EP0977872A1 - PROTEINASE, ISSUE DE $i(STREPTOCOCCUS PNEUMONIAE) DEGRADANT LA PROTEINE C3 HUMAINE DU COMPLEMENT - Google Patents

PROTEINASE, ISSUE DE $i(STREPTOCOCCUS PNEUMONIAE) DEGRADANT LA PROTEINE C3 HUMAINE DU COMPLEMENT

Info

Publication number
EP0977872A1
EP0977872A1 EP98918689A EP98918689A EP0977872A1 EP 0977872 A1 EP0977872 A1 EP 0977872A1 EP 98918689 A EP98918689 A EP 98918689A EP 98918689 A EP98918689 A EP 98918689A EP 0977872 A1 EP0977872 A1 EP 0977872A1
Authority
EP
European Patent Office
Prior art keywords
protein
nucleic acid
seq
antibody
pneumoniae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP98918689A
Other languages
German (de)
English (en)
Inventor
Margaret K. Hostetter
Gary Dunny
Lakshmi S. Nandiwada
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota
Original Assignee
University of Minnesota
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota filed Critical University of Minnesota
Publication of EP0977872A1 publication Critical patent/EP0977872A1/fr
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • This invention relates to Streptococcus pneumoniae and in particular this invention relates to the identification of an S. pneumoniae protein that is capable of degrading human complement protein. C3.
  • S pneumoniae Streptococcus pneumoniae
  • S pneumoniae Respiratory infection with the bacterium Streptococcus pneumoniae leads to an estimated 500,000 cases of pneumonia and 47.000 deaths annually.
  • Those persons at highest risk of bacteremic pneumococcal infection are infants under two years of age and the elderly. In these populations. S. pneumoniae is the leading cause of bacterial pneumonia and meningitis. Moreover. S. pneumoniae is the major bacterial cause of ear infections in children of all ages. Both children and the elderly share defects in the synthesis of protective antibodies to pneumococcal capsular polysaccharide after either bacterial colonization, local or systemic infection, or vaccination with purified polysaccharides.
  • S pneumoniae is the leading cause of invasive bacterial respiratory disease in both adults and children with HIV infection and produces hematogenous infection in these patients (Connor et al. Current Topics in AIDS 1987;1 : 185-209 and Janoff et al. nn. Intern. Med. 1992;117(4):314- 324).
  • Conjugate vaccines consist of pneumococcal capsular polysaccharides coupled to protein carriers or adjuvants in an attempt to boost the antibody response.
  • conjugate vaccines there are other potential problems with conjugate vaccines currently in clinical trials. For example, pneumococcal serotypes that are most prevalent in the United States are different from the serotypes that are most common in places such as Israel. Western Europe, or Scandinavia. Therefore, vaccines that may be useful in one geographic locale may not be useful in another. The potential need to modify .
  • pneumococcal proteins have been proposed for conjugation to pneumococcal capsular polysaccharide or as single immunogens to stimulate immunity against S. pneumoniae.
  • Surface proteins that are reported to be involved in adhesion of S. pneumoniae to epithelial cells of the respiratory tract include PsaA, PspC/CBPl 12. and IgAl proteinase (Sampson et al. Infect. Immun. 1994;62:319-324, Sheffield et al. Microb. Pathogen. 1992; 13: 261-9, and Wani, et al. Infect. Immun. 1996; 64:3967-3974).
  • Antibodies to these adhesins could inhibit binding of pneumococci to respiratory epithelial cells and thereby reduce colonization.
  • Other cytosolic pneumococcal proteins such as pneumolysin, autolysin, neuraminidase, or hyaluronidase are proposed as vaccine antigens because antibodies could potentially block the toxic effects of these proteins in patients infected with S. pneumoniae.
  • these proteins are typically not located on the surface of S. pneumoniae, rather they are secreted or released from the bacterium as the cells lyse and die (Lee et al. Vaccine 1994; 12:875-8 and Berry et al. / «/ect. Immun. 1994; 62:1101-1108).
  • PspA pneumococcal surface protein A
  • the PspA structure includes an alpha helix at the amino terminus, followed by a proline-rich sequence, and terminates in a series of 1 1 choline-binding repeats at the carboxy-terminus.
  • PspA is not structurally conserved among a variety of pneumococcal serotypes, and its function is entirely unknown (Yother et al. J. Bacteriol. 1992;174:601-9 and YotherJ. Bacteriol. 1994;176:2976-2985). Studies have confirmed the immunogenicity of PspA in animals (McDaniel et al. Microb. Pathogen. 1994; 17;323-337). Despite the immunogenicity of PspA, the heterogeneity of PspA, its existence in four structural groups (or clades), and its uncharacterized function complicate its ability to be used as a vaccine antigen.
  • the third component of complement, C3, and the associated proteins of the alternative complement pathway constitute the first line of host defense against S. pneumoniae infection.
  • complement proteins cannot penetrate the rigid cell wall of S. pneumoniae
  • deposition of opsonic C3b on the pneumococcal surface is the principal mediator of pneumococcal clearance.
  • Interactions of pneumococci with plasma C3 are known to occur during pneumococcal bacteremia, when the covalent binding of C3b, the opsonically active fragment of C3, initiates phagocytic recognition and ingestion (Johnston et al. J. Exp. Med 1969;129:1275-1290, Hasin HE, J. Immunol.
  • This invention relates to the identification and use of a family of human complement C3-degrading proteinases expressed by S. pneumoniae.
  • the protein has a molecular weight of about 24 kD to about 34 kD as determined on a 10% SDS polyacrylamide gel.
  • the invention includes a number of proteins isolatable from different C3 -degrading strains of S. pneumoniae.
  • the invention relates to an isolated protein comprising at least an 80% sequence identity of SEQ ID NO:2 and capable of degrading human complement protein C3.
  • the protein is isolated from S. pneumoniae or alternatively the protein is a recombinant protein.
  • the protein binds human complement protein C3.
  • the protein has a molecular weight as determined on a 10% polyacrylamide gel of between about 24 kDa to about 34 kDa.
  • a preferred protein of this invention is an isolated protein including SEQ ID NO:2.
  • the invention also relates to peptides from the C3-degarding proteinase of this invention and preferably peptides of at least 15 sequential amino acids from an isolated protein comprising at least an 80% sequence identity of SEQ ID NO:2 and capable of degrading human complement protein C3 and more preferably peptides of at least 15 sequential amino acids from SEQ ID NO:2.
  • the invention relates to a peptide of at least 15 sequential amino acids from SEQ ID NO:2.
  • the protein of this invention can comprise SEQ ID NO:2, and preferably has a molecular weight as determined on a 10% polyacrylamide gel of between about 24 kDa to about 34 kDa. Also preferably the protein degrades human complement protein C3.
  • Preferred protein or polypeptides of this invention include a protein comprising amino acids 1-50 of SEQ ID NO:2 and a nucleic acid fragment comprising nucleic acids 1246 to 1863 of FIG. 1A.
  • the invention in another aspect of the invention relates to a protein that degrades human complement protein C3 and wherein nucleic acid encoding the protein hybridizes to SEQ ID NO: 1 under hybridization conditions of 6XSSC, 5X Denhardt, 0.5% SDS, and 100 ⁇ g/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC. 0.1% SDS at room temperature for at least 3-5 minutes.
  • the invention also relates to an immune-system stimulating composition
  • an immune-system stimulating composition comprising an effective amount of an immune system-stimulating peptide or polypeptide comprising at least 15 amino acids from a protein comprising at least an 80% sequence identity with SEQ ID NO:2 and capable of degrading human complement protein C3.
  • the protein is isolatable from S. pneumoniae.
  • the immune system stimulating composition further comprises at least one other immune stimulating peptide, polypeptide or protein from S. pneumoniae.
  • the invention further relates to an antibody capable of specifically binding to a protein comprising at least a 80% sequence identity with SEQ ID NO:2 and capable of degrading human complement protein C3.
  • the antibody is a monoclonal antibody an din an other embodiment, the antibody is a polyclonal antibody.
  • the antibody is an antibody fragment.
  • the antibody or antibody fragments can be obtained from a mouse, a rat, human or a rabbit.
  • the invention also relates to a nucleic acid fragment capable of hybridizing to SEQ ID NO: l under hybridization conditions of 6XSSC. 5X Denhardt, 0.5% SDS, and 100 ⁇ g/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes.
  • the nucleic acid fragment is isolated from an S. pneumoniae genome and in another embodiment, the nucleic acid fragment encodes at least a portion of a protein.
  • the protein degrades human complement C3 and in another embodiment, the nucleic acid fragment encodes a protein that does not degrade human complement C3.
  • the nucleic acid fragment is in a nucleic acid vector and the vector can be an expression vector capable of producing at least a portion of a protein.
  • Cells containing the nucleic acid fragment are also contemplated in this invention.
  • the cell is a bacterium or a eukaryotic cell.
  • the invention further relates to an isolated nucleic acid fragment comprising the nucleic acid sequence gctcccagtatgcgtactcgtaaggtagagggaagaaaaaaactagctag.
  • the invention in another aspect of this invention, relates to a method for producing an immune response to S. pneumoniae in an animal including the steps of: administering a composition comprising a therapeutically effective amount of at least a portion of a protein to an animal, wherein nucleic acid encoding the protein hybridizes to SEQ ID NO:l under hybridization conditions of 6XSSC, 5X Denhardt, 0.5% SDS, and 100 ⁇ g/ml fragmented and denatured salmon sperm DNA, hybridized overnight at 65 °C and washed in 2x SSC, 0.1%) SDS one time at room temperature for about 10 minutes followed by one time at 65°C for about 15 minutes followed by at least one wash in 0.2xSSC.
  • the composition is a vaccine composition.
  • the at least a portion of the protein is at least 15 amino acids in length and also preferably the composition further comprises at least one other protein from S. pneumoniae.
  • the protein comprises at least 15 amino acids of SEQ ID NO:2.
  • the invention relates to a bacteria comprising an insertional mutation, wherein the insertion mutation is in a gene encoding a protein capable of degrading human complement C3.
  • the bacteria comprises an insertional duplication mutation.
  • the invention further relates to an isolated protein of about 24 kDa to about 34 kDa from Streptococcus pneumoniae that is capable of binding to and degrading human complement C3 and to a method for inhibiting Streptococcus pneumoniae-mediated C3 degradation comprising the step of : contacting a Streptococcus pneumonia bacterium with antibody capable of binding to a protein with at least 80% amino acid sequence identity to SEQ ID NO:2.
  • the invention further relates to an isolated nucleic acid fragment comprising the nucleic acid sequence of SEQ ID NO:l and to an RNA fragment transcribed by a double-stranded DNA sequence comprising SEQ ID NO: 1.
  • Figure 1A provides a gene sequence and Figure IB provides an amino acid sequence of a C3 degrading proteinase of this invention.
  • Figure 2 is a diagram of an insertion duplication mutant according to this invention.
  • Figure 3 is a diagram of the restriction analysis of an insert from an insertion duplication mutant of this invention.
  • the present invention relates to the identification and isolation of a C3 degrading proteinase with a molecular weight of about 29 kDa ( ⁇ 5 kDa) on a 10%) SDS-PAGE gel (with a predicted size of about 27.5 kDa based on SEQ ID NO:l) and nucleic acid encoding the C3 degrading proteinase.
  • the protein was originally identified by electrophoresis of pneumococcal lysates on SDS-PAGE gels impregnated with C3.
  • the term "degrade” is used herein to refer to enzymes that are capable of cleaving proteins into amino acids, peptides and/or polypeptide fragments.
  • the proteins of this invention degrade C3 without producing specific cleavage fragments as observed on a polyacrylamide gel.
  • a C3-degrading proteinase of about 29 kDa was isolated from a library of insertionally interrupted pneumococcal genes by identifying those clones that had increased C3 degrading activity as compared to wild type S. pneumoniae.
  • Exemplary methods for performing insertion duplication mutagenesis and for the identification of clones with elevated C3 degrading activity is provided in Example 1.
  • a gene encoding a C 3 -degrading proteinase is contained within a region that includes four open reading frames and interruption of the third open reading frame by homologous recombination severely impaired C3 degradation.
  • ORF3 includes about 726 nucleotides and the sequence of the translated protein shares no substantial homology with proteins registered in either the GenBank or SwissProt databases.
  • the full length gene encoding a C3 -degrading proteinase of this invention was inserted into a gene expression vector for expression in E. coli.
  • the gene encoding the C3 degrading protein of this invention was identified using a plasmid library made with pneumococcal genomic DNA fragments from strain CP1200.
  • a plasmid library was constructed with Sau 3A digested pneumococcal genomic DNA fragments (0.5 -4.0 kb) from pneumococcal strain CP 1200 (obtained from D.A. Morrison, University of Illinois, Champagne-Urbana. Illinois and described in Havarstein LF, et al. Proc. Natl. Acad. Sci.
  • Plasmid library DNA was extracted from the E. coli transformants and was used to transform the CP 1200 parent pneumococcal strain using insertional mutatgenesis homologous recombination.
  • the pneumococcal strain CP 1200 cells were made competent using a pH shift with HCI procedure in CTM medium. The competent cells were frozen at -70° C in small aliquots until needed. Eight thousand pneumococcal transformants were produced using these methods.
  • the optical densities of the mutant and parent strains were compared to that of negative controls.
  • the negative controls were culture medium containing different concentrations of C3.
  • the percent of C3 degrading activity was determined as a ratio of optical density of sample to control.
  • Four mutants (SN3, SN4, SN5 and SN6) were identified with elevated C3 degrading activity (about 2-2.2 fold higher activity) as compared with the activity of the about 29 kDa C3-degrading protein from parent strain CP1200. This finding was confirmed by Western Blot analysis.
  • Protein samples from the native C3-degrading protein and from mutants SN3, SN4, SN5, SN6 were incubated with C3 and separated on a 7.5% SDS-PAGE gel under reducing conditions. C3 degrading activity was assessed using western blot analysis employing HRP-conjugated antibody to C3. Mutant SN4 and mutant SN4-4G were used in further experiments. Mutant SN4-4G was identified after CP 1200 was retransformed with the recombinant plasmid pLSN4a rescued from SN4. Both mutant SN4 and mutant SN4-4G almost completely degraded C3 after a 4 hr incubation.
  • Plasmid pLSN4a was used as a hybridization probe in southern hybridization experiments to verify the presence of the insert in chromosomal DNA samples from the pneumococcal mutants. The results confirmed that the vector with insert (pLSN4a) and also the origin of the inserts in the mutants SN3 and SN4 were integrated in the chromosomal DNA. Both mutants SN3 and SN4 consisted of two hybridizing junction fragments of sizes about -2.2 kb and about ⁇ 5.8 kb. These fragments were also present in their parent strain CP1200. There were two other hybridizing fragments at about ⁇ 4.2 kb and about ⁇ 3.
  • ORF3 nucleic acid sequence encoding a C3 degrading proteinase of this invention is provided in Figure 1 A and is designated SEQ ID NO:L
  • SEQ ID NO:2 The amino acid sequence of this C3 degrading proteinase is provided in Figure IB and is designated SEQ ID NO:2.
  • ORF3 PCR product
  • the entire ORF3 gene (PCR product) was cloned into Nde I and Bam H I sites of pet-28b(+).
  • the vector positions a His-Tag at the N-terminus of the protein.
  • the plasmid construct was transformed into an E. coli (DHL ⁇ MCR) strain for stabilization before it was transformed into an E. coli (BL 21 DE3) protease deficient strain for protein expression.
  • the BL 21 DE3 strain that included the construct (pet 28b(+) with ORF3) was induced for ORF3 protein expression.
  • Total cell protein extracts of the induced and uninduced cultures were tested for C3 degrading activity.
  • the expressed His-tagged ORF3 protein was about - 29 kDa ( ⁇ 5 kDa) on 10% SDS-PAGE gels in the induced samples from the insoluble protein fraction.
  • Solubilization of the ORF 3 protein from induced BL21 DE3 cultures was performed by treating the sample with: a) TES (50mM, ImM, 1M); b) 6mM G-HC1 + ImM DTT; c) 6mM G-HC1 + ImM DTT + 1% Tween 20; and d) 6mM G-HC1 + ImM DTT + 1% Triton X -100. Both treatments “c” and “d” resulted in soluble protein. Treatment “c” was used to produce solubilized recombinant C3 degrading protein that was used for further protein studies.
  • the isolated protein encoded by ORF 3 was incubated with human complement C3 for 4 hrs at 37°C in the presence of PBS. Control samples without the protein samples were used as negative controls for comparative purposes. The samples were run on SDS-PAGE gel under reducing conditions and analyzed for the structure of C3 by Western Blot assay using polyclonal antibodies to human complement C3. The results indicated that the samples contained a protein encoded by the ORF 3 region and that the protein degraded human C3 protein. Both ⁇ and ⁇ chains of C3 molecules were susceptible to degradation. In these experiments while the ⁇ chain was almost completely degraded, the ⁇ chain was also degraded, but to a somewhat lesser extent.
  • the C3 degrading proteins of this invention were designated CppA proteinases and the genes of this invention are designated cppA.
  • the proteins of this invention have an apparent molecular weight on a 10% SDS-polyacrylamide gel of about 29 kDa ( ⁇ 5 kDa) and preferably has a molecular weight of about 24 kDa to about 34 kDa.
  • Example 5 indicates that the proteinase is conserved throughout S. pneumoniae strains. However, those of ordinary skill in the art will recognize that some variability in amino acid sequence is expected and that this variability should not detract from the scope of this invention.
  • conserved mutations do not detract from this invention nor do variations in amino acid sequence identity of less than about 80 % amino acid sequence identity and preferably less than about 90% amino acid sequence identity where the protein is capable of degrading human complement protein C3, and particularly where the protein is isolated or originally obtained from an S. pneumoniae bacterium.
  • nucleic acid sequence variability is expected among the strains as is some amino acid variability.
  • conserved amino acid substitutions are known in the art and include, for example, amino acid substitutions using other members from the same class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations are not expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis or isoelectric point. Particularly preferred conservative substitutions include, but are not limited to, Lys for Arg and vice verse to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free NH 2 .
  • a preferred protein of this invention includes a protein with the amino acid sequence of SEQ ID NO:2.
  • proteins include those degrading human complement protein C3 and having nucleic acid encoding the protein that hybridizes to SEQ ID NO: 1 under hybridization conditions of 6XSSC, 5X Denhardt, 0.5% SDS, and 100 ⁇ g/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1 % SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1%) SDS at room temperature for at least 3-5 minutes are also contemplated in this invention.
  • Polypeptides or peptide fragments of the protein can also be used and a preferred protein of this invention comprises amino acids 1-50 of SEQ ID NO:2.
  • the proteins of this invention can be isolated or prepared as recombinant proteins. That is, nucleic acid encoding the protein, or a portion of the protein, can be incorporated into an expression vector or incorporated into a chromosome of a cell to express the protein in the cell.
  • the protein can be purified from a bacterium or another cell, preferably a eukaryotic cell and more preferably an animal cell. Alternatively, the protein can be isolated from a cell expressing the protein, such as a S. pneumoniae cell. Peptides of the CppA proteinase are also considered in this invention.
  • the peptides are preferably at least 15 amino acids in length and preferred peptides are peptides with at least 15 sequential amino acids from SEQ ID NO:2.
  • Another preferred protein fragment includes amino acids l-50 of SEQ ID NO:2.
  • Nucleic acid encoding CppA proteinase is also part of this invention.
  • SEQ ID NO:l is a preferred nucleic acid fragment encoding a CppA proteinase. Those of ordinary skill in the art will recognize that some substitution will not alter the CppA proteinase sequence to an extent that the character or nature of the CppA proteinase is substantially altered. For example, nucleic acid with an identity of at least 80% to SEQ ID NO:l is contemplated in this invention. A method for determining whether a particular nucleic acid sequence falls within the scope of this invention is to consider whether or not a particular nucleic acid sequence encodes a C3-degrading proteinase and has a nucleic acid identity of at least 80%> as compared with SEQ ID NO:l .
  • nucleic acid sequences encoding the CppA proteinase includes nucleic acid encoding CppA where the CppA has the same sequence or at least a 90% sequence identity with SEQ ID NO:2 but which includes degeneracy with respect to the nucleic acid sequence.
  • a degenerate codon means that a different three letter codon is used to specify the same amino acid.
  • RNA codons and therefore, the corresponding DNA codons, with a T substituted for a U
  • T substituted for a U can be used interchangeably to code for each specific amino acid:
  • GCA GCC Tyrosine (Tyr or Y) UAU or UAC Histidine (His or H) CAU or CAC Glutamine (Gin or Q) CAA or CAG Asparagine (Asn or N) AAU or AAC Lysine (Lys or K) AAA or AAG Aspartic Acid (Asp or D) GAU or GAC Glutamic Acid (Glu or E) GAA or GAG Cysteine (Cys or C) UGU or UGC Arginine (Arg or R) CGU, CGC, CGA, CGG, AGA, AGC Glycine (Gly or G) GGU or GGC or GGA or GGG Termination codon UAA, UAG or UGA Further, a particular DNA sequence can be modified to employ the codons preferred for a particular cell type.
  • nucleic acid sequences include nucleic acid fragments of at least 30 nucleic acids in length from SEQ ID NO: l or other nucleic acid fragments of at least 30 nucleic acids in length where these fragments hybridize to SEQ ID NO: 1 under hybridization conditions of 6XSSC, 5X Denhardt, 0.5% SDS, and 100 ⁇ g/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65°C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1%) SDS at room temperature for at least 3-5 minutes.
  • the nucleic acid fragments of this invention can encode all, none (i.e., fragments that cannot be transcribed, fragments that include regulatory portions of the gene, or the like) or a portion of SEQ ID NO:2 and preferably containing a contiguous nucleic acid fragment that encodes at least nine amino acids from SEQ ID NO:2. Because nucleic acid fragments encoding a portion of the CppA proteinase are contemplated in this invention, it will be understood that not all of the nucleic acid fragments will encode a protein, polypeptide or peptide with C3 degrading activity. Further, the nucleic acid of this invention can be mutated to remove or otherwise inactivate the C3 degrading activity of this protein.
  • nucleic acid fragments include get ccc agt atg (Claim 34).
  • nucleic acid fragments of this invention can be incorporated into nucleic acid vectors or stably incorporated into host genomes to produce recombinant protein including recombinant chimeric protein.
  • nucleic acid vectors are known in the art and include a number of commercially available expression plasmids or viral vectors. The use of these vectors is well within the scope of what is ordinary skill in the art. Exemplary vectors are employed in the examples, but should not be construed as limiting on the scope of this invention.
  • This invention also relates to antibody capable of binding specifically to a protein of about 29 kDa, and preferably a protein of about 24 kDa to about 34 kDa, from S. pneumoniae and preferably where the protein is capable of degrading human complement C3.
  • Polyclonal antibody can be prepared to a portion of the protein or to all of the protein.
  • monoclonal antibodies can be prepared to all or to a peptide fragment of the about 29 kDa C3 degrading protein of this invention.
  • Methods for preparing antibodies to protein are well known and well described, for example, by Harlow, et al. (supra).
  • the antibodies can be human derived, rat derived, mouse derived or rabbit derived. Protein-binding antibody fragments and chimeric fragments are also known and are within the scope of this invention.
  • the invention also relates to the use of immune stimulating compositions.
  • immune stimulating or “immune system stimulating” refers to protein or peptide compositions according to this invention that activates at least one cell type of the immune system.
  • Preferred activated cells of the immune system include phagocytic cells such as macrophages. as well as T cells and B cells.
  • Immune stimulating compositions comprising the peptides. polypeptides or proteins of this invention can be used to produce antibody in an animal such as a rat, mouse, rabbit, a human or an animal model for studying S. pneumoniae infection.
  • Preferred immune stimulating compositions include an immune stimulating amount of at least a peptide including at least 15 amino acids from the CppA proteinase.
  • the immune stimulating composition can further include other proteins in a pharmaceutically acceptable buffer, such as PBS or another buffer recognized in the art as suitable and safe for introduction of proteins into a host to stimulate the immune system.
  • the immune stimulating compositions can also include other immune system stimulating proteins such as adjuvants or immune stimulating proteins or peptide fragments from S. pneumoniae or other organisms.
  • a cocktail of peptide fragments may be most useful for controlling S. pneumoniae infection.
  • one or more fragments of the proteins of this invention are used in a vaccine preparation to protect against or limit S. pneumoniae colonization or the pathogenic consequences of S. pneumoniae colonization.
  • This invention also relates to a method for inhibiting Streptococcus pneumoniae-mediated C3 degradation comprising contacting a Streptococcus pneumonia bacterium with a protein, such as an antibody or another protein that is capable of binding to an isolated protein of about 24 kDa to about 34 kDa from Streptococcus pneumoniae.
  • a protein such as an antibody or another protein that is capable of binding to an isolated protein of about 24 kDa to about 34 kDa from Streptococcus pneumoniae.
  • the protein capable of binding to an isolated protein of about 24 kDa to about 34 kDa can be an antibody or a fragment thereof or the protein can be a chimeric protein that includes the antibody binding domain, such as a variable domain, from antibody that is capable of specifically recognizing an isolated protein of about 24 kDa to about 34 kDa from Streptococcus pneumoniae having C3 degrading activity.
  • the isolated S. pneumoniae protein of this invention can be isolated and purified and the isolated protein or immunogenic fragments thereof can be used to produce antibody. Peptide fragments or polypeptide fragments of the protein without C3 degrading ability can be tested for their ability to limit the effects of S. pneumoniae infection. Similarly, the protein of this invention can be modified, such as through mutation to interrupt or inactivate the C3 degrading capacity of the protein. Isolated protein can be used in assays to detect antibody to S. pneumoniae or as part of a vaccine or a multi-valent or multiple protein or peptide-containing vaccine for S. pneumoniae therapy.
  • the proteins of this invention can be surface expressed on vertebrate cells and used to degrade C3, for example, where complement deposition (or activation) becomes a problem, such as in xenotransplantation or in complement-mediated glomerulonephritis.
  • the recombinant protein, or a portion thereof can be incorporated into xenotransplant cells and expressed as a surface protein or as a secreted protein to prevent or minimize complement deposition (and/or complement-mediated inflammation).
  • insertion-duplication mutagenesis was used to isolate a gene encoding the C3 degrading proteinase from Streptococcus pneumoniae of this invention.
  • a plasmid library was created with 0.5 - 4.0 kb chromosomal fragments of pneumococcal strain CP 1200 (derivative of RX1 ; Morrison, D. A., et al. J. Bacteriol, 156:281-290,1983) originally obtained from Dr. Morrsion' s lab, University of Illinois at Chicago and inserted into the Bam HI shuttle vector pVA 891 (erm r , cm' Marcina, F.L. et. al. Gene 25:145-150, 1983, obtained from Dr.
  • pVA891 has resistance markers for erythromycin (erm) and chloramphenicol (cm).
  • the vector has an origin of replication for E. coli, but the origin is no n-replicative in Streptococci. Recombinant plasmid can survive when it integrates into the pneumococcal chromosomal DNA by homologous recombination .
  • E. coli DH5 ⁇ MCR competent cells were made according to the procedure given in the Bio-Rad Laboratories manual (Richmond, CA) and the library was transformed into the competent cells with Bio-Rad Gene Pulser apparatus (Bio-Rad Laboratories, Richmond, CA) by electroporation.
  • E. coli cells were maintained as freezer stocks in small aliquots at -80°C, in LB broth in the presence of 10% glycerol. The cells were grown either in LB or TB broth or on LB agar plates containing appropriate antibiotics (erythromycin 200 ⁇ g/ml or chloramphenicol 15 or 30 ⁇ g /ml or kanamycin 30 ⁇ g/ml).
  • Electroporation was conducted in 0.1 cm cuvette at 1- 2 kV/cm voltages and a capacitance of 200 ⁇ .
  • Transformants were selected on LB medium containing either chloramphenicol (cm, 30 ⁇ g /ml) or erythromycin (erm, 300 ⁇ g /ml) or combination of erm and cm (200ug/ml + 15ug/ml).
  • chloramphenicol cm, 30 ⁇ g /ml
  • erythromycin erm, 300 ⁇ g /ml
  • combination of erm and cm 200ug/ml + 15ug/ml
  • Plasmids or recombinant plasmids were extracted from E. coli strains by polyethylene glycol precipitation procedure (Kreig. P. and Melton. D., in Promega Protocols and Applications p. 106, 1985-86) or a modified alkaline lysis miniprep protocol (Xiang. C, et al., Biotechniques. 17:30-32, 1994) a modified alkaline extraction procedure (Birnboim H C and J Doly., Nucl. Acids Res. 7:1513-1523, 1979), or CsCl-ethidium bromide gradient method or Qiagen kit (Plasmid midi kit., Chartsworth, CA).
  • the plasmids were transformed into Pneumococcal cells.
  • the pneumococcal strains were always maintained as freezer stocks in small aliquots at -80°C, in THB in the presence of 10% glycerol.
  • Pneumococcal cells were grown without shaking in CAT (Morrison, D. A., et al., 1983, supra) or THB medium (broth or agar).
  • CAT Mention, D. A., et al., 1983, supra
  • THB medium broth or agar
  • For transformation experiments either complete transformation (CTM) broth (Morrison, D. A., et al. 1983) or THB+ 0.5% Yeast broth (Yother Janet., et al. J. Bacteriol.
  • SMP a synthetic medium (see Table 1) were used.
  • Erythromycin (0.05 ⁇ g /ml) was employed as a selective antibiotic marker for pneumococcal mutants.
  • Table 1 SMP - a synthetic medium
  • SMP solution 2 (vitamins): Biotin 0 075 mg, Choline 25 mg, Nictinamide 3 0 mg, ca pantothenate 12 0 mg, Py ⁇ doxal HCI 3 0 mg. Riboflavin 1 5 mg, Thiamme 3 0 mg. L-Cysteine I 1C1 0 5 g, L-Glutamine 0 1 g, Na Pyruvate 4 ⁇ g. add water and then make up to 50ml
  • Pneumococcal strain CP 1200 cells were made competent by "competence induction by pH shift" (procedure obtained from Dr. Morrison ' s lab, Univ. of Illinois at Chicago, 111.) in CTM medium and the competent cells were frozen at -70 ° C in small aliquots until required.
  • CTM a mixture of cells
  • IM HCI final concentration 9mM
  • O.D. 0.2 O.D. (550 nm) of frozen pneumococcal stock cells.
  • This culture was incubated at 37°C and O.D. readings of the culture were taken at 20 minute intervals beginning after 3 hrs of incubation. When the culture reached an O.D.
  • the transformation culture was diluted and plated on selective medium (erythromycin 0.05 ⁇ g/ml). The time point sample that showed the highest transformation efficiency was used for future transformation experiments. Transformation of the extracted recombinant plasmid library from E coli transformants into pneumococcal strain CP1200 yielded about 8,000 pneumococcal transformants indicating that the plasmid was inserted into the CP1200 chromosome via homologous recombination.
  • cells were resuspended in 1/100 volume of cold STE, lysed with 1% Triton X-100, and incubated at 37°C for 5-10 minutes for autolysis. After the addition of 1% SDS, the cells were swirled in water bath at 50-60°C for 5 min. RNase (100 ⁇ g/ml) and proteinase K (50 ⁇ g/ml) were added sequentially with incubations of 2 hours and 1 hours, respectively. The cells were extracted twice with one volume of phenol/chloroform and once with one volume of chloroform and the supernatant was collected for ethanol precipitation.
  • RNase 100 ⁇ g/ml
  • proteinase K 50 ⁇ g/ml
  • the precipitate was washed twice with 70% ethanol, and the pellet was collected and resuspended in TE (lOmM Tris-HCl pH 8.0, ImM EDTA) or water as required.
  • TE lOmM Tris-HCl pH 8.0, ImM EDTA
  • the plasmid library DNA was extracted by polyethylene glycol precipitation procedure (Kreig. P. and Melton. D. 1985 supra), from pooled E. coli transformants and used to transform CP 1200, the parent pneumococcal strain following the method that was obtained from Dr. Morrison, University of Illinois at Chicago.
  • frozen pneumococcal competent cells were thawed on ice and to 100 ⁇ l of these competent cells.
  • plasmid library 200 ng to 1000 ng of plasmid library was added in a separate eppendorf tube. This tube was incubated at 37°C in a water bath for about 25 min to 35 min and the mixture was diluted 1/10 in CAT medium and incubated further for about 1-1.7 hrs. Following the final incubation, the mixture was plated by overlay procedure (method was obtained from Dr. Morrison University of Illinois at Chicago).
  • E. coli Spontaneous excision of recombinant plasmids occur in these kind of pneumococcal mutants with low frequency and therefore, chromosomal DNA preparations of these mutants often include low levels of plasmid DNA (Pearce B J., et al., Mol. Microb. 9(5):1037-1050, 1993). Electroporation of E. coli is a highly efficient way of isolating the plasmid constructs in E. coli for further study. Chromosomal DNA (100 ng-200 ng in a final volume of 2 ⁇ ls) from the individual pneumococcal mutants of interest was electroporated into E. coli DH5 ⁇ MCR competent cells to obtain E.
  • coli transformants with recombinant plasmids.
  • One of the recovered recombinant plasmids (pLSN4a) (see Table 2) was introduced back into wild type CP 1200 pneumococcal strain by transformation.
  • the transformant SN4-4G was again evaluated for its C3 degrading activity by ELISA.
  • DNA fragments were analyzed by horizontal electrophoresis in agarose gels (0.5 % to 1.0%) with Tris-borate EDTA (TBE) buffer or Tris-acetic acid EDTA (TAE) buffer (Sambrook, J. E. Fritsch and T.Maniatis.1989).
  • TBE Tris-borate EDTA
  • TAE Tris-acetic acid EDTA
  • DNA fragments were analyzed by Southern hybridization. DNA was transferred from gels to MSI Magnagraph nylon membranes (Micron Separations, Inc., Westboro, MA) for hybridization and detection using Genius nonradioactive DNA labeling and detection kit (Boehringer Mannheim).
  • Chromosomal or plasmid DNA either from the pneumococcal or E. coli culture was isolated as described in earlier sections. About 100 ng - 400 ng of each sample was digested with required restriction enzymes and run on 0.7% agarose gel, transblotted onto Magnagraph-nylon membrane overnight. The rest of the procedure was performed as instructed by the manufacturer.
  • pneumococcal transformants were screened by ELISA for their altered C3 degrading activity.
  • the pneumococcal transformants were grown individually in THB in the presence of erythromycin (0.05 ⁇ g/ml) in microtitre plates up to log phase and diluted 1/0 in SMP medium (0.05 ⁇ g of erythromycin ml).
  • the SMP bacterial cultures were grown up to log phase and incubated with C3 (0.83 ⁇ g of C3/ml of culture) for 2-4 hrs. After incubation with C3, 100 ⁇ ls of each individual transformant was transferred to an ELISA binding plate and incubated overnight at 4°C.
  • the plates were washed with PBS (10 ⁇ M phosphate buffer saline + 0.05% Tween-20) three times. 100 ⁇ l of HRP- conjugated goat polyclonal antibody specific to human complement C3 (1 : 10000 dilution of 48mg/m ⁇ ) was added to each well and the plates were incubated for 1- 2 hrs at 37°C. Each microtitre plate was washed with PBS as described above.
  • E. coli cultures with or without plasmids were grown from freezer stock cultures, in THB or LB up to log phase and incubated with C3 (0.83 ⁇ g of C3 / ml) for 2- 4 hrs, the cultures were spun down (2,500 rpm for 15min RT or 4°C) and the supernatants were collected. The optical densities of the cultures were carefully monitored and samples were equalized before being subjected to incubation with C3. Equal amounts of all collected supernatants containing undegraded C3 were applied to 7.5% or 10% SDS-PAGE gels under reducing conditions. The gel was transblotted to nitrocellulose membrane (75 volts; 4°C) for 1 hr.
  • Proteins were transferred in this example and in subsequent examples from gels to nitrocellulose membranes using a Hoeffer transfer apparatus in Towbin buffer (3.03g Tris, 14.4g glycine and 200ml Methanol in 1 litre volume pH.8.3; Towbin et al. (1979) RN ⁇ S:4350-4354) for lhr at 70 volts or gels were stained with 0.125%) Coomassie Brilliant Blue R-250 (Pierce, Rockford, IL) made in 50% Methanol and 10% Acetic acid.
  • Towbin buffer 3.03g Tris, 14.4g glycine and 200ml Methanol in 1 litre volume pH.8.3; Towbin et al. (1979) RN ⁇ S:4350-4354
  • Coomassie Brilliant Blue R-250 Pierce, Rockford, IL
  • the blot was incubated in 10% skim milk (skim milk powder) for lhr (room temperature) or overnight (4°C) with gentle shaking.
  • the blot was washed in TTBS (0.1% Tween, 20 mM Tris, 137mM Saline Buffer) several times and incubated with a 1 : 1000 dilution of HRP- conjugated goat antihuman C3, polyclonal antibody, IgG fraction (IC ⁇ Pharmaceuticals/Cappel, Costa Mesa. CA) made in 3X TTBS+3% BSA for 1 hr with gentle shaking.
  • the incubated blot was washed again several times in TTBS and incubated for one minute in chemiluminescent reagents (1 : 1 ratio of 2X luminol/Enhancer and 2X stable peroxide solutions, Pierce. Rockford, IL). This blot was exposed to films for 5 sec to several seconds in the dark and the films were developed.
  • the SDS- PAGE gels always contained pre-stained high molecular weight markers
  • Electroporation of chromosomal DNA from the hyper-active pneumococcal mutants, SN3, SN4, SN5 and SN6 into E. coli DH5 ⁇ MCR competent cells gave rise to E. coli transformants with rescued recombinant plasmids.
  • LSN5, LSN6, LSN4G contained plasmids (Table 2 from pneumococcal mutants, SN3, SN4 SN5, SN6 and SN4-4G mutants respectively). Details of E. coli strains containing different constructs are listed in Table 2 (supra).
  • the fourth pneumococcal mutant, SN6 gave two different, ⁇ 6.5kb and ⁇ 10.5kb recombinant plasmids, pLSN ⁇ a and pLSN6 b which had inserts of 1.1 kb and 5.1kb respectively. These pneumococcal mutants were also examined by southern hybridization. The hyperactive pneumococcal mutant SN4 was chosen for further studies of C3 degradation and therefore, the recombinant plasmid pLSN4 which was rescued from the mutant SN4 was subjected to a full investigation.
  • Plasmid pLSN4 was used as a probe against EcoRI digested chromosomal DNA samples of the pneumococcal mutants and this confirmed the integration of the vector + insert (pLSN4) in the mutants SN3 and SN4. Both SN3 and SN4 hyperactive mutants included two hybridizing fragments of sizes ⁇
  • Double stranded DNA sequence analysis was performed on the insert part of the recombinant plasmid pLSN4. Since this insert was associated with C3 degrading hyper-activity, we expected to see insertion either in regulatory region of the corresponding gene or duplication of the gene; however, there was no indication of insertion in a regulatory region on the basis of the protein data base search. This suggested the possibility of gene duplication.
  • ORFs full open reading frames
  • One partial open reading frame with no significant homology between the derived amino acid sequences of the above ORFs and the proteins as provided in searches of GenBank, Blast and SwissProt databases. Preliminary data (Cathryn A S., et al. , J. Inf. Dis.
  • Double-stranded DNA of plasmid pLSN4a was prepared using CsCl gradient /ethidium bromide isolation and used as a template. Oligonucleotide primers were synthesized using an applied Biosystems 391 automated synthesizer, by Gibco BRL. or by Oligo 1000M DNA synthesizer (Beckman Instruments Inc.
  • DNA amplifications were carried out using a Hybaid Omnigene machine with primers (see Table 4 for primers' sequences and amplification cycle conditions) complimentary to the 5' and 3' ends of the required DNA fragments. All the primers were constructed to include a restriction site on both ends.
  • the amplification reaction (final volume 0.1 ml volume) utilized 10 ⁇ l of 10X vent buffer (final concentration, IX contains: lOmM KC1, lOmM (NH 4 )S0 4 .
  • Applied Biosystems Model 373a DNA sequencer DNA Sequencing Core Facility, Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida, Gainesville, FL).
  • a Robotlo Workstation (ABI Catalyst 800) and a Perkin Elmer-Cetus PEC 9600 thermocycler were used in cycle sequencing reactions.
  • the template an amplified gene product that represented the whole insert from plasmid pLSN4a, was cleaned directly from 0.7% agarose gel by Qiagen kit before it was used for automated sequencing.
  • the sequencing analysis was conducted with programs (fasta, blast and other programs) available in the GCG software package.
  • PCR-l(LSN4a-L) CAG GAA GCT TGA TCT TGA AAT TTC TAT GAC TCC (SEQ ID NO:3)
  • PCR-l(LSN4a-R) CGA GAA GCT TGA TCC TGT CGA AAT CAA AGC AGG ACG (SEQ ID NO:4)
  • ORF3 is one of the open reading frames of the insert that was present in the pLSN4 and encoded C3 degrading proteinase
  • ORF3a is an internal part of the cppA (ORF3)gene which was used to disrupt the cppA (ORFS) gene in the parent pneumococcal strain CP1200.
  • the CppA protein appeared to preferentially degrade the C3 ⁇ chain.
  • a 620 bp internal portion of the cppA gene was ligated into Hind III site of pVA 891 and the construct was transformed into CP 1200 competent cells. The obtained transformant was tested for its ability to degrade C3.
  • the ORF3 mutant was found to have a poor activity.
  • the x chain of the C3 molecule was degraded and the ⁇ -chain was less degraded, by SDS-PAGE and western blotting analysis in comparison with its parent strain CP 1200.
  • the reduced activity rather than a complete absence of activity in the mutant indicated that the potential for the presence of another fully functional gene encoding another C3 degrading proteinase in the mutant.
  • the entire cppA gene was amplified and cloned into Nde I and Bam H I sites of pet-28b(+) (Novagen, INC. Madison, WI) and the gene was incorporated with a His-Tag in its N-terminus region. The entire gene was positioned in the vector in frame as confirmed by sequence analysis.
  • the plasmid construct was transformed into E. coli DH5 oc MCR strain for stabilization and the presence of the insert was verified before the vector and insert were transformed into E. coli BL 21 D3 (Novagen) protease deficient strain for expression.
  • the colonies containing the plasmid constructs were selected on LB medium containing kanamycin (30 ⁇ g/ml).
  • Protein was isolated according to the Pet System manual (Madison, WI) for small scale or large scale preparations.
  • the BL 21 DE3 strain containing the construct (pet 28b(+)::ORF3 (cppA gene) was induced by IPTG and the expressed protein, CppA, was solubilized.
  • the induced bacterial cultures were centrifuged and the pellet was resuspended in TES (50 mM Tris; 1 mM EDTA; 100 mM NaCl).
  • the resuspension was sonicated (6x 15 sec pulses at a high output setting: about 50 watts) on ice and spun down to collect the pellet.
  • the pellet was washed in TES (50 mM Tris; 1 mM EDTA; 100 mM NaCl) twice and finally the pellet was treated with 6mM G-HC1 + ImM DTT + 1 % Tween-20 for 3 hrs at 4°C.
  • TES 50 mM Tris; 1 mM EDTA; 100 mM NaCl
  • the solubilized protein was diluted 1 : 10 in TTS (1% Tween, 50 mM Tris, 0.7M NaCl) and dialyzed against TTS (1% Tween, 50 mM Tris .0.7M NaCl) to remove Guanidine-HCl, DTT and EDTA.
  • the dialysed CppA protein was purified by Nickel column chromatography using the Pet system manual instructions (Novagen, INC. Madison, WI). Nickel column (2.5 ml) was poured and after removal of Guanidine-HCl, DTT and EDTA, the expressed His-Tagged CppA protein was applied to the Nickel column for purification.
  • the eluted fractions were tested for His-Tagged-CppA protein by 10% SDS-PAGE gel and Coomassie Brilliant Blue R- 250 staining. The protein was kept on ice at 4°C or frozen in small aliquots at -80°C until required.
  • the CppA protein (about 600 ng per ml of the reaction mixture) was incubated with human complement C3 (0.83 ⁇ g of C3 per ml of the reaction mixture) for 4 hrs at 37°C in the presence of PBS and a negative control without protein was simultaneously set up.
  • the samples were analyzed by 7.5% or 10% SDS-PAGE gel under reducing conditions and western-blotting (ECL Western blotting protocols -Amersham Life Sciences, Arlington Heights, IL).
  • the PCR product of the whole ORF3 gene was subcloned into pet vector pET28b(+) (Novagen, Madison, WI) with a His-tag in the amino terminus position and the construct was introduced into protease deficient strain E. coli BL 21 DE3 (Table 2) after it was stabilized in E. coli DH5 ⁇ MCR.
  • the E. coli BL 21 DE3 with the construct was subjected to induction by IPTG. Total cell protein extracts of the induced and uninduced cultures were tested.
  • the expressed His-tagged ORF3 protein ( - 29 kd) was identified in the insoluble fraction of the induced protein sample on 10% SDS- Page gel.
  • Pre-stained high molecular weight standards Protein markers (kd) : lysozyme, 14,300; ⁇ -lactoglobulin, 18,400; carbonic anhydrase, 29,000; ovalbumin, 43,000; bovine serum albumin, 68,000; phophorylase B, 97,400 myosin, 200,00 (Bethesda research laboratories, life sciences, Grand Land, NY) were included on the gels.
  • the large SDS-PAGE gels were electrophoresed at 15mA for 14 hrs or 10mA for 20hr. Mini gels were electrophoresed around 2-3 hrs at a constant voltage (100 -150 volts).
  • the expressed protein was incubated with C3 and the amount of C3 present was assessed by Western immunoblotting. Immunoblotting analysis suggested that the samples that contained the expressed protein degraded C3 molecules. The undegraded C3 was detected by polyclonal antibodies specific to human complement C3 and this was clearly seen on the developed film in the case of the negative sample. Both ⁇ x and ⁇ chains of C3 molecules were seemed to be susceptible to the activity of the ORF3 protein in comparison with the negative control which did not contain any ORF3 protein; however, the oc chain was almost completely degraded while the ⁇ chain was partially degraded in the ORF3 samples.
  • the clinical isolates, typel, type3, type 14F and virulent type 23F showed a hybridized band of about 2.3kb which was also present in the control pneumococcal strain CP1200 and in the SN4 mutants. This common band indicates that the cppA gene was present in all isolates tested.
  • the SN4 mutants also contained a second band with a size of about 3.5kb indicating the presence of a gene duplication. The 3.5 kb size is consistent with the observation that plasmid pLSN4 has two restriction endonuclease recognition sites for EcoRI, one in the insert region and a second in the vector.
  • the restriction digestion with EcoRI produces two fragments of about 4.175 kb ( 3.531 kb of vector + 0.649 kb of insert) and 3.539kb ( ⁇ 1.67kb form insert + about 1.869 kb from vector) from the recombinant plasmid.
  • the cppA gene was located on the 1.67kb portion of the insert and hence the -3.539 kb restricted fragment of the recombinant plasmid contained the cppA gene and only this band would hybridize to the probe which was an internal fragment of the cppA gene; therefore, in the case of the mutants with duplicated cppA gene, the second hybridized band at - 3.5kb represented the duplicated cppA gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne l'identification et l'utilisation d'une famille de protéinases dégradant la protéine C3 humaine du complément, exprimées par S. pneumoniae. La protéinase de l'invention a un poids moléculaire d'environ 24 kD à environ 34 kD, conformément à la détermination sur un gel de polyacrylamide à 10 % de SDS. La protéinase préférée de l'invention comprend la séquence d'acides aminés SEQ ID NO:2.
EP98918689A 1997-04-24 1998-04-24 PROTEINASE, ISSUE DE $i(STREPTOCOCCUS PNEUMONIAE) DEGRADANT LA PROTEINE C3 HUMAINE DU COMPLEMENT Ceased EP0977872A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US4431697P 1997-04-24 1997-04-24
US44316P 1997-04-24
PCT/US1998/008281 WO1998048022A1 (fr) 1997-04-24 1998-04-24 Proteinase, issue de streptococcus pneumoniae degradant la proteine c3 humaine du complement

Publications (1)

Publication Number Publication Date
EP0977872A1 true EP0977872A1 (fr) 2000-02-09

Family

ID=21931691

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98918689A Ceased EP0977872A1 (fr) 1997-04-24 1998-04-24 PROTEINASE, ISSUE DE $i(STREPTOCOCCUS PNEUMONIAE) DEGRADANT LA PROTEINE C3 HUMAINE DU COMPLEMENT

Country Status (8)

Country Link
EP (1) EP0977872A1 (fr)
JP (1) JP2001523960A (fr)
KR (1) KR100544594B1 (fr)
CN (1) CN1253589A (fr)
AU (1) AU740153B2 (fr)
BR (1) BR9809405A (fr)
CA (1) CA2283755A1 (fr)
WO (1) WO1998048022A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6676943B1 (en) 1997-04-24 2004-01-13 Regents Of The University Of Minnesota Human complement C3-degrading protein from Streptococcus pneumoniae
WO1999015675A1 (fr) * 1997-09-24 1999-04-01 Regents Of The University Of Minnesota PROTEINASE DE DEGRADATION DE LA PROTEINE DE COMPLEMENT HUMAIN C3, TIREE DU $i(STREPTOCOCCUS PNEUMONIAE)
JP2002526082A (ja) * 1998-09-24 2002-08-20 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ ストレプトコッカス・ニューモニア由来のヒト補体ｃ３分解ポリペプチド

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1770164B1 (fr) * 1996-10-31 2010-09-01 Human Genome Sciences, Inc. Antigènes et vaccins pour streptococcus pneumoniae

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9848022A1 *

Also Published As

Publication number Publication date
CA2283755A1 (fr) 1998-10-29
AU740153B2 (en) 2001-11-01
JP2001523960A (ja) 2001-11-27
KR100544594B1 (ko) 2006-01-24
BR9809405A (pt) 2000-06-13
WO1998048022A9 (fr) 1999-04-15
KR20010012096A (ko) 2001-02-15
CN1253589A (zh) 2000-05-17
WO1998048022A1 (fr) 1998-10-29
AU7156698A (en) 1998-11-13

Similar Documents

Publication Publication Date Title
AU6060899A (en) Human complement c3-degrading polypeptide from (streptococcus pneumoniae)
AU9510598A (en) Human complement c3-degrading proteinase from (streptococcus pneumoniae)
US6291654B1 (en) Method for isolating a C3 binding protein of streptococcus pneumoniae
JP2001508650A (ja) 新規細菌ポリペプチドおよびポリヌクレオチド
WO1998021337A9 (fr) Proteine de liaison c3 de streptococcus pneumoniae
Hu et al. Morganella morganii urease: purification, characterization, and isolation of gene sequences
US6676943B1 (en) Human complement C3-degrading protein from Streptococcus pneumoniae
AU740153B2 (en) Human complement C3-degrading proteinase from streptococcus pneumoniae
WO2009113664A1 (fr) Médicament contenant une anatoxine dermonécrotique recombinante pour la rhinite atrophique du porc
EP1111059B1 (fr) Nouveau gene de lysozyme humain, son polypeptide de codage et leur procede de preparation
JP2001510990A (ja) 新規原核生物ポリヌクレオチド、ポリペプチドおよびそれらの使用
EP1111054B1 (fr) Gene de lysozyme humain, polypeptide code par celui-ci et leur procede de preparation
US6582950B1 (en) C3 binding polypeptide of Streptococcus agalactiae group b Streptococcus
EP1111058A1 (fr) Nouveau gene de lysozyme humain, son polypeptide de codage et leur procede de preparation
JPH11235181A (ja) 新規ｔｉｇ
JPH11235183A (ja) シグナル認識粒子ポリペプチドおよびポリヌクレオチド
JPH11235178A (ja) 新規ＭｕｒＢ
AU2420800A (en) Human complement C3-degrading polypeptide from streptococus pneumoniae
EP1111060A1 (fr) Nouveau gene de lysozyme humain, son polypeptide de codage et leur procede de preparation
MXPA00002932A (en) Human complement c3-degrading proteinase from streptococcus pneumoniae
JPH11155586A (ja) 新規な原核生物ポリヌクレオチド、ポリペプチドおよびその使用
JPH09504962A (ja) ストレプトコッカスピオジェンスから誘導される組換えｄｎアーゼｂ
Lei et al. Effect of Group A Streptococcal Cysteine
JPH11225777A (ja) 新規ｇａｐｄｈ
Belongs Adherence of the Gram-Positive Bacterium

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19991105

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RTI1 Title (correction)

Free format text: HUMAN COMPLEMENT C3-DEGRADING PROTEINASE FROM STREPTOCOCCUS PNEUMONIAE

17Q First examination report despatched

Effective date: 20020103

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20080731