MXPA00002932A

MXPA00002932A - Human complement c3-degrading proteinase from streptococcus pneumoniae

Info

Publication number: MXPA00002932A
Application number: MXPA/A/2000/002932A
Authority: MX
Inventors: Margaret K Hostetter; David J Finkel; Qi Cheng; A Green Bruce; Amy W Masi
Original assignee: American Cyanamid Company; Qi Cheng; David J Finkel; A Green Bruce; Margaret K Hostetter; Amy W Masi; Regents Of The University Of Minnesota
Priority date: 1997-09-24
Filing date: 2000-03-24
Publication date: 2002-03-26

Abstract

The present invention relates to the identification and use of a family of human complement C3-degrading proteinases expressed by S. pneumoniae. The proteinase has a molecular weight of about 15 kD to about 25 kD. A preferred proteinase of this invention includes the amino acid sequence of SEQ ID NO:2.

Description

PROTEINASE OF STREPTOCOCCUS PNEUMONIAS THAT DEGRADED C3 OF HUMAN COMPLEMENT FIELD OF THE INVENTION This invention relates to Streptococcus pneumoniae and in particular, this invention relates to the identification of a protein of S. pneumoniae that is capable of degrading the human complement protein, C3.

BACKGROUND OF THE INVENTION Respiratory infection with the bacterium Streptococcus pneumoniae (S. pneumoniae) produces an estimated 500,000 cases of pneumonia and 47,000 deaths annually. Those with a higher risk of pneumococcal bacteremic infection are infants under two years of age, and individuals with a compromised immune system in old age. In these populations, S. pneumoniae is the main cause of bacterial pneumonia and meningitis. In addition, S. pneumoniae is the main bacterial cause of otic infections in children of all ages. Both children and the elderly share defects in the synthesis of protective antibodies to neu ococular capsular polysaccharide after bacterial colonization, local or systemic infection, or vaccination with REF .: 33076 purified polysaccharides. The bacterium S. pneumoniae is the main cause of invasive bacterial respiratory disease in adults and children with HIV infections and produces hematogenous infection in these patients (Connor et al., Current Topics in AIDS 1987; 1: 185-209 and Janoff et al. Ann, Intern. Med. 1992; 117 (4): 314-324). Individuals who demonstrate the highest risk of serious infection are not able to produce antibodies to current capsular polysaccharide vaccines. As a result, there are now four vaccine conjugates in a clinical trial. The vaccine conjugates consist of pneumococcal capsular polysaccharides coupled to carriers or protein adjuvants in an attempt to enhance the antibody response. However, there are other potential problems with vaccine conjugates currently in clinical trials. For example, the pneumococcal serotypes that are most prevalent in the United States are different from the serotypes that are more common in places such as Israel, Western Europe, South Africa or Scandinavia. Therefore, vaccines that may be useful in one geographic area may not be useful in another. The potential need to modify currently available capsular polysaccharide vaccines or to develop protein conjugates for capsular vaccines and adapt them to geographical serotypic variability implies financial complications and prohibitive techniques. Therefore, the search for immunogenic proteins, of exposed surface that are highly conserved worldwide among various virulent serotypes, for the prevention of pneumococcal infection and the formulation of highly protective pneumococcal vaccines is of paramount importance. In addition, the emergence of pneumococci resistant to penicillin and cephalosporin on a global basis makes the need for effective vaccines even more imperative (Baquero et al., J. Antimicrob, Chemother, 1991; 28S; 31-8). Several pneumococcal proteins have been proposed for configuration with the pneumococcal capsular polysaccharide or as simple immunogens to stimulate immunity against S. pneumoniae. It has been reported that surface proteins are involved in the adhesion of S. pneumoniae to epithelial cells of the respiratory tract and include PsaA, PspC / CBP112 and the IgAI proteinase (Sampson et al., Infect. Immun., 1994; 62: 319 -324, Sheffield et al., Microb. Pa thogen., 1992; 13: 261-9, and Wani, et al., Infect. I mun, 1996; 64: 3967-3974). Antibodies to these adhesins can inhibit the binding of pneumococci to respiratory epithelial cells and thus reduce colonization. Other cytosolic pneumococcal proteins such as pneumolysin, autolysin, neuraminidase or hyalurodinase are proposed as vaccine antigens because antibodies can potentially block the toxic effects of these proteins in patients infected with S. pneumoniae However, these proteins are typically not located on the surface of S. pneumoniae, rather they are secreted or released from the bacterium as the cells are lysed and killed (Lee et al., Vaccine 1994; 12: 875-8 and Berry et al. Infect, Immun, 1994; 62: 1101-1108). Although the use of these cytosolic proteins as immunogens may decrease the subsequent consequences of S. pneumoniae infection, antibodies to these proteins do not promote pneumococcal death or prevent initial or subsequent pneumococcal colonization. A prototypic surface protein that is being tested as a pneumococcal vaccine is pneumococcal surface protein A (PspA). The PspA protein is a heterogeneous protein of approximately 70-140 kDa. The structure of PspA includes an alpha helix in the terminal amino part, followed by a proline-rich sequence, and ends in a series of 11 repeated sequences linked to choline in the carboxy terminal part. Although much information is available regarding its structure, PspA is not structurally conserved among the various pneumococcal serotypes and its function is completely unknown (Yother et al., J. Bacteriol., 1992; 174: 601-9 and Yother J. Bacteriol, 1994).; 176: 2976-2985). Studies have confirmed the immunogenicity of PspA in animals (McDaniel et al., Microb. Pa thogen, 1994; 17; 323-337). Despite the inumogenicity of PspA, the heterogeneity of PspA, its existence in four structural groups (or ciados), and its function, not characterized, complicates its ability to be used as a vaccine antigen. In patients who can not generate protective antibodies for the capsular polysaccharide of specific type, the third complement component, C3, and the proteins associated with the alternative pathway of complement constitute the first line of defense of the host against S. pneumoniae infection. Because complement proteins can not penetrate the rigid cell wall of S. pneumoniae, deposition of opsonic C3b on the pneumococcal surface is the main mediator of pneumococcal clearance. The interactions of pneumococci with plasma C3 are known to occur during pneumococcal bacteremia, when the covalent binding of C3b, the opsonically active fragment of C3, initiates phagocytic recognition and ingestion (Johnston et al., J. Exp. Med 1969; 129: 1275-1290, Hasin HE, J. Immunol., 1972; 109: 26-31 and Hostetter er al. ". Infect. Dis. 1984; 150: 653-61.) C3b is deposited on the pneumococcal capsule, as well as On the cell wall, this method to control infection by S. pneumoniae is very inefficient.The methods of increasing the opsonization of S. pneumoniae can improve the course of the disease induced by this organism.There is currently a strong need for methods and therapies to limit infection by S. pneumoniae.

BRIEF DESCRIPTION OF THE INVENTION This invention relates to the identification and use of a family of human complement C3-degrading proteins (proteinases) expressed by S. pneumoniae. The proteins preferably have a molecular weight of about 15 kD to about 25 kD, determined, for example, in a 10% SDS polyacrylamide gel. The invention includes numerous isolable proteins of different C3-degrading strains of S. pneumoniae. In one aspect, the invention relates to an isolated protein having at least 80% sequence identity with SEC. FROM IDENT. NO: 2. In a preferred embodiment, the protein is isolated from S. pneumoniae or alternatively the protein, it is a recombinant protein. Preferably, the isolated protein degrades the human complement protein, C3. A preferred protein of this invention is an isolated protein having an amino acid sequence that includes SEQ. FROM IDENT. NO: 2, and more preferably is the SEC. FROM IDENT. NO: 2. As used herein, the term "isolated" refers to a naturally occurring species that has been removed from its natural environment, as well as synthetic species. As used herein, the term "protein" herein includes one or more functional units, which encompass one or more peptides or polypeptides. The invention also relates to peptides or polypeptides isolated from the C3 degrading proteinase of this invention. Preferably, the invention provides peptides or polypeptides of at least 15 sequential amino acids from an isolated protein having at least 80% sequence identity with SEC. FROM IDENT. NO: 2, and more preferably, peptides or polypeptides of at least 15 sequential amino acids of SEQ. FROM IDENT. NO: 2. In another aspect of this invention, the peptides or polypeptides are capable of degrading the human complement protein, C3. Preferred embodiments of the invention include an isolated protein comprising amino acids from about 1 to about 58 of SEQ. FROM IDENT. NO: 2, and an isolated nucleic acid fragment comprising the nucleotides from about 1 to about 174 of SEQ. FROM IDENT. NO: 1, or its complementary chain. Preferably, the isolated nucleic acid fragment comprises the nucleotides of about 150 to about 174 of SEQ. FROM IDENT. NO: l or its complementary chain. In another aspect, the invention relates to an isolated protein that degrades C3 human complement protein, wherein the nucleic acid encoding the protein hybridizes with SEC. FROM IDENT. NO: 1, or its complementary chain, under conditions of highly astringent hybridization. The invention also relates to a stimulatory composition of the immune system (preferably a vaccine) comprising an effective amount of a peptide or polypeptide stimulating the immune system, comprising at least 15 sequential amino acids derived from a protein wherein the protein has at least 80% sequence identity, with SEC. FROM IDENT. NO: 2, and is able to degrade the human complement protein, C3. Preferably, the protein is isolated from S. pneumoniae. In one embodiment, the immune system stimulating composition or vaccine further comprises at least one other peptide stimulating the immune system, a polypeptide or a protein that is isolated from S. pneumoniae. The invention further relates to an antibody capable of binding (typically specifically binding) to a protein comprising at least 80% sequence identity with SEC. FROM IDENT. NO: 2, and capable of degrading the human complement protein, C3. In one embodiment, the antibody is a monoclonal antibody, and in another embodiment, the antibody is a polyclonal antibody. In another embodiment, the antibody is an antibody fragment. The antibody or antibody fragments can be obtained from mouse, rat, goat, chicken, human or rabbit. In another embodiment, the antibody is capable of binding to at least a portion of a protein, wherein the nucleic acid encoding the protein hybridizes with SEC.

FROM IDENT. N0: 1 or its complementary strand under conditions of highly astringent hybridization. The invention also relates to an asylated nucleic acid fragment (polynucleotide) capable of hybridizing with SEC. FROM IDENT. NO: l or its complementary chain under highly stringent hybridization conditions. As used herein, highly stringent hybridization conditions include, for example, 6XSSC, 5X Denhardt, 0.5% SDS and 100 μm / ml fragmented and denatured salmon sperm DNA, hybridized overnight at 65 ° C and wash in 2XSSC, 0.1% SDS once at room temperature for approximately 10 minutes, followed once for 65 minutes at approximately 65 ° C, followed by at least one wash at 0.2 XSSC, 0.1% SDS at room temperature for at least 3-5 minutes. In one embodiment, the nucleic acid fragment is isolated from S. pneumoniae, and in another embodiment, the nucleic acid fragment encodes at least a portion of a protein. In one embodiment, the protein degrades human complement protein, C3. In another embodiment, the nucleic acid fragment encodes a peptide or polypeptide that does not degrade human complement, C3. In another embodiment, the nucleic acid fragment is in a nucleic acid vector, and the vector can be used as an expression vector capable of producing at least a portion of a protein. Cells containing the nucleic acid fragment are also contemplated in this invention. In one embodiment, the cell is a bacterium or a eukaryotic cell. The invention further relates to an isolated nucleic acid fragment comprising the nucleic acid sequence of SEQ. FROM IDENT. N0: 1, or its complementary chain. The invention further relates to an RNA fragment transcribed by a double-stranded DNA sequence comprised by SEQ. FROM IDENT. N0: 1 In another aspect of this invention, the invention relates to a method for producing an immune response against S. pneumoniae in a mammal (particularly a human), which includes the steps of: administering a composition comprising a therapeutically effective amount of at least a portion of a protein to an animal, wherein the nucleic acid encoding the protein hybridizes with SEC. FROM IDENT. NO: 1, or its complementary strand, under highly stringent hybridization conditions to produce an immune response to the protein. The immune response may be a B cell response, a T cell response, an epithelial response or an endothelial response. In a preferred embodiment, the composition is a vaccine composition. Preferably, the protein is at least 15 amino acids in length and preferably the composition further comprises at least one other immune system stimulating peptide, the S. pneumoniae polypeptide or protein. In one embodiment, the protein comprises at least 15 amino acids of SEC. FROM IDENT. NO: 2. The invention is further related to an isolated protein of about 15 kDa to about 25 kDa of Streptococcus pneumoniae which is capable of degrading C3 human complement, and with a method to inhibit C3 degradation mediated by Streptococcus pneumoniae, comprising the step of: contacting a Streptococcus pneumoniae bacterium, with an antibody capable of binding to a protein with at least 80% identity in the amino acid sequence with the SEC. FROM IDENT. NO: 2. The invention also relates to a method for inhibiting C3-mediated inflammation and rejection in a xenotransplant, comprising the step of expressing on the surface of an organ of an animal used in xenotransplantation, a protein with the sequence of amino acids of the SEC. FROM IDENT. NO: 2. This method is particularly advantageous to cause, for example, that pig kidneys express the protein described herein and thus inhibit C3-mediated inflammation after xenotransplantation. The invention also relates to an isolated nucleic acid molecule containing a region of at least 15 nucleotides which hybridizes under highly stringent hybridization conditions with at least a portion of a SEC nucleic acid sequence. FROM IDENT. N0: 1 or its complementary chain. In a modality, an isolated nucleic acid molecule is capable of hybridizing under high stringency hybridization conditions with at least one region of SEQ. FROM IDENT. N0: 1 or its complementary strand, preferably, at least one region includes nucleotides 1-174 or 230-492 of SEQ. FROM IDENT. NO: l. In still another embodiment, the invention relates to an isolated nucleic acid molecule, which contains a region of at least 15 nucleotides which hybridizes under high stringency hybridization conditions with at least a portion of the nucleic acid sequence of SEC. FROM IDENT. NO: 4 or its complementary chain. In one embodiment, an isolated nucleic acid molecule is capable of hybridizing under conditions of high stringency with at least one region of the SEC. FROM IDENT. NO: 4 or its complementary chain. Preferably, at least one region includes nucleotides 507-681 or 827-999 of SEQ. FROM IDENT. NO: 4 In another embodiment, at least a portion of the nucleic acid molecule of SEQ. FROM IDENT. NO: 4 codes for at least a portion of a protein. Preferably, the protein has a predicted amino acid sequence as shown in SEQ. FROM IDENT. NO: 5, and has a molecular weight of about 75 kDa to about 85 kDa determined, for example by SDS-PAGE. The invention also relates to fragments of Isolated DNAs or primers having the nucleic acid sequences shown in SEQ. FROM IDENT. NO: 6, SEC. FROM IDENT. NO: 7, SEC. FROM IDENT. NO: 8 and SEC. FROM IDENT. NO: 9. In another aspect of the invention, the invention relates to an immune system stimulating composition or vaccine containing a therapeutically effective amount of at least a portion of a protein, wherein the nucleic acid encoding the protein is able to hybridize with the sequence of the SEC. FROM IDENT. NO: 4 or its complementary chain, under conditions of high stringency hybridization. A method to produce an immune response for S. pneumoniae in a mammal (particularly a human) includes the steps of: administering a composition comprising a therapeutically effective amount of at least a portion of a protein to a mammal, wherein the nucleic acid encoding the protein hybridizes with the SEC . FROM IDENT. NO: 4 or its complementary chain, under conditions of astringent hybridization to obtain an immune response to the protein. In another embodiment, the invention relates to a vaccine or a composition that stimulates the immune system, which contains an amount of at least a portion of a protein that is effective to immunize or treat a mammalian subject against infection or S colonization. pneumoniae and a pharmaceutically acceptable carrier. The protein is derived from a nucleic acid molecule that hybridizes under conditions of high stringency with a nucleic acid sequence, as shown in SEQ. FROM IDENT. NO: 4 or its complementary chain, which codes for the protein. Preferably, the protein is provided in an amount effective to provide a therapeutic effect to the mammalian subject, especially a human subject.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 provides a nucleic acid sequence of a translated portion of a C3 degrading proteinase gene of this invention (SEQ ID NO: 1).

Figure 2 provides the amino acid sequence of a C3 degrading proteinase of this invention (SEQ ID NO: 2). Figure 3 presents a diagram of the amino acid sequence of a C3 degrading proteinase placed with the nucleic acid sequence encoding a C3 degrading proteinase according to this invention (SEQ ID NO.

NOS: 2 -3). Figure 4 provides the nucleic acid sequence for a predicted amino acid sequence of 79 kDa (SEQ ID NO: 4). Figure 5 provides the predicted amino acid sequence of 79 kDa (SEQ ID NO: 5). Figure 6 shows the sequence alignments of the SEC. FROM IDENT. NO: l and SEC. FROM IDENT. NO: 4 Figure 7 shows the sequence alignment of the SEC. FROM IDENT. NO: 2, with the corresponding amino acids 169-331 of SEC. FROM IDENT. NO: 5 DETAILED DESCRIPTION OF THE PREFERRED MODALITIES The present invention relates to the identification and isolation of a proteinase that degrades C3 of human complement with a molecular weight of approximately 20 kDa (± 5 kDa) on a 10% SDS-PAGE gel and nucleic acid encoding the proteinase that Degrade C3. It has been observed that cultures that grow exponentially from pneumococci of various serotypes are able to first degrade the β chain and then degrade the C3 chain to C3 without producing defined separation fragments of C3 (Angel, et al., "Infect. Dis. 170: 600-608, 1994.) This pattern of degradation without separation differs substantially from that of other microbial products such as the enzyme elastase from Pseudomonas aeruginosa and the cysteine proteinase from Entamoeba histolytica.The term "degrade" is used herein to refer to the removal of amino acids from proteinase molecules, generating peptides or polypeptides The proteins of this invention degrade C3 without producing specific separation fragments as observed in a polyacrylamide gel.There is at least some preference for proteinases that degrade C3 of this invention for C3 in that, for example, the proteinase that degrades C3 does not appear to degrade other proteins, such as albumin. A proteinase that degrades C3 of about 20 kDa is isolated from a library of pneumococcal genes intentionally interrupted by identifying those clones that have decreased C3 degrading activity, compared to wild-type S. pneumoniae. In Example 1 an exemplary assay is provided to determine the C3 degrading activity of clones. Clones with decreased C3 degrading activity are identified and a Smal insert of 546 bp is selected, based on the sequence of the clones that have demonstrated decreased C3 degrading activity. These Smal fragments are used to probe a library of S. pneumoniae constituted from strain CP1200. Positive clones from the S. pneumoniae library that hybridize to the Smal fragment are isolated and the open reading frame of the gene associated with the C3 degrading activity is identified. The following oligonucleotide (SEQ ID NO: 10) is used, which has sequence identification with a portion of PspA, by differential hybridization, so that the gene encoding the proteinase degrading C3 is different from the gene which codes for PspA.

SEC. FROM IDENT. NO: 10 GAAAACAATAATGTAGAAGACTACTTTAAAGAAGGTTAGA An open reading frame of a 20 kDa protein covers an area of 492 base pairs (SEQ ID NO: 1) which predicts a protein of molecular weight of about 20 kDa (+/- 5 kDa) or about 163 amino acids (SEQ ID NO: 2). An exemplary gene sequence encoding a protein that degrades C3 is provided in Figure 1 as SEC. FROM IDENT. NO: 1 and an amino acid sequence of the protein are provided in Figure 2 as SEC. FROM IDENT. NO: 2. Figure 3 combines a preferred gene sequence with a corresponding preferred protein such as SEC. FROM IDENT. NO: 3. Using the SEC. FROM IDENT. NO: 2, it is determined that the amino acid sequence of the protein is not related to other proteins in the GenBank or Swiss Prot databases. The predicted protein encompasses a proline-rich sequence, characteristic of the membrane domains in prokaryotes, particularly between amino acids 80-108 suggesting that the protein is expressed on the surface. The amino acid sequence does not show apparent repeated sequences that bind choline. Electrophoresis of pneumococcal lysates and culture supernatants of CP1200 in SDS-PAGE gels impregnated with C3 identify a lytic band at approximately 20 kDa (+ 5 kDa) in both supernatants and lysates, confirming that a protein of a size predicted by the SEC. FROM IDENT. NO: 2 has C3 degrading activity (see example 2). As provided in example 3, the gene coding for the C3 degrading protein of 20 kDa, at least two dozen pneumococcal isolates representing five serotypes (serotypes 1, 3, 4, 14 and 19F) are conserved. The full-length gene encoding a C3-degrading proteinase of this invention is inserted into the gene expression vector for expression in E. coli.

The recombinant C3-degrading proteinase is isolated as described in the examples. Those of ordinary skill in the art will recognize that, given a particular gene sequence such as that provided in SEQ. FROM IDENT. N0: 1, there are several expression vectors that can be used to express the gene. In addition, there are various methods known in the art which can be used to produce or isolate the insulating protein of this invention and those of ordinary skill in the art will also recognize that the C3 degrading assay of this invention will determine whether a particular expression system, In addition to those expression systems provided by the examples, it will work or not, without requiring undue experimentation. Various molecular and immunological techniques can be found in basic technical texts such as that of Sambrook et al. (Molecular Cloning, A Laboratory Manual, 1989 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) and Harlow et al. (Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988). The gene encoding the C3-degrading protein of the invention is identified using a plasmid library constituted with pneumococcal genomic DNA fragments of strain CP1200. Although there are several known methods for obtaining a plasmid library, in a preferred strategy, the plasmid library is constructed with different pneumococcal genomic DNA fragments with Sau3A (0.5-4.0 kb) from the pneumococcal strain CP1200 (obtained from DA Morrison, University of Illinois, Champagne-Urbana, Illinois and described in Havarstein LF, et al., Proc. Nati, Acad. Sci. (USA) 1995; 92: 11140-11144) and inserted into the BamHl site of the integrative shuttle vector pVA 891 (ermr, cmr; has origin of replication for E. coli). This library is transformed into E. coli strain DH5a MCR by electroporation. The plasmidic extractions of some transformants of randomly selected E. coli show that all of them contain recombinant plasmids. The plasmid library DNA can be extracted from E. coli transformants and can be used to transform the parental pneumococcal strain CP1200- using insertional mutagenesis by homologous recombination. The cells of the pneumococcal CP1200 strain can be rendered competent by using a pH shift with the HCl method in CTM medium. The competent cells are frozen at -70 ° C in small aliquots, until it is needed. The isolated protein of this invention can be incubated with human complement C3 for 4 hours at 37 ° C in the presence of PBS to detect degradation of C3. Control samples without the isolated pneumococcal protein are used as controls for comparative purposes.

The protein of this invention has an apparent molecular weight in a 10% SDS-polyacrylamide gel of about 20 kDa (+5 kDa) and preferably has a molecular weight of about 15 kDa to about 25 kDa. An exemplary protein sequence is provided in SEQ. FROM IDENT. NO: 2. Those of ordinary skill in the art will recognize that some variability in the amino acid sequence is expected and that this variability is not eliminated from the scope of this invention. For example, conserved mutations are not deleted from this invention as well as variations in amino acid sequence identity of less than about 80% amino acid sequence identity and preferably less than about 90% amino acid sequence identity when the protein is capable of degrading the C3 protein of human complement, and particularly when the protein is isolated or originally obtained from an S bacterium. pneumoniae Fragments of the protein are also within the scope of the present invention, particularly if they are capable of degrading the human complement C3 protein. Some variability in the nucleic acid sequence between the pneumococcal strains and serotypes is expected as well as some variability in the amino acids. Substitutions of conserved amino acids are known in the art and include, for example, amino acid substitutions using other members of the same class to which the amino acids belong. For example, non-polar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine and tryptophan. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged amino acids (acids) include aspartic acid and glutamic acid. Such alterations are not expected to affect the apparent molecular weight as determined by polyacrylamide gel electrophoresis or by isoelectric point. Particularly preferred conservative substitutions include, but are not limited to, Lys by Arg or vice versa, to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Be by Thr so that a free OH is maintained; and Gln by Asn, to maintain a free NH2. A preferred protein of this invention includes a protein with the amino acid sequence of SEQ. FROM IDENT. NO: 2. Other proteins include those that degrade the C3 protein of human complement and that have a nucleic acid sequence that codes for the protein, and that hybridizes with the SEC. FROM IDENT. NO: l under highly stringent hybridization conditions such as 6XSSC, 5X Denhardt, 0.5% SDS (sodium dodecyl sulfate) and 100 μg / ml denatured and fragmented salmon sperm DNA, hybridized overnight at 65 ° C and washed in 2XSSC SDS 0.1% once at room temperature for approximately 10 minutes, followed by once at 65 ° C for approximately 15 minutes, followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes and also contemplated in this invention. Typically, an SSC solution contains sodium chloride, sodium citrate and water to prepare a concentrated solution. Protein peptides or polypeptides can also be used. A preferred protein of this invention comprises amino acids from about 1 to about 50 of SEQ. FROM IDENT. NO: 2. The proteins of this invention can be isolated or can be prepared as recombinant proteins. That is, the nucleic acid encoding the protein, or a portion of the protein, can be incorporated into an expression vector or can be incorporated into a chromosome of a cell to express the protein in the cell. The protein can be purified from a bacterium or another cell, preferably a eukaryotic cell and more preferably an animal cell. Alternatively, the protein can be isolated from a cell expressing the protein, such as a S. pneumoniae cell. Peptides or polypeptides are also considered in this invention. The peptides or polypeptides are preferably of a length of at least 15 amino acids and the preferred peptides or polypeptides have at least 15 sequential amino acids of SEQ. FROM IDENT. NO: 2. The nucleic acid encoding the 20 kDa protein is also part of this invention. The SEC. FROM IDENT. NO: l is a preferred nucleic acid fragment encoding the C3 degrading proteinase. Those of ordinary skill in the art will recognize that some substitution does not alter the sequence of C3-degrading proteinase to the extent that the character or nature of the C3-degrading protein is substantially altered. For example, a nucleic acid with an identity of at least 80% with SEC. FROM IDENT. NO: 1 is contemplated in this invention. A method for determining whether a particular nucleic acid sequence is within the scope of this invention is to consider whether or not the particular nucleic acid sequence encodes a C3-degrading proteinase and has a nucleic acid identity of at least 80% compared to the SEC. FROM IDENT. NO: l. Other nucleic acid sequences encoding the C3 proteinase include nucleic acid encoding proteinase C3 wherein the C3 proteinase has the same sequence or at least 90% sequence identity with SEC. FROM IDENT. NO: 2, but which includes degeneration with respect to the nucleic acid sequence. A degenerate codon means that a different three-letter codon is used to specify the same amino acid. For example, it is well known in the art that those which can be used in the following RNA codons (and therefore the corresponding DNA codons with a T substituting a U) interchangeably to encode each specific amino acid: Phenylalanine (Phe or F) UUU, UUC, UUA or UUG Leucine (Leu or L) CUU, CUC, CUA or CUG Isoleucine (lie or I) AUU, AUC or AUA Methionine (Met or M) AUG Valine (Val or V) GUU, GUC, GUA or GUG Serine (Ser or S) AGU or AGC Proline (Pro or P) CCU, CCC, CCA, CCG Threonine (Thr or T) ACU, ACC, ACÁ, ACG Alanine (Wing or A) GCU, GCG, GCA, GCC Tryptophan (Trp) UGG Tyrosine (Tyr or T) UAU or UAC Histidine (His or H) CAU or CAC Glutamine (Gln or Q) CAA or CAG Asparagine (Asn or N) AAU or AAC Lysine (Lys or K) AAA or AAG Aspartic Acid (Asp or D) GAU or GAC Glutamic Acid (Glu or E) GAA or GAG Cysteine (Cys or C) UGU or UGC Arginine (ARG OR) AGA or AGG Glycine (Gly or G) GGU or GGC or GGA or GGG Termination coil UAA, UAG or UGA In addition, a particular DNA sequence can be modified to use preferred codons for a particular cell type. For example, the use of preferred codons for E. coli is known, as well as the preferred codons for animals including humans. These changes are known to those ordinarily skilled in the art and therefore these gene sequences are considered part of this invention. Other nucleic acid sequences include a nucleic acid fragment of at least 15, and preferably at least 30 nucleic acids in length of SEQ. FROM IDENT. NO: l or other nucleic acid fragments of at least 15, and preferably at least 30 nucleic acids in length when these fragments hybridize with SEC. FROM IDENT. NO: 1 under highly stringent hybridization conditions such as 6XSSC, 5X Denhardt, 0.5% SDS and 100 μg / ml denatured and fragmented salmon sperm DNA, hybridized overnight at 65 ° C and washed in 2XSSC 0.1% SDS time at room temperature for approximately 10 minutes, followed once at 65 ° C for approximately 15 minutes, followed by at least one wash in 0.2XSSC, 0.1% SDS at room temperature for at least 3-5 minutes.

The nucleic acid fragments of this invention can encode the whole, none (ie fragments that can not be transcribed, fragments including regulatory portions of the gene or the like) or a portion of SEQ. FROM IDENT. NO: 2 or SEC. FROM IDENT. NO: 5 and preferably contain a contiguous nucleic acid fragment encoding at least nine amino acids of SEQ. FROM IDENT. NO: 2 or SEC. FROM IDENT. NO: 5. Because the nucleic acid fragments which code for a portion of the C3 proteinase are contemplated in this invention, it will be understood that not all nucleic acid fragments will code for a protein or peptide or polypeptide with a degrading activity of C3. In addition, the nucleic acid of this invention can be mutated to remove or inactivate in some other way the C3 degrading activity of this protein. Therefore, fragments without C3-degrading activity that satisfy the hybridization requirements described above are also contemplated. Methods for mutating or otherwise altering the nucleic acid sequences have been well described in the art and the preparation of an immunogenic but enzymatically inactive protein can be tested for therapeutic use. The nucleic acid fragments of this invention can be incorporated into nucleic acid vectors or stably incorporated into host genomes to produce a recombinant protein that includes the recombinant chimeric protein. In one embodiment, the C3 degrading protein is encoded by a gene in a vector and the vector is in a cell. Preferably, the cell is a prokaryotic cell such as a bacterium. Genes and gene fragments may exist as the fusion of all or a portion of the gene with another gene, and the C3-degrading protein may exist as a fusion protein of one or more proteins when the fusion protein is expressed as a protein alone. Various nucleic acid vectors of this invention are known in the art and include numerous commercially available expression vectors or viral vectors. The use of these vectors is within the scope of what is usual skill in the art. Exemplary vectors are used in the examples, but are not considered as limiting the scope of this invention. This invention also relates to antibodies capable of binding "typically to bind specifically" to a protein of about 20 kDa, and preferably to a protein of about 15 kDa to about 25 kDa, of S. pneumoniae and preferably where the protein capable of degrading human complement C3. The polyclonal antibody can be prepared to a portion of the protein or to the entire protein. Similarly, monoclonal antibodies can be prepared for all or for a peptide or polypeptide (fragment) of about 20 kDa of a C3-degrading protein of this invention. Methods for preparing antibodies for the protein are well known and well described, for example by Harlow et al., (Antibodies.; A Laboatory Manual, Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988). In a preferred example, the antibodies can be derived from human, derived from rat, derived from mouse, derived from goat, derived from chicken or derived from rabbit. Antibody fragments that bind proteins and chimeric fragments are also known and are within the scope of this invention. The invention also relates to the use of immuno-antimust compositions. The term "immunostimulant" or "immune system stimulants" in the compositions refers to peptide, or polypeptide, protein compositions according to the invention that activate at least one cell type of the immune system in a subject such as a mammal, preferably , the immunostimulatory composition provides an immunizing response or a prophylactic benefit in a normal, i.e., non-infected subject, typically a vaccine. However, any measurable immune response is beneficial to the subject in an application or therapy protocol. Preferably, the activated cells of the immune system include phagocytic cells such as neutrophils or macrophages, T cells, B cells, epithelial cells and endothelial cells. The immunostimulatory compositions comprise the peptides, polypeptides or proteins of the invention and can be used to produce antibodies in an animal such as a rat, mouse, goat, chicken, rabbit or a human or animal model to study an S. infection. pneumoniae Preferred immunostimulant compositions include an immunostimulant amount, for example a therapeutically effective amount of at least one peptide or polypeptide that includes at least 15 amino acids of the C3 degrading proteinase. The term "vaccine" refers to a composition for immunization. This process can include the administration of a protein, peptide, polypeptide, antigen, nucleic acid sequence or complementary sequence, for example antisense or antibody, or suspensions thereof, wherein upon administration, the molecule will produce active immunity and will provide protection against infection or colonization by S. pneumoniae Typically, such vaccines are prepared as an injectable material, either liquid solutions or suspensions. Solid forms suitable for solution, or suspension, liquids prior to injection can also be prepared. The vaccine preparation can optionally be emulsified or encapsulated in liposomes. The immunostimulatory composition (such as a vaccine) may additionally include other proteins in a pharmaceutically acceptable buffer or carrier such as PBS (phosphate buffered saline) or other buffers recognized in the art as suitable and innocuous for introduction of proteins into a host for stimulate the immune system. The immunostimulatory compositions may also include other immune stimulating proteins such as adjuvants or immunostimulatory proteins, peptides or polypeptides of S. pneumoniae or other organisms. For example, a combination of peptides and polypeptides may be more useful for controlling an infection by S. pneumoniae. Preferably, one or more fragments of the proteins of this invention are used in a vaccine preparation to protect against, or limit S colonization. pneumoniae or the pathogenic consequences of a colonization by S. pneumoniae. By a "therapeutically effective amount," as used herein, it refers to that amount which is effective for the production of a desired result. This amount varies based on the health and physical condition of the subject's immune system, that is, the ability to synthesize antibodies, the degree of protection desired, the formulation prepared and other relevant factors. It is expected that the amount will fall within a relatively broad range that can be determined by systematic or routine testing.

The active immunostimulant ingredients are often mixed with excipients or diluents that are pharmaceutically acceptable as carriers, and compatible with the active ingredient. The term "pharmaceutically acceptable carrier" refers to a carrier or carriers that are "acceptable" in the sense of being compatible with the other ingredients of a composition and not harmful to the recipient thereof. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof. In addition, if desired, the immunostimulatory composition (which includes the vaccine) may contain minor amounts of auxiliary substances such as wetting agents or emulsifiers, pH buffering agents and / or adjuvants which improve the effectiveness of the immunostimulatory composition. Examples of adjuvants or carriers that may be effective include, but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, designated as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2 - (1 ', -2 '-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) -ethylamine (CGP 19835A, designated as MTP-PE) and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall main structure (MPL + TDM + CWS) in a 2% squalene / Tween 80 emulsion. This invention also relates to a method for inhibiting the degradation of C3 mediated by Streptococcus pneumoniae, which comprises contacting a Streptococcus pneumoniae bacterium with a protein , such as an antibody or other protein that is capable of binding to an isolated protein of about 15 kDa to about 25 kDa of Streptococcus pneumoniae. The protein capable of binding to an isolated protein of about 15 kDa to about 25 kDa may be an antibody or a fragment thereof or the protein may be a chimeric protein that includes the antibody binding domain, such as a variable domain, from antibody that is capable of specifically recognizing an isolated protein of about 15 kDa to about 25 kDa of Streptococcus pneumoniae having C3 degrading activity. The isolated protein of S. pneumoniae of this invention can be isolated, and optionally purified, and the isolated protein or immunogenic fragments thereof can be used to produce an immune response including, in one example, an antibody response in a human or in an experimental animal. Peptide or polypeptide fragments of the protein without C3 degrading capacity can be tested for their ability to limit the effects of S. pneumoniae infection. Similarly, the protein of this invention can be modified, for example by mutation to interrupt or inactivate the C3 degrading activity of the protein. Antibodies capable of inhibiting the C3-degrading activity of the protein of this invention can be used as a strategy to prevent the degradation of C3 and to promote the clearance of S. pneumoniae through the opsonic pathway. The isolated protein can be used in assays to detect antibodies to S. pneumoniae as part of a multivalent or multiple vaccine or protein, a peptide or a polypeptide containing vaccine for therapy against S. pneumoniae. Therefore, the term "treatment" as used herein, refers to prophylaxis and / or therapy of normal mammalian subjects or mammalian subjects colonized with, diagnosed with or exhibiting features or symptoms of various S. pneumoniae infections. The term "therapy" refers to providing a therapeutic effect to a mammalian subject so that the subject exhibits few or no symptoms of a pneumococcal infection or other related disease. Such treatment can be carried out by the administration of nucleic acid molecules (direct or antisense), proteins, peptides or polypeptides or antibodies of the present invention.

It is further contemplated that the proteins of this invention can be expressed on the surface in vertebrate cells and can be used to degrade C3, for example, when the deposition of complement (or activation) becomes a problem, for example in xenotransplantation or in complement-mediated glomerulonephritis. For example, the entire pneumococcal protein, or a recombinant protein, or a portion of both, can be incorporated into xenotransplant cells and can be expressed as a surface protein or as a secreted protein to prevent or minimize complement deposition. (and / or complement-mediated inflammation). Another specific aspect of the present invention relates to the use of a vaccine vector that expresses an isolated protein and peptides or polypeptides thereof. Accordingly, in a further aspect, this invention provides a method for inducing an immune response in a mammal, which comprises providing a mammal with a vaccine vector that expresses at least one, or a mixture of a protein and / or peptide. or polypeptide of the invention isolated. The protein and peptides or polypeptides of the present invention can be administered to the mammal using an inactivated or live vaccine vector, in particular using a living recombinant bacterium, a virus or other living agents, which contain the genetic material necessary for the expression of the protein and / or peptides or polypeptides as a foreign polypeptide. Particularly, bacteria colonizing the gastrointestinal tract such as Salmonella, Shigella, Yersinia, Vibrio, Escherichia and BCG have been developed as vaccine vectors and these and other examples are discussed by J. Holmgren et al., Immunobiol. , 184, 157-179 (1992) and J. McGhee et al., Vaccine, ip_, 75-88 (1992). A further embodiment of the present invention relates to a method for inducing an immune response in a subject, for example a mammal, comprising administering to a subject an amount of a DNA molecule that codes for a protein and / or peptide or polypeptide isolated therefrom, of this invention, optionally with an agent that facilitates transfection, wherein the protein and / or peptides or polypeptides retain immunogenicity- and, when incorporated into an immunostimulatory composition, e.g. a vaccine, and administered to a human, provide protection without inducing increased disease upon subsequent infection of the human with the pathogen S. pneumoniae. Agents that facilitate transfection are known in the art. It is further contemplated that the antisense sequence of the gene encoding the 20 kDa protein can be used as a vaccine or a therapeutic treatment for pneumococcal infection. Antisense DNA is defined as a non-coding sequence that is complementary, i.e., a chain complementary to all or a portion of the SEC. FROM IDENT. N0: 1 For example, the antisense sequence pra 5'-ATGTCAAGC-3 'is 3' -TACAGTTCG-5 '. The delivery of an antisense or oligonucleotide sequence in an animal can result in the production of an antibody by the animal or in the incorporation of the sequence in a living bacterium or other cells whereby transcription and / or translation of the antibody is inhibited. whole of a portion of the product of the 20 kDa gene. The introduction of an antisense nucleic acid sequence can be carried out, for example, by loading the antisense nucleic acid into a suitable carrier, such as a liposome, for introduction into pneumococci or infected cells. Typically, an antisense nucleic acid sequence having eight or more nucleotides is capable of binding to a bacterial nucleic acid or a bacterial messenger RNA. The antisense nucleic acid sequence typically contains at least about 15 nucleotides, preferably at least about 30 nucleotides or more nucleotides, to provide the necessary stability of a bacterial nucleic acid or bacterial messenger RNA hybridization product. The introduction of the sequences preferably inhibits the transcription or translation of at least one endogenous nucleic acid sequence of S. pneumoniae. Methods for loading antisense nucleic acid are known in the art as exemplified by U.S. Patent 4,242., 046. The present invention also provides nucleic acid having an open reading frame of 2163 bases (SEQ ID NO: 4) spanning the open reading frame of a nucleic acid sequence (SEQ ID NO: 1) which codes for a protein having a molecular weight of about 20 kDa (SEQ ID NO: 2). The 20 kDa protein described herein is further characterized as a C3 degrading protein. A larger open reading frame eg 2163 bp (SEQ ID NO: 4) encodes a putative protein of approximately 79 kDa SEC. FROM IDENT. NO: 5). All references and publications mentioned herein are expressly incorporated by reference in this description. There are a variety of alternative techniques and procedures available to those skilled in the art which similarly allow a person to successfully perform the proposed invention in view of the present disclosure. It will be appreciated by those skilled in the art that although the above invention has been described in relation to particular embodiments and examples, the invention is not necessarily chosen in this way and that numerous additional embodiments, examples, uses, modifications and deviations from the modalities, examples and uses, without departing from the inventive scope of this application.

EXAMPLE 1 IDENTIFICATION OF INSERTIONAL MUTANTS WITH ACTIVITY REDUCED DEGRADING OF C3 Insertional mutants are received from Dr. Elaine Toumanen (Rockefeller Inst., New York, New York). Clones with inserts are tested in an assay to detect reduced C3 degrading activity. 137 clones are tested by growing them in cells in Todd Hewitt broth overnight at room temperature in microtiter plates. The 1:10 cells are diluted in synthetic medium for pneumococci (see Sicard A.M., Genetics 50: 31-44, 1984) and the rest of the cells are frozen in the microtiter plate. We added either 63 ng or 83 ng of C3 per 100 μl of medium containing 1 mg / ml medium 0.1% BSA in phosphate buffered saline (PBS) at approximately 200 μm of diluted cells. The cells are incubated at 37 ° C for 4 h. Add 100 μl of the mixture to ELISA plates and incubate overnight at 4 ° C. The plates are washed three times with wash buffer and the wells are filled with 0.05% Tween 20 in PBS with incubations of 5 minutes between washes. 100 μl of antibody for C3 (goat antibody, conjugated with horseradish peroxidase, monoclonal, specific for the human C3 fraction - IgG, ICN Cappel, Costa Rica, CA) 1: 1200 with 3% BSA in PBS is diluted. The ELISA plate is incubated at 37 ° C for about 30 minutes at 1 h in the dark and washed with wash buffer as above. The assay is revealed using 12 mg of OPD in 30 ml of 0.1M sodium citrate buffer with 12 μl of 30% hydrogen peroxide. The results of the assay are determined by reading optical density at 490 nm on an ELISA plate reader. Each clone is tested four times. We select 19 clones that have less than 40% degradation of C3 compared to non-mutated controls. These 19 clones are analyzed 6 times by the assay described above and from these results, 6 clones with less than 30% of C3 degrading activity are selected, in comparison with the controls. These 6 clones are analyzed 11 times each and two clones with the lowest C3 degrading activity are selected for further study. A partial sequence of one of the clones is received and a Smal fragment of 546 bp is labeled with 3P by random primer labeling (equipment available from Stratagene, La Jolla, CA). The 546 bp Smal fragment of SEC. FROM IDENT. DO NOT . : 1 hybridizes to the EcoRl and Kpnl digests of numerous pneumococcal strains in Southern blot tests. This same fragment is also used to analyze a library of Sau3A fragments in genomic DNA of S. pneumoniae strain CP1200.

A 3.5 kb insert is identified from the CP1200 library. The insert is sequenced and an open reading frame of 492 base pairs is identified, which includes the stop codon. The reading frame encodes a protein of 163 amino acids and a predicted molecular weight of approximately 18500 Dalton units. PCR primers are constructed to amplify the open reading frame; the 5 'PCR primer incorporates a site BamHl; the 3 'primer incorporates a PstI site. The amplified insert is ligated in frame to an His-tagged E. coli expression vector, pQE30 (Qiagen, San Diego, CA). The resulting plasmid is used to transform E. coli strain BL21 (Novagen, Madison, Wl) containing Lac repressor pREP4 (Qiagen). E.coli cultures are induced to express the His-tagged protein and the protein is purified on a column with Ni-NTA resin (Qiagen). The purified protein is confirmed by gel on SDS-PAGE.

EXAMPLE 2 IDENTIFICATION OF A PROTEINASE OF 20 KDA. DEGRADING OF C3 To determine the C3 degrading capacity of a 20 kDa protein, 0.5 mg / ml C3 (prepared according to Tack et al., Meth. Enzymol.80: 64-101, 1984) is copolymerized in a dodecylsulfate gel of sodium (SDS) containing 15% acrylamide (15% SDS-PAGE gel). Pneumococcal supernatants are obtained from cultures of S. pneumoniae strain CP1200 that grow exponentially in Todd Hewitt broth; pneumococcal lysates are obtained by incubating 5 x 108 cells with 5% SDS for 30 minutes at room temperature. The lysate is concentrated 10 times using a Centricon filtration device with a molecular weight limit of 10,000 (Amicon, Beverly, MA). The samples are not heated before electrophoresis. Samples of supernatants and lysates are added to the SDS-PAGE gels containing 15% C3 and electrophoresis is carried out at 4 ° C, at 150 v until the front of the dye runs completely. The gel is washed successively with 50 ml Triton X-100 2.5% in water (twice, 10 minutes), Triton X-100 2.5% in 50 mM Tris-HCl, pH 7.4 (twice, 10 minutes) and 50 mM Tris-HCl, pH 7.4 (twice, minutes) to remove SDS. After the washings, 50 ml of 50 mM Tris-HCl, pH 7.4 are poured into containers containing the gels, and the containers are covered and incubated at 37 ° C for 1.5 hours and overnight (approximately 16 hours). The gels are stained with cumasi blue for more than 10 minutes and completely fade. Two lytic bands are visualized, one of which is approximately 20 kDa in size, against the dark blue background of both the lysates and the supernatant. The activities of proteinase C3 in pneumococcal lysates are observed after 1.5 hours of incubation at 37 ° C, while the activities of proteinase C3 in the supernatant Pn is observed after an overnight incubation. Therefore, the activities of C3 proteinases seem to be associated mainly with cells.

EXAMPLE 3 THE GENERALLY THAT CODIFIES FOR THE PROTEIN OF 20 KDA IS CONSERVED IN MANY STEMS OF S. PNEUMONIAE DNA is obtained from a variety of strains of S. pneumoniae (clinical isolates of type 1, type 3, LL02, L003 (type 3), type 4, type 14 and laboratory isolates CP1200, WU2, R6X, 6303, 109, 110, JY1119, JY182 and JY53) and SEC is used. FROM IDENT. DO NOT . : 3 as a probe to detect the presence of nucleic acid encoding the 20 kDa protein in DNA of these strains. Isolated chromosomal DNA is digested with EcoRi and separated by electrophoresis. The DNA is transferred to a solid support and hybridized to the SEC. FROM IDENT. DO NOT. : 3 labeled at the end under the hybridization and washing conditions of 6X SSC, 5X Denhart, 5% SDS, 100 μg / ml of fragmented and denatured salmon sperm DNA, hybridized at 65 ° C overnight and lava in 2X SSC, once at room temperature for 10 minutes and in 2X SSC, 0.1% SDS, once at 65 ° C for 15 minutes, followed by two washes in 0.2X SSC, 0.1% SDS for 3 minutes each room temperature. The results indicate that SEC. FROM IDENT. DO NOT. : 3 hybridizes identically in each of the DNA samples tested, indicating that the protein appears to be conserved between the strains. In some strains, the DNA encoding the C3 degrading protein of 20 kDa appears to be part of a larger open reading frame of 2163 bp that is presumed to code for a 79 kDa protein.

EXAMPLE 4 SOUTHERN BLOT TEST OF THE DNA PROBE / 5F1 OF S. PNEUMONIAE Samples of 5 μg of genomic DNA from 11 strains of S. pneumoniae are obtained. Each sample is digested with the restriction enzyme Kpnl. The samples are subsequently loaded onto an agarose gel and separated by electrophoresis. The samples contained in the gel are subsequently transferred to a Hybond-N + membrane available from Amersham (Upsalla, Sweden) by capillary transfer. A 540 bp Smal fragment from a 5F1 isolate is randomly labeled with 32P using T7 QuickPrime kit (Pharmacia, Piscathaway, NJ) and purified from unincorporated nucleotides using the NucTrap column (Stratagene, La Jolla, CA ) and hybridize. Hybridization conditions are 6XSSC, 5X Denhardt, SDS 0.5% and 100 μg / ml denatured and fragmented salmon sperm DNA, hybridized overnight at 65 ° C and washed in 2XSSC, 0.1% SDS, once at room temperature for approximately 10 minutes, followed by a time at 65 ° C for approximately 15 minutes, followed by at least one wash in 0.2XSSC, SDS ol% at room temperature for at least 3-5 minutes.The blot shows that the generally 20 kDa is present in all tested strains of S. pneumoniae.

EXAMPLE 5 Two DNA primers are prepared from SEC. FROM IDENT. NO .: 1, and are used to amplify the generally 20 kDa sequence of the genomic DNA of S. pneumoniae (serotype 3). The first primer, a 5 'primer, SEQ. FROM IDENT.

NO .: 6, encompasses the ATG start codon of the generally 20 kDa, inserts a Ncol site and has a Wing residue inserted after the ATG start codon to maintain the correct reading frame. The second primer, a 3 'primer, SEQ. FROM IDENT. DO NOT. : 7, covers the termination codon of the generally 20 kDa and inserts a BamHl site.

'-GGGGG CCA TGG CC TCA AGC CTT TTA CGT GAA TTC-3'; (SEQ ID NO: 6) '-GGGGG GGA TCC CTA GCT ATA TGA GAT AAA CTT TCC TGC T-3'; (SEQ ID NO: 7) The two primers are synthesized on an Applied Biosystems 380A DNA DNA synthesizer (Foster City, CA), using reagents purchased from Glen Research (Sterling, VA). The amplifications are performed using a Perkin Elmer Thermocycler (ABl) device in accordance with the manufacturer's instructions. The identified PCR product is ligated into a PCR cloning vector PCR2.1 with a TA tail, available from Invitrogen, Carlsbad, CA, and used to transform OneShot ToplOF 'complement cells (Invitrogen). Transformants resistant to kanamycin are analyzed by restriction enzyme analysis of the plasmid DNA prepared by alkaline lysis. An insert fragment of approximately 500 bp is identified and subsequently cut with restriction enzyme Ncol and BamHl. The 500 bp fragment is purified from a low melting point agarose gel and subsequently ligated into the Ncol-BamHl sites of the p728a expression vector promoted with T7, available from Novagen (Madison, Wl). The ligation mixture is then transformed into ToplOF 'cells (Invitrogen) and the kanamycin-resistant transformants are analyzed by restriction enzyme analysis of the plasmid DNA prepared by alkaline lysis. Subsequently, a recombinant plasmid (pLP505) is transformed in BL21 cells (Novagen) and grown in SOB medium supplemented with 30 μg / ml kanamycin. The cells are grown to an OD 600 of 0.6 and subsequently induced with 0.4 mM IPTG (Boehringer Mannheim, Indianapolis, Indiana) for 2-4 hours. Whole cell lysates are prepared and electrophoresed on a 14% SDS-PAGE gel. The gel is stained with cumasi and the expression product is detected. The gel dyed with cumasi shows a band between the molecular weight markers of 28 kDa and 18 kDa, and it is determined to be about 20 kDa. The DNA sequence is obtained from the insert in the recombinant pLP505 plasmid using the ABI370A DNA sequencer. The DNA sequence is aligned with the DNA sequence of the SEC. FROM IDENT. DO NOT. : 1, using the matrix graph feature Pustell DNA from Mac Vector (Oxf rd Molecular Group, Campbell, CA). The alignment of the DNA sequence obtained from the plasmid pLP505, SEQ. FROM IDENT. DO NOT. : 1, and the genome of S. pneumoniae (serotype 4), shows that the open reading frame (ORF) that codes for the 20 kDa protein can be part of a larger ORF, that is, 2163 bp in the serotype 4 genome, which codes for a protein with a predicted MW of approximately 79 kDa (SEQ ID NO: 4). The DNA of the SEC. FROM IDENT. NO .: 4 codes for the predicted amino acid sequence and is shown as the SEC. FROM IDENT. DO NOT . : 5. The S. pneumoniae genome sequence (serotype 4) is obtained from The Institute for Genomic Research at www.tigr.org and / or through NCBI at www.ncbi.nlm.nih.gov, using the Clustal W feature of Mac Vector (Oxford Molecular Group, Campbell, CA). A sequence comparison is made between the 20 kDa amino acid sequence (SEQ ID NO: 2) and the predicted 79 kDa amino acid sequence (SEQ ID NO: 5). It is noted that amino acids 1-58 and amino acids 90-132 of SEC. FROM IDENT. DO NOT. : 2 have substantially sequence identity with amino acids 170-227 and amino acids 258-300 of SEQ. FROM IDENT. DO NOT. : 5, respectively. The proteins and peptides or polypeptides that these particular sections contain are the preferred embodiments of the invention. Based on the available genomic DNA sequence (serotype 4), two ORF bleaching primers of 21 to 63 bp are designed and subsequently synthesized using an ABI 380A DNA synthesizer (SEQ ID NO: 8 and 9) . The SEC. FROM IDENT. NO .: 8 is a 5 'primer of S. pneumoniae having an inserted Ncol site and a "Glu" residue added after the ATG start codon to maintain the correct reading frame. The SEC. FROM IDENT. NO .: 9 is a primer 31 of S. pneumoniae that has an inserted HindIII site.

'-AGA GCT CCT CCC ATG GAA GAT CCG AAT TAT CAG-3'; (SEQ ID NO: 8) '-CCG GGC AAG CTT TTA CTT ACT CTC CT-3'; (SEC.

IDENT. DO NOT. : 9) A DNA fragment of approximately 2100 bp is then amplified from 4 different serotypes of S. pneumoniae (serotypes 3, 5, 6B and 7) resulting in 4 fragments. Each of the 4 fragments subsequently linked to a PCR cloning vector PCR2.1 (Invitrogen), and used to transform OneShot Top 10F1 cells (Invitrogen). The kanamycin-resistant transformants are analyzed by restriction analysis of the plasmid DNA prepared by alkaline lysis. A recombinant plasmid containing the serotype 7 PCR product, for example pLP512, is identified. The DNA sequence of the serotype 7 clone is obtained using the ABL model 370A DNA sequencer. The DNA sequence is essentially identical to the SEC. FROM IDENT. DO NOT. : 4 and encodes a predicted amino acid sequence essentially identical to SEC. FROM IDENT. NO .: 5. It will be appreciated by those skilled in the art that although the above invention has been described in relation to particular embodiments and examples, the invention is not necessarily limited in this way and numerous modalities, examples, uses, modifications can be made and deviations from the modalities, examples and indicated uses, without departing from the inventive scope of this application.

LIST OF SUBSTITUTE SEQUENCES < 110 > HOSTETTER, Margaret K FINKEL, David J. CHENG, Qi GREEN, Bruce A. MASI, Amy W. REGENTS OF THE UNIVERSITY OF MINNESOTA < 120 > IDENTIFICATION OF INSERTIONAL MUTANTS WITH REDUCED ACTIVITY DEGRADING OF C3 < 130 > 11000570201 Human complement < 140 > Without assignment < 141 > 1998-09-24 < 150 > 60 / 059.907 < 151 > 1997-09-24 < 160 > 10 < 170 > Patentln Ver. 2.0 < 210 > 1 < 211 > 492 < 212 > DNA < 213 > Streptococcus pneumoniae < 400 > 1 atgtcaagcc ttttacgtga attgtatgct aaacccttat cagaacgcca tgtagaatct 60 gatggtctta ttttcgaccc agcgcaaatc acaagtcgaa ccgccaatgg tgttgctgta 120 ccgcacggag accattatca ctttattcct tattcacaac tgtcaccttt ggaagaaaaa 180 ttggtcgtat tattcccctt cgttatcgtt caaaccattg ggtaccagat tcaaagacca 240 gaacaaccag tccacaatcg actccgggaa cctagtccaa gtccgaaacc tgcaccaaat 300 cctcaaccag ctccaagcaa tccaattgat gagaaattgg tcaaagaagc tgttcgaaaa 360 gtaggcgatg gttatgtctt rgaggagaat ggagttgcct cgttatatcc caagccaagg 420 atcttacagc agaaacagca gcaggcattg atagcaaact ggccaagcag gaaagtttat 480 ctcataagct ag 492 < 210 > 2 < 211 > 163 < 212 > PRT < 213 > Streptococcus pneumoniae < 400 > Met Ser Ser Leu Leu Arg Glu Leu Tyr Ala Lys Pro Leu Ser Glu Arg 1 5 10 15 His Val Glu Being Asp Gly Leu lie Phe Asp Pro Wing Gln lie Thr Ser 20 25 30 Arg Thr Wing Asn Gly Val Wing Val Pro His Gly Asp His Tyr His Phe 35 40 45 lie Pro Tyr Ser Gln Leu Ser Pro Leu Glu Glu Lys Leu Val Val Leu 50 55 60 Phe Pro Phe Val lie Val Gln Thr lie Gly Tyr Gln lie Gln Arg Pro 65 70 75 80 Glu Gln Pro Val His Asn Arg Leu Arg Glu Pro Ser Pro Pro Pro Lys 85 90 95 Pro Ala Pro Asn Pro Gln Pro Pro Ala Pro Ser Asn Pro Lie Asp Glu Lys 100 105 110 Leu Val Lys Glu Ala Val Arg Lye Val Gly Asp Gly Tyr Val Phe Glu 115 120 125 Glu Asn Gly Val Wing Ser Leu Tyr Pro Lys Pro Arg lie Leu Gln Gln 130 135 140 Lys Gln Gln Gln Ala Leu He Wing Asn Trp Pro Ser Arg Lys Val Tyr 145 150 155 160 Leu He Ser < 210 > 3 < 211 > 492 < 212 > DNA < 213 > Streptococcus pneumonia e < 400 > 3 ctagcttatg agataaactt tcctgcttgg ccagtttgct atcaatgcct gctgctgttt 60 ctgctgtaag atccttggct tgggatataa cgaggcaact ccattctcct caaagacata 120 accatcgcct acttttcgaa cagcttcttt gaccaatttc tcatcaattg gattgcttgg 180 agctggttga ggatttggtg caggtttcgg acttggacta ggttcccgga gtcgattgtg 240 gactggttgt tctggtcttt gaatctggta tgaacgataa cccaatggtt cgaaggggaa 300 taatacgacc aatttttctt ccaaaggtga cagttgtgaa taaggaataa agtgataatg 360 gtctccgtgc ggtacagcaa caccattggc ggttcgactt gtgatttgcg ctgggtcgaa 420 aataagacca tcagattcta catggcgttc tgataagggt ttagcataca attcacgtaa 480 aaggcttgac at 492 < 210 > < 211 > 2163 < 212 > DNA < 213 > Streptococcus pneumoniae < 400 > 4 atgaaagatc cgaattatca gttgaaggat tcagacattg tcaatgaaat caagggtggt 60 tatgttatca aggtagatgg aaaatactat gtttacctta aggatgcagc tcatgcggat 120 caaaagaaga aatattcgga gattaaacgt cagaagcagg aacacagtca taatcacggg 180 ggtggttcta acgatcaagc agtagttgca gccagagccc aaggacgcta tacaacggat 240 gatggttata tcttcaatgc atctgatatc attgaggaca egggtgatgc ttatatcgtt 300 cctcacggcg accattacca ttacattcct aagaatgaqt tatcagctag cgagttagct 360 gctgcagaag cctattggaa tgggaagcag ggatctcgtc cttcttcaag ttctagttat 420 aatgcaaatc cagctcaacc gagaaccaca aagattgtca atctgactgt cactccaact 480 tatcatcaaa atcaagggga aaacatttca agccttttac gtgaattgta tgctaaaccc 540 ttatcagaac gccatgtgga atctgatggc cttattttcg acccagcgca aatcacaagt 600 cgaaccgcca gaggtgtagc tgtccctcat ggtaaccatt accactttat cccttatgaa 660 caaatgtctg aattggaaaa acgaattgct cgtattattc cccttcgtta tcgttcaaac 720 cattgggtac cagattcaag accagaacaa ccaagtccac aatcgactcc ggaacctagt 780 ccaagtccgc aacctgcacc aaatcctcaa ccagctccaa gcaatccaat tgatgagaaa 840 ttggtcaaag aagctgttc g aaaagtaggc gatggttatg tctttgagga gaatggagtt 900 tcccagccaa tctcgttata gr.atctttca gcagaaacag 960 cagcaggcat tgatagcaaa ctggccaagc aggaaagttt atctcataag ctaggagcta agaaaactga cctcccatct 1020 agtgatcgag aattttacaa taaggcttat gacttactag ccaagattta caagaattca 1080 aaggtcgaca cttgataata agttgatttt gaggctttgg ataacctgtt ggaacgactc 1140 caagtgataa aaggatgtcc agtcaagtta gtggatgata ttcttgcctt cttagctccg 1200 attcgtcatc cagaacgttt aggaaaacca aatgcgcaaa ttacctacac tgatgatgag 1260 attcaagtag ccaagttggc aggcaagtac acaacagaag acggttatat ctttgatcct 1320 ccagtgatga cgtgatataa gggggatgcc tatgtaactc cacatatgac ccatagccac 1380 tggattaaaa aagatagttt gtctgaagct gagagagcgg cagcccaggc ttatgctaaa 1440 gagaaaggtt tgacccctac ttcgacagac catcaggatt caggaaatac tgaggcaaaa 1500 ctatctacaa ggagcagaag gcagctaaga ccgcgt'gaaa aggtgccact tgatcgtatg 1560 ccttacaatc ttcaatatac tgtagaagtc aaaaacggta gtttaatcat acctcattat 1620 gaccattacc ataacatcaa atttgagtgg tttgacgaag gcctttatga ggcacctaag 1680 gggtatactc ttgaggatct tttg gcgact gtcaagtact atgtcgaaca tccaaacgaa 1740 cgtccgcatt cagataatgg ttttggtaac gctagcgacc atgttcaaag aaacaaaaat 1800 ggtcaagctg ataccaatca aacggaaaaa ccaagcgagg agaaacctca gacagaaaaa 1B60 cctgaggaag aaacccctcg agaagagaaa ccgcaaagcg agaaaccaga gtctccaaaa 1920 ccaacagagg aaccagaaga atcaccagag gaatcagaag aacctcaggt cgagactgaa 1980 aaggttgaag aaaaactgag agaggctgaa gatttacttg gaaaaatcca ggatccaatt 2040 atcaagtcca atgccaaaga gactctcaca ggattaaaaa ataatttact atttggcacc 2100 caggacaaca atactattat ggcagaagct gaaaaactat tggctttatt aaaggagagt 2160 aag 2163 < 210 > 5 < 211 > 721 < 212 > PRT < 213 > S Streptococcus pneumoniae < 4 00 > Met Lys Asp Pro Asn Tyr Gln Leu Lys Asp As Asp He Val Asn Glu 1 5 10 15 He Lys Gly Gly Tyr Val He Lys Val Asp Gly Lye Tyr Tyr Val Tyr 20 25 30 Leu Lys Asp Wing Wing His Wing Asp Asn He Arg Thr Lys Glu Glu He 35 40 45 Lys Arg Gln Lys Gln Glu His Ser His Asn His Gly Gly Gly Ser Aen 50 55 60 Asp Gln Ala Val Val Ala Ala Arg Ala Gln Gly Arg Tyr Thr Thr Asp 65 70 75 80 Asp Gly Tyr He Phe Asn Wing Being Asp He He Glu Asp Thr Gly Asp 85 90 95 Ala Tyr He Val Pro His Gly Asp His Tyr His Tyr He Pro Lys Asn 100 105 110 Glu Leu Ser Ala Ser Glu Leu Ala Ala Ala Glu Ala Tyr Trp Asn Gly 115 120 125 Lys Gln Gly Being Arg Pro Being Being Being Tyr Asn Wing Asn Pro 130 135 140 Wing Gln Pro Arg Leu Ser Glu Asn His Asn Leu Thr Val Thr Pro Thr 145 150 155 160 Tyr His Gln Asn Gln Gly Glu Asn He Ser Ser Leu Leu Arg Glu Leu 165 * 170 175 Tyr Ala Lys Pro Leu Ser Glu Arg His Val Glu Ser Asp Gly Leu He 180 185 190 Phe Asp Pro Wing Gln He Thr Ser Arg Thr Wing Arg Gly Val Wing Val 195 200 205 Pro His Gly Asn His Tyr Hie Phe He Pro Tyr Glu Gln Met Ser Glu 210 215 220 Leu Glu Lys Arg He Wing Arg He He Pro Leu Arg Tyr Arg Ser Aen 225 230 235 240 Hie Trp Val Pro Asp Ser Arg Pro Glu Gln Pro Ser Pro Gln Ser Thr 245 250 255 Pro Glu Pro Ser Pro Pro Pro Pro Gln Pro Pro Asn Pro Gln Pro Wing 260 265 270 Pro Ser Asn Pro He Asp Glu Lys Leu Val Lys Glu Ala Val Arg Lys 275 280 285 Val Gly Asp Gly Tyr Val Phe Glu Glu Asn Gly Val Ser Arg Tyr He 290 295 300 Pro Ala Lys Asp Leu Ser Ala Glu Thr Ala Ala Gly He Asp Ser Lys 305 310 315 320 Leu Ala Lys Gln Glu Ser Leu Ser His Lys Leu Gly Ala Lys Lys Thr 325 330 335 Asp Leu Pro Being Ser Asp Arg Glu Phe Tyr Asn Lys Wing Tyr Asp Leu 340 345 350 Leu Ala Arg He His Gln Asp Leu Leu Asp Asn Lys Gly Arg Gln Val 355 360 365 Asp Phe Glu Ala ^ eu Asp Asn Leu Leu Glu Arg Leu Lys Asp Val Pro 370 375 380 Be Asp Lye Val Lys Leu Val Asp Asp He Leu Wing Phe Leu Wing Pro 385 390 395 400 He Arg His Pro Glu Arg Leu Gly Lye Pro Asn Wing Gln He Thr Tyr 405 410 415 Thr Asp Aep Glu He Gln Val Wing Lys Leu Wing Gly Lys Tyr Thr Thr 420 425 430 Glu Asp Gly Tyr He Phe Asp Pro Arg Asp He Thr Ser Asp Glu Gly 435 440 445 Asp Wing Tyr Val Thr Pro His Met Thr His Ser His Trp He Lys Lys 450 455 460 Asp Ser Leu Ser Glu Wing Glu Arg Wing Wing Wing Gln Wing Tyr Wing Lys 465 470 475 480 Glu Lys Gly Leu Thr Pro Pro Ser Thr Asp His Gln Asp Ser Gly Asn 485 490 495 Thr Glu Wing Lys Gly Wing Glu Wing He Tyr Asn Arg Val Lys Wing Wing 500 505 510 Lye Lys Val Pro Leu Asp Arg Met Pro Tyr Asn Leu Gln Tyr Thr Val 515 520 525 Glu Val Lys Asn Gly Ser Leu He He Pro His Tyr Asp His Tyr His 530 535 540 Asn He Lys Phe Glu Trp Phe Asp Glu Gly Leu Tyr Glu Wing Pro Lys 545 550 555 560 Gly Tyr Thr Leu Glu Asp Leu Leu Wing Thr Val Lys Tyr Tyr Val Glu 565 570 575 Has Pro Asn Glu Arg Pro His Ser Asp Asn Gly Phe Gly Asn Wing Ser 580 '585 590 Asp Hie Val Gln Arg Asn Lys Asn Gly Gln Wing Asp Thr Asn Gln Thr 595 600 605 Glu Lys Pro Ser Glu Glu Lys Pro Gln Thr Glu Lys Pro Glu Glu Glu 610 615 620 Thr Pro Arg Glu Glu Lys Pro Gln Ser Glu Lys Pro Glu Ser Pro Lys 625 630 635 640 Pro Thr Glu Glu Pro Glu Glu Pro Pro Glu Glu Glu Glu Pro Gln 645 650 655 Val Glu Thr Glu Lys val Glu Glu Lys Leu Arg Glu Ala Glu Asp Leu 660 665 670 Leu Gly Lys He Gln Asp Pro He He Lys Ser Asn Wing Lys Glu Thr 675 £ 80 685 Leu Thr Gly Leu Lys Asn Asn Leu Leu Phe Gly Thr Gln Asp Asn Asn 690 695 700 Thr He Met Ala Glu Ala Glu Lys Leu Leu Ala Leu Leu Lys Glu Ser 705 710 715 720 < 210 > < 2 11 > 34 < 212 > DNA < 213 > Sequence art i f i cia l < 220 > < 223 > Description of the artificial sequence: primer < 220 > < 223 > It incorporates a Ncol site and a DNA codon for Ala < 400 > 6 gggggccatg gcctcaagcc ttttacgtga attg 34 < 210 > 7 < 211 > 39 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: primer < 220 > < 223 > It incorporates a BamHl site. < 400 > 7 gggggggatc cctagctata tgagataaac tttcctgct 39 < 210 > 8 < 211 > 33 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: primer < 220 > < 223 > It incorporates a Ncol site and a DNA codon for Glu, < 400 > 8 agagctcctc ccatggaaga tccgaattat cag 33 < 210 > 9 < 211 > 26 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: primer < 220 > < 223 > It incorporates a HinD III site. < 400 > 9 ccgggcaagc ttttacttac tctcct 26 < 210 > 10 < 211 > 40 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of the artificial sequence: probe < 220 > < 223 > Oligonucleotide < 400 > 10 gaaaacaata atgtagaaga ctactttaaa gaaggttaga 40 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is the conventional one for the manufacture of the objects or products to which it refers.

Claims

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An isolated protein having at least 80% sequence identity with SEC. FROM IDENT. DO NOT. : 2, which is capable of degrading human complement C3 protein.

2. The protein according to claim 1, characterized in that it is isolated from S. pneumoniae.

3. The protein according to claim 1, characterized in that it is a recombinant protein.

4. The protein according to claim 1, characterized in that it has a molecular weight of about 15 kDa to about 25 kDa.

5. An isolated peptide or polypeptide, characterized in that it comprises at least 15 sequential amino acids of the protein according to claim 1.

6. An isolated peptide or polypeptide, characterized in that it comprises at least 15 sequential amino acids of SEQ. FROM IDENT. NO .: 2.

7. An isolated protein, characterized in that it comprises SEC. FROM IDENT. NO .: 2.

8. The isolated protein, according to claim 7, characterized in that it has a molecular weight of about 15 kDa to about 25 kDa.

9. The protein according to claim 8, characterized in that it is isolated from S. pneumoniae.

10. The protein in accordance with the claim 8, characterized in that it degrades the human complement protein C3.

11. The protein according to claim 7, characterized in that it is SEC. FROM IDENT. NO .: 2.

12. An isolated protein, characterized in that it comprises amino acids from about 1 to about 58 of SEC. FROM IDENT. NO .: 2.

13. The isolated protein, according to claim 12, characterized in that it also comprises amino acids from about 90 to about 132 of SEQ. FROM IDENT. NO .: 2.

14. An isolated protein, characterized in that it comprises the amino acids from about 170 to about 227 of the SEC. FROM IDENT. NO .: 5

15. The isolated protein, according to claim 14, characterized in that it also comprises amino acids from about 258 to about 300 of SEQ. FROM IDENT. NO .: 5

16. An isolated protein, characterized in that it degrades human complement C3 protein, where the nucleic acid encoding the protein hybridizes to the SEC. FROM IDENT. DO NOT. : 1 or its complementary chain under conditions of high stringency hybridization.

17. An isolated protein, from approximately 15 kDa to approximately 25 kDa of S. pneumoniae, characterized in that it is capable of degrading C3 of human complement.

18. An immune system stimulating composition, characterized in that it comprises an effective amount of a peptide or polypeptide stimulating the immune system, comprises at least 15 sequential amino acids derived from a protein, wherein the protein has at least 80% sequence identity with SEC. FROM IDENT. DO NOT. : 2 and is able to degrade the C3 protein of human complement.

19. The stimulating composition of the immune system, according to claim 18, characterized in that the protein is isolated from S. pneumoniae.

20. The stimulating composition of the immune system, according to claim 19, characterized in that it further comprises at least one protein, peptide or polypeptide stimulating the immune system, isolated from S. pneumoniae.

21. A stimulating composition of the immune system, characterized in that it comprises a therapeutically effective amount of at least a portion of the protein, wherein the nucleic acid encoding the protein hybridizes with SEC. FROM IDENT. DO NOT . : 1 or its complementary chain under conditions of high stringency hybridization.

22. The immune system stimulating composition, characterized in that it comprises an effective amount of at least a portion of the protein according to claim 17, effective to immunize or treat a mammalian subject against infection or colonization by S. pneumoniae, and a carrier pharmaceutically acceptable.

23. The immune system stimulating composition, according to claim 22, characterized in that the protein is provided in an amount effective to provide a therapeutic effect to the mammalian subject.

24. An antibody capable of binding to a protein, characterized in that it comprises at least 80% sequence identity with SEC. FROM IDENT. DO NOT. : 2, and able to degrade the C3 protein of human complement.

25. The antibody according to claim 24, characterized in that it is a monoclonal antibody.

26. The antibody according to claim 24, characterized in that it is obtained from a mouse, a rat, a goat, a chicken, a human or a rabbit.

27. The antibody capable of binding to at least a portion of a protein, characterized in that the nucleic acid encoding the protein hybridizes with SEC. FROM IDENT. DO NOT. : 1 or its complementary chain under conditions of high stringency hybridization.

28. An isolated nucleic acid fragment, characterized in that it is capable of hybridizing with SEC. FROM IDENT. NO .: 1 or its complementary chain under high-stringency hybridization conditions.

29. The nucleic acid fragment according to claim 28, characterized in that it is isolated from S. pneumoniae.

30. The nucleic acid fragment according to claim 28, characterized in that the nucleic acid fragment codes for at least a portion of a protein.

31. The nucleic acid fragment according to claim 30, characterized in that the protein degrades human complement C3.

32. The nucleic acid fragment according to claim 28, characterized in that it is in a nucleic acid vector.

33. The nucleic acid fragment according to claim 32, characterized in that the vector is an expression vector capable of producing at least a portion of a protein.

34. A cell, characterized in that it comprises the nucleic acid according to claim 28.

35. The cell according to claim 34, characterized in that the cell is a bacterium or a eukaryotic cell.

36. An isolated fragment of nucleic acid, characterized in that it comprises the nucleotides from about 1 to about 174 of SEQ. FROM IDENT. NO .: 1, or its complementary chain.

37. The isolated fragment of nucleic acid, according to claim 36, characterized in that it also comprises nucleotides from about 320 to about 492 of SEQ. FROM IDENT. DO NOT. : 1, or its complementary chain.

38. The isolated fragment of nucleic acid, characterized in that it comprises the nucleic acid sequence of SEQ. FROM IDENT. DO NOT. : 1 or its complementary chain.

39. An RNA fragment, characterized in that it is transcribed by a double-stranded DNA sequence comprising SEQ. FROM IDENT. DO NOT. : 1 or its complementary chain.

40. A method for producing an immune response to S. pneumoniae in a mammal, characterized in that it comprises the steps of: administering a composition comprising a therapeutically effective amount of at least a portion of a protein to a mammal, wherein the nucleic acid encodes for the protein hybridizes with SEC. FROM IDENT. DO NOT. : 1 or its complementary strand under conditions of high stringency hybridization, in a pharmaceutically acceptable carrier, to generate an immune response.

41. The method according to claim 40, characterized in that the immune response is a B cell response, a T cell response, an epithelial cell response or an endothelial cell response.

42. The method according to claim 40, characterized in that at least a portion of a protein has a length of at least about 15 amino acids.

43. The method according to claim 40, characterized in that the composition further comprises at least one protein, peptide or polypeptide of S. pneumoniae, estimator of the immune system.

44. The method according to claim 40, characterized in that at least a portion of a protein comprises at least 15 amino acids of SEC. FROM IDENT. DO NOT. : 2.

45. A method to inhibit the degradation of C3 mediated by S. pneumoniae, characterized in that it comprises the step of: contacting a S. pneumoniae bacterium with an anti-code capable of binding to a protein with the amino acid sequence of the SEC. FROM IDENT. DO NOT. : 2 or with a fragment of it.

46. A method for inhibiting inflammation and rejection of the transplants, mediated by C3, characterized in that it comprises the step of: expressing on the surface of an organ of an animal used in trans-endotransplantation, a protein with the amino acid sequence of SEC. FROM IDENT. DO NOT. : 2 or a fragment of it.

47. An isolated nucleic acid molecule, characterized in that it comprises a region of at least 15 nucleotides which hybridizes under high stringency hybridization conditions with at least a portion of a nucleic acid sequence, as shown in SEQ. FROM IDENT. NO .: 1, or its complementary chain.

48. An isolated nucleic acid molecule, characterized in that it comprises a sequence that hybridizes under high stringency hybridization conditions with at least one SEC reaction. FROM IDENT. DO NOT. : 1 or its complementary strand, wherein the region is selected from the group consisting of nucleotides 1-174 and 320-492.

49. An isolated nucleic acid molecule, characterized in that it comprises a region of at least 15 nucleotides which hybridizes under high stringency hybridization conditions with at least a portion of a nucleic acid sequence as shown in SEQ. FROM IDENT. DO NOT. : 4, or its complementary chain.

50. An isolated nucleic acid molecule, characterized in that it comprises a sequence that hybridizes under high stringency hybridization conditions with at least one region of SEQ. FROM IDENT. DO NOT. : 4 or its complementary strand, wherein the region is selected from the group consisting of nucleotides 507-681 and 827-999.

51. The nucleic acid molecule according to claim 49, characterized in that it encodes at least a portion of a protein.

52. The nucleic acid molecule according to claim 51, characterized in that the protein has a predicted amino acid sequence of SEQ. FROM IDENT. DO NOT. : 5.

53. An isolated fragment of nucleic acid, characterized in that it has a nucleic acid sequence that is selected from the group consisting of SEC. FROM IDENT. DO NOT. : 6, SEC. FROM IDENT. NO .: 7, SEC. FROM IDENT. NO .: 8 and SEC. FROM IDENT. DO NOT. : 9

54. A composition for stimulating the immune system, characterized in that it comprises a therapeutically effective amount of at least a portion of a protein, wherein the nucleic acid encoding the protein hybridizes with SEC. FROM IDENT. DO NOT. : 4 or its complementary chain under conditions of high stringency hybridization.

55. A method for producing an immune response against S. pneumoniae in a mammal, characterized in that it comprises the steps of: administering a composition comprising a therapeutically effective amount of at least a portion of protein to a mammal, wherein the nucleic acid encoding for the protein hybridizes with the SEC. FROM IDENT. DO NOT. : 4 or its complementary strand under conditions of high stringency hybridization in a pharmaceutically acceptable carrier to provide an immune response.

56. A composition for stimulating the immune system, characterized in that it comprises an effective amount of at least a portion of the protein according to claim 51 which is activated to immunize or treat a subject or mammal against infection or colonization by S. pneumoniae, and a pharmaceutically acceptable carrier.

57. The stimulatory composition of the immune system, according to claim 56, characterized in that the protein is provided in an amount effective to provide a therapeutic effect to the mammalian subject.

58. The stimulatory composition of the immune system, according to claim 56, characterized in that the composition is a vaccine.

59. A polypeptide, characterized in that it has the SEC. FROM IDENT. DO NOT . : 5.

60. The stimulatory composition of the immune system, according to claim 23, characterized in that the protein encoded by the nucleic acid sequence or its complementary strand inhibits the transcription or translation of at least one endogenous nucleic acid sequence of S. pneumoniae.

61. The stimulatory composition of the immune system, according to claim 56, characterized in that the protein encoded by the nucleic acid sequence or its complementary strand inhibits the transcription or translation of at least one endogenous nucleic acid sequence of S. pneumoniae. PROTEINASE OF STREPTOCOCCUS PNEUMONIAS DEGRADED C3 OF HUMAN COMPLEMENT SUMMARY OF THE INVENTION The present invention relates to the identification and use of a family of proteinases that degrade C3 human complement, expressed by S. pneumoniae. The proteinase has a molecular weight of about 15 kDa to about 25 kDa. A preferred proteinase of this invention includes the amino acid sequence of SEQ. FROM IDENT. DO NOT. : 2.