-30
WO2000012704A9 (fr) 2000-06-08
CA2343046A1 (fr) 2000-03-09
WO2000012705A9 (fr) 2000-07-13
AU756244B2 (en) 2003-01-09
EP1123391A2 (fr) 2001-08-16
WO2000012705A3 (fr) 2000-10-05
WO2000012704A3 (fr) 2000-11-30
WO2000012704A2 (fr) 2000-03-09
AU5701199A (en) 2000-03-21
WO2000012705A2 (fr) 2000-03-09
JP2002523091A (ja) 2002-07-30

Similar Documents

Publication Publication Date Title
EP1112359A2 (fr) Expression fonctionnelle amelioree des recepteurs couples a la proteine g
Price et al. Functional coupling of a mammalian somatostatin receptor to the yeast pheromone response pathway
US6406871B1 (en) Method for detecting ligand binding to G protein coupled receptors
US5482835A (en) Methods of testing in yeast cells for agonists and antagonists of mammal G-protein coupled receptors
US20080153124A1 (en) Methods for improving the function of heterlogous G protein-coupled receptors
JP5108062B2 (ja) Gタンパク質キメラ体
Harashima et al. Gα subunit Gpa2 recruits kelch repeat subunits that inhibit receptor-G protein coupling during cAMP-induced dimorphic transitions in Saccharomyces cerevisiae
JP2009143932A (ja) 改変g蛋白質を発現する酵母細胞及びそれらの利用方法
Ladds et al. Modified yeast cells to investigate the coupling of G protein‐coupled receptors to specific G proteins
US6291177B1 (en) Assay for agents which alter G-protein coupled receptor activity
WO2002083934A1 (fr) Recepteur p2yac implique dans l'agregation plaquettaire
Chinault Molecular mechanisms of G protein activation
Overton G protein-coupled receptor structure and activation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010426

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050401