AU2420800A - Human complement C3-degrading polypeptide from streptococus pneumoniae - Google Patents

Description

HUMAN COMPLEMENT C3-DEGRAD[NG POLYPEPrJ[)E FROM STREPTOCOCCUS PNEUMONL4E Field of the Invention This invention relates to &'replococcuspneuoniae and in particular this invention relates to the identification of an S pneumoniae polypeptide that is capable of degrading human complement protein C3.

Background of the Invention Respiratory infection with the bacterium Streptococcuspneumtoniae

(S.

pneumoniae) leads to an estimated 500,000 cases of pneumonia and 47,000 :deaths annually. Those persons at highest risk of bacteremic pneurnococcal infection are infants under two years of age, individuals with a compromised immune system and the elderly. In these populations, S& pneumoniae is the a...leading cause o f bacterial pneumonia and meningitis. Moreover, S. pneumoniae is the major bacterial cause of ear infections in children of all ages. Both children and the elderly share defects in the synthesis of protective antibodies to pneumococcai capsular polysaccharide after either bacterial colonization, local or systemic infection, or vaccination with purified polysaccharides.

S

*.pneumorziae is the leading cause of invasive bacterial respiratory disease in both adults and children with HIV infection and produces hematogenous infection in these patients (Connor et Current Topics in AIDS 198 7; 1:185-209 and Janoff et al. Ann. Intern Med 1992; 17(4):3 14-3 24).

Individuals who demonstrate the greatest risk for severe infection are not able to make antibodies to the current capsular polysaccharide vaccines. As a result 1 there are now four conjugate vaccines in clinical trial. Conjugate vaccines consist of paeumococcal capsular polysaccharides coupled to protein carriers or adjuvants in an attempt to boost the antibody response. However, there are other potential problems with conjugate vaccines currently in clinical trials. For example, pneuniococcal serotypes that are most prevalent in.the United States are different from the serotypes tbv-.i .i most cemion in places such as Israel, Western Europe, South Africa, or Scandinavia. Therefore, vaccines that may be useful in one geographic locale may not be useful in another. The potential need to modify currently available capsular polysaccharide vaccines or to develop protein conjugates for capsular vaccines to suit geographic serotype variability entails prohibitive financial and technical complications. Thus, the search for immunogenic, surface-exposed proteins that are conserved worldwide among a variety of virulent serotypes is of prime importance to the prevention of pneumococcal infection and to the formulation of broadly protective pneumococcal vaccines. Moreover, the emergence of 10 penicillin and cephalosporin-resistant pneumococci on a worldwide basis makes the need for effective vaccines even more exigent (Baquero et al. J Antimicrob.

Chemother. 1991;28S;31-8).

Several pneumococcal proteins have been proposed for conjugation to pneumococcal capsular polysaccharide or as single immunogens to stimulate immunity against S. pneumoniae. Surface proteins that are reported to be involved in adhesion of S. pneumoniae to epithelial cells of the respiratory tract include PsaA, PspC/CBP112, and IgAl proteinase (Sampson et al. Infect.

Immun. 1994;62:319.324, Sheffield et al. Microb. Pathogen 1992; 13: 261-9, and Wani, et al. Infect. Immun. 1996; 64:3967-3974). Antibodies to these adhesins could inhibit binding ofpneumococci to respiratory epithelial cells and thereby reduce colonization. Other cytosolic pneumococcal proteins such as pneumolysin, autolysin, neuraminidase, or hyaluronidase are proposed as vaccine antigens because antibodies could potentially block the toxic effects of these proteins in patients infected with S. pneumoniae. However, these proteins are typically not located on the surface of S. pneumoniae, rather they are secreted or released from the bacterium as the cells lyse and die (Lee et al. Vaccine 1994; 12:875-8 and Berry et al. Infect. Immun. 1994; 62:1101-1108). While use of these cytosolic proteins as immunogens might ameliorate late consequences of S. pneumoniae infection, antibodies to these proteins would neither promote pneumococcal death nor prevent initial or subsequent pneumococcal colonization.

A prototypic surface protein that is being tested as a pneurzococcal vaccine is the pneumococcal surface protein A (PspA). PSPA is a heterogeneous protein of about 70-140 kDa. The PsPA structure includes an alpha helix at the amino terminus, followed by a prolinc-rich sequence, and tenninates in a series of I1I choline-binding repeats at the carboxy-termius Although much information regarding its structure is available, PspA is not Structurally conserved among a variety of pneuxnococcal serotypes, and its function is entirely unknown (YOther et al. J Bacteria!. 1992; 174:601-9 and Yother J Bacterial. 1994; 176:2976-2985). Studies have confirmed the imniunogenicity of PspA in animals (McDaniel et al. Microb. Pathogen. 1994; 1 7;323-337).

Despite the immxunogenicity of PspA, the heterogeneity of PspA, its existence in four structural groups (or clades), and its uncharacterized function complicate its bitity to be used as a vaccine antigen, In patients who cannot make protective antibodies to the type-'specific polysaccharide capsule, the third component of complement, C3, and the associated proteins of the alternative complement pathway constitute the first line of host defense against S. pneumoniae infection. Because complement Proteins cannot Penetrate the rigid cell wall of S pneumoniae, deposition of opsonic COb on the pneumococcaj surface is the principal mediator of pneumococcal clearance. Interactions of pneuinococci with plasma C3 are known to-occur during pneuxnococcal bacteremia, when the covalent binding of Cb, the opsonically active fragment of C3, initiates phagocytic recognition and ingestion (Johnston et al. J Exp. Med 1969; 129:1275-1290, Basin HE, Immunal 1972; 109:26-31 and Hostetter et al. J Infect. Di. 1984; 150:653-6 COb deposits on the pneumococcal capsule, as well as on the cell wall This method for controlling S pneumaniae infection is fairly inefficient Methods for augmenting S pnewnaniae opsonization could improve the disease course induced by this organism. There currently exists a strong need for methods and therapies to limit S. pnewnoniae infection.

This invention relates to the identificationt ziud use of-a f"inily of humr- I I 4 complement C3-degrading polypeptides proteins) expressed by S pneumoniae. The polypeptides preferably have a molecular weight of about kDa to about 25 kDa, or about 75 kDa to about 95 kDa, as determined, for example, on a 10% SDS polyacrylamide gel. The invention includes a number of polypeptides isolatable from different C3-degrading strains of S. pneumoniae.

In one aspect, the invention relates to an isolated polypeptide having at least 80% sequence identity with SEQ ID NO:2 or SEQ ID NO:5. In a preferred embodiment, the polypeptide is isolated from S. pneumoniae or alternatively the polypeptide is a recombinant polypeptide. Preferably, the isolated polypeptide 10 degrades human complement protein C3. A preferred polypeptide of this invention is an isolated polypeptide having an amino acid sequence that includes SEQ ID NO:2 or SEQ ID NO:5, and more preferably, is SEQ ID NO:2 or SEQ ID NO:5. The term "isolated" as used herein refers to a naturally occurring species that has been removed from its natural environment, as well as to synthetic species. The term "polypeptide" as used herein includes peptides, polypeptides, and proteins, regardless of length. Preferably, the polypeptides of the invention include one or more functional units, which encompasses polypeptides that degrade human complement protein C3.

Thus, the invention also relates to polypeptide fragments isolated from a C3-degrading protein of this invention. Such fragments are encompassed by the term "polypeptide" as used herein. Preferably, the invention provides polypeptides of at least 15 sequential amino acids derived from a protein that has at least 80% sequence identity with SEQ ID NO:2 or SEQ ID NO:5, and more preferably, polypeptides of at least 15 sequential amino acids of SEQ JD NO:2 or SEQ ID NO:5. In another aspect of this invention, preferred polypeptides are capable of degrading human complement protein C3.

In another aspect, the invention relates to an isolated polypeptide that preferably degrades human complement protein C3, wherein nucleic acid encoding the isolated polypeptide hybridizes to at least a portion of SEQ ID NO:1 or SEQ ID NO:4 or their complementary strands under highly stringent hybridization conditions. Preferably, the polypeptide includes at least sequential amino acids, which are, more preferably, of SEQ ID NO:2 or SEQ ID In an additional aspect, this invention relates to polypeptides that have reduced human C3 degradation activity or which do not degrade human C3; however, the nucleic acids encoding this group of polypeptides each include a nucleotide sequence that hybridizes to either the nucleic acids that encode human C3 degrading polypeptides, or the complementary strands for each nucleic acid.

This latter group of polypeptides having reduced or no human C3 degrading activity are referred to herein as "non-degrading" polypeptides. The non- 10 degrading polypeptides may differ from C3 degrading polypeptides by one or more amino acids. This amino acid change may be a substitution, alteration, or deletion of one or more amino acids. Various types of amino acid changes are discussed herein. Nucleic acids encoding the non-degrading polypeptides are alternatively preferred embodiments of this invention.

The invention also relates to an immune system stimulating composition (preferably, a vaccine) comprising an effective amount of an immune system stimulating polypeptide of the present invention, which is preferably isolated from S. pneumoniae, and a therapeutically acceptable carrier. In one embodiment, the immune system stimulating composition or vaccine further comprises at least one other immune system stimulating polypeptide isolated from S. pneumoniae.

The invention further relates to an antibody capable of binding (typically, specifically binding) to a polypeptide (at least a portion thereof) of the present invention. In one embodiment, the antibody is a monoclonal antibody and in another embodiment, the antibody is a polyclonal antibody. In another embodiment the antibody is an antibody fragment. The antibody or antibody fragments can be obtained from a mouse, a rat, a goat, a chicken, a human, or a rabbit.

The invention also relates to an isolated nucleic acid molecule a polynucleotide, which can be single stranded or double stranded, and which can be a part, or fragment, of a larger molecule such as a vector) capable of hybridizing to at least a portion of SEQ ID NO: 1 or SEQ ID NO:4 or their 6 complimentary strands under highly stringent hybridization conditions. As used herein, highly stringent hybridization conditions include, for example, 6XSSC, Denhardt, 0.5% SDS, and 100 pg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65 0 C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes. In one embodiment, the nucleic acid molecule is isolated from S. pneumoniae and in another embodiment, the nucleic acid molecule encodes a polypeptide. In one embodiment, the polypeptide 10 degrades human complement protein C3. In another embodiment, the nucleic acid molecule encodes a polypeptide that does not degrade human complement C3.

In another embodiment, the nucleic acid molecule is in a vector it is a fragment of a nucleic acid vector). The vector can be an expression vector capable of producing a polypeptide. Cells containing the nucleic acid molecule 'are also contemplated in this invention. In one embodiment, the cell is a bacterium or a eukaryotic cell.

The invention further relates to an isolated nucleic acid molecule .comprising the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:4, or their complementary strands. The invention further relates to an RNA molecule transcribed by a double-stranded DNA sequence comprising SEQ ID NO:1 or SEQ ID NO:4.

In another aspect of this invention, the invention relates to a method for producing an immune response to S. pneumoniae in a mammal (particularly a human). The method includes: administering to a mammal a composition comprising a therapeutically effective amount of a polypeptide of the present invention, and a pharmaceutically acceptable carrier, to produce an immune response to the polypeptide. The immune response can be a B cell response, a T cell response, an epithelial response, or an endothelial response. In a preferred embodiment, the composition is a vaccine composition. Preferably the polypeptide is at least 15 amino acids in length and also prefersbly ihe composition further comprises at least one other immune system stimulating 7 polypeptide from S. pnewnonio2. In one embodiment the polypeptide comprises at least 15 amino acids of SEQ ID NO:2 or SEQ ID NO: The invention fuirther relates to an isolated polypeptjde of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptococcus pneumoniae that is capable of degrading human complement C3 and to a method for inhibiting Sfr eptococcas pneumoniae-mediated C3 degradation. The method includes contacting a Streptococcrispnewmoniae bacterium with antibody capable of binding to a polypeptide (at least a portion thereof) of'the present invention.

The invention also relates to a method for inhibiting C3-mediated inflammation and rejection in xenotransplantation. The method includes :expressing on the surface of an organ of an animal used in xenotransplantation a polypptide of the present invention. This method is particularly advantageous for causing, for example, the kidneys of pigs to express the polypeptide described herein and thereby to inhibit C3 mediated inflammation after xenotansplantation.

The invention also relates to an isolated nucleic acid molecule that contains a region of at least 15 nucleotides which hybridize tinder highly stringent hybridization conditions to at least a portion of a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO:4 or their complementary strands.

The invention also relates to isolated DNA molecules or primers having the nucleic acid sequences as shown in SEQ ID NQ:6, SEQ ID) NO:79,'SEQ

ID)

NO:8 AND) SEQ ID NO:9.

Brief Descrin)tfon teWFiure Figure 1 provides the nucleic. acid sequence of the translated portion of a

C

3 -degrading potypeptide (approximately 20 kDa) gene of this invention

(SEQ

ID NO: 1).

Figure 2 provides the amino acid sequence of a C3-degrading 36 polypeptide (approximately 20 kDa) of this invention (SEQ ID) NO:2).

Figure 3 diagrams the amino acid sequence of a C3-degrading polypeptide (approximately 20 kDa) prc itfoned wihthe nucleic acid sequence- (double ftranded) encoding a C3-degrading polypeptide according to this invention (SEQ ID NOS:l1-3 wherein SEQ ID NO:3 is the complement of SEQ EID NO: 1).

Figure 4 provides the nucleic acid sequence for a predicted 92 kDa amino acid sequence (SEQ ID NO:4).

Figure 5 provides the predicted 92 kDa amino acid sequence (SEQ ID Figure 6 shows sequence alignments of SEQ ID) NO:1I and a portion of SEQ IIDNO:4.

Figure 7 shows sequence alignment of SEQ ID) NO:2 with a portion of SEQ ID NO: Figure 8. Western blot analysis of several pacumococcal whole cell lysate with polyclonal anti-r20 kDa sera. Molecular weight markers were run in lane 1; recombinant 20 kDa polypeptide from pDFl22 was run in lane 2; recombinant 92 kDa polypeptide from Type 7 was run in lane 3; lane 4 was a blank; CP1200 whole cell lysate was run in lane 5; Type 3 whole cell lysate was run in lane 6; and Type 7 whole cell lysate was run in lane 7. The antisera recognizes the recombinant polypeptides of approximately 20 kDa and approximately 92 kDa, but only recognized the larger polypeptide in whole cell lysates.

Figure 9. Autoradiogramn showing degradation of biotinylated C3 by kDa and 92 kDa polypeptides of the present invention.

Figure 10. Cooxnassie Blue-Stained 7.5% SDS-PAGE analysis of C3 degradation by the 20 kDa (Lane A8) and the 92 kDa (Lane C8) polypeptides of the present invention.-I Figure I11 is a chart which shows the survival of CBA/CAIIN xid/J mice immunized SC (subcutaneous) with r79 kDa protein adjuvanted with MPL and challenged IN (intranasal) with S. pneumoniae Type 3.

Figure 12 is a SDS-PAGE gel described in Example 8.

Detailed D2escription of the-preferred EmbodiMents- The Present invention relates to the identification and isolation of a human complement C3 degrading polypeptide fragment of a larger Polypeptide of about 75 kD to about 95 kD. This fragment has a molecular weight of about 20 kDa 5 kDa) on a 10% SDS-PAGE gel. It also relates to nucleic acids encoding C3 degrading polypeptides.

It has been observed that exponentially growing cultures of pneumococcj from several serotypes were able to first degrade the P-chain then degrade the cc chain of C3 without producing defined C3 cleavage fragments (Angel, et al. J Infect. Dis. 170:600-608, 1994). This pattern of degradation without cleavage differs substantially from that of other microbial products such as the elastase enzyme of Pseudcomonas aeru ginosa and the cysteine proteinase of Entamoeba histolytica The term "degrade" is used herein to refer to the removal of arnino acids from proteinaceous molecules, generating peptides or polypeptides. Th1e polypeptide of this invention degrade C3 without generating the cleavage fragments known as COb, iC~b, or COd. There is at least some preference of the C3-degrading polypeptides of this invention for C3 in that for example, the C3degrading polypeptide does not appear to degrade other proteins, such as albumin.

A C3-degrading polypeptide of about 20 kDa was isolated from a library of insertionally interrupted pneumococcaJ genes by identifying those clones that had decreased C3 degrading activity as compared to wild type S. pnewnoniae.An exemplary assay for assessing C3-degrading activity of clones is provided in Example 1. Clones with decreased C3-degrading activity were identified and a 546 bp Sinai insert was selected, based on the sequence of the clones that bad demonstated decreased C3-degrading activity. This Sinal fr-agment was used to probe an S. pneumoniae library made from strain CPI200. Positive clones fromn the S. pneunoniae library that hybridized to the Sil fragment were isolated and the open reading frame of the gene associated with C3-degrading activity was identified. The following oligonucleotide (SEQ ID NO: 10), which has sequence, identif with a portion of PspA, was'used to coafrmn, by differential hybridization, that the gene encoding the C3-degrading protinease was distinct from the gene encoding PspA.

SEQ ID NO: G3AAAACAATAATTAGAAGACTACAAGGGTTAGA An open'reading frame of a 20 kDa polypeptide spans an area of approximately 500 base pairs (SEQ ID NO: 1) predicting a polypeptide of molecular weight of a bout 20 kDa 5 kDa) or about 168 amino acids (SEQ ID NO:2). An exemplary gene sequence encoding a C3-degrading polypeptide is provided in Figure Ilas SEQ ED NO: I and an amino acid sequence of the polypeptide is provided in Figure 2 as SEQ ID NO:2. Figure 3 combines a preferred gene sequence with a corresponding preferred translated polypeptide as.

:SEQrD NOS: 1-3.

Using SEQ ID) NQ:2, the amino acid sequence of the approximately kDa polypeptide, was determined to be unrelated to other polypeptides in the GenBank or Swiss Prot databases. The predicted polypeptide encompasses a :0 protine-rich sequence characteristic of membrane domains in prokaryotes, particularly between amino acids 80-108 suggesting that the polypeptide is expressed at the surface. The amino acid sequence exhibits no apparent cholinebinding repeats. Electrophoresis of pneumococcal lysates and supernatants from cultures of CP 1200 on SDS-PAGE gels impregnated with C3 identified a Jytic band at about 20 kDa 5 kDa) in both supernatants and lysates, confirming that a polypeptide of a size predicted by SEQ ID NO:2 had 03-degrading activity (see Example As provided in Example 3, the gene encoding the 20 kDa, C3degrading polypeptide is conserved in at least two dozen pneurnococcaj iSolates representing five serotyps (serotypes 1, 3, 4, 14, and 1 9F).

The nucleotide sequence encoding the C3-degrading polypeptide of this invention was inserted into a gene expression Vector for expression in K coli.

Recombinant C3-degrading polypeptide was isolated as described in the examples. Those of ordinary skill in the art revognizc that, given a particular gene sequence such as that p'rb-vided in SEQ I.D NO:l1, there are a variety of expression vectors that could be used to express the gene. Further, there are a variety of methods known in the art that could be used to produce arnd isolate the recombinant polypeptide of this invention and those of ordinary skill in the art also recognize that the C3 degrading assay of this invention will determine whether or not a particular expression systemi, in addition to those expression systems provided in the examples, is fuidctioning, without requiring undue experimentation. A variety of molecuflar and immunological techniques can be found in basic technical texts such as those of Sanmbrook et al. (Molecular Cloning, A Laboratory Manual, 1989 Cold Spring Harbor Laboratory Press, 10 Cold Spring Harbjor, NY) and Harlow et al. (Antibodies; A Laboratory Manual.

Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988).

The polynucleotide encoding the C3 degrading polypeptide of this **invention was identified using a plasmid library made with pneumnococcal genomic DNA fragments from strain CP1200. Although there arc a variety of methods known for obtaining a plasmid library, in a preferred strategy, a plasnuld library Was constructed with Sau 3A digested pneurnococcal genoniic DNA fragments (0.5 -4.0 kb) from pneumococcal strain CP 1200 (obtained from D.A.

Morrison, University of Illinois, Champagne-Urbana, Illinois and described in Havarstein LF, et al. Proc. Nat!. Acad Sc. (USA) 1995;92:1 1140-11144) and inserted into the Barn FE site of the integrative shuttle vector pVA 891 (crn?, em; has origin of replication for E. coli). This library was transformed into an E.

coi DH~cz MCR strain by electroporation. Plasmid extractions of some randomly selected E coi transfoimants revealed that all of them contained recombinant plasmids.

Plasmid library DNA can be extracted from the E coli transformants and used to transform the OP 1 2 0 0 pren pneumococcal strain using insertional mutagenesis by homologous recomnbination.

The pneuxnococcal strain CP 1200 cells can be made competent using a pH shift with H~l procedure in CTM medium. The competent cells are frozen at -70*C in small aliquots until needed.

The isolated polypeptide of this inventiin ca;;d be incubated with humancomplement C3 for 4 boui~s 6r longer at 3700 in the pre:ence of PBS to detect- .12 C3 degradation. Control samples without the isolated pneumococcal polypeptide are used as controls for comparative purposes.

The polypeptides of this invention have an apparent molecular weight on a 10% SDS-polyacrylamide gel of either about 15 kDa to about 25 kDa; and preferably about 20 kDa; or about 75 kDa to about 95 kDa; and preferably about 92 kDa. Exemplary polypeptides sequences are provided by SEQ ID NO: 2 and SEQ ID NO:5. Those of ordinary skill in the art will recognize that some variability in amino acid sequence is expected and that this variability should not detract from the scope of this invention. For example, conserved mutations do 10 not detract from this invention nor do variations in amino acid sequence identity of less than about 80% amino acid sequence identity and preferably less than about 90% amino acid sequence identity where the polypeptide is capable of c degrading human complement protein C3, and particularly where the .e polypeptide is isolated or originally obtained from an S. pneumoniae bacterium.

Proteins and fragments thereof (all referred to as polypeptides) are also within the scope of the present invention, particularly if they are capable of degrading human complement protein C3.

i Some nucleic acid sequence variability is expected among pneumococcal strains and serotypes as is some amino acid variability. Conserved amino acid substitutions are known in the art and include, for example, amino acid S. *substitutions using other members from the same class to which the amino acid belongs. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, and tryptophan. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations are not expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis or isoelectric point. Particularly preferred conservative substitutions include, but are not limited to, Lys for Arg and vice verse to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free NH 2 Preferred polypeptides of this invention includes polypeptides with the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:5. Other polypeptides include those degrading human complement polypeptide C3 and having nucleic acid encoding the polypeptide that hybridizes to SEQ ID NO:1 or SEQ ID NO:4 under highly stringent hybridization conditions such as 6XSSC, 5X Denhardt, SDS (sodium dodecyl sulfate), and 100 pg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS 10 at room temperature for at least 3-5 minutes are also contemplated in this invention. Typically, an SSC solution contains sodium chloride, sodium citrate, and water to prepare a stock solution.

The polypeptides of this invention can be isolated or prepared as recombinant polypeptides. That is, nucleic acid encoding a protein, or a portion thereof can be incorporated into an expression vector or incorporated into a chromosome of a cell to express the polypeptide inthe cell. The polypeptide can be purified from a bacterium or another cell, preferably a eukaryotic cell and more preferably an animal cell. Alternatively, the polypeptide can be isolated from a cell expressing the polypeptide, such as a S. pneumoniae cell. Thus, proteins, peptides, or polypeptides are all considered within the scope of this invention when the term "polypeptide" is used. The polypeptides are preferably at least 15 amino acids in length and preferred polypeptides have at least sequential amino acids from SEQ ID NO:2 or SEQ ID Nucleic acid encoding the about 15 kDa to about 20 kDa polypeptide and the about 75 kD to about 95 kD polypeptide are also part of this invention.

SEQ

ID NOS:1 and 4 are preferred nucleic acid molecules encoding a C3-degrading polypeptide. Those of ordinary skill in the art will recognize that some substitution will not alter the C3-degrading polypeptide sequence to an extent that the character or nature of the C3-degrading polypeptide is substantially altered. For example, nucleic acid with an identity of at least 80% to SEQ ID NO:1 is contemplated in this invention. A method for determining whether a particular nucleic aid sequence f'lls within the scope of this invention is to consider whether or not a particular nucleic acid sequence encodes a C3degrading polypeptide and has a nucleic acid identity of at least 80% as compared with SEQ ID NO:lI or SEQ ID NO:4 Other nucleic acid sequences encoding the C3 polypeptide include nucleic acid encoding the C3 polypeptide where the C3 polypeptide has the same sequence or at least a 90%/ sequence identity with SEQ ID NO:2 or SEQ ID NO:5 but which includes degeneracy with respect to the nucleic acid sequence. A degenerate codon means that a different three letter codon is used to specify the same amino acid. For example, it is well known in the art that the following RNA codons (and therefore, the 10 corresponding DNA codons, with a T substituted for a U) can be used interchangeably to code for each specific amino acid: @0 S S

S.

0056 0 00 0 00 0* 0000 0@ 0 @0 00 0 0 0 @0Cm

C

S.C.

0000 0 *6 be @0 0

S

Phenylalaiiine (Phe or F) Leucine (Len or L) Isoleucine (le or 1) Methionine (Met or M Valine (Val or V) Serine (Ser or S) Proline (Pro or P) Threonine (Trhr or TI) Alanine (Ala or A) Tryptophan (Trp) Tyrosine (Tyr or Y) Histidine (His or H) Glutamine (Gin or Q) Asparagine (Asn or N) Lysine (Lys or K) Aspartic Acid (Asp or D) Glutamic Acid (Glu or E) Cysteine (Cys or C) Arginine (Arg orR) Glycine (Gly or G) .Termindti6ja codon UUU, UUC, UUA or UUG CULT, CUC, CUA or CUG AULT, AUC or AUA

AUG

GUU, GUC, GUA, GUG AGU or AGC CCU, CCC, CCA, CCG ACU, ACC, ACA, ACG GCU, GCG, GCA, 0CC

UGG

UAU or UAC CALT or CAC CAA or CAG AAU or AAC AAA or AAG GAU or GAC GAA or GAG UGU or UGC AGA or AGG GGU or CGC or OGA or GG UAAI UAG or UGA Further; a particular DNA sequence can be modified to employ the codons preferred for a particular cell type. For example, the preferred codon usage for E. coli is known, as are preferred codons for animals including humans. These changes are known to those of ordinary skill in the art and therefore these gene sequences are considered part of this invention. Other nucleic acid sequences include at least 15, and preferably, at least 30 nucleic acids in length from SEQ ID NO:1 or SEQ ID NO:4 or other nucleic acid fragments of at least 15, and preferably at least 30 nucleic acids in length where these fragments hybridize to SEQ ID NO:1 or SEQ ID NO:4 under highly 10 stringent hybridization conditions such as 6XSSC, 5X Denhardt, 0.5% SDS, and 100 gg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65 0 C and washed in 2X SSC, 0.1% SDS one time at rooni temperature for about 10 minutes followed by one time at, 65*C for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 15 minutes.

The nucleic acid molecules of this invention can encode all, none fragments that cannot be transcribed, fragments that include regulatory portions of the gene, or the like), or a portion of SEQ ID NO:2 or SEQ ID NO:5 and preferably containing a contiguous nucleic acid fragment that encodes at least nine amino acids from SEQ ID NO:2 or SEQ ID NO:5. Because nucleic acid molecues encoding a portion of a C3 degrading polypeptide are contemplated in this invention, it will be understood that not all of the nucleic acid molecules will encode a protein or peptide or polypeptide with C3 degrading activity. Further, the nucleic acid of this invention can be mutated to remove or otherwise inactivate the C3 degrading activity of this polypeptide. Therefore, nucleic acid molecules that encode polypeptides without C3 degrading activity that meet the hybridization requirements described above are also contemplated. Methods for mutating or otherwise altering nucleic acid sequences are well described in the art and the production of an immunogenic, but enzymatically inactive polypeptide can be tested for therapeutic utility.

The nucleic acid molecules of his invention can be incorporated into nucleic acid vectors or tably incorporated into host genomes to produce 16 recombinant polypeptides including recombinant chimeric polypeptides. In one embodiment, the C3-degrading polypeptide is encoded by a gene in a vector and the vector is in a cell. Preferably, the cell is a prokaryotic cell such as a bacterium. The genes and gene fragments can exist as the fusion of all or a portion of the gene with another gene and the C3-degrading polypeptide can exist as a fusion protein of one or more proteins where the fusion protein is expressed as a single protein. A variety of nucleic acid vectors of this invention are known in the art and include a number of commercially available expression plasmids or viral vectors. The use of these vectors is well within the scope of 10 what is ordinary skill in the art. Exemplary vectors are employed in the examples, but should not be construed as limiting on the scope of this invention.

:i This invention also relates to antibodies capable of binding (typically specifically binding) to polypeptides of about 15 kDa to about 25 kDa; and preferably about 20 kDa; and about 75 kDa to about 95 kDa; and preferably S. 15 about 92 kDa, from S. pneumoniae and preferably where the polypeptides are capable of degrading human complement C3. Polyclonal or monoclonal antibodies can be prepared to all or part of the polypeptides of the invention e.oo Methods for preparing antibodies to polypeptides are well known and well described, for example, by Harlow et al., (Antibodies; A Laboratory Manual.

Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988). In a preferred example, the antibodies can be human derived, rat derived, mouse derived, goat derived, chicken derived, or rabbit derived. Polypeptide-binding antibody fragments and chimeric fragments are also known and are within the scope of this invention.

The invention also relates to the use of immune stimulating compositions. The term "immune stimulating" or "immune system stimulating" composition refers to protein, peptide, or polypeptide compositions according to the invention that activate at least one cell type of the immune system in a subject, such as a mammal. Preferably, the immune stimulating composition provides an immunizing response or prophylactic benefit in a normal, i.e., uninfected subject, typically a vaccine. However, any measurable immune response is beneficial to the subject in a therapy application or protocol.

17 Preferred activated cells of the immune system include phagocytic cells such as neutrophils or macrophages, T cells, B cells, epithelial cells and endothelial cells. Immune stimulating compositions comprising the peptides, polypeptides or proteins of the invention can be used to produce antibody in an animal such as a rat, mouse, goat, chicken, rabbit, or a human or an animal model for studying S. pneumoniae infection. Preferred immune stimulating compositions include an immune stimulating amount, e.g, a therapeutically effective amount, of at least one peptide or polypeptide including at least 15 amino acids from the C3 degrading polypeptide.

10 The term "vaccine" refers to a composition for immunization. This process can include the administration of a protein, peptide, polypeptide, antigen, nucleic acid sequence or complementary sequence,'e.g., anti-sense, or antibody, or suspensions thereof, wherein upon administration, the molecule will produce active immunity and provide protection against an S. pneumoniae 15 infection or colonization. Typically, such vaccines are prepared as injectables, "either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The vaccine preparation may optionally be emulsified, or encapsulated in liposomes.

The immune stimulating composition (such as a vaccine) can further 20 include other polypeptides in a pharmaceutically acceptable buffer or carrier, such as PBS (phosphate buffer saline) or another buffer recognized in the art as suitable and safe for introduction of polypeptides into a host to stimulate the immune system. The immune stimulating compositions can also include other immune system stimulating polypeptides such as adjuvants or immune stimulating proteins, peptides, or polypeptides from S. pneumoniae or other organisms. For example, a cocktail of peptides or polypeptides may be most useful for controlling S. pneumoniae infection. Preferably one or more of the polypeptides, or fragments thereot of this invention are used in a vaccine preparation to protect against or limit S. pneumoniae colonization or the pathogenic consequences ofS. pneumoniae colonization.

A "therapeutically effective amount," as used herein, refers to that amount that is effective for production of a desired result. This amount variesdepending upon the health and physical condition of a subject's immune system, to synthesize antibodies, the degree of protection desired, the formulation prepared and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.

The active immune stimulating ingredients are often mixed with excipients or diluents that are pharmaceutically acceptable as carriers and compatible with the active ingredient. The term "pharmaceutically acceptable carrier" refers to a carrier(s) that is "acceptable' in the sense of being compatible with the other ingredients of a composition and not deleterious to the recipient 10 thereof. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the immune stimulating composition (including vaccine) may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the immune stimulating 15 compostion.

Examples of adjuvants or carriers that may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-Disoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alany-D-al-D-i mine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-Lalanine-2-(l'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamne (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL TDM CWS) in a 2% squalene/Tween 80 emulsion.

This invention also relates to a method for inhibiting Streptococcus pneumoniae-mediated C3 degradation comprising contacting a Streptococcus pneumonie bacterium with a polypeptide, such as an antibody or another polypeptide that is capable of binding to an isolated polypeptide (typically, at least a portion thereof) of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptcoccus pneumoniae. The protein capable of binding to an isolated polypeptide -fabout 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa. cnn be an antibody or a fragment thereof, or the protein can be a-- 19 Chimieric' Protein that includes the antibody binding domain, such as a variable domain, from antibody that is capable of specifically recognizing an isolated polYPeptide of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa, from Stetccupenna having C3 degrading activity.

The isolated S. pnewnoniae polypeptide of this invention can be isolated, and optionally Purified, and the isolated polypeptide or inunogenic fr-agments thereof Can be Used to produce an immunologic response, including, in one example, an antibody response in a human or an experimental animal.

Polypeptides without C3 degrading ability can be tested for their ability to limit' .10 the effe cts of S. pneumoniae infection. Similarly, the polypeptides of this invention can be modified, such as through mutation to interrupt or inactivate the C3 degrading activity of the polypeptides. Antibody capable of inhibiting the :9 C-degrading activity of the polypeptides of this invention may be used as a strategy for preventing C3 degradation and for promoting clearance of S pneumoniae through the opsonic: pathway. Isolated polypeptides can be used in assays to detect antibody to S pneumoniae or as part of a vaccine or a multivalent or multiple protein, peptide, or polypeptide-containing vaccine for S pneumoniae therapy.

Thus, the term "treatment," as used herein, refers to prophylaxis and/or therapy of either normal mammalian subjects or mammalian subjects colonized with, diagnosed with, or exhibiting characteristics'or symptoms of various

S.

pnezanoniae infections. The term "therapy" refers to providing a therapeutic effect to a.mammalian subject such that the subject exhibits few or no symptoms of a pneunlococcaj infection or other related disease. Such treatment can be accomplished by administration of nucleic acid molecules (sense or antisense),.proteins, peptides or polypeptides or antibodies of the instant invention.

It is further contemplated that the polypeptides of this invention can be surface expressed on vertebrate cells and used to degrade C3, for example, where complement deposition (or activation) becomes a problem, such as in xenotransplantation or in complement-mediae glomerulonephritis. For example, the entire pneumococcal polypeptide, a recombinant polypeptide, or a pc~r tion of either, can be incorporated into xenotransplaiit cells and expressed as a surface polypeptide or as a secreted polypeptide to prevent or minimize complement deposition (and/or complement-mediated inflammation).

Another specific aspect of the present invention relates to using a vaccine vector expressing an isolated protein, and peptides or polypeptides therefrom.

Accordingly, in a further aspect this invention provides a method of inducing an immune response in a mammal, which comprises providing to a mammal a vaccine vector expressing at least one, or a mixture of an isolated protein and/or peptide or polypeptide of the invention. The protein and peptides or polypeptides of the present invention can be delivered to the mammal using a live vaccine vector, in particular using live recombinant bacteria, viruses or other live agents, containing the genetic material necessary for the expression of the protein and/or peptides or polypeptides as a foreign polypeptide. Particularly, Sbacteria that colonizes the gastrointestinal tract, such as Salmonella, Shigella, Yersinia, Vibrio, Escherichia and BCG have been developed as vaccine vectors, and these and other examples are discuessed by J. Holmgren et al., Imni ob 184, 157-179 (1992) and J. McGhee et al., ccine JQ, 75-88 (1992).

An additional embodiment of the present invention relates to a method of inducing an immune response in a subject, mammal, comprising administering to the subject an amount ofa DNA molecule encoding an isolated protein and/or peptide or polypeptide therefrom of this invention, optionally with a transfection-facilitating agent, where the protein and/or peptides or polypeptides retain immunogenicity and, when incorporated into an immune stimulating composition, e.g, vaccine, and administered to a human, provides protection without inducing enhanced disease upon subsequent infection of the human with S. pneumoniae pathogen. Transfection-facilitating agents are known in the art.

It is further contemplated that the antisense sequence of the gene encoding the about 15 kDa to about 25 kDa polypeptide, and the about 75 kDa to about 95 kDa polypeptide may be used as a vaccine or as a therapeutic treatment for pneumococcal infection. Antisense DNA is defined as a non-coding sequence that is complementary, a complementary strand, to all or a portionof SEQ ID NO: or SEQ ID NO:4. For example, the antisense sequence for ATGTCAAGC-3' is 3'-TACAGTTCG-5'. Delivery of antisense sequence or oligonuclotides into an animal may result in the production of antibody by the animal or in the incorporation of the sequence into living bacteria or other cells whereby transcription and/or translation of all or a portion of the 92 kDa gene product is inhibited.

Introduction of an antisense nucleic acid sequence can be accomplished, for example, by loading the antisense nucleic acid into a suitable carrier, such as a liposome, for introduction into pneumococci or infected cells. Typically, an antisense nucleic acid sequence having eight or more nucleotides is capable of 10 binding to the bacterial nucleic acid or bacterial messenger RNA. The antisense nucleic acid sequence, typically contains at least about 15 nucleotides, preferably at least about 30 nucleotides or more nucleotides to provide necessary stability of a hybridization product of bacterial nucleic acid or bacterial messenger

RNA.

Introduction of the sequences preferably inhibit the transcription or translation of 15 at least one endongenous S. pneumoniae nucleic acid sequence. Methods for loading antisense nucleic acid is known in the art as exemplified by U.S. Patent 4,242,046.

The present invention also provides nucleic acid having an open reading frame of 2478 bases (SEQ ID NO:4) that encompasses the open reading frame of a nucleic acid sequence (SEQ ID NO:1) that encodes a polypeptide that has a molecular weight of about 20 kDa (SEQ ID NO:2). The 20 kDa polypeptide, described herein, is further characterized as a C3-degrading polypeptide. The larger open reading frame, 2163 bp (SEQ ID NO:4), encodes for a putative polypeptide of about 92 kDa (SEQ ID All references and publications cited herein are expressly incorporated by reference into this disclosure. There are a variety of alternative techniques and procedures available to those of skill in the art which would similarly permit one to successfully perform the intended invention in view of the present disclosure.

It will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples, the invention is not necessarily so limited and that numerous other embodiments, examn!-, uses, modifications and departures from the embodiments, examples: and uses may ber mde wtout departing from the inventive scope of this application.

Example

I

Identification of Insertional Mutants with Reducedj

C

3 -Degradig Activity Insertbonal mutants were received from Dr. Elaine Tuomnanen, (Rockefeller finst, New York, New York). The clones with insertions were tste in n asayto detect reduced C3-degrading activity. 137 clones were tested by growing the cells in Todd Hewitt broth overnight at room temnperature in itre plates. The clswere diluted 1: 10 in synthetic medium for pacumococci (see Sicard A. Genetics 50:3 1-44, 1984) and the remainder of the cells were frozen in the microtiter plate. Either 63 ng or 83 ng of C3 (purified from human plasma according to the method of Tack et al., Mieth Enzym. 806-10 1, 1 9 84 per 100 glz of medium containing I ingfiof 1Vo ]3SA in phosphate buffered saline (PBS) was added to about 200 p1l of diluted cells. T1he cells were incubated at 37 0 C for 4 birs. One hundred P1 of the mixture wsadded to ELISA plates and incubae overnight at 4 0 C. The plates were washed three times with wash buffer and the wells were filled with 0.05% *~*Tween 20 in PBS with five minute incubations between the washes. One hundred Wd of antibody to C3 (polyclonal horse-radish peroxidase-conjugated goat antibody specific to human C3-IgG fraction, ICN~ Cappel, Costa Mesa,

CA)

was diluted 1:120(} with 3% BSA in PBS. The ELISA plate was incubated at 3 7 *C for about 3minsto hr in thdak~ n ahedwihasbufrs above. The assay was developed using 12 mng of OPD in 30 ml of 0.l1M sodium citrate buffer with 12 p1 of 30% hydrogen peroxide. Assay results were determined by optical density readings at 490 ni on an ELISA plate reader.

Each clone was tested four times. Nineteen clones were selected that had less than 40%/ C3 degradation as compared to nonniutafed controls. These 19 clones were screenied 6 times by the assay described above and from these results 6 clones Were selected with less than 30% C 3 -degrading activity as compared to controls. These 6 clones were screened eleven times each and the two clones with the lowest C3-degrading activity were selected for further study.

A partial sequence of one of the clones was received and a Sinai fragment of 546 bp was labeled with 1 2 P by random Primer labeling (kit available from Stratagene, La Jolla, CA). The 546bp Sinai fr-agment from SEQ ID NO: I was hybridized to EcoR I and Kpnl digests of numerous pnelunOcoca strains on Southern blots. This same fragment was also used to screen a library of Sau3A fragments of genomic DNA from S. pneumnoniae strain CP1200.

A 3.5 kb insert was identified from the CP1200 library. The insert w'as sequenced and an open reading frame of 492 base pairs, including the stop codon, was identified. The open reading fr~ame coded for a polypeptide of 168 amino acids and a predicted molecular weight of about 18,500 daltons.

PCR primers were constructed to amplify the open reading frame; the PCR primer incorporated a Barn!! site; the 3'primer incorporated a PstI site.

The amplified insert was ligated in frame to a H1is-Tagged E. coli expression vector pQE3O (Qiagen, San Diego, CA). The resulting plasmid was used to transform E coli stain BL21 (Novagen, Madison, WI) containing the Jac repressor plasmid pREP4 (Qiagen). E coli cultures were induced to express the His-Tagged polypeptide and the polypeptide was column purified with Ni-NTA resin (Qiagen). The purified polypeptide was confirmed by SDS-PAGE gel.

Example 2 Identification of a 20kDa C3-Degrading Polypeptide To determine the C3-degrading capability of the 20 kDa polypeptide, mg/mi of C3 (prepared accordfig to Tack et al., Meth EnzyroL 80:64-101,- 1984) was copolymerized in a sodium dodecyl sulfte (SDS) gel-containing acrylamide (15% SDS-PAGE gel). Pneumococcal supernatants were obtained from cultures of S. pneumoniae strain CP 1200 grown to exponential phase in Todd Hewitt broth; pneumococca1 lysates were obtained by incubating 5 x 108 cells with 5% SDS for 30 minutes at room temperatuje. The lysate was concentrated .10 fold using a Centricon filtration device with a 10,000 mw cutoffnjcon, Beverly, MA). The samples were not heated before electrophqrei- Samples of supernatants and lysates were added to the 15% C 3 -containing

SDS-

PAGE gels and electrophoresis was carried out at 4°C at 150 V until the dye front ran out The gel was washed successively with 50 ml of 2.5% Triton X- 100 in water (2 times, 10 minutes), 2.5 Triton X-100 in 50 mM Tris-HCI, pH 7.4 (2 times, 10 minutes), and 5 0 mm Tris-HCI, pH 7.4 (2 times, 10 minutes) to remove SDS. After washes, 50 ml of 50 mM Tris-HCl, pH 7.4, was poured into dishes containing the gels, and the dishes were covered and incubated at 37°C for 1.5 hour and overnight (about 16 hours). The gels were stained with Coomassie blue for 10 minutes and destained totally.

Two lytic bands were visualized, one of which was about 20 kDa in size, against the dark blue background in both lysates and supernatant. C3 degrading activities in the pneumococcal lysates were observed after a' 1.5 hour incubation at 37 0C while C3 degrading activities in the Pn supernatant were observed after an overnight incubation. Therefore, C3 degrading'activities appeared to be mainly cell associated.

*oe.

Example 3 The gene encoding the 20 kD polypeptide is conserved in a number of S.

*o ~pneumoniae strains.

DNA was obtained from a variety of S. pneumoniae strains (Clinical ~isolates of Type 1, Type 3, L002 and L003 (type Type 4, Type 14 and "[Laboratory isolates CP1200, WUJ2, R6X, 6303,109,110, JY 119, JYI Y182, and JY53) and SEQ ID NO:3 was used as a probe to detect the presence of nucleic acid encoding the 20 kD polypeptide in DNA from these strains. Isolated chromosomal DNA was digested with EcoPJ and separated by electrophoresis.

The DNA was transferred to a solid support and hybridized to end-labeled

SEQ

ID NO:3 under the hybridization and washing conditions of 6X SSC, Denhart's, 0.5% SDS, 100 Rg/ml denatured fragmented salmon sperm DNA hybridized at 65 °C overnight and washed in 2X SSC, 1 time at room temperature for 10 minutes and in 2X SSC, 0.1% SDS 1 time at 65°C for minutes followed by two washes in 0.2X SSC, 0.1% SDS for 3 minutes each at room temperature.

Results indicated that SEQ ID) NO:3 hybridized identically in each of the DNA samples tested indicating that the polypeptide appears to be conserved among strains. In some strains, the DNA encoding the 20 kDa C 3 -degrading polypeptjde appears to be part of a larger open reading frame of 2478 bp that putatively encodes a 92 kDa polypeptide.

Southern blot of pnewmnfiae DNA probe Five ug samples of genonie DNA were obtained from 11 strains OfS.

pneumoniae. Each sample was digested -with the restriction enzyme Kpn 1. The samples were subsequently loaded onto an agarose gel and resolved by **electrophoresis. The samples contained in the gel were subsequently transferred to a Hybond-N+ membrane available from Amersharn (Upsalla, Sweden) by *capillar transfer. A 540 bp Sinai fragment from the open reading frame was random primer labeled with P3 2 using a '7Quick~rirne kit (Pharmacia, Piscathaway, NJ) and purified from non-incorporated nucleotides using NucTrap column (Stragene, La Jolla, CA) and hybridized.

The hybridization conditions were 6XSSC, 5X Denhardt, 0.5% SDS, and 100 jig/mI fragmented and denatured salmon sperm DNA hybridized overnight .20 at 65*C and washed in 2X SSC, 0. 1% SDS once at room temperature for about minutes followed by 1 time at, 65*C for about 15 minutes followed by at least ~:one wash in 0.2XSSC, 0. 1% SDS at room temperature for at least 3-5 minutes.

The blot demonstrated that the 20 kDa gene was present in all tested strains Of S.

pnewnonlae.

ExaMpl Two DNA primers were prepared from SEQ I) NO: 1 and utilized to amplify the nucleotide sequence encoding the 20 kDa polypeptide from S pneumoniae (serotype 3) genomic DNA. The first primer, a 5'-primer, SEQ ID NO:6, includes an ATO start codon of the 5' end of the nucleotide sequence, inserts ai NCO I site, and had an Ala residue inserted after the ATG start codon to maintain a correct reading frame. The second primer, a 3'-primer, SEQ ID NO:7, includes a termination codon at the 3' end of the nucleotide sequence an inserts a BamrH I site.

C 2fl CC TCA AGC CTI' TITA CGT GAA TTG-3'; (SEQ ID NO:6) CKAL= OTA OCT ATA TGA GAT AAA CTT TCC TOC (SEQ ID) NO:7) The two primers Were synthesized on an Applied Biosystems 380A DNA synthesizer (Foster City, CA) using reagents purchased from Glen Research *(Sterling, VA). Amnplificauions were Performed utilizing a Perkin Elmer Thrmcyle (AB)T according totemnfcue'-ietos The identified PCR product was ligated into the TA tailed PCR cloning vector PCR2. 1, :15 available from Invitrogen, Carlsbad, CA, and used-to transform OneShot.

ToplIOF competent cells (Invitrogen). Kanamycin resistant transformants were screened by restriction enzyme analysis of plasn-id DNA prepared by alkaline lysis. An approximately 500 bp insert fr-agment was identified and subsequently excised with restriction enzymes Ncol and Banill. The 500 bp fragment was puife from alow melting agarose gel, and subsequently ligated into the Nco 1 Bam Il sites of the T7 promoted expression vector PET 2 9a, available from Novagen (Madison,

WI).

The ligation mixture was subsequently transformed into Top IOF'cells (Invitrogen), and the kanamycin resistant transfonnants were screened by restriction enzyme analysis of plasmid DNA prepared by alkaline lysis. A recombinant plasmid (pLP5O5) was subsequently tranfonned into BL21 (Novagen) cells and grown in SOB media supplementedj with 30 gg/mI Icanamycin. Cells were grown to an of 0.6, and were subsequently induced with 0.4mM IPTG (Boebringer Mannhejin, Indianapolis, Indiana) for 2- 4 hours. Whole cell lysates were prepared and electrophoresed on a 14% SDS- PAGE gel. The gel was stained with Coomassie and the expression product was detected. The coomassie stained gel revealed a band between the 28 kDa and the 18 kDa molecular weight markers, and was determined to be approximately kDa.

The DNA sequence of the insert in the recombinant pLP5O5 plasM-id waMs obtained using the ABI 370A DNA sequencer. The DNA sequence was aligned with the DNA sequence of SEQ ID NO: 1, using the Pustell DNA matrix plot feature of Mac Vector (Oxford Molecular Group, Campbell, CA). Aligrnent of the DNA sequence obtained from the pLP505 plasmid, SEQ ID) NO: 1, and the pneumoniae (serotype 4) genome, revealed that the open reading firame (ORF) that codes for the 20 kDa polypeptide may be part of a larger ORF, a 2478 bp in-the serotype 4 genome, that codes for a polypeptide with a predicted

MW

of approximately 92 kDa (SEQ NO: DNA SEQ ID NO:4 encodes for a *.*.predicted amino acid sequence as shown in SEQ ID The S. pneumoniae (serotype 4) genome sequence was obtained from :The Institute for Genomic Research at www.tigr.org and/or.througb NCBI at www.ncbi.nlmrnih-goy, using the ClusalW feature of McVector, (Oxford Molecular Group, Campbell CA). A sequence comparison was made between the 20 kDa amino acid sequence (SEQ ID NO:2) and the predicted 92 kDa amino acid sequence (SEQ ID Based upon the available genoie DNA (serotype 4) sequence, two primers flanking the 2478 bp ORF were designed and subsequently synthesized using the AI 380A DNA synthesizer (SEQ ID NOS:8 and SEQ ID) NO:8 was an S. pneumoniae 5'-primer having an inserted Neol1 site and a "Glu" residue added after the ATO start codon to maintain a correct reading frame.

SEQ ID NO:9, was an S. pnewnoniae 31 -prmer having an inserted HindlH site.

I

CCC GGG CCA TGG CTA AAA ITA ATA AAA AAT ATC TAG (SEQ ID NO:8) TTACerrACT CTC (SEQ ID NO:9) An approximately 2400 bp DNA fr-agment was then amplified from the 4-.

different S. pneumoniae scrotypes (serotype 3, 5, 6B and 7) resulting in 4 fragments. Each of the 4 fragments were subsequently ligated into the PCR cloning vector PCR2.I (Invitrogen), and used to transform OneShot Top I OF' cells (Invitrogen). Kanamycin resistant transforruants were screened by restriction analysis of the plasmid DNA prepared by alkaline lysis. A recombinant plasmid containing the serotype 7 PCR product was identified, e.g., 12. The DNA sequence was obtained from the serotype 7 clone using the ABI model 370A DNA sequencer. The DNA sequence was essentially identical to SEQ ID NO:4 and encoded a predicted amino acid sequence essentially identical to SEQ DD Western blot detection of 92 kDa Polypeptdde in Whole Pneumococci Recombinant approximately 20 kDa C3 degrading polypeptide was :15 purified from Eschwrichia colt strain BLR containing plasmid pDFI 22. Plasinid pDFl22 contains the polynucleotide shown in SEQ ID NO: 1 expressed under control of the T7 phage promoter system. The bacterial cells were grown to midlog phase in Hy-Soy/yeast Extract mediumn containing ampicillin to select for the plasmid. Expression of the recombinant polypeptide was induced by adding 20 IPTCI to a concentration of 1'mM and continuing incubation for an additional 3 hours. The bacterial cells were harvested by centrifuigation and resuspended in Tris buffered saline, pH 7.2. Cells were mechanically lysed in a French Pressure cell and the insoluble material including inclusion bodies were pelleted in a centrifuge. The pellet was solubilized in 3 M Urea buffered with 100mM NaPQ 4 pH 8.0 containing 0. 1% Triton X-100. After pelleting and discarding insoluble material (centrifuged at '-100,000 x the soluble r 2OkDa polypeptide was exchanged into 0. 1% Zwittergent 3-12 (Calbiochem-Behmrg) replacing the Urea and then into 100 mM NaPO 4 pH 8.0 replacing the detergent

SDS-PAGE

analysis confirmed that the -20 kDa material remained soluble. The His-tagged recombinant polypeptide was dialyzed into 50 mM NaPO 4 buffer, pH 8.0 and absorbed onto a Ni column equilibrated with the same buffer. The column was .sev~entially washed with 50 mM NAPO 4 at PH 7.0,6.6, and 5.5 until baseline absorbances (0D 2 go) were reached with each buffr. The bound 7v0 kDa polypeptide was eluted with 50 mM NaPO 4 pH 4.5. The eluted polypeptide was approximately 90% homogeneous in SDS-PAGE analysis.

This palypeptide was used to immunize Swiss-Webster mice. Five pig doses of the polypeptide were mixed with S0 gPg of Monophosphoryl lipid A (Ribi Immunochernicals) and injected intramuscularly into mice. Animals were immunized at weeks 0, 4, and 6 and exsangruinated at week 8. The sera were' pooled together and found to contain high titered-antisera against the immunogen.

Pneurnococcal str-ains CP1200, 13, and VP were grown in Todd-Hewitt broth containing yeast Extract and the cells pelleted by centrifugation.

.*::::*Pneurnococcal cells were lysedin SDS-PAGE cracking buffer under reducing *.conditions by boiling for Srninutes. The lysates were loaded'onto a I SDS- PAGE gel and electrophoresed. Separated polypeptides were electroblotteci onto Nitoclluos and the filter blocked with 5% BLOT'TO in phosphate buffered saline, pH 7.4. The polyclonal antisera was diluted 1:2000 in BLOTTO and used to probe the separated polypeptides. Bound antibodies were detected with Alkaline phosphatase conjugated goat anti-mouse IgG. The Western Blot is shown in Figure 8 and described fuirther in the brief description of the figures.

Example 7 Evidence of that the 20 kba and 92 kba Polypeptides Degrade C3.

The gel shown in Figure 9 is a Western blot. This data were obtained by incubating a 20 kDa polypeptide and a 92 kDa polypeptide with biotinylated and methylamine-treateci C3 as shown in the table below. These polypeptides were expressed from a T7 vector.

METHYLAMINE..TREATED C3: 500 i of purified human C3 at concentration of 4.46 nigmI (prepared according to the method of Tack et Meth. Enzymol. 80:64-101, 1984) was incubated with 55 p1l of I M methylamine

(CH

3

NH

2 in 0. 1 M TRIS/O.Oi M EDTA, pH 8.0 for 80 minutes at 37 0 C, then diaiyzed overnight in 0.1 M TRIS/O.Oi M EDTA, pH 8.0, at 4 0 C. The following.

day, the C3 was incubated agaiwith 60 ill of I M methylamiine ino0. M TRJS/0.ol M-EDTA for 80 minutes at 37 0 C, then dialyzed overnight in 50 mM NaHCO 3 at 4 0

C.

BIOTINYLATION Of NMTHYLAJ 1 -TREATED C3: 2 mg of metbylamne-ret C3, prepared above, was incubated with 75 p1 of NSCbiotin (Pierce) made as I mg NSC biotin in I ml H 2 0 for 30 minutes at room temperat ure. The biotinylated C3 was dialyzed overnight in 50 mM NaHCO 3 pH 8.0 at 4 0

C.

S

S

S

Reagents Polypeptide Biotinylated C3 Buffer TubeA 20kDa Tube C -92kDa 34 0d 20 kDa polypeptide 100 j4 92 kDa polypeptide 15.6 x 10 moles 5.6 x 10-9 moles 3 pl C3 3 p.1C3 71 X 10"1 moles 71 x 10-12 moles: 63 W1 0.01% BSAIPBS 63 p1 0.01 BSA/PBS Samples from Tubes A and C were removed after 66 hours of incubation, reduced by boiling for 2 minutes in reducing buffer with p mercaptoethanol, electrophoresed on 7.5% SDS-PAGE, and transfeied to nitrocellulose paper for Western blotting. Western blotting was carried out for one hour according to standard procedures (Tobin et al. PNAS USA 76:4350-4354, 1979). Membranes were incubated with horseradish-peroxiase-avidin 10,000 dilution) and developed with the Supersignal CL-HRP Substrate System (Amersham) to detect biotinylated C3 fragments.

InFgr aeIi 3aoe(oto) ae n r h 0ad9 kDa polypeptides, and lanes 4 and 5 are again C3 alone (controls). Along the right margin the position of the a-chain of C3, the 0-chain of C3, and the C3 fr-agment present in the control samples are showni. The position of a C3 fament inthe 20 k adtadsevrl ramenin the 9 2 ka diges r identified.

The second experiment used the reagents of the first (expressed..

polypeptides, biotinylated.C3, and buffer) in tbe~sare proportions ais shown in the table above. C3 control samples werc removed at time 0, 2 hours, 8 hours, and 24 hours. l-owever, instead of doing a Western blot, -the samples were reduced on 7.5% SDS-PAGE, reasoning that some additional degradation fiagments might not be biotinylated and would therfore show up on a Coomassie stained SDS-PAGE gel. Indeed, that is what was observed. Only the (lane A8) and 92 (lane CS) kDa polypeptidcs were analyzed on this gel. The gel of Figure 10 shows along the right margin the position of the a-chain of C3 and the p-chain of C3, and the 92 k.Da polypcptide in lane CS. In lane C8 are at les w imnsrnigi i rm-0kat 5ka There are also severa fi mnsbnahtepcana 5ka In lane A8is amajor degradation fragment just below the p-chain of C3. Thus, both the 92 kDa *:9*epd in lane C8 and th 20 wa polypeptide in lane A8 degrade C3.

Preparation of recomibinant 92 kDa protein and generation of poyclonal anitsera The insert in plasmid pLP5I2 (see Example 5) was excised with NcolI and HindM. A fragment of the expected size was purified from low melting point agarose, and subsequently ligated into the Ncol- IRindMl sites of the T7 promoted expression vector pET28a (Novagen, Mladison,

W.

The ligation mixture was subsequently transformed into Topl OF' cells (Invitrogen) and the kanamycin resistant transforlnants were screened as described previously in Example 5. A recombinant plasnmid (pLP5I 5) was subsequently transformed info BL21 cells (Novagen) and grown in SOB media supplemented with 30 rig/mI kanmycin. Cells were grown to an O.D. wo of 0.6, and were subsequently induced with 0.4 trM LPTG (Boebringer Mannheim, Indianapol is, IN) for 2-4 hours. Whole cell lysates were prepared and electrophoresed on a 10% SDS-PAGE get. Coomassie staining of the gel revealed a new band of approximately 80 kfla as compared to a pre-induction sample.

Recombinant protein coded by the -92 kDa ORE was purified from Coil Sftain BL21 (Novagen) containing the plasnild pLP5 15. Bacteria cells were grown to mid log phase in SOB medium containing 50 pig/I kananyciii to select for the Plasmid. Expresssion of the recombinant polypeptide was induced by addition .IPTO to 0.4 miM and continuing incubation for 3 hours. The bacterial cells were harvested by Centrifugation and resuspended in Tris-Buffered Saline, pH7.2.

Cells were mechanically lysed in a French Pressure Cell and the insoluble material including inclusion bodies were pellcted in a centrifuge at 7700 x g at 4 degrees for 10 minutes. The pellet containing the inclusion bodies was* resoliibflized and the soluble protein was purified by ion exchange chromatography. Recombinant protein was used to generate polyclonal antibodies in mice. Briefly, 5 jig of protein was adjuvanted for each dose with jig QS21 and injecte subcutaneously into the necks of a 6-8 weeks Swiss Webster ice. The mice were bled and vaccinated at week 0, vaccinated at week 4, then bled and exsanguinated at week 6. 10 mice were vaccinated with the recombinant 92 kDa protein adjuvanted with QS2I. Pooled sera were used at a 1: 1000 dilution to examine whole cell lysates'and concentrated culture V..supernatants from several serotypes of S. pneumoniae on a Western Blot The sera reaced specifically to a protein in whole cell lysates and concentrated culture supernatants whose molecular weight was approximately 90 kDa.

Eyamne 9 The chart of Figure 11 summarizes thir results from an intranasal

(IN)

challenge of CBAJCAHmN xld/ mice vaccinated with 092 kDa protein, prepared as described in Example 8 (SEQ ID NO:S) adjuanted with monophasphoryl lipid A "ML).

mice per group were vaccinated subcutancously in the neck region at weeks 0, 3,and 5, with either 5 Ri each of 92 kDa adjuvanted with 50 I~ ML, 1 Sec fTp asecnua otepoencrirCM9 adjuvanted with 100 Vig aluminum phosphate, or phosphate buffered saline (PBS) alone, in a sample volume of 10 jil. CRM 197 is a gietically detoxified version of diptheria. toxin. EAch mouise was challenged in at week 7 with 1 x 106 cfu's of Type 3 S. pneumoniae in a 10 pd sample volumne. Nasal tissue was isolated 3 days after challenge and the number of type 3 S. pneumoniae colonyforming units per gram of nasal tissue determined by plating on selective media.

Type 3 is capsule isolated from S. pneumoniae serotype 3, and then conjugated to protein carrier CRM 197, through reductive animation (see U.S. Patent No. 360,897 for preparation of the Type 3 control; see U.S. Patent No. 5,614,382 for genetically detoxified version ofditheria toxin; see U.S.Patent 4,902,506 with regard to using CRM 197 as a carrier).

The chart in Figure 11 shows that in this model, both the negative 10 controls, mice adjuvanted with MPL and naive mice at 6 weeks of age, had a "survival rate of approximately 30% when challenged intranasally, while the positive control, the Type 3 conjugate adjuvanted with aluninum phosphate, offered 100% protection against death to the end of the study, approximately 14 days. When mice immunized with r92 kDa were challenged, 100% survived to the end of the study, indicating that r92 kDa protein does offer protection against death from intranasal challenge by Type 3 S. pneumoniae.

Examnle

METHODS

Recombinant 92 kDa (r92 kDa) polypeptide (SEQ ID NO:5) were incubated with purified human C3 for 2 hours, 6 hours, and 26 hours at 37°C in the following ratios: Tub A (Control): C3 3pl [7.2x10-12 moles] PBS/0.01% bovine serum albumin (BSA) 100 l; TOIbe: r92 kDa 50 l [5.

6 x10-10 moles] C3 3 il [7.2x10-12 moles] PBS/0.01% BSA 50 pl.

At each time point 6, and 26 hours), 20 gp samples were removed from Tubes A and B reducing buffer was added, and the samples were boiled at 100°C for 2 minutes.

After boiling, samples were electrophoresed on 7.5% SDS-PAGE under reducing conditions. The SDS-PAGE gel was stained with Coomassie blue. The resultant gel is shown in Figure 12.

Lane 1 molecular weight standards (reading from top of gel 20 k- 1 kfla,97 kDa, 66 kDa, 45 kDa); Lanes 2and 4- 2 hour incubatio'n Laue 2 C3 control (Tube Lane 4 -r92 kDa sapl (Tube Laes5 ad 7 -6hou inuain ae5-C oto rb ae7-r2kasml rb Lans 8 and 10 -26 hour incubation; Lane 8 Q3 control (Tube Lane r92 kDa sample (Tube B).

INTERPRETATION of GEL The c-chain of C3 rung at about 115 kDa.The -Chain of C3 runs at abu 75 Mta. These arc marked on the gel. The band at abu 66 kDa is .albumin. Lanes 2 and 4are te2-hour incubation. Compared to Lane 2 (M control), Lane 4 shows cleavage of the C3 a-chain new fragment at -97 kDa.

Lanes 5 and 7 are the 6-hour incubation. There is the same new 97 kDa cleavage fr-agment in Lanie 7. Lanes 8 and 10 are the 26-hour incubation. Compared to Lane 8 (C3 control), Lane 10 shows continued cleavage of the a-chain.

It will be appreciated by those skilled in the art that while the invention has been described above in connection with particalar emibodimnents and examples, the invention is not necessarily so limited and that numerous other embodiments, examples, uses, modifications and departures from the embodiments, examples and uses may be made without departing from the inventive scope of this application.

SEQUENCE LISTING <110> H4OSTETTER, Margaret K.

FINKEL, David J.

CfLENG, Qi MASI, Amy W.

REGENTS OF THE UNIVERSITY OF MINNESOTA AMERICA.N CYNAMID COMPANY <120> HUMAN COMPLEMENT C3-DEGHADING PROTEINASE FF1OM STREPTOCOCCUS PkIEUMONIAE <130> 11000570230 <140> Not Assigned <141> 1999-09-24 <150> 60/101,-736 <151' 1998-09-24 <150> 09/283,094 <151> 1999-03-31 <160> <170> Patentln Ver. <210> <211> <212> <213> 1 504

DNA

Streptococcus pneumoniac en.

a <400> 1 atgtcaa gcc gatggcctta ccgcacggag ttggctcgta gaacaaccaa c-ctcaaccag gtaggcgatg ctttcagcag cataagctgc ttttacgtga ttttcgaccc Accattatca ttattcccct gtccacaatc ctccaagqaa gttatgtctt aaacageagc agttagatcc attgtatgct agcgcaaatc ctttattect tcgttatcgt gacteeggaa tccaattgat tgagjgaga&t aggcattgat atta aaacccttat cagaacgcca acangtcgaa ccgCCaatgg tattcacaac tgtcaccttt tcaaaccatt qggtaccaga ectagtccaa gtccgcaacc gagaaattgg tcaaagaage ggagttcctc gttatatccc agcaaactgg ccaageagga tgtagaatct tgttgctgta ggaagaaaaa ttcaagacca tgcaccaaat tgttcgaaaa agcoaaggat aagtttatct <210> 2 <211> 168 <212> PRI <213> Streptococcus pneunioniae <400> 2 m1et Ser Ser loeu Leu Arg Glu Lou Tyr Al~a Lys 1 5 10 Pro Lau Ser Glu Arg His Val Glu Ser Asp Gly Leu Ile Phe 25 Arg Thr Ala Asn Gly Val Ala Val Pro 1 35 40 Ile Pro Tyr Ser GIn Lou Ser Pro Lou 55 Asp Pro Ala Gin Ile Thr Ser His Gly Asp His Tyr His Phe Glu Glu Lys Lou Ala Arg Il.

Ile Pro Lett Arg Tyr Arg Ser Asn His Trp Val Pro Asp Ser Arg Pro' 70 75 Giu Gin Pro Ser Pro Ala Pro Asn 100 Leu Val. Lys Glu 115 Gin Ser Thr Pro Ciii P~o Ser Pro Pro Gin Pro Ala Val Arg Ala Pro 105 Sex Asn Pro Ile Ser Pro GIn Asp Glu Lys 110 Val. Phe Giu Val Gly AZP GlY Glu Asn Gly Val Pro Arg Tyr 130 135 Thr Ala Ala Gly Ile Asp Ser 145 150 le Pro Ala Lya Asp 140 Leu Ser A-la Giu Lys Leu Ala Gin Glu Ser Lau Ser 160 fee* 0 .0 His LYS Leu Gin Leu 165 Asp Pro Len K210> 3 <211> 504 <212> DNA (213> Streptococcus pneumoniae <400> 3 taat ggatct gcctgctgct ctcaaagaca tggattgctt agtcgattgt acgaagggga aaagtgataa Cgctgggtc-g caattcacgt a. a.

a aactgcagct gtttetgctg taaccatcgc ggagctggtt ggacttggtt ataatacgag tggrtctccgt aaaataaggc aaaaggcttg tatgagataa aaagatcctt ctacttttcg gaggatttgg gttctggtet ccaatttttc gcggtacagc Catcagattc acat actttcctgc ggctgggata aacagcttct tgcaggttgc tgaatctggt ttecaaaggt ancaocattg tacatggcgt ttggccagtt taacgaggaa ttgaccaatt ggacttggac acccaatggt gacagttgtq gcgqrttcgaQ tctgataagg tgctatcaat ctccattctc tctcatcaat taggttccgg ttgaaegata aataaggaat ttgtgatttg gtttagcata 120 180 240 300 360 420 480 504 <210> 4 <211> 2478 <212> DNA <213> Streptococcum pneumoniae <400) 4 atgaaaatta tcctatgaac tatatagatg aagagggagg acctctcatg agtgaagagc gaaatcaagg 9cagctcatg agteatantc cgctatacaa gatgettata gctagcgagt tcaagttcta actgteactc ttgytatgcta gcgcaaatca tttatccctt cgttatcgtt actccggaac ataaaaaata ttgqjtcg-tca gtgatcaggc ggatcaacgc gjagaccatta.

tcctcatgaa gtggttatgt cggataatat aCgggggtgg cggatgatgg tcgttcctva tagctgctgc gttataatgc caacttatca aacccttatc caagtcgaac atgaacaaat caaaccattg Ctagjtccaag tctagcaggt teagtggcag ccaagctggt caggttaaga tggtcaaaag gcagaaaact agaacaaatc gtcatcaaga tcattactat aatggcaagg agatccgoat tat cagttga tatcaaggta gatggaaaat tcggacaaaa gaagagatta ttctaacgat caagcagtag ttatatcttc aatgcatctg cggcgaccat taccattaca.

agaagectat tggaatggga aaatccagct caaccaagat7 tcaaaatcaa ggggaaaaca agaacgccat gtggaatctg cgccagaggt gtagctgtc gtctgaattg gaaaaacga ogtaccagat'tcaagaccag tccgcaacat gcaccaaatc tccttgecct aagtgtttgt aagagtctaa tcgagtttct 120 tgacaccaga tgaagtcagt 190 ttacggatca aggttatgtg 240 tecettatga tqccatcatc 300 aggattcaga cattgtcaat 360 actatgttta ccttaaggat 420 aacgtcagma gcaggaacac 480 ttgcagccag agcccaagga 540 atatcattga ggacaegggt 600 ttectaagaz tgagttatca 66D agcagggatc tcgtccttc-t 720 tg-tcagagaa ccacaatotg 780 tttcaagcct tttacgtgaa 840 atggccttat tttcgaccca 900 ctcatqgtaa ccattaccac 960 ttgCtCgtat tattcccctt 1020 etacaaccaag tccacaatcg mAso.

ctocaaccagc tccaagcaat 1140 ccaattgatg gaggagaatq ggcattgata actgacetce attcaccaag ctgttggaac gccttcttag tacactgatg tatatctttg atgacccata caggcttatg aatactgagg ccaettgatc atcatacctc tatgaggcac gaacatccaa.

caaagaaaca cctcagacag ccagagtctc caggt ogiga atccaggatc ttactatttg ttattaaagg agaaattggt gagtttctcg gcaaactggc catctagtga atttacttga gactcaagga ctccgattcg atgagattca aItcctegtga gcc-actggat ctaaagagaa caaaaggagc gtatqcctta.

attatgacca ctaaggggjta acgaacgtcc aaaatggtca aaaaacctga caaaaccaac ctgaaaaggt caattatcaa gcacccagga agagtaag caaagaagct ttatmtccca caagcaggaa tcgagaattt taataaaqgt tgtcccaagjt tcatceagaa agtagccaag tataaccagt taaaaaagat aggtttgacc agaagctatc caatcttcaa ttaccataac tactcttgag gcattcagat agctgat acc ggaagaaacc agaggaacca tgaagaaaa gtccaatgcc caacaatact gttcgaaaag gccaaggatc agtttatctc tacaataagg cgacaagttg gataaagjtCa cgtttaggaa ttggcaggca gatgaggggg agtttgtctg cctccttcga tacaaccgeg tatactgtag atcaaatttg gatcttttgg aatggttttg aatcaaacgg cctcgagaag 4aagaatcac ctgagagagg aaagagactc attatggcag taggcgatgg tttcagcaga ataagctagg cttatgactt attttgaggc acqttagtgga aaccaaatgc agtacacaac atgcctatgt aagctgagag cagaccatca tgaaagcagc aagjtcaaaaa agtggtttga cgactgtcaa gtaacgctag aaaaaccaag agaaaccgea cagaggdatc ctgaagattt tcacaggatt nagctgaaa ttatgtcttt aacagcagea agctaagaaa actagcaaga tt tggataac tgatattctt gcaaattacc agaagacqgt aactccacat agcggcagc ggatt cagga taagaaggtg cggtagttta cgaaggcctt gtactatgtc cgaccatgtt cgaggagaa aagcgagaaa agaagaaect acttggaaaa aaaaaataat actattgqct 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 2400 2460 2478 a. a <210> <211> 826 <212> PRT <213> StrePtococcus prieumoaiae <400> Met Lys Ile Asn Lys Lys Tyr Leu Ala Gly Ser Val Ala Val Leu Ala 5 10 Leu Ser Val Lys Lys Glu Cys Ser 20 Tyr Gin Leu Gly Arg 25 His Gln Ala Gin Ala Gly Ser Asn Azg Val Tyr Ile Asp Gly a. aGin Lys s0 Ala Giti Azn Leu Thr Pro Asp Giti Val Lys Arg Clu Gly Asn Ala Giu Gin Val XIQ Lys Ile Thr Asp Gin Gly Tyr Thr Ser His Giy His Tyr His Tyr Asn Gly Lys Val Pro Tyr Asp Ala Ilie Leu Lys Asp 115 Ser Giu Glu, Leu Met Ly3 Asp Pro Asn Tyr Gin 110 Tyr Val Ile Ser Asp Ile Val Glu Ile Lys Gly Lys Vai 130 Asp Gly Lys Tyr Val Tyr Lou Lys Asm 140 Arg Gin 155 Ala Ala His Ala Lys Gin Giu His 160 Asn Ile Arg Thr Lys 150 Glu Giu Ile Lys Ser His Aen HiS Gly Gly Gly Ser Asn Asp *Gln Ala Val Val Ala Ala 165 170 175 Arg Ala Gin Gly Arg Tyr Thr Thr Asp Asp Gly Tyr 114 Phe Asn Ala 180 185 190 Ser Asp Ile Ile Glu Asp Thr Gly Asp Ala Tyr le Val Pro His Gly 195 200 205 Asp His Tyr His Tyr Ile Pro Lys Asn Glu Leu Ser Ala Ser Glu Lea 210 215 220 Ala Ala Ala Glu Ala Tyr Trp Asn Gly Lys Gin Gly Ser Arg Pro Ser 225 230 235 240 Ser Ser Sex Ser Tyr Asn Ala Asn Pro Ala Gin Pro Arg Lea Ser Glu 245- 250 255 Asn His Asn Lau Thr Val Thr Pro Thr Tyr His Gin Asn Gin Gly Glu 260 265 270 Asn Ile Ser Ser Leu Leu Arg Glu Lea Tyr Ala Lys Pro Leu Ser Glu 275 290 205 Arg His Val Glu Ser Asp Gly Leu Ile Phe Asp Pro Ala Gin Lie Thr 290 295 300 Se Arg Thr Ala Arg Gly Val Ala Val Pro His Gly Asn His Tyr His 305 310 315 320 Phe le Pro Tyr Giu Gin Met Ser Glu Len Giu Lys Arg Ile Ala Arg 325 330 335 Lie Lie Pro Len Arg Tyr Arg Ser Asn His Trp Vai Pro Asp Ser Arg 340 345 350 Pro Glu Gin Pro Ser Pro Gin Ser Thr Pro Glu Pro Ser Pro Ser Pro 355 360 365 Gin Pro Ala Pro Asn Pro Gin Pro Ala Pro Ser Asa Pro Ile Asp Glu 370 375 380 Lys Len Val Ly$ Glu Ala Val Arg Lys Val Gly Asp Gly Tyr Vai Phe 385 390 395 400 Glu Glu Asn Gly Val Ser Arg Tyr Ile Pro Ala Lys Asp Leu Ser Ala 405 410 415 Glu Thr Ala Ala Gly Ile Asp Ser Lys Lau Aa Lys Gin Glu Ser Len 420 425 430 Ser His Lys Leu Gly Ala Lys Lys Thr Asp Leu Pro Ser Set Asp Arg 435 440 445 GIu Phe Tyr Asn Lys Ala Tyr Asp Leu Leu Ala Arg lie His Gin Asp 450 455 460 Len Lea Asp Asn Lys Giy Arg Gin Val Asp Phe Glu Ala Len Asp Asn 465 470 475 480 Lau Lou Glu Arg Leu iys Asp Vai Pro 5cr Asp Lys Val Lys Lou Val 485 490 495 Asp Asp Ile Leu Ala Phe Leu Ala Pro-ile Arg His Pro Glu Arg Leu 500 505 51-0 0 v

C

C.

C.

C

be..

C

C

Gly Lys Pro Asn 515 Ala Lys Leu Ala 530 Pro Aig Asp Ile 545 Met Thr his Ser Arg Ala Ala Ala 580 Ser Thr Asp His 595 Ala Ile Tyr Azn 610- Met Pro Tyr Asn 625 Ile Ile Pro His Asp Glu Gly Leu 660 Leu Ala Thr Val 675 Ser Asp Asn Gly 690 Aan Gly Gin Ala 705 Pro Gin Thr Glu Gin Ser Giu Lys 740 Ser Pro Glu Glu 755 Glu Lys Leu Arg 770 Ile Ile Lys Ser 785 Leu Leu Phe Gly Lys Leu Leu Ala 820 Gly Thr His 565 Gin Gin Arg Lea Tyr 645 Tyr Lys Phe Asp Lys 725 Pro Ser Glu Asn Thr 805 Leu Lys Tyr 535 Ser Asp 550 Trp Ile Ala Tyr Asp Ser Val Lys 615 Gin Tyr 630 Asp His Glu Ala Tyr Tyr Gly Asn 695 Thr Asn 710 Pro Glu Glu Ser Glu Glu Ala Glu 775 Ala Lys 790 Gin Asp Lou Lys Thr Thr Giu Asp Glu Gly Asp Ala 555 Lys Lys Asp Ser 570 Ala Lys Giu Lys 585 Gly Asn Thr Giu 600 Ala Ala Lys Lys Thr Val Giu Val 635 Tyr His Asn Ile 650 Pro Lys Gly Tyr 665 Val Glu His Pro 680 Ala Set Asp His Gin Thr Glu Lys 715 Glu Glu Thr Pro 730 Pro Lys Pro Thr 745 Pro Gin Val Glu 760 Asp Leu Leu Gly Glu Tbr Leu Thz 795 Asn Asn Thr Ile 810 Glu Ser Lys 825 Gly 540 Tyr Leu Gly Ala Val 620 Lys Lys Thr Asn Val 700 Pro Arg Glu Thr Lys 780 Gly Met Tyr Val Ser Leu Lys 605 Pro Asn Phe Leu Glu 685 Gin Ser Glu Glu Glu 765 Ile Leu Ala Ile Phe Asp Thr Pro His 560 Glu Ala Glu 575 Thr Pro Pro 590 Gly Ala Glu Leu Asp Arg Gly Ser Leu 640 Glu Trp Phe 655 Glu Asp Leu 670 Arg Pro His Arg Asn Lys Glu Glu Lys 720 Glu Lys Pro 735 Pro Glu Glu 750 Lys Val Glu Gin Asp Pro Lys Asn Asn 800 GluAla Glu 815 Ala Gin Ile Thr Tyr Thr Asp Asp lu le Gin Val 520 525 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <220> <223> Incorporates a Ncol site and a DNA codon for ala.

<400> 6 gggggccatg gcctcaagcc ttttacgtga attg 34 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> i~e..<223> Description of Artificial sequence: Primer to: <220> *<223> Incorporates a RzmRl site.

<400> 7 ggggggatc cctagctata tgagataaac tttcctgct 39 <210> 8 36 <212> DNA <213> Artificial Sequence <220> :<223> Description of Artificial Sequence: Primer 0 <220> <223> Incorporates a Ncol site and a DNA codon for Glu.

.too <400> 8 ccgggecat ggctaaaatt aataaaaaat atctag 36 .<210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <220> <223> Incoporates a HindD III site.

<400> 9 ccgggcaagc ttttacttac tctcct 26 <210> <211> <212> DNA <213> Artificial Sequence <22 0> <223> Description of Artificial Sequence: Probe <220> 7 <223> Oligonucleotide <400>. gjaaaaqaata atgtagaaga ctactttaaa gaaggttaga 0* 0 se* ago*

Claims (26)

1. 3. The polypeptide of claim I which is a recombinant polypeptide.
2. 4. The polypeptide of claim 1 having a molecular wreight of about 15 kfla to about 25 The polypepticie of claim 1 having a molecular weight of about 75 kDa to 9 about 95 kba.
3. 6- Th olpptd of claim 1 which degrades hurnan complement protein 9 9 C3.
4. 7. The polypeptide of claim 1 comprising at least 15 sequential amino acids.
5. 8. An isolated polypeptide comnprising at least 15 sequential amino acids of SEQ ID) NO:2 or SEQ ID
6. 9. -An isolated polypepdec comprising SEQ ID NO.2 or SEQ ID) An immune system stimulating composition comprising an effective amount of the polypeptide of claim 1 and a therapeutically acceptable carrier.
7. 11. The immune system stimulating composition of claim 10 wherein the polypeptide is isolated from S. pneumaoniae.
8. 12. The immune system stimulating composition of claim 11 further comprising at least one other immune system stimulating polypeptide -isolated from pnemnonlae. 0e
9. 13. The immune system stimulating composition of claim 10 wherein the polypeptide is effective to immunize or treat a mammalian subject .against S. pnewnoniae infection or colonization. so&* .S
10. 14. The immune system stimulating composition of claim 13 wherein the polypeptide is provided in an amount effective to provide a therapeutic effect to the mammalian subject. *age 0*90 An antibody capable of binding to the polypeptide of claim 1.
11. 16. The antibody ofclaim 15 which is a monoclona antibody.
12. 17. The antibody of claim 16 which is obtained from a raouse, a rat, a goat, a chicken, a human, or a rabbit.
13. 18. An isolated nucleic acid molecule which hybridizes under highly stringent hybridization conditions to at least a portion of either the nucleotides in SEQ ID NO:1 or a complementary strand thcreo or (b) the nucleotides in SEQ ID NO:4 or a complementary strand thereof
14. 19. The nuclei: acid molecule of clim 18 isola',d from S. pnewnmontae. The nucleic acid molecule of claim 19 which encodes a polypeptide that degrades human complement C3.
15. 21. A vector comprising the nucleic acid miolecule of clain 18S.
16. 22. A cell comprising the nucleic acid of claitn 18.
17. 23. The cell of claim 22 which is a bacterium or a eukaxyotic cell.
18. 24. An isolated nucleic acid molecule comprising the nucleic acid sequence of SEQ ID) NO:1I or its complemnentazy strand or SEQ ID) NO:4 or its complementary strand. An RNA molecule transcribed by a double-stranded DNA sequence comprising SEQ MD NO:1I or SEQ ID) NOA4
19. 26. A method for producing an immune response to S pneumoniae in a mammal, the method comiprising administering to.a. mammal a composition comprising: a therapeutically effective amount of the polypeptide of claim 1; and a pharmaceutically acceptable carrier.
20. 27. The method of claim 26 wherein the immune response is a B cell response, a T cell response, an epithelial cell response, or an endothelial cell response.
21. 28. The method of claim 26 wherein the polypeptide is at least 15 amino acids in length.
22. 29. The method of claim 26 wherein the composition further comprise at least one other immune system stimulating polypeptide from S Pneumoniae. A method for inhib~iting pneumoniae-mediated C3 degradation, the method comprising contacting an S. pneumoniae bacterium with an antibody capable of binding to the polypeptide of claim 1. 3 1. -A method for inhibitin C3-mediatecj inflammation and rejection in xenotransplantation. the ruethod comprising expressing on the surface of an organ of an animal used in xenotranslantation the polypeptide of claimn 1.
23. 32. An isolated nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID) NO:6,, SEQ ID NO:7, SEQ ED NO:8, and SEQ 1E) NO:9.
24. 33. An isolated polypeptide having at least 80%/ sequence identify to SEQ ID NO:2 or SEQ ID
25. 34. An isolated polypeptide of about 15 kDa to about 25 kDa from S. pfleumoniae that degades human complement protein C3. An isolated polypeptide of about 75 kDa to about 95 kDa from S pneuinoniae that degrades human complement protein C3. DATED THIS THIRTIETH DAY OF MARCH
26. 2000. Regents of the University of Minnesota; American Cyanamid Company By_ Pizzeys Patent and Trade Mark Attorneys