EP0938568A1 - Pflanzliche phytase und ihre biotechnologische verwendungen - Google Patents

Pflanzliche phytase und ihre biotechnologische verwendungen

Info

Publication number
EP0938568A1
EP0938568A1 EP97936730A EP97936730A EP0938568A1 EP 0938568 A1 EP0938568 A1 EP 0938568A1 EP 97936730 A EP97936730 A EP 97936730A EP 97936730 A EP97936730 A EP 97936730A EP 0938568 A1 EP0938568 A1 EP 0938568A1
Authority
EP
European Patent Office
Prior art keywords
phytase
plant
sequence
fragment
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97936730A
Other languages
English (en)
French (fr)
Inventor
Sébastien MAUGENEST
Anne-Marie Lescure
Pascual Perez
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BIOCEM
Institut National de la Recherche Agronomique INRA
Original Assignee
BIOCEM
Institut National de la Recherche Agronomique INRA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BIOCEM, Institut National de la Recherche Agronomique INRA filed Critical BIOCEM
Publication of EP0938568A1 publication Critical patent/EP0938568A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Definitions

  • the present invention relates to plant phytases, as well as their biotechnological applications.
  • the present invention also relates to one or more nucleic acid fragment (s) coding for a cereal phytase, more particularly for corn phytase and one or more fragment (s) characterized in that it is cDNA or genomic DNA fragments.
  • the present invention relates to a nucleic acid fragment characterized in that it comprises all or part of the nucleotide sequence as shown in the sequence identifier (SEQ ED) n ° 1 coding for a phytase activity or all or part of the Phyt I or Phyt II genomic sequences as defined below.
  • SEQ ED sequence identifier
  • the present invention relates to a fragment characterized in that it comprises all or part of the coding sequence ranging from nucleotide n ° 32 to 1192 of SEQ ED n.
  • Phytin a complex salt of myo-inositol-hexaphosphoric acid (phytic acid).
  • Phytin is a store of phosphorus, carbohydrates and various cations. In corn kernels, phytate phosphorus represents up to 88% of total phosphorus (O'Dell et al., 1972). The mobilization of phytin is due to phytases, a special type of phosphatases, capable of hydrolyzing phosphate from phytic acid as well as from other phosphorylated substrates (Gibson and Ullah, 1990). Phytase activities have been reported in a wide range of seeds.
  • Extracellular phytases produced by the fungus Aspergillus niger can be obtained in large quantities and have been found to be well suited for use as a feed additive for animals (Nair and Duvnjak, 1990, Simons et al., 1990) .
  • We have sequenced van Hartingsveldt et al., 1993; Ehrlich et al., 1993) cDNAs encoding two different phytases, Phy A and Phy B ⁇ 'Aspergillus niger.
  • transgenic tobacco plants have been obtained ectopically expressing the fungal phytase Phy A (Pen et al, 1993, Ver oerd et al, 1995)
  • a cDNA encoding the subunit of this corn seed phytase has been isolated and characterized. This constitutes the first nucleotide sequence obtained for a plant phytase.
  • a rabbit polyserum directed against the phytase of maize purified until homogenization was used to screen a cDNA expression library of young corn plants.
  • Several positive clones containing an insert of approximately 1400 bp were able to be isolated.
  • the insert sequence of one of these clones was established.
  • This cDNA, called phy SU contains 1335 bp with an open reading frame for 387 aa.
  • the N-terminal residues (23 aa) of the purified phytase were established. These residues are found in positions 19 - 41 of the sequence of aa for which code phy SI 1. This confirms that this cDNA codes for the phytase of corn.
  • the present invention therefore provides the first sequence coding for a plant phytase.
  • Ehrlich and Montalban (1992) and Gellatly and Lefebvre (1990) reported attempts to clone and sequence phytase cDNAs from soybean seeds and potato tubers respectively, but the corresponding sequences have never been published , so comparison of maize cDNA with other plant phytase cDNAs is not possible.
  • nucleotide sequences available correspond to phytases originating from Aspergillus niger (van Hartingsveldt et al., 1993; Ehrlich et al., 1993).
  • the phytases' of microorganisms belong to class 3 phytases which start by removing orthophosphate from position 3 of phytic acid, while plant phytases belong to class 6 phytases which catalyze the removal of! Orthophosphate of position 6.
  • Previous comparisons between the purified phytases of Aspergillus ficuum and soybeans due to Gibson and Ullah (1990) show that few physical characteristics at the protein level (molecular size, amino acid composition, AA sequences partial) appear to be common to both enzymes.
  • EcAP E.coli periplasmic acid phosphatase
  • the consensus motif is generally located at the N-terminus of the microorganism acid phosphatases (position 81 - 87 in Phy A to "Aspergillus), while it is located between positions 204 and 210 in the sequence of These comparisons confirm that the plant phytases are very different from the well characterized ergspergillus phytases.Also: a) the two Aspergillus phytases are excreted in the external environment during a phosphate deficiency, they have a signal peptide and are highly glycosylated. However, plant phytases are intended to hydrolyze the phytin contained in the plant.
  • the present invention therefore relates to the fragments isolated nucleic acid encoding a plant phytase enzyme
  • the enzyme is cereal phytase, such as, but, wheat, barley, rye, triticale
  • the present invention relates to an isolated nucleic acid fragment coding for a phytase activity, characterized in that it comprises all or part of a nucleotide sequence as shown in the identifier of sequence no.1, or all or part of a sequence homologous to that shown in sequence identifier no.1, or all or part of a sequence complementary to said sequence of sequence identifier No. 1 or of a homologous sequence.
  • nucleic acid fragment is meant here a nucleotide sequence which may be of DNA or RNA type. These terms are defined in all basic molecular biology works.
  • a nucleic acid fragment according to the invention is a double stranded DNA fragment.
  • the term “part” designates in particular a fragment of at least 20 nucleotides, in particular of at least 100 nucleotides, for example of at least 500 nucleotides and advantageously of at least 1000 nucleotides identical to a portion of equivalent length of the nucleotide sequence concerned.
  • the term “homologous” refers to any nucleic acid exhibiting one or more sequence modification (s) with respect to all or part of the sequence shown in SEQ ID No. 1, and coding for an enzyme having the activity mentioned above. above.
  • nucleotide (s) can be introduced in particular to improve the activity of the enzyme.
  • a degree of homology of at least 70% with respect to the native sequence will be preferred, advantageously at least 80%, preferably at least 90% and even more preferably at least 95%.
  • the invention relates to two phytases with different amino acid sequences, in particular in the part
  • sequence of SEQ ED No. 1 is a cDNA sequence, that is to say devoid of the introns of the corn phytase.
  • the subject of the invention is in particular a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 1.
  • the fragment according to the invention comprises the complete sequence of 1335 nucleotides as shown in SEQ ID No. 1, a homologous sequence, a complementary sequence, or a sequence homologous to said complementary sequence.
  • the fragment comprises in particular the leader sequence going from nucleotide n ° 1 to 31 of SEQ ID n ° 1, as well as the termination sequence ranging from nucleotide 1 193 to 1335 of SEQ ID No. 1.
  • it may comprise said termination sequence augmented by a poly A tail at its 3 ′ end.
  • the fragment according to the invention comprises all or part of the coding sequence ranging from nucleotide No. 32 to 1,192 of SEQ ID No. 1, or its complement, or of a sequence homologous or complementary to said homologous sequence.
  • the invention also includes any sequence capable of hybridizing under stringent conditions with one of the above sequences. From a fragment originating from a particular plant, it is thus possible to isolate homologous fragments from other plants. On the other hand, using the cDNA, the corresponding genomic DNAs were isolated.
  • the present invention therefore also relates to the genomic DNA coding for the plant phytase.
  • the present invention also relates to a fragment consisting of cDNA and further comprising only part of the intronic fragments of genomic DNA. Introns allow in certain cases to improve the conformational structure of messenger RNA and its expression levels.
  • the invention also relates to any equivalent DNA sequence, that is to say that differs from the sequences mentioned above only by one or more neutral mutations, that is to say whose change or substitution of nucleotides involved does not affect the primary sequence of the resulting protein.
  • the DNA fragment according to the invention will be associated with a regulatory sequence suitable for its transcription, its translation and its addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • a regulatory sequence suitable for its transcription, its translation and its addressing such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • the means and methods for identifying and selecting these different regulatory signals are well known to those skilled in the art.
  • the present invention also relates to a DNA sequence identical or homologous to more than 70% of all or part of the sequence as defined in SEQ ID No. 2 or SEQ ID No. 3.
  • SEQ ID No. 2 represents the nucleotide sequence corresponding to the PHYT I gene (also shown in Figure 4);
  • SEQ ID No. 3 represents the nucleotide sequence corresponding to the PHYT II gene (also represented in FIG. 5).
  • the fragment according to the invention comprises the promoter of the genomic DNA of the plant.
  • the subject of the invention is also a DNA sequence characterized in that it comprises all or part of a sequence complementary or complementary to the homolog of a sequence as defined in SEQ ID N ° 1, SEQ ID N ° 2 or SEQ DD N ° 3. It also relates to the use of one of these sequences as a molecular probe.
  • the present invention therefore also relates to the promoter of a plant phytase gene as well as the promoter of a cereal phytase gene and the promoter of a corn phytase gene.
  • the promoter of a plant phytase gene contains all or part of the fragment ranging from nucleotide No. 1 to nucleotide No. 2096 of the sequence as defined by SEQ ID No. 2, or all or part of the fragment ranging from nucleotide n ° 1 to nucleotide n ° 1328 of the sequence defined by SEQ ED N ° 3.
  • promoters of a plant phytase gene comprising a sequence identical or homologous to more than 70% of the sequence of the fragments as defined above, as well as the promoters comprising all or part of a sequence complementary or complementary to the homolog of such a sequence.
  • the invention also includes the use of the above promoters in molecular constructions intended to improve the agronomic food or industrial quality of a plant, in particular resistance to pathogens or the availability of nutrients.
  • the present invention also relates to an expression cassette characterized in that it comprises a nucleic acid fragment according to the present invention, placed under the control of regulatory sequences capable of controlling the expression of said phytase.
  • regulatory sequences include a promoter as defined above.
  • said regulatory sequences are capable of controlling expression specifically in a particular type of tissue, in particular in the albumen.
  • chloroplastic addressing signals mention may be made of the sequence coding for the transit peptide of the precursor of the small subunit of ribulose 1, 5-biphosphate carboxylase from Pisum sativum.
  • addressing signals mitochondrial we can cite the sequence coding for the transit peptide of the precursor of the beta subunit of the mitochondrial ATP-aseFl of Nicotiana plumbaginifolia.
  • the addressing sequences can be sequences coding for an N-terminal signal peptide ("prepeptide"), possibly in association with a signal responsible for the retention of the protein in the endoplasmic reticulum (signal of the KDEL type ), or a vacuolar or "propeptide” addressing signal.
  • prepeptide an N-terminal signal peptide
  • the presence of the N-terminal signal peptide or prepeptide allows the penetration of the nascent protein into the endoplasmic reticulum where a certain number of post-translational maturations take place, in particular the cleavage of the signal peptide, the N-glycosylations, if the protein in question presents N-glycosylation sites, and the formation of disulfide bridges.
  • the prepeptide responsible for addressing the protein in the endoplasmic reticulum, is very useful. It is normally a hydrophobic N-terminal signal peptide having between 10 and 40 amino acids and being of animal or vegetable origin. Preferably, it is a prepeptide of plant origin, for example that of sporamine, barley lectin, plant extensin, ⁇ -mating factor, pathogenesis protein 1 or 2.
  • the signal peptide is cleaved by a signal peptidase upon the co-translational introduction of the nascent polypeptide into the lumen of the RER (Granular Endoplasmic Reticulum).
  • the mature protein no longer has this N-terminal extension.
  • the addressing sequences can, in addition to the prepeptide, also include an endoplasmic retention signal, consisting of the peptides KDEL, SEKDEL or HEKDEL. These signals are normally found at the C-terminus of the protein and remain on the mature protein. The presence of this signal tends to increase the yields of recombinant proteins.
  • the addressing signals may, in addition to the prepeptide, also include a vacuolar or "propeptide" addressing signal.
  • a vacuolar or "propeptide” addressing signal In the presence of such a signal, after passing through the RER, the protein is addressed to the vacuoles of the aqueous tissues, for example the leaves, as well as to the protein bodies of the reserve tissues, for example the seeds, tubers and roots.
  • the targeting of the protein to the protein bodies of the seed is particularly interesting because of the capacity of the seed to accumulate proteins, up to 40% of the proteins relative to the dry matter, in cellular organelles derived from vacuoles. , called protein bodies and because of the possibility of storing for several years the seeds containing the recombinant proteins in the dehydrated state.
  • propeptide a signal of animal or vegetable origin can be used, the plant signals being particularly preferred, for example pro-sporamine.
  • the propeptide can be N-terminal ("N-terminal targeting peptide" or
  • NTTP NTTP
  • C-terminal C-terminal
  • the use of the signal peptide or prepeptide can lead to the glycosylation of the protein.
  • the protein In the absence of any addressing signal, the protein is expressed in the cytoplasm.
  • the accumulation of phytase is carried out in the endosperm.
  • a cloning or expression vector comprising the fragment mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses etc.
  • plasmids will be used.
  • the present invention therefore also relates to a method for increasing the phytase content in a plant, characterized in that an overexpression of the phytase enzyme is induced in the plant using an expression cassette according to the present invention.
  • an overexpression of phytase activity is induced in the plant.
  • the term “phytase” is understood here to mean a functional definition which includes any plant phytase capable of functioning as a selection marker by conferring phytase activity on a host cell deficient in phytase or having an enzymatic activity as measured for example according to Example 1. 13. This definition also includes any plant phytase capable of functioning in a given plant to increase the phytase activity of said plant. This term therefore includes not only the specific enzyme of the specific plant to be treated, but any other phytase enzyme from other plants if this phytase is capable of functioning in the plants to be treated.
  • overexpression is understood here both to mean an increase in the level of phytase activity relative to the level expressed in a normal plant, as well as a deregulation of the expression leading to the expression of the phytase activity in a tissue or a compartment and / or at a stage of development where this is not normally expressed.
  • Obtaining plants expressing the phytase in a deregulated manner is obtained by introducing, by the methods of genetic engineering, a plant phytase gene possibly modified in an appropriate manner to obtain the modification of the expression, and preferably the overexpression of the phytase in the plant to be improved.
  • plants may be modified by the methods of genetic engineering described in the literature, by transformation of cells followed by their regeneration, or by transformation of tissues or gametes.
  • a functional coding sequence is introduced into the plant genome under conditions allowing its expression.
  • the term "functional coding sequence” means a DNA sequence coding for a polypeptide as defined above as “phytase”, said sequence can therefore be shorter or longer than the total coding sequence of the complete gene of the enzyme .
  • the “functional coding sequence” will include the coding sequence for a 5 'and / or 3' signal peptide.
  • the foreign gene can be a heterologous gene, that is to say which comes from a different plant than the host cell, the gene coding for a polypeptide ordinarily not produced by the plant in the genome of which it is introduced.
  • the foreign gene introduced into the genome of the plant can also be a gene homologous to the endogenous gene, that is to say the expression of which produces the phytase naturally produced by the plant.
  • condition allowing its expression is meant that the gene encoding phytase is placed under the control of elements ensuring its expression.
  • DNA sequence coding for phytase is associated with a regulatory sequence suitable for its transcription, translation and addressing, such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • a regulatory sequence suitable for its transcription, translation and addressing such as promoters and its possible enhancers, and terminators, including start and stop codons.
  • Said functional gene coding for phytase can be introduced into plant cells according to known techniques. We can use for example in this case, but not necessarily, the phytase gene regulation system.
  • the bacterial strain will contain the gene coding for phytase under the control of elements ensuring the expression of said gene.
  • the strain can be transformed by a vector into which is inserted the gene encoding phytase under the control of elements ensuring the expression of said gene. This gene will be inserted for example in a binary vector such as pBIN19 (Bevan, 1984) or pMON 505 (Horsch and Klee, 1986) or any other binary vector derived from the plasmids Ti and Ri.
  • a functional phytase gene for example, we will transform monocotyledonous species, notably rice, wheat and corn, using Agrobacterium tumefaciens.
  • an expression vector comprising the functional phytase gene according to the invention mention may be made of vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses , etc.
  • plasmids will be used.
  • a functional gene coding for a phytase according to the invention is introduced into the genome of the plant, this will preferably be under the control of a heterologous promoter.
  • the present invention also relates to plants or plant organs with increased phytase content which can be obtained by the process according to the invention.
  • the phytase content can be increased globally or only locally, i.e. in a part of the plant or in a particular cell compartment.
  • Cereals in particular corn, wheat, barley, sorghum, rye, as well as peas, soybeans and potatoes, are cited as transgenic plants according to the invention.
  • the present invention more particularly relates to a plant, in particular transgenic, according to the invention, characterized in that it produces transgenic seeds expressing an increased amount of phytase.
  • a subject of the present invention is also dried seeds of transgenic plants according to the invention and in particular seeds comprising an increased phytase content obtained by specific expression of the nucleic acid fragment or of the DNA sequence according to the present invention, in the seed.
  • the subject of the present invention is in fact also a plant host consisting of a plant or plant organ, in particular transgenic, in which the plant phytase can be expressed in a part of the plant or in a cell compartment where this enzyme is not produced naturally, characterized in that an expression cassette according to the invention has been introduced comprising regulatory sequences which induce specific expression in said part of the plant or said cell compartment.
  • the plant or the plant organ in question is advantageously a cereal and more advantageously still corn or their corresponding organs.
  • the present invention also relates to a flour obtained from a seed according to the invention.
  • the subject of the present invention is a composition for human or animal consumption comprising seeds, a seed meal or a phytase according to the present invention.
  • the plant or a part thereof can be used in the food ration of monogastric animals, on the one hand to reduce the level of phytate in the manure or slurry and on the other hand to improve the digestibility of the phytate .
  • the expressed phytase will act on the plant during its development.
  • Phytase will also be used in food preparation processes or in starch extraction processes (soaking process).
  • the phytase activity generated can also be used to recover recovered soaking water or brewing water.
  • the increased availability of phosphorus makes these waters very useful as additives for culture media or fermentation supports.
  • the phytase activity generated allows better recovery of innositol and its derivatives from soaking or brewing water.
  • the invention also relates to the use of the phytase according to the invention for obtaining better availability of calcium, for example for food purposes.
  • the activity of the phytase is exerted on phytates of another plant origin present in the ration.
  • the DNA fragments according to the invention can also be used to transform microorganisms or eukaryotic cells to clone and produce the phytase enzyme.
  • the present invention therefore also relates to a method for the production of phytase, characterized in that it comprises the steps of: a) transformation of a eukaryotic or prokaryotic host, in particular of a plant or of a microorganism with a expression cassette according to the present invention, comprising regulatory sequences capable of controlling the expression of an increased quantity of phytase in the plant host or the microorganism respectively; b) culture of the transformed microorganism or growth of the transformed plant, and c) extraction of the phytase from the culture of microorganisms or transgenic plant tissues.
  • the present invention also relates to a recombinant phytase obtained by the process according to the invention, preferably in the form of a dimer or a heterodimer, and antibodies directed against the plant phytase according to the invention.
  • the present invention also relates to the use of phytase to increase the extractability of the starches of the grains where it is expressed.
  • Phytate precipitates proteins with starch so that if you reduce the phytate level, the extraction of starch is easier.
  • the addition of a phytase to the grains of plants from which it is desired to extract the starch makes it possible to alleviate the precipitation of proteins by phytates.
  • the subject of the present invention is therefore the use of a phytase according to the invention and / or of seeds containing a phytase according to the invention for extracting starch from grains of plants
  • DNA fragments according to the invention can be used as a marker for a phenotype linked to the expression of phytase.
  • the invention also relates to the use of a phytase according to the invention or the use of all or part of plants containing a phytase according to the invention, for the production of myo-inositol for therapeutic or dietetic purposes.
  • Myo-inositol the active nutritional form of inositol, is a constituent of the phospholipid phosphatidylinositol
  • Myo-inositol is known for its virtues in the health field. It has often been attributed to effects on the decrease in the concentration of triglycerides and cholesterol in the blood, and more generally for protection against cardiovascular diseases.
  • myo-inositol have beneficial effects on insomnia and anxiety.
  • the peripheral neuropathy of the diabetic is one of the most paralyzing complications of diabetes.
  • myo-inositol it has already been assumed for several years that a reduction in the level of myo-inositol is associated with damage to the nerve fibers of diabetics suffering from such a complication.
  • Figure 1 represents the nucleotide sequence and the deduced amino acid sequence of the phy SI cDNA 1.
  • the underlined amino acids correspond to two N-terminal sequences obtained from purified corn phytase.
  • the sequence of aa which has a homology with 33 aa of phytase to Aspergillus Phy A (van Hartingsveldt et al., 1993) is underlined in dotted lines.
  • the Ncol (CCATGG) and Asel (ATTAAT) sites used for cloning into the expression vector pET 14 (b) are framed
  • FIG. 2 represents the comparison of the 33 aa overlap regions of the protein sequence deduced from the phy S I 1 cDNA and the phytase sequences Phy A and Phy B of Aspergillus.
  • FIG. 3 represents the restriction maps deduced from the genomic clones isolated from the EMBL3 library
  • FIG. 4 represents the nucleotide sequence of the class I clone (I 9. 14 HindIII / Sal I fragment of 4.7 Kb) coding for a class I phytase protein corresponding to the PHYT I gene (this sequence corresponds to SEQ ID No. 2).
  • FIG. 5 represents the nucleotide sequence of the class II clone (P23 7 HindIII fragment of 3 Kb) coding for a class II phytase protein corresponding to the PHYT II gene (this sequence corresponds to SEQ ID No. 3) 5
  • the lower case letters correspond to the non-coding sequence
  • the upper case letters correspond to the transcribed sequence
  • the deduced protein sequence is indicated using the three-letter code of the representation of amino acids.
  • Figure 6 shows the comparison of protein sequences of phytase of the phy SU cDNA, class I and class II. The alignment was carried out with the "Clustal V multiple alignment" program. The protein sequence is indicated using the letter code of the amino acid representation.
  • the cDNA library is constructed with RNAs extracted from Zea mays c.v. MO 17 (Maisadour).
  • the RNA used for Northern blot analyzes is extracted from Zea mays c.v. AM0406 (Maisadour).
  • Corn seeds are soaked for twelve hours in distilled water aerated at room temperature and then transferred to wet sand at 26 ° C, with an eight-hour photo-period (50 ⁇ E / s per vr) .
  • Germination of corn kernels of line B73 is carried out on vermiculite in the dark at 28 ° C.
  • the B73 line was chosen for the analysis of the transcription starts since the genomic sequences were determined from this genetic material. Thus, the possible differences noted between the sequences of the transcripts and those of genomic fragments cannot be attributed to intervenarietal polymorphism.
  • RNA is purified from frozen embryos (scutellum and embryonic axis) of young corn plants three to four days old, using guanidine hydrochloride (Logemann et al., 1987). We select the fraction poly (A) + on oligo dT columns (Pharmacia). Two-stranded cDNA was synthesized using a cDNA kit (Promega) and an oligo primer adapter (dT) -Notl. After ligation of the Eco RI adapters (Pharmacia), the cDNA is digested with NotI and it is cloned directionally in ⁇ gtl 1 (Promega).
  • E. coli extracts About 1 x 10 ° independent recombinants are obtained after packaging (Stratagene) and infection of E. coli strain L ⁇ 392 (Promega).
  • the cDNA library of ⁇ gtl 1 is amplified in E. coli strain RY1090.
  • the phage plaques are immunologically screened using the Promega ProtoBlot immuno-screening system according to the supplier's protocol. The screening is carried out with a crude rabbit antiserum directed against the purified corn phytase (Labouré et al., 1993). After dilutions (1: 1000 for the first screening and 1: 5000 for the subsequent screening steps), the antiserum is treated with E. coli extracts as indicated in the Promega guidelines.
  • the phage inserts of interest are then subcloned into the Eco RI - Notl sites of a pBS-SK + vector (Stratagene).
  • the nucleotide sequences are determined on a double-stranded DNA using the PRISM Ready Reaction Kit (Applied Biosystems). ), following the manufacturer's instructions and using a Perking Elmer Cetus PEC480 DNA thermal cycling device and an ABI 373A sequencer (Applied Biosystems).
  • Phage plaques are hybridized with partial phy AM10 cDNA as a probe, in order to isolate full-length cDNAs, on 360,000 plaques according to the technique of Benton and Davis (Sambrook et al., 1989): the filter is immersed, DNA side up, in the denaturing solution for ten minutes, then for six minutes in the neutralizing solution.
  • the Mac Vector program (Kaufman et al. 1994, Eastman KODAK company New Haven, CT, USA) was also used for processing the genomic sequences.
  • the phytase phy SI 1 cDNA (Eco RI / Not I fragment containing the phy SU sequence of 1335 bp) is used as a probe for the screening of a lambda corn genomic library.
  • the bank is a commercial bank (Clontech, Palo
  • Alto, CA, USA constructed from DNA fragments extracted from seedlings of the B73 line.
  • the DNA is partially digested with the enzyme Mbo I.
  • the genomic fragments thus obtained are cloned at the Bam HI site of the phage EMBL-3 (Frischholz et al. 1983, J. Mol Biol. 170: 827) and can be excised by an enzyme digestion Sal I.
  • the screening of the genomic library was carried out according to the indications of Sambrook et al. (1989, Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York). 10 ° recombinant phages by genomic DNA library (ie six corn genome equivalents in total) are spread at different concentrations on petri dishes in the presence of the host bacterium. Replicates of the lysis ranges are produced on a nitrocellulose filter. Recombinant phages containing genomic fragments homologous to cDNA phytase are identified after hybridization of the filters with the phytase probe. By superimposing the filter presenting positive signals with the corresponding box, the interesting lysis range is removed and the phages resuspended. The phages are then rediluted, re-spread on a petri dish to undergo an additional screen. Three successive screens were carried out in order to obtain isolated positive clones. After the third round of screening, thirteen clones were positive.
  • RNAs are extracted using guanidine hydrochloride (Logeman et al., 1987) from frozen embryos at various stages of germination. The size of equal amounts of RNA is fractionated on an agarose gel to
  • Proteins are extracted and analyzed according to the
  • the purified corn phytase is electrophoresed on SDS-PAG ⁇ at 12.5% and an electro-transfer is carried out on a PVDF "Problott" membrane (Applied Biosystems).
  • the region corresponding to the 38 kDa subunit is revealed by staining with amido black.
  • Automated ⁇ dman degradation of the protein is carried out using an Applied Biosystems 473 A sequencer with the reagents and
  • RNAgents Total RNA Isolation System The embryos (embryonic axis and scutellum) aged one day and one and a half days were ground separately in liquid nitrogen. The total RNA and the messenger RNA were extracted and purified from a gram of ground material according to the indications of the kits used. "RNAgents Total RNA Isolation System" and
  • JD Southern method (1975, J. Mol Biol. 98: 503-517) makes it possible to demonstrate individual differences in the size of the restriction fragments obtained with a given enzyme and a given probe, which correspond to defined locations on the genome i.e. at genetic loci
  • the phy SU probe - Eco RI / Not I fragment of 1361 bp - was hybridized on a transfer of an electrophoresis gel containing the DNA digested with Eco RI and Hind III from different lines of maize for which segregated progeny were available and used for genetic mapping of maize.
  • the Al 88 x HD7 crossover was chosen because a polymorphism of the size of the restriction fragments homologous to the probe was demonstrated between the two parental lines.
  • Al 88 is an American line (University of Minnesota) and HD7 is a doubled haploid line (Murigneux et al. 1993, Theor. Appl. Genêt. 87: 278-287) from a synthetic population including material of Chinese origin essentially.
  • the phy SU probe was then hybridized on membranes containing the DNA of 58 SSD ("Single Seed Descent") recombinant lines from this cross. On the membranes containing the DNA digested with Hind III, two bands of different sizes were observed for each of the parents.
  • the plasmid pBIOS 255 was obtained by inserting the 1.3 kb fragment from PI 9.14 restricted to Sac I (position + 749) / Nco I (Nco I is located at the level of the first methionine of the gene carried by this genomic fragment), in the plasmid pRPA-RD-100 cut with Sac I / Nco I.
  • Sac I position + 749
  • Nco I is located at the level of the first methionine of the gene carried by this genomic fragment
  • the latter contains the GUS gene and the terminator Nos (Bevan et al., 1983, Nature 304: 184-187).
  • a second construct with a larger promoter fragment (2, 1 kb) was developed.
  • the P19.14 fragment restricted to Eco RI / Sph I was inserted into the plasmid pBIOS 255 cut to Eco RI / Sph I.
  • the resulting plasmid is called pBIOS 261.
  • the plasmid pBIOS 262 was obtained by inserting the 1.3 kb fragment from P23.7 cut at Eco RI / Nco I (Eco RI, site of the polylinker of the vector and
  • pBIOS 256 containing the phytase cDNA attached to the terminator of the nopaline synthetase gene (ter Nos) which brings about a functional polyadenylation signal in many plant species.
  • This plasmid was obtained by cloning the 300 bp Sma I / Eco RV fragment comprising the Nos terminator (Bevan et al. 1983, Nature 304: 184-187) from the plasmid pBIOS 250 at the Bst XI site (made "blunt ends" thanks to to the action of T4 DNA polymerase) of the plasmid phy SU.
  • the vector pBIOS 2500 had been generated by deletion of the Sma I fragment from the plasmid pDM 302 (Cao et al. 1992, Plant Cell Reports 1 1: 586-591).
  • pBIOS 250 comprising the Actin promoter - Actin intron (pAct) (Me Elroy et al. 1991, M.G.G. 231: 150-160), in pBIOS 256 restricted to Hind III.
  • the vector obtained is called pBIOS 259 carrying the pAct - PHYT I - ter Nos gene;
  • the plasmid pBIOS 220 is a construct comprising the 35S promoter of CaMV and the Nos terminator .
  • the vector obtained is called pBIOS 264 carrying the p35S - PHYT I - ter Nos gene. ⁇ blbis) Constructed carrying the PHYT I genes (class I phytase expressed in the cycloplasm of the corn grain albumin)
  • the constructions allowing the expression of the phytase in the cytoplasm of the endosperm were carried out as follows: - cloning of the Bam HI / Nsi I fragment from pBIOS 256 into the BamHI / Nsi I sites of pDV 03000, plasmid containing the HMWG promoter (promoter of the gene for a wheat storage protein, the "High Molecular Weight Glutenin”; Robert et al. 1989, The Plant Cell 1: 569-578) and the terminator Nos.
  • the vector obtained is called pBIOS 258, carrying the pHMWG - PHYT I - ter Nos gene;
  • PHYT I - ter Nos is called pBIOS 263;
  • cloning under the control of the ⁇ -zeine promoter can be obtained by cloning the Hind III / Sma I fragment of the plasmid p ⁇ 63 comprising the ⁇ -zeine promoter, in pBIOS 259 digested to Hind III and Eco RV, substituting thus the actin promoter and the rice actin intron by the ⁇ -zeine promoter
  • the vector obtained, carrying the p ⁇ zeine -PHYT I - ter Nos gene, is called pBIOS 263bis.
  • the plasmid pBIOS 256 serves as the basic construction.
  • the oligonucleotides used for the amplification are the following:
  • - ol MUP1 5 'CAT GAA CTT CCT CAA AAG TTT CCC CTT TTA TGC CTT CCT TTGTTT TGG CCA ATA CTT TGT AGC TGT TAC TCA TGC TGA CTC
  • clone M2 # 61 had the perfect addition of 60 of 76 nucleotides, thus defining only part of the shedding signal.
  • the sequence of the rest of this plasmid revealed a basic substitution in the coding part (adenine in place of guanine at position 853 of phySl 1) not altering the amino acid coded by the affected nucleic acid triplet.
  • the plasmid M2 n ° 61 was selected as the base matrix, to add the entire PR-S signal by a second series of site-directed mutagenesis experiments.
  • the oligonucleotides used for the amplification were the following:
  • the entire amplification product was deposited on 1% agarose gel.
  • the band corresponding to the mutagenized plasmid was cut and then eluted (Micropure 0.22 + Microcon 50 System from Amicon, Ma USA).
  • the purified product was ligated for 16 h at 12 ° C. with 3 units of T4 DNA Ligase
  • a plasmid was retained and the structure of the Sec-PHYT I gene was confirmed by sequencing using three oligonucleotides: - Ml 3-20 primer, - phy5 (position 718/737 of phyS l 1),
  • pBIOS 265 bis The plasmid resulting from the addition of the excretion signal and containing the coding part of the fused class I phytase is called pBIOS 265 bis.
  • a study of the promoter activity can advantageously be carried out by introducing, by the particle gun method, into cells originating from the tissue where this activity is sought, the promoter zone to be evaluated fused to a reporter gene whose activity is easily detectable
  • the GUS gene E coli ⁇ -glucuronidase
  • the cells then produce a blue pigment which allows their observation If the promoter is active in the bombarded tissue and at the stage considered, several tens of cells has the surface of the explant will acquire this blue color No spot will be visible if the promoter is inactive under the conditions used corn grains are sterilized by immersion of 20 'in a saturated solution of calcium hypochlorite, then put to germinate in sté ⁇ le condition between two sheets of blotting paper soaked
  • the bombardment medium can for example be composed of 0.2 M of Mannitol and 0.2 M of Sorbitol solidified with 8 g / l of Agar.
  • the fabrics are then bombarded.
  • the plasmids containing the promoter to be studied fused to the GUS gene are purified on a Qiagen® column according to the manufacturer's instructions. They are then precipitated on tungsten particles (M10) according to the protocol described by Klein (1987, Nature 327: 70- 73). The particles thus coated are projected towards the target cells using the cannon. Optimization of the bombardment conditions may depend on the type of aircraft used and is one of the techniques normally mastered by those skilled in the art. Forty-eight hours after the bombing, the fabrics are stained as described by Jefferson and then observed
  • Plantlets are regenerated from these calluses by modifying the hormonal and osmotic balance of the cells according to the method described by Vain et al (1989, Plant Cell Tissue and Organ Culture 18: 143-151). These plants are then acclimatized in the greenhouse where they can be crossed or self-fertilized
  • the target cells are callus fragments with a surface of 10 to 20 mm 2 They are placed, 4 h before bombardment, at the rate of 16 fragments per dish, in the center of a petri dish containing a culture medium identical to the initiation medium, supplemented with 0.2 M mannitol + 0.2 M sorbitol The tissues are then bombarded as described above The boxes of calluses thus bombarded are then sealed using
  • Scellofrais® then grown in the dark at 27 ° C. The first subculturing takes place 24 hours later, then every two weeks for 3 months on medium identical to the initiation medium supplemented with a selective agent, the nature and concentration of which may vary depending on the gene used.
  • the selective agents which can be used are generally active compounds of certain herbicides (Basta®, Round up®) or certain antibiotics (Hygromycin,
  • calluses whose growth is not inhibited by the selective agent are usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene.
  • the frequency of obtaining such calluses is approximately 0.8 calluses per bombarded box.
  • calluses are identified, individualized, amplified and then cultivated so as to regenerate the plants. In order to avoid any interference with untransformed cells, all of these operations are carried out on culture media containing the selective agent.
  • the plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.
  • the Bar gene from Streptomyces hygroscopicus codes for a phosphinothricin acyl transferase (PAT) which inactivates acetylation of phosphinotricin - the active molecule of the herbicide Basta®.
  • PAT phosphinothricin acyl transferase
  • the coding sequence of the Bar gene is under the control of a regulatory region allowing a strong and constitutive expression in plant cells.
  • a regulatory region can advantageously consist of the promoter and the first intron of the rice Actin gene as described by Mc Elroy (1991, Mol. Gen. Genêt. 231: 150-160).
  • This chimeric gene is cloned on a plasmid allowing its amplification by Escherichia coli.
  • a so-called cotransformation technique can advantageously be used.
  • the two plasmids (the plasmid carrying the selection gene and one of the different "phytase" plasmids) are coprecipitated on the tungsten particles, the total amount of DNA precipitated on the particles remaining identical to what it is in the standard protocol (5 ⁇ g of DNA for 2.5 mg of particles) each plasmid will represent approximately half of the total DNA used.
  • cointegration of plasmids in plant cells is the most frequent event (of the order of
  • RT-PCR is carried out on 10 mg of total RNAs previously treated for 1 hour at 37 ° C. with DNase-RNase free (Boehringer) in the presence of
  • RNAsin Boehringer
  • RNAs are then deproteinized by treatment with phenol-chloroform and precipitated.
  • oligonucleotide "D” complementary to a sequence common to the two genes hybridizing 546 bp downstream of ATG for gene I and 552 bp downstream of ATG for gene II.
  • the sequence of oligo "D” is as follows: CTGGGAGTAGGCGCGGGAGTG (SEQ ID No. 15).
  • the amplifications are carried out on a fraction of the reverse transcription, in the presence of an oligonucleotide "C”: GCTGTAGCAGTCGCTCACCG (SEQ ID N ° 14), common to both genes and hybridizing 214 bp downstream of ATG for gene I and 220 bp downstream for gene II.
  • the second oligonucleotides used start at the initiating ATG and are specific for each gene.
  • PCR conditions are as follows: 94 ° C, 1 min; 60 ° C, 1 min; 72 ° C, 1 min, repeated 30 times. PCR products are analyzed on agarose gel at 2
  • transgenic maize were cultivated in the field, and quantities of the order of 16 kg per batch were harvested.
  • the technical study consists in studying the availability of phosphorus from these corn in broiler chickens. Two biological measurement criteria are retained for this: phosphorus retention or digestive balance and bone mineralization.
  • Each diet is made up of 3 parts: a base, the phosphorus source to be tested and an adjustment part.
  • the base is common to all diets, it ensures a minimum and constant intake of phosphorus and proteins, as well as the trace elements and vitamins necessary to cover the needs of the animals.
  • the phosphorus source to be tested consists of the different lots of corn according to the invention or else the reference monocalcium phosphate
  • the batches to be tested are introduced at the rate of approximately 50%, so that the quantity of phosphorus to be tested is identical for all the regimes, and the monocalcic phosphorus at 3 rates: 0; 0.45 and 0.90%)
  • the adjustment part is made up of raw materials which do not provide phosphorus (corn starch, amino acids, oil, calcium, cellulose) and helps to balance the amino acid, energy and calcium regimes Only the phosphorus of experimental diets are far below the recommendations for chicken of this age (otherwise release of P in the urine which is mixed with the feces, and impossibility of measuring the digestibility of P)
  • the bunches were steam granulated (La Meccanica press, type CLM 200, 2.5 mm x 35 mm die)
  • the experimental batches consist of - one but only control, one but control supplemented with 500 Units (UP) of microbial phytase, one but adds 1000 Units (UP) of microbial phytase, the batches of transgenic corn according to the invention Food are distributed at will from D14 to D25
  • the collection of droppings is carried out every 24 hours for three days from D22 to D25
  • the excreta are grouped by cage They are then frozen at - 20 ° C, then lyophilized for 72 hours before d '' to be ground
  • a sample per cage is then taken for the determination of the total phosphorus content
  • the chickens are sacrificed and the two central phalanges of the middle finger of each leg are taken for the determination of the ash rate
  • the in vivo availability of P is assessed according to two criteria, either by measuring the P retained by the animal (digestive assessment), or by the bone mineralization test (Sauveur, 1983)
  • the phosphorus retention coefficient (CR P) is measured on each of the regimes.
  • the CR P of the different but experimental ones is then calculated by difference with the CR P of the base measured on the regime consisting solely of the base and the part of adjustment
  • the availability of phosphorus from experimental maize measured by the bone mineralization test is calculated by the ratio between the amount of ash obtained with the diet containing the raw material, and the amount of ash obtained with the plans containing monocalcium phosphorus (calculated by regression using the 3 diets of this standard range for the same amount of phosphorus ingested) 1.13) Determination of phytase activity
  • test extract is added, 50 ml in 50 mM sodium acetate, pH 4.8; after 1 h of incubation at 55 ° C., the released inorganic phosphate is measured as follows: 750 ml of the mixture are added to each tupe: acetone: 5N SO 4: 10 mM ammonium molybdate (2: 1: 1) and 50 ml citric acid 1M. After homogenization with a vortex, the tubes are centrifuged for 3 min at 3000XG to remove any precipitate due to acetone.
  • the activity is expressed in nmoles of phosphate released in 1 hour at 55 ° C, per mg of protein.
  • the proteins are dosed on the extracts by the classic Bradford method.
  • a cDNA library is constructed in the expression vector ⁇ gtl 1 using cDNAs synthesized with polyadenylated mRNAs isolated from young corn plants three to four days old.
  • the library is screened with crude rabbit antiserum directed against the phytase subunit purified from young corn plants. The initial screening results in the isolation of twelve positive clones. When tested with affinity purified antiserum on the phytase subunit, a single clone gives a strong positive response.
  • the corresponding insert is subcloned into the vector pBS-SK and sequenced. It contains 930 bp with an open reading frame coding for 139 aa.
  • cDNA phy AM10 This labeled cDNA, called phy AM10, is used as a probe to screen the same library in order to search for corresponding full-length clones.
  • Several positive clones containing an insert of approximately 1400 bp are isolated.
  • the insert of one of these clones, called cDNA phy SI 1 is completely sequenced.
  • the nucleotide sequence of cDNA phy SI 1 contains 1335 bp with a high GC content (65%) and presents an open reading frame for a 387 aa polypeptide ( Figure 1).
  • the size of the encoded protein deduced from the amino acid sequence is 41 kDa, corresponding to the size of the phytase subunit detected by analysis.
  • FIG. 2 shows the alignment of this maize sequence with the corresponding sequences of the Phy A and Phy B phytases of Aspergillus this sequence of maize presents 84% of similarity (27% identity) with the corresponding Phy A phytase sequence from Aspergillus and 79% similarity with that of Phy B phytase.
  • Aspergillus phytase sequences contain the RHGxRxP consensus motif (underlined in FIG. 2) characteristic of the acid phosphatases of yeast, E. coli and certain mammals, and which it is believed to be acts from the phosphatase acceptor region (Piddington et al., 1993).
  • RNA is extracted from dry seeds, the seeds are hydrated for twelve hours in aerated water, the seeds are transferred to wet sand for 1, 2, 3, 5 and 6 days.
  • RNA is subjected to a Northern blot analysis, using the phy SU cDNA as a probe. No Phy S 11 transcripts were detected in total RNA from dry seeds or from seeds soaked for twelve hours in aerated water.
  • the phy SU cDNA is found to hybridize to a single mRNA of about 1400 bp, which appears during the first day of germination at 26 ° C, reaches its highest level on day 2, then gradually decreases from day 3 on day 6. Only a very slight hybridization is observed with the mRNA originating from mature leaves. This kinetics of mRNA accumulation is compatible with what has been described previously for phytase accumulation, but the maximum level of RNA is obtained two days before the maximum level reported for protein accumulation.
  • the coloring of the gel with Coomassie blue reveals a weak band at 40 kDa, which is only present after induction by IPTG
  • the procedure is as follows. the total proteins are separated (10 ⁇ g per lane) extracted from E. coli BL21 on SDS / PAGE at 12.5% and an electrostatic analysis is carried out on a nitrocellulose membrane. The protein is identified with the purified antibody for: 1) unprocessed BL21, 2) transformed BL21 with recombinant pET14, without induction by IPTG,
  • the phytase antibody cross-reacts with a polypeptide from induced E. coli extracts which migrate at exactly the same levels
  • the immuno-screening of a cDNA library of young maize plants allowed the isolation of a cDNA called phy SU, coding for a polypeptide at 41 kDa which in fact corresponds to the phytase subunit detected through
  • the target protein is produced in small quantities, and no accumulation is observed after one hour of induction.
  • the assembled form migrates to the same size as the native purified phytase, but the resulting protein shows no phosphatase activity. This suggests either that the assembly that occurs in the bacteria is not correct and results in a non-functional protein, or that a post-translational modification of the necessary protein that does not occur in E. coli is necessary for the activity.
  • Sequence reactions were also carried out on phage clones P3, P19 and P22 using oligonucleotides specific for the cDNA phytase phy SI 1.
  • P3, P22 and PI 9 could thus be positioned in relation to each other ( Figure 3).
  • the restriction and hybridization analyzes of the P5 clone reveal that the latter is also chimeric.
  • the genomic fragment P19 14 (class I)
  • the comparison of the sequence drawn from the genomic fragment and of the sequence of the cDNA phy SU reveals a single intron of 131 bp in the region 5 'leader not translated
  • the splicing of the intron would take place after the 13 th nucleotide base of the phy SU cDNA
  • S 1 1 These differences could correspond to intervenarietal polymorphism (phy SU comes from the Mol 7 line and P19 14 of the B73 line)
  • the phy SU sequence is entirely found in the genomic sequence From the Nco I site located at the triplet coding for the first methionine, to the Hind III cloning site, 2, 1Kb allow to determine the promoter region of this gene.
  • the open reading frame determined is the same as that of phy SU, the termination codon is also TAA This gene would therefore code for
  • Phy 1 is approximately 4.6 cm from the umcOlO locus on the side of the short arm of the chromosome and phy II, positioned in the same location as bnl 06.06, is 4.2 cm from the marker umc026.
  • Complementary hybridization was carried out on the membranes containing the digested DNA of the recombinant lines in order to establish the correspondence between these two loci and the genes of classes I and II characterized from the genomic fragments. To do this, the Eco RI / Sph I fragment specific for the sequence upstream of the class I gene (P19.14) was used as probe. The hybridization results demonstrate that the class I gene corresponds to the phy I locus.
  • oligonucleotides were tested: AP I and AP2 (Kit Marathon) / phy 20 (position + 95 / + 75 of phy SU); API and AP2 / phy 18 (position + 294 / + 273 of phy S U).
  • Their demonstration was carried out by hybridization with the phy SU cDNA probe (EcoR I / Not I).
  • the positive products were then cloned into the plasmid vector pGEM-T (Promega) according to the recommendations of the supplier, then sequenced. Different products, which can be classified into two groups, have proved to be informative:
  • each phytase gene (2.1 kb upstream from the start codon for class I and 1.3 kb upstream from the start codon for class II) can confer transcriptional expression in certain tissues. of the corn seedling.
  • These promoter fragments of the two phytase genes (also containing the leaders with their unique intron) can be used for all biotechnological modifications of various plants.
  • the data on the regulation of phytase genes suggest that they are only transcriptionally active at the time of germinative phase We therefore have promoters who are likely to be specific to this key stage in the development of the plant and its yield
  • telomeres in corn, for example, they can be useful for directing the production of an antifungal peptide in order to increase the resistance of the plant to fungi, particularly during the germination stage.
  • Other applications such as increasing the vigor of germination can be preferentially envisaged via the increase in the production of certain hormones such as by for example cytokinins and gibberellines. This can be achieved by the expression of biosynthetic enzymes from these hormones.
  • H.6a Constitutive expression in the cytoplasm The first consists in directly reducing the quantity of phytic acid produced in the corn embryo. It is known that certain mutants of corn, low phytic acid I and 2 can have a reduction in their phytic acid content of up to 33% of the total amount without seeing a reduction in their total phosphorus content (Raboy et al., 37 * "Annual Maize Genetics Conference 1995, Asilomar: Asbstract p. 6). We have also chosen to produce class I phytase throughout the plant via the use of constitutive promoters and this so that it hydrolyzes phytic acid into during production in the embryo as it seems that phytic acid is required during development of the embryo.
  • strategy aims to optimize the growth of plants according to the invention. The goal is to proceed in such a way that the phytase is not in the same compartment as the phytin, and therefore will not exercise its activity until the grains are crushed and ingested by the animal or during the 'dipping operation, the first industrial stage of starch extraction.
  • strategy we use two different approaches which can be combined to make a third.
  • Cytoplasmic expression in the albumen The first consists in taking advantage of the morphology of the grain of corn by expressing the phytase of class I of cytoplasmic type (PHYT I) in the compartment which does not contain phytic acid, c is to say in the albumen.
  • This tissue compartment is very large and can allow the expression of a large amount of phytase. Promoters of specific expression of this tissue are known and we have chosen to use 2 promoters of genes coding for cereal reserve proteins: the first comes from the ⁇ -zein gene of corn (Reina et al. 1990, NAR 18: 6425-6426) the second comes from the gene for a wheat storage protein, "High Molecular Weight Glutenin” (Robert et al. 1989, The Plant Cell 1: 569-578).
  • H.6b2 Constitutive expression in the extracellular space
  • the second approach is similar to the realization using a fungal phytase (Pen et al. 1993, Biotechnology 1 1: 81 1-814 and patent of invention of Pen et al. N ° EP-0 449 375) in tobacco and rapeseed via expression in a cell compartment different from that in which phytic acid is found.
  • the compartment chosen is the extracellular space.
  • an extracellular addressing signal is added at the start of the class I phytase protein via a phase fusion, to give a new protein (Sec-PHYT I).
  • H.6b3 Extracellular expression in endosperm Taking into account the opportunity that corn and cereals in general have a deep endosperm, we can combine the two previous approaches, namely: using specific endosperm promoters to express the excreted phytase (Sec-PHYT I). The same promoters as those used for the expression of the cytoplasmic phytase were chosen. This third approach guarantees a high level of phytase expression in the corn kernel ensuring its absence of expression in the germ rich in phytic acid.
  • a first analysis was carried out by Northern blots on total RNAs extracted at various stages of development (1, 2, 4 and 7 days) from different parts of the young seedling (coleoptile, leaf, scutellum, coleorrhize and root).
  • the results of the Northerns show a significant accumulation of mRNA phytase at 1 day in the coleorhize, the root and the coleoptile.
  • the hybridization signal then decreases in the root during the following stages (2, 4 and 7 days). It continues to increase in the coleoptile at least until the 4-day stage.
  • RNA phytase originating from roots were also carried out on total RNAs extracted from leaves or roots of adult plants (1 month). While no hybridization with phytase cDNA is observed in the case of leaf RNAs, a weak signal but significant is observed with RNAs originating from roots: the presence of RNA phytase is therefore detected in transcripts originating from adult roots, at a stage very after germination.
  • M situ hybridizations carried out on embryos at 1 day, also demonstrate a significant accumulation of mRNA phytase at the level of the coleoptile and the root.
  • immunolocation on sections at the same stage it was possible to locate the protein phytase in the same place as its mRNA.
  • Hybridizations /// situated on transverse sections (4, 8 or 14 days) have shown that phytase transcripts are located essentially at the level of two cellular layers surrounding the central cylinder, the endoderm and the pericycle. We also detect them at the level of l epidermis The phytase revealed by immunolocation is located at the same cellular base All of these data therefore show a very localized expression of the phytase at the level of the roots bearing at the same time on the messenger, the protein and the enzymatic activity
  • the endoderm is known to constitute an important physiological barrier it is at the level of this cellular base that occurs the regulation of the selective transport of minerals to the central cylinder and subsequently to the aerial parts of the plant.
  • Oligo D located approximately 300 bp downstream of C Oligo D allows in the presence of reverse transcriptase and a population of RNAs total to synthesize by reverse transcription the cDNA strands complementary to the mR As phytase
  • These cDNAs are then used to carry out amplifications by PCR in the presence of either the oligo A + C pair or the B + C pair.
  • Controls have shown that the combination A + C specifically amplified the a corresponding region of the plasmid containing the gene I, while the combination B + C specifically amplified the cDNA corresponding to the class II plasmid
  • RNAs extracted from the different parts of the seedling at different stages were thus tested by RT-PCR.
  • the first results carried out on RNAs extracted at 4 days show that in the coleoptile only the class I gene is abundantly expressed.
  • the two genes I and II are expressed more or less identically.
  • the promoter of gene I controls the expression of phytase in the embryonic organs (coleoptile, coleorhize, embryonic root) and regulates the mobilization of the phytin stored in the embryo.
  • the promoter of gene II is specific to the root cell bases involved in the control of homeostasis of minerals in the plant.
  • Extractions and westerns were carried out as described in labouré et al., Biochem. J., 1993, 295, 413-419 with the following modification: before electrophoresis, the proteins were precipitated with 10% TCA, washed twice with 80% acetone before being taken up in the deposition buffer; non-protein products reacting with the antibody have indeed been found in particular in leaf extracts. These products were eliminated by this precipitation.
  • GTCTGTTTGT CATGCCTGGC GTGGCCATAA TTATTCTTAG GGTATGTTAG ATTACTTTAG 900
  • TCTCCCGCGA CAACGGAAAT AAATAAGGGG CAACCATGAA ATTGACATGT TTTAGGGGTT 1080
  • AAG ATT GCA GCC ACG ACG TGG GCG CAG GCG GTG AGC GTC TTC ATC ATG 2912 Lys Ile Ala Ala Thr Trp Ala Gin Ala Val Ser Val Phe Ile Met 260 265 270
  • GAG GCC ATC CTC AAG GGC AGC CTC AAC CTC CTG GCG GGG CTA GGG GGC 3008 Glu Ala Ile Leu Lys Gly Ser Leu Asn Leu Leu Ala Gly Leu Gly Gly 290 295 300
  • TCCCCTTCCC TATCAACAAC GGAGGGACGA TGATATATTA TTTAGGTCTT GTTCGGATAC 960
  • AAGCTACTAC TAGTTACAAG CTGGTTTATA TTTAACTACA AGTAGCAACG ATTTGTCTTA 1260
  • a tobacco osaic virus-induced tobacco protein is homologous to the sweet-tasting protein thaumatin. Nature 321: 531-532.
  • MAPMAKER an interactive computer package for constructing p ⁇ mary genetic linkage maps of experimental and natural populations Genomics 1, 174-181

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)
EP97936730A 1996-08-01 1997-08-01 Pflanzliche phytase und ihre biotechnologische verwendungen Withdrawn EP0938568A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9609734A FR2751987B1 (fr) 1996-08-01 1996-08-01 Phytases de plantes et applications biotechnologiques
FR9609734 1996-08-01
PCT/FR1997/001443 WO1998005785A1 (fr) 1996-08-01 1997-08-01 Phytases de plantes et applications biotechnologiques

Publications (1)

Publication Number Publication Date
EP0938568A1 true EP0938568A1 (de) 1999-09-01

Family

ID=9494738

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97936730A Withdrawn EP0938568A1 (de) 1996-08-01 1997-08-01 Pflanzliche phytase und ihre biotechnologische verwendungen

Country Status (5)

Country Link
EP (1) EP0938568A1 (de)
AU (1) AU3944697A (de)
CA (1) CA2261913A1 (de)
FR (1) FR2751987B1 (de)
WO (1) WO1998005785A1 (de)

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU3755599A (en) 1998-04-24 1999-11-16 E.I. Du Pont De Nemours And Company Phytic acid biosynthetic enzymes
US6451572B1 (en) * 1998-06-25 2002-09-17 Cornell Research Foundation, Inc. Overexpression of phytase genes in yeast systems
ES2248067T3 (es) 1999-03-31 2006-03-16 Cornell Research Foundation, Inc. Fosfatasas con actividad de fitasa mejorada.
US7148064B1 (en) 1999-05-26 2006-12-12 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
CA2375071A1 (en) * 1999-05-26 2000-12-07 National Research Council Of Canada Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phosphate synthase gene
AU6082600A (en) * 1999-07-12 2001-01-30 E.I. Du Pont De Nemours And Company Plant inositol polyphosphate phosphatase homologs
AUPQ304999A0 (en) * 1999-09-24 1999-10-21 Australian Wool Research & Promotion Organisation Method of modifying plant productivity
US6841370B1 (en) 1999-11-18 2005-01-11 Cornell Research Foundation, Inc. Site-directed mutagenesis of Escherichia coli phytase
AU7242200A (en) * 2000-06-12 2001-12-13 Academia Sinica Protein production in transgenic plant seeds
FR2810994B1 (fr) * 2000-06-30 2004-03-12 Biogemma Fr Acides nucleiques codant pour une phosphatase vegetale de type mipp a activite phytasique et applications
FR2818286A1 (fr) * 2000-12-19 2002-06-21 Agronomique Inst Nat Rech Acides nucleiques et polypeptides exprimes specifiquement dans les cellules de la zone de transfert d'un grain de plante et leurs applications
AU2002223038A1 (en) * 2000-11-06 2002-05-15 Centre National De La Recherche Scientifique Nucleic acids and polypeptides specifically expressed in cells of the transfer zone of a plant seed and uses thereof
AU2002356880A1 (en) 2001-10-31 2003-05-12 Phytex, Llc Phytase-containing animal food and method
CA2498017C (en) 2002-09-13 2016-06-14 Cornell Research Foundation, Inc. Using mutations to improve aspergillus phytases
US20040063184A1 (en) 2002-09-26 2004-04-01 Novozymes North America, Inc. Fermentation processes and compositions
US20040253696A1 (en) 2003-06-10 2004-12-16 Novozymes North America, Inc. Fermentation processes and compositions
WO2006110507A2 (en) * 2005-04-07 2006-10-19 The Samuel Roberts Noble Foundation, Inc. Plant phytase genes and methods of use
US7919297B2 (en) 2006-02-21 2011-04-05 Cornell Research Foundation, Inc. Mutants of Aspergillus niger PhyA phytase and Aspergillus fumigatus phytase
WO2008017066A2 (en) 2006-08-03 2008-02-07 Cornell Research Foundation, Inc. Phytases with improved thermal stability
EP3712274A1 (de) 2013-09-11 2020-09-23 Novozymes A/S Verfahren zur herstellung von gärungsprodukten
EP3394274A1 (de) 2015-12-22 2018-10-31 Novozymes A/S Verfahren zur herstellung von gärungsprodukten
EP3537890A4 (de) * 2016-11-08 2021-01-27 Agrivida, Inc. Phytaseproduktion und verfahren zur verwendung davon
US20200263207A1 (en) 2017-09-15 2020-08-20 Novozymes A/S Enzyme blends and processes for improving the nutritional quality of animal feed
WO2019083831A1 (en) 2017-10-23 2019-05-02 Novozymes A/S METHODS FOR LACTIC ACID REDUCTION IN A BIOCARBURIZER FERMENTATION SYSTEM
MX2020012754A (es) 2018-05-31 2021-02-26 Novozymes As Procesos para mejorar el crecimiento y la productividad de la levadura.
BR112021014873A2 (pt) 2019-01-31 2021-10-05 Novozymes A/S Polipeptídeo, combinação de enzimas, polinucleotídeo, construto de ácido nucleico ou vetor de expressão recombinante, célula hospedeira recombinante, método de produção de um polipeptídeo, e, processo de produção de um produto de fermentação
BR112022002203A2 (pt) 2019-08-05 2022-09-06 Novozymes As Misturas de enzimas e processos para produção de um ingrediente alimentar com alto teor de proteína a partir de um subproduto de vinhaça completa
BR112022011634A2 (pt) 2019-12-16 2022-08-30 Novozymes As Processos para produção de um produto de fermentação, para diminuição da quantidade de amido residual presente em um liquefato e para aumento da quantidade de oligossacarídeos de cadeia curta presente em um liquefato
WO2024137250A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2024137252A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Process for reducing syrup viscosity in the backend of a process for producing a fermentation product
WO2024137248A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization
WO2024137246A1 (en) 2022-12-19 2024-06-27 Novozymes A/S Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same
WO2024137704A2 (en) 2022-12-19 2024-06-27 Novozymes A/S Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL8702735A (nl) * 1987-11-17 1989-06-16 Dorr Oliver Inc Werkwijze voor het weken van granen met een nieuw enzympreparaat.
US7705215B1 (en) * 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
CZ289014B6 (cs) * 1989-09-27 2001-10-17 Dsm N. V. Vyčiątěná a izolovaná sekvence DNA kódující fungální fytázu, konstrukt pro expresi, vektory a transformované hostitelské buňky a způsob produkce fytázy
KR100225087B1 (ko) * 1990-03-23 1999-10-15 한스 발터라벤 피타아제의 식물내 발현
EP0611395A1 (de) * 1991-11-05 1994-08-24 Novartis AG Aussergewoehnlich suesser mais
US5248765A (en) * 1991-12-20 1993-09-28 Abbott Laboratories Separation of phytate from plant protein and dietary fiber using alumina
US5693506A (en) * 1993-11-16 1997-12-02 The Regents Of The University Of California Process for protein production in plants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9805785A1 *

Also Published As

Publication number Publication date
AU3944697A (en) 1998-02-25
FR2751987B1 (fr) 1998-12-31
WO1998005785A1 (fr) 1998-02-12
FR2751987A1 (fr) 1998-02-06
CA2261913A1 (fr) 1998-02-12

Similar Documents

Publication Publication Date Title
EP0938568A1 (de) Pflanzliche phytase und ihre biotechnologische verwendungen
CA2242903C (fr) Proteines de reserve de plantes enrichies en acides amines, notamment .gamma.-zeine de mais enrichie en lysine, plantes exprimant ces proteines
Murphy et al. Role of lipid bodies and lipid-body proteins in seeds and other tissues
KR101965019B1 (ko) 식물에서의 베타-다마세논의 조절
CA2296840A1 (en) Dna sequence coding for a hydroxyphenylpyruvate dioxygenase and overproduction thereof in plants
US7199284B2 (en) Chlorophyllases
JP2009509509A (ja) コーヒー中のスクロース分解と関連している核酸及びタンパク質
RO122151B1 (ro) Procedeu de modificare a nivelurilor concentraţiilor de compuşi metabolici secundari, din plante
JP2008523821A (ja) 植物由来の脂肪酸デサチュラーゼ遺伝子をコードする核酸分子およびその使用方法
WO2005068625A1 (en) Plants transformed for elevated levels of gallic acid and methods of producing said plants
FR2774379A1 (fr) Procede de production, par des cellules vegetales, d'alpha 1-antitrypsine et de ses variantes, et produits contenant l'alpha-antitrypsine ainsi obtenue
EP2627667B1 (de) Herstellung von pflanzen mit verbesserter toleranz gegenüber wassermangel
CA2385763C (fr) Promoteurs specifiques de l'albumen des graines de vegetaux
CN101600340A (zh) 具有改变的油、蛋白或纤维含量的植物的生产
US20090208632A1 (en) Generation of plants with altered oil content
JP2003511049A (ja) プロトポルフィリノーゲンオキシダーゼ遺伝子を利用した作物の収量またはバイオマスの増大方法
FR2794772A1 (fr) Promoteur permettant l'expression de transgenes dans toute la plante hormis dans la graine
WO2002036788A2 (fr) Acides nucleiques et polypeptides exprimes specifiquement dans les cellules de la zone de transfert d'un grain de plante et leurs applications
WO2013030812A1 (en) High-methionine transgenic soybean seeds expressing the arabidopsis cystathionine gamma-synthase gene
WO1997031106A1 (fr) Procede pour modifier la composition des phospholipides produits par un corps vivant et vecteur de recombinaison utilise a cet effet
MXPA06007097A (es) Generacion de plantas con contenido oleaginoso alterado.
EP2627772B1 (de) Herstellung von pflanzen mit verbesserter wassermangeltoleranz
EP1294900A1 (de) Nukleinsäuren kodierend für eine pflanzenphosphatase von mipp typ mit phytasaktivität und deren verwendungen
TWI332029B (de)
MXPA05006761A (es) Generacion de plantas con contenido alterado de aceite.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990222

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20020129

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20030607