CA2375071A1 - Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phosphate synthase gene - Google Patents

Abstract

A plant, multicellular fragment of said plant or seed of said plant transformed with a nucleotide sequence of SEQ ID NO 1 or an allelic variant or a fragment thereof or a genetic equivalent thereof according to the degenera cy of the genetic code coding for a peptide having a Brassica myo-inosit ol 1-phosphate synthase activity, said plant, multicellular fragment or seed having reduced myo-inositol 1-phosphate synthase activity when compared with an equivalent untransformed plant, multicellular fragment or seed, such that there is reduced phytate present in the plant, multicellular fragment or see d. The invention also provides a method for reducing phytate in Brassica , which method comprises growing a Brassica plant comprising one of a m yo- inositol 1-phosphate synthase antisense sequence and a myo-inositol 1- phosphate synthase cosuppression sequence thereby yielding a reduced amount of myo-inositol 1-phosphate synthase and consequently reduced phytate in said Brassica.

Description

METHOD FOR REDUCING PHYTATE IN CANOLA MEAL USING GENETIC

BACKGROUND OF THE INVENTION
S
The use of canola meal as an acceptable protein source in the animal feed industry is severely limited by the presence in the meal of undesirable seed contents such as glucosinolates, phytates, phenolics and hull. Phytate is a significant component of canola seeds, comprising up to 10% by weight of the seed. Phytic acid is the hexaphosphate derivative of myo-inositol. The presence of phytate has been linked to such symptoms as loss of appetite, reduced litter size and increase in the number of stillborn pups in rats. These effects have been attributed to the zinc-binding ability of phytic acid. The reduction of phytate in canola protein preparations has, to date, been difficult. Hence modification of its biosynthetic pathway to reduce its accumulation and enhance protein or oil synthesis in its place would be very significant in terms of the economic value of canola.
SUMMARY OF THE INVENTION
An aim of the present invention is to limit the utilization of myo-inositol as a starting material for phytic acid synthesis. This is complicated by the fact that myo-inositol is a crucial biological substrate, the presence of which is essential for the growth and multiplication of all living cells. In plants, for example, in addition to its participation in cell wall biogenesis, where myo-inositol furnishes a carbon source for uronides and pentoses, it is also present in phosphoinositides of plant cell membranes, as well as other complex plant lipids including glycophosphoceramides. Additionally, in some of its phosphorylated forms it acts as important second messengers in signal transduction pathways in eukaryotes. It is also a precursor of other naturally occurring inositol isomers and many of these as well as myo-inositol are distributed as methyl ethers in a species specific pattern throughout the plant kingdom.
In view of the vital role myo-inositol plays in plants, limiting its supply to the cell can be expected to promote reorganization of priorities within the cell, with possibly unforeseen consequences. Myo-inositol pathways leading to critical cell components or functions may be expected to proceed at the expense of other pathways that are of no direct and immediate consequence to the well-being of the plant during its life cycle. Phytic acid synthesis is an example of such a "futile" pathway since phytic acid is a storage substance that does not take part in any of the essential pathways during plant growth and development. It therefore seemed possible to us that, by limiting the availability of myo-inositol I-phosphate synthase, lesser amounts of glucose 6-phosphate would be converted to myo-inositol thereby leading to a lower rate of phytic acid synthesis. It can be seen that a difficult balance has to be struck between over-limiting the production of myo-inositol thereby threatening critical pathways and under-limiting the production of myo-inositol with little consequent economic benefit.
The basic approach to limiting the rate of conversion of glucose 6-phosphate to myo inositol 1-phosphate in Brassica na us was to prepare a mRNA transcript for the enzyme responsible for this step from B. napes and then to introduce a recombinant version of this gene into Brassica plants by, for example, A~robacterium-mediated transformation in two different orientations (sense, for cosuppression, and antisense). Two particular types of constructs were produced containing either the 35S promoter or the seed-specific napin promoter. Integration of the construct into the genome was confirmed by Southern blot analysis. Phytic acid analysis showed reduction in levels of around 30 % to 50 % for antisense 1 S and cosuppression transgenic plants.
The invention provides a nucleotide sequence of SEQ ID NO 1 or an allelic variant or a fragment thereof or a genetic equivalent thereof according to the degeneracy of the genetic code coding for a peptide having a Brassica myo-inositol 1-phosphate synthase activity.
In preferred embodiments the nucleotide sequence, variant or fragment of the invention is in combination with a promoter sequence in reading frame alignment (preferably antisense) therewith.
The invention also provides a myo-inositol 1-phosphate synthase-active peptide sequence encoded by the nucleotide sequence of the invention. The invention also provides cells (preferably Brassica, especially B. napes cells) transformed with a nucleotide sequence of the invention. The invention further provides plants, multicellular fragments of such plants and seeds of such plants transformed with a nucleotide of the invention, the plant , multicellular fragment or seed having reduced myo-inositol 1-phosphate synthase activity such that there is reduced phytate present in the plant, multicellular fragment or seed. The multicellular fragment is preferably in the form of a seed meal.
The invention also provides a method for reducing phytate in Brassica which comprises limiting the availability of myo-inositol 1-phosphate synthase in said Brassica with one of one of a myo-inositol 1-phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase cosuppression sequence to give a reduced amount of translatable myo-inositol 1-phosphate synthase thereby reducing phytate in said Brassica. Preferably the Brassica is Brassica na~us. The invention also provides a method for reducing phytate in Brassica, which method comprises growing a Brassica plant comprising one of a myo-inositol 1-phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase cosuppression sequence thereby yielding a reduced amount of myo-inositol 1-phosphate synthase and consequently reduced phytate in said Brassica.
DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO: 1 shows the nucleotide sequence of a myo-inositol 1-phosphate synthase gene of Brassica na us.
SEQ ID NO: 2 show the amino acid sequence of my-inositol 1-phosphate synthase of Brassica napus.
SEQ ID NO: 3 shows the myo-inositol 1-phosphate synthase right primer used in the examples.
SEQ ID NO: 4 shows the myo-inositol 1-phosphate synthase left primer used in the examples.
SEQ ID NO: 5 shows a sequence comprising the myo-inositol 1-phosphate synthase (mips) promoter sequence used in the examples.
DESCRIPTION OF THE DRAWINGS
Figure 1 shows the nucleotide sequence of the Brassica na us myo-inositol 1-phosphate synthase of the invention.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the term "functional fragments" when used to modify a specific gene or gene product means a less than full length portion of the gene or gene product which retains substantially all of the biological function associated with the full length gene or gene product to which it relates. To determine whether a fragment of a particular gene or gene product is a functional fragment, fragments are generated by well-known nucleolytic or proteolytic techniques or by the polymerise chain reaction and the fragments tested for the described biological function.
As used herein, a coding sequence is "operably linked to" another coding sequence when S RNA polymerise will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequence is ultimately processed to produce the desired protein.
As used herein, "recombinant" polypeptides refer to polypeptides produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA
construct encoding the desired polypeptide. "Synthetic" polypeptides are those prepared by chemical synthesis.
As used herein, a "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
As used herein, a "vector" is a replicon, such as a plasmid, phage, or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
As used herein, a "reference" gene refers to the wild type gene sequence of the invention and is understood to include the various sequence polymorphisms that exist, wherein nucleotide substitutions in the gene sequence exist, but do not affect the essential function of the gene product.
As used herein, a "mutant" gene refers sequences different from the reference gene wherein nucleotide substitutions and/or deletions and/or insertions result in perturbation of the essential function of the gene product.
As used herein, a DNA "coding sequence of" or a "nucleotide sequence encoding"
a particular protein, is a DNA sequence which is transcribed and translated into a polypeptide when placed under the control of appropriate regulatory sequences.
As used herein, a "promoter sequence" is a DNA regulatory region capable of binding RNA polymerise in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bound at its 3' terminus by a translation start codon (e.g., ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes.
Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensussequences.
As used herein, DNA "control sequences" refers collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers and the like, which collectively provide for the expression (i.e., the transcription and translation) of a coding sequence in a host cell.
As used herein, a control sequence "directs the expression" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
As used herein, a "host cell" is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous DNA sequence.
As used herein, a cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell membrane. Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid. With respect to eukaryotic cells, a stably transformed or transfected cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
As used herein, "transfection" or "transfected" refers to a process by which cells take up foreign DNA and integrate that foreign DNA into their chromosome. Transfection can be accomplished, for example, by various techniques in which cells take up DNA
(e.g., calcium phosphate precipitation, electroporation, assimilation of liposomes, etc.) or by infection, in which viruses are used to transfer DNA into cells.
As used herein, a "target cell" is a cell that is selectively transfected over other cell types (or cell lines).
As used herein, a "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.
As used herein, a "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature. Thus, when the heterologous region encodes a gene, the gene will usually be flanked by DNA that does not flank the gene in the genome of the source.
Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.
An aspect of the present invention is isolated polynucleotides encoding a protein including substantially similar sequences and functional fragments. Isolated polynucleotide sequences are substantially similar if they are capable of hybridizing under moderately stringent conditions to SEQ ID NO:1 or they encode DNA sequences which are degenerate to SEQ ID NO:1 or are degenerate to those sequences capable of hybridizing under moderately stringent conditions to SEQ ID NO:1.
Moderately stringent conditions is a term understood by the skilled artisan and has been described in, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition, Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989). An exemplary hybridization protocol using moderately stringent conditions is as follows.
Nitrocellulose filters are prehybridized at 65° C. in a solution containing 6× SSPE, 5× Denhardt's solution (10 g Ficoll, 10 g BSA and 10 g polyvinylpyrrolidone per litre solution), 0.05% SDS
and 100 ,ug/ml tRNA. Hybridization probes are labelled, preferably radiolabelled (e.g., using the Bios TAG-IT® kit). Hybridization is then carried out for approximately 18 hours at 65° C. The filters are then washed twice in a solution of 2× SSC
and 0.5 % SDS at room temperature for 15 minutes. Subsequently, the filters are washed at 58° C., air-dried and exposed to X-ray film overnight at -70° C. with an intensifying screen.
Degenerate DNA sequences encode the same amino acid sequence as SEQ ID N0:2 or the proteins encoded by that sequence capable of hybridizing under moderately stringent conditions to SEQ ID NO: l, but have variations) in the nucleotide coding sequences because of the degeneracy of the genetic code. For example, the degenerate codons UUC
and UUU both code for the amino acid phenylalanine, whereas the four codons GGX all code for glycine.
Alternatively, substantially similar sequences are defined as those sequences in which about 70 % , preferably about 80 % and most preferably about 90 % , of the nucleotides or amino acids match over a defined length of the molecule. As used herein, substantially similar refers to the sequences having similar identity to the sequences of the instant invention. Thus nucleotide sequences that are substantially the same can be identified by hybridization or by sequence comparison. Protein sequences that are substantially the same can be identified by techniques such as proteolytic digestion, gel electrophoresis and/or microsequencing.
Embodiments of the isolated polynucleotides of the invention include DNA, genomic DNA
and RNA, preferably of Brassica origin. A method for isolating a nucleic acid molecule encoding a protein is to probe a genomic or cDNA library with a natural or artificially designed probe using art recognized procedures. See, e.g., "Current Protocols in Molecular Biology", Ausubel et al. (eds. ) Greene Publishing Association and John Wiley Interscience, New York, 1989,1992.
The ordinarily skilled artisan will appreciate that SEQ ID NO:1 or fragments thereof comprising at least 15 contiguous nucleotides are particularly useful probes. It is also appreciated that such probes can be and are preferably labelled with an analytically detectable reagent to facilitate identification of the probe. Useful reagents include, but are not limited to, radioisotopes, fluorescent dyes or enzymes capable of catalysing the formation of a detectable product. The probes would enable the ordinarily skilled artisan to isolate complementary copies of genomic DNA, cDNA or RNA polynucleotides encoding proteins from Brassica or other plant sources or to screen such sources for related sequences, e.g., additional members of the family, type and/or subtype, including transcriptional regulatory and control elements as well as other stability, processing, translation and tissue specificity-determining regions from 5' and/or 3' regions relative to the coding sequences disclosed herein, all without undue experimentation.
Another aspect of the invention is functional polypeptides encoded by the polynucleotides of the invention. An embodiment of a functional polypeptide of the invention is the Brassica protein having the amino acid sequence set forth in SEQ ID N0:2.
Another aspect of the invention is a method for preparing essentially pure Brassica protein.
Yet another aspect is the Brassica protein produced by the preparation method of the invention.
This protein has the amino acid sequence listed in SEQ ID N0:2 and includes variants with a substantially similar amino acid sequence that have the same function. The proteins of this invention can be made by recombinant genetic engineering techniques by culturing a recombinant host cell containing a vector encoding the polynucleotides of the invention under conditions promoting the expression of the protein and recovery thereof.
The isolated polynucleotides, particularly the DNAs, can be introduced into expression vectors by operatively linking the DNA to the necessary expression control regions, e.g., regulatory regions, required for gene expression. The vectors can be introduced into an appropriate host cell such as a prokaryotic, e.g., bacterial, or eukaryotic, e.g., yeast or plant cell by methods well known in the art. See Ausubel et al., supra. The coding sequences for the desired proteins, having been prepared or isolated, can be cloned into any suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art and the selection of an appropriate cloning vector is a matter of choice. Examples of recombinant DNA
vectors for cloning and host cells which they can transform include, but are not limited to, the bacteriophage lambda. (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pGEX4T-3 (E. coli , pKT230 (gram-negative bacteria), pGV 1106 (gram-negative bacteria), pLAFRl (gram-negative bacteria), pME290 (non-E.coli gram-negative bacteria), pHVl4 (E. coli and Bacillus subtlilis), pBD9 (Bacillus , pIJ61 (Streptomyces), pUC6 (Streptomyces), YIpS (Saccharomvces) and YCpl9 (Saccharom~). See generally, "DNA Cloning": Vols. I & II, Glover et al. ed.
IRL Press Oxford (1985) (1987); and T. Maniatis et al. ("Molecular Cloning" Cold Spring Harbor Laboratory (1982).
The gene can be placed under the control of control elements such as a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the DNA
sequence encoding the desired protein is transcribed into RNA in the host cell transformed by a vector containing the expression construct. The coding sequence may or may not contain a signal peptide or leader sequence. The proteins of the present invention can be expressed using, for example, the E. coli tac promoter or the protein A gene (spa) promoter and signal sequence.
Leader sequences can be removed by the bacterial host in post-translational processing. See, e.g., U.S. Pat. Nos. 4,431,739; 4,425,437 and 4,338,397.
In addition to control sequences, it may be desirable to add regulatory sequences which allow for regulation of the expression of the protein sequences relative to the growth of the host cell. Regulatory sequences are known to those of skill in the art. Exemplary are those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound or to various temperature or metabolic conditions. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.
An expression vector is constructed so that the particular coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control sequences, i.e., RNA polymerase which binds to the DNA
molecule at the control sequences transcribes the coding sequence.
Modification of the sequences encoding the particular antigen of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the reading frame. The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors described above.
Alternatively, the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.
In some cases, it may be desirable to produce mutants or analogues of Brassica protein.
S Mutants or analogues may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., T. Maniatis et al., supra;
"DNA Cloning,"
Vols. I and II, supra; and "Nucleic Acid Hybridization", supra.
Depending on the expression system and host selected, the proteins of the present invention are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. Preferred plant cells include Brassica cells. If the expression system secretes the protein into growth media, the protein can be purified directly from the media. If the protein is not secreted, it is isolated from cell lysates or recovered from the cell membrane fraction. The selection of the appropriate growth conditions and recovery methods are within the skill of the art.
An alternative method to identify proteins of the present invention is by constructing gene libraries, using the resulting clones to transform E. coli and pooling and screening individual colonies.
The proteins of the present invention may also be produced by chemical synthesis such as solid phase peptide synthesis on an automated peptide synthesizer, using known amino acid sequences or amino acid sequences derived from the DNA sequence of the genes of interest.
Such methods are known to those skilled in the art.
Another aspect of the invention is antisense oligonucleotides comprising a sequence which is capable of binding to the polynucleotides of the invention. Synthetic oligonucleotides or related antisense chemical structural analogs can be designed to recognize, specifically bind to and prevent transcription of a target nucleic acid encoding protein by those of ordinary skill in the art. See generally, Cohen, J. S., Trends in Pharm. Sci., 10, 435(1989) and Weintraub, H. M., Scientific American, January (1990) at page 40.By "antisense" RNA is meant a complementary RNA sequence that binds to and blocks the transcription of a naturally occurring sense messenger RNA molecule.
By "cosuppression" is meant the phenomenon of native gene silencing as a result of attempting to over-express the same gene, by recombinant DNA, in its original host plant (from which the gene has been isolated). In the case of this invention the myo-inositol 1-phosphate (mips) gene was isolated from Brassica na us and was re-introduced back into B. napus by A~robacterium tumefasciens transformation.
Defining appropriate hybridization conditions is within the skill of the art.
See, e.g., "Current Protocols in Mol. Biol." Vol. I & II, Wiley Interscience. Ausbel et al. (eds.) (1992).
Probing technology is well known in the art and it is appreciated that the size of the probes can vary widely but it is preferred that the probe be at least 15 nucleotides in length. It is also appreciated that such probes can be and are preferably labelled with an analytically detectable reagent to facilitate identification of the probe. Useful reagents include but are not limited to radioisotopes, fluorescent dyes or enzymes capable of catalysing the formation of a detectable product. As a general rule, the more stringent the hybridization conditions the more closely related genes will be that are recovered.
Another aspect of the invention is transgenic, non-Brassica plants capable of expressing the polynucleotides of the invention in any cell. Transgenic, non-Brassica plants may be obtained by transfecting with the polynucleotides of the invention. The resultant transgenic plant may be used as a model for the study of gene function or for producing large amounts of protein for screening or crystallography purposes. Particularly useful transgenic plants are those which display a detectable phenotype associated with the expression of the protein.
Experimental Results a) Cloning of myo-inositol 1-phosphate synthase (MIPS) gene from B. napus:
A cDNA copy of MIPS gene was isolated from B. na us developing seed by the RT-PCR method . RT-PCR was conducted by synthesizing 1 st strand cDNA of MIPS using the 1 st strand cDNA
synthesis kit (Boehringer Mannheim). Briefly, 1 pg of total RNA from B. napus developing seeds was added to 0.5 ml tube containing MIPS-right primer (5' AAAAAATCTAGAGTGAACACTTGTATTCCAAGATCA 3'), lx RT (reverse transcriptase) buffer, the four dNTPs, and water. The mixture was incubated at 25° C
for 10 min and was then placed on ice. Subsequently, 20 U of RT (reverse transcriptase) was added, mixed very well. The reaction was initiated by incubating the tube at 42° C for 60 min.
Finally, heating at 95° C for 10 min inactivated the RT enzyme. The product is the 1 st strand of MIPS gene.
For PCR amplification, 5 ~L of 1 st strand cDNA solution was added to 0.5 ml tube containing lx Vent polymerise buffer, the four dNTPs, the MIPS-left primer (5' AA.AAAACCCGGGATGATCGAGAGCTTCAAAGTC 3'), the right primer, and water. The reaction was initiated by addition of 1 U of Vent DNA polymerase, mixed very well and placed in a DNA thermal cycler (Perkin Elmer Cetus). Heating at 94° C for 2 min followed by 35 cycle each of which includes heating at 94° C for 1 min, annealing at 52° C for 1 min and extension at 72° C for 3 min.
The left and right primer (containingXbaland Smal site respectively) were synthesized according to the published MIPS DNA sequence of Arabidopsis thaliana (GenBank accession number U04876).
At the end of the PCR run, 5 ~L of the reaction solution was loaded on 1.2%
Agarose gel. The PCR product was purified by PCR purification kit (Promaga) and was then digested with bothXbal and Smal. The digested DNA was loaded on gel and the 1.7 Kb fragment was eluted and purified.
The purified fragment was then cloned into pSPORTl (GIBGOBRL) pre-cut with bothXbal and Smal. The clone containing the insert was subjected to full length DNA
sequencing.
Total RNA was extracted from plant tissue by using RNeasy plant total RNA kit (Qiagen).
b) DNA sequence analysis DNA sequencing was performed by the DNA Services Lab at PBI using ABI Prism Dye Terminator cycle sequencing ready reaction kit with AmpliTaq DNA polymerase and following the company's protocol (Perkin Elmer).
These primers as well as those for sequencing were synthesized in an Applied Biosystems DNA synthesizer.
c) Cloning of MIPS gene in pBI121 The MIPS cDNA was cloned under CamV35S or B. napus napin promoters in both orientations ( sense or anti-sense) in the plant vector pBI121 (from Clontech). The constructs were transferred into A~robacterium tumefaciens strain CV3101: pMP90RK by electroporation. The transformants were grown on kanamycin-containing plates and then screened by PCR
analysis for the presence of the construct. The positive transformants were used for Brassica napus transformation. Plant transformation was conducted according to Maloney et a1,1989 Maloney ,N.M., Walker, J M., and Sharma,K.K. 1989, Plant Cell Reports 8, 238) d) Isolation of the MIPS genomic promoter The genomic MIPS promoter was isolated from B. napes by PCR with a primer designed to read beyond the 5' end of the MIPS gene. The DNA sequence of this promoter probably extends much beyond the promoter itself. This promoter would be useful for targeting the expression of foreign genes to the same location and at the same time (spatial-and temporal-mode of expression). In this way more precise deactivation of MIPS gene can be achieved.
Also, it can be used in any experiments where the desired trait must accompany the expression of the native MIPS gene. The sequence including the MIPS promoter(3795 bp) from B.napus that we cloned is shown in SEQ ID NO:S.
e) Plant materials:
Brassica napes, Var. Westar, the control and transgenic , plants were grown in a growth chamber under a l6hr. light cycle at 20°C, followed by 8hr. darlrness at 15°C. Phytate levels were measured and compared for control and transgenic plants. Reductions of 30% to 50% in phytate levels were found.

SEQUENCE LISTING
<110> Georges, Fawzy Hussain, Atta A
$ Keller, Wilfred A
<120> Method for Reducing Phytate in Canola Meal Using Genetic Manipulation Involving myo-Inositol 1-Phosphate Synthase Gene <130> Method for reducing phytate in canola <140> unknown <141> 2000-05-25 1$
<150> US 60/136,204 <151> 1999-05-26 <160> 4 <170> PatentIn Ver. 2.1 <210> 1 <211> 1781 2$ <212> DNA
<213> Brassica napus <400> 1 aaaccacaca aactcgattc aattaaaaac cgagaaaaca aaagtctgtt taaaagatgt 60 tcatcgagag cttcaaagtc gagagcccga acgtgaagta cacggagaat gagattcatt 120 cggtgtacga ttacgagacc acggaggtcg ttcacgagaa cgtcaacggt gcttaccagt 180 3$ ggatcgtgaa gcccaaggtt gtcaaatacg atttcaaaac cgacactcgt gtccccaaat 240 taggggttat gcttgttggt tggggaggaa acaatggatc aaccctcacc gctggtgtaa 300 SUBSTITUTE SHEET (RULE 26) ttgccaataa agaaggaatc tcgtgggcga ccaaggacaa ggtgcaacaa gcgaactact 360 tcgggtcgtt aacacaagca tcgtctattc gtgtcggatc ctttaacggt gaagagatgt 420 S
atgccccttt caagagtctc gttccaatgg tgaatccgga tgatgttgtg tttggaggat 480 gggacataag cgatatgaat ttagcagacg cgatgggtag agccaaggtt cttgacattg 540 atctgcagaa acagctcagg ccttacatgg agaacattgt cccactccct gggatctacg 600 accctgattt catcgctgcc aatcaaggct cacgtgccaa caacgtgatc aaaggtacca 660 agaaggaaca agtcgaccaa atcatcaagg acatgaggga gtttaaggag aagaacaagg 720 tggataaggt tgtggttctg tggacggcta acacagagcg ttacagcaat gtgatcgtgg 780 ggctaaacga cactatggag aatcttatga actctgtgga tagggatgag tctgagatct 840 ctccttccac gctttatgct attgcatgtg ttcttgaagg tattcctttc atcaatggaa 900 gccctcagaa cacctttgtt ccgggtctta ttgatttggc tatcaagaac aatgttttga 960 tcggtggaga tgacttcaag agtggtcaaa ccaagatgaa atctgtcttg gttgatttcc 1020 ttgttggtgc aggcatcaag cctacttcaa ttgtgagcta caatcaccta gggaacaacg 1080 atggaatgaa cctctcagct ccacagacat tcagatctaa ggagatctcc aaaagtaatg 1140 tggttgacga tatggttgct agcaacggta tcctcttcga gcccggggaa catccagacc 1200 atgtagttgt catcaagtat gtaccgtatg ttgcagatag caagcgagcc atggatgagt 1260 atacatcaga gatattcatg ggaggcaaga acacaattgt gatgcacaat acctgcgagg 1320 actctctctt agctgctcca atcatcttgg atcttgttct cctcgctgaa atcagcacca 1380 SUBSTITUTE SHEET (RULE 26) ggattcagtt caaatccgag aaagagggga agtttcattc tttccatcct gtggccacca 1440 aacttagcta tctcaccaag gcaccgctcg tgccgccggg aacaccggtg gttaatgcgc 1500 tgtcgaagca gcgggctatg ctggagaata ttcttagggc gtgtgttggg ctggcgccgg 1560 agaacaatat gatcttggaa tacaagtgaa cacgaagcgt ttaagagtct ttaattagcc 1620 ccaaatataa gacttctgtt tcttgttttt ttttaataaa tgttttaaaa tatgaatgct 1680 tgtgttttca gagatcaaag agcttttaga ttgatctttg tagggtgtga agttaccggt 1740 gtttctagta atccagatgg gctagtataa aaaaaaaaaa a 1781 1$ <210> 2 <211> 510 <212> PRT
<213> Brassica napus <400> 2 Met Phe Ile Glu Ser Phe Lys Val Glu Ser Pro Asn Val Lys Tyr Thr Glu Asn Glu Ile His Ser Val Tyr Asp Tyr Glu Thr Thr Glu Val Val 2$ 20 25 30 His Glu Asn Val Asn Gly Ala Tyr Gln Trp Ile Val Lys Pro Lys Val Val Lys Tyr Asp Phe Lys Thr Asp Thr Arg Val Pro Lys Leu Gly Val Met Leu Val Gly Trp Gly Gly Asn Asn Gly Ser Thr Leu Thr Ala Gly Val Ile Ala Asn Lys Glu Gly Ile Ser Trp Ala Thr Lys Asp Lys Val SUBSTITUTE SHEET (RULE 26) Gln Gln Ala Asn Tyr Phe Gly Ser Leu Thr Gln Ala Ser Ser Ile Arg Val Gly Ser Phe Asn Gly Glu Glu Met Tyr Ala Pro Phe Lys Ser Leu Val Pro Met Val Asn Pro Asp Asp Val Val Phe Gly Gly Trp Asp Ile Ser Asp Met Asn Leu Ala Asp Ala Met Gly Arg Ala Lys Val Leu Asp Ile Asp Leu Gln Lys Gln Leu Arg Pro Tyr Met Glu Asn Ile Val Pro Leu Pro Gly Ile Tyr Asp Pro Asp Phe Ile Ala Ala Asn Gln Gly Ser Arg Ala Asn Asn Val Ile Lys Gly Thr Lys Lys Glu Gln Val Asp Gln Ile Ile Lys Asp Met Arg Glu Phe Lys Glu Lys Asn Lys Val Asp Lys 2$ Val Val Val Leu Trp Thr Ala Asn Thr Glu Arg Tyr Ser Asn Val Ile Val Gly Leu Asn Asp Thr Met Glu Asn Leu Met Asn Ser Val Asp Arg Asp Glu Ser Glu Ile Ser Pro Ser Thr Leu Tyr Ala Ile Ala Cys Val Leu Glu Gly Ile Pro Phe Ile Asn Gly Ser Pro Gln Asn Thr Phe Val 3$ 275 280 285 SUBSTITUTE SHEET (RULE 26) $/10 Pro Gly Leu Ile Asp Leu Ala Ile Lys Asn Asn Val Leu Ile Gly Gly Asp Asp Phe Lys Ser Gly Gln Thr Lys Met Lys Ser Val Leu Val Asp $ 305 310 315 320 Phe Leu Val Gly Ala Gly Ile Lys Pro Thr Ser Ile Val Ser Tyr Asn His Leu Gly Asn Asn Asp Gly Met Asn Leu Ser Ala Pro Gln Thr Phe Arg Ser Lys Glu Ile Ser Lys Ser Asn Val Val Asp Asp Met Val Ala 1$
Ser Asn Gly Ile Leu Phe Glu Pro Gly Glu His Pro Asp His Val Val Val Ile Lys Tyr Val Pro Tyr Val Ala Asp Ser Lys Arg Ala Met Asp Glu Tyr Thr Ser Glu Ile Phe Met Gly Gly Lys Asn Thr Ile Val Met 2$ His Asn Thr Cys Glu Asp Ser Leu Leu Ala Ala Pro Ile Ile Leu Asp Leu Val Leu Leu Ala Glu Ile Ser Thr Arg Ile Gln Phe Lys Ser Glu Lys Glu Gly Lys Phe His Ser Phe His Pro Val Ala Thr Lys Leu Ser Tyr Leu Thr Lys Ala Pro Leu Val Pro Pro Gly Thr Pro Val Val Asn 3$ 465 470 475 480 SUBSTITUTE SHEET (RULE 26) Ala Leu Ser Lys Gln Arg Ala Met Leu Glu Asn Ile Leu Arg Ala Cys Val Gly Leu Ala Pro Glu Asn Asn Met Ile Leu Glu Tyr Lys <210> 3 <211> 36 <212> DNA
<213> Brassica napus <400> 3 aaaaaatcta gagtgaacac ttgtattcca agatca 36 <210> 4 <211> 33 <212> DNA
<213> Brassica napus <400> 4 aaaaaacccg ggatgatcga gagcttcaaa gtc 33 <210> 5 <211> 3795 <212> DNA
<213> Brassica napus <400> 5 taaattctag aacccacccc aaaaccaaaa aaaaactgga ccaaatgtga tgctataagc 60 ctactttaga tgcggaaaat tatggtcctt tacaaagatt tacctccttt agttgggata 120 tatgtggttt atagacgact taagatataa gcagtgtttt catacacgat ttaacccgca 180 SUBSTITUTE SHEET (RULE 26) gtcgaaacgg taaatttggt aaccatatat aatatggttt cgatttaatg aaaaaactca 240 ttaactaaaa atgcaataaa acctaaaaac ccgcaattaa cccgtgaacc gacacatgtt 300 S
gatccagtaa aatcccagaa aaatgtgatt aaacttttca tatacttttt attagtataa 360 aaaattaaat aaactatttg atttgtcata taaagtaaat acattgtatt tatgttatgc 420 attttagttt atgagttttg taatgatcat attaaagtta catttgtgag ttttgaaatt 480 aatatgagat tttaataatt ttagttatat tattataata taactatgta aatagatgaa 540 atctcttttt ttaagtgaaa taggattctc ttacactctc agattttatg taaatatata 600 tatatatata tatatacact aacgtgtgtt gtgcactatt agtctattat aaatgtattt 660 gttaatgtca catactgaag gttagccaaa taaaaatgtc acacggttaa accattttgt 720 aacggttcct cgtttttaat gaataattat atatatgtca taagaatcaa accaatcggt 780 aatgttttgt ttgaattaat tgtaggacca aaataataac taatagtaat aaataggcca 840 aataattttt tgaagtagat ttattaaaac tccttccctt ttaatagtat tgatttctta 900 aatatggaaa ataagtatac ctcgaaatca tcggaaattt tattaaattt atgaatagta 960 gcatcaatta attaaaggat ttataacact gtacgaatct accagtatct ccggataata 1020 catagaaacg tccacgaaga aaccttttat aaaggttgga aaagatttag aaccatttat 1080 gcgttaatta cttgatttaa tccgtttctg aacacttttc acacagacta aaaaaagagc 1140 agaaatatac ggtaagttgt tattaaatta tatttttctg accaaaagta ttttagataa 1200 ataaaattat ttataaaatc aatgcagttt acaataaatt ttcagttgaa agtaagtata 1260 SUBSTITUTE SHEET (RULE 26) atttgcattg aaattgtaaa ttgacatttt ttgtgtaaca aaaaaaaaag caagaataat 1320 cacttgtcat agaacagtgg gagtatgata aaaactaatt ataaatgttc agacatatgt 1380 aagcttgtag attcaagtat ggtatagagc tcgacttcgg tcgtctcgag ctcgaactcg 1440 ccaaggtcga gatgcccgga ctcatggctt gccgtaccga gttcggccca tctcagccct 1500 tcaaaggcga tagaatcacc ggatctctcc acatgaccat ccaaaccgac gtcctcatcg 1560 agaccctaac cgccctcggc gctgaagtca gatggtgctc ctgcaacatc gtctacagaa 1620 gaagcctcct ccgattgtcg tgattcgctc aagtaaaagg agaaagcagc ggagagagga 1680 agagggtcgg accataaccc taattcccaa aatcacgagt cgattcgagg gtctggtggc 1740 gatgggtcgt cgaggtcggt ttcggttgcg gagagtgtcg tgtttggtaa agagaaggac 1800 tttaacggtg gaatgaacag agagctcgat ggcagtgaaa gcgtggtttc gttagtgcct 1860 tgtcgaagct ctggattgga gccatcatcc aaggtggttt cctcgcttgg agggacgacg 1920 cgctcgcgtg gaggccgtgg cgtgagaaga tcggattgca tgttcgagtt gtggttccgg 1980 2$ gagatggagg ctaccacaga tctgtcgtcg ccggcttttc tccggggggt ggaggctcct 2040 tcagctccgc cgacgccggt tcaagttccc gggaaaggga gtcttcctta gatttacctt 2100 cgcccggttt ggtgaacgga attgccggat gctttcatag atccgcgctg ccgatgagaa 2160 acccgaagct tttgggttaa ggttactatt gttcgtttag tgcgaaacta gaagtggtta 2220 ctgtctaggt ggttctgggt cagggcggag gagttctcgg tttgatgatg aagctctctg 2280 ctgaggtgaa gttggtcaag tcaacaatta ggtgattatc gatacgcacg tctagggttt 2340 taagcggttc aaaggcggag atgatctcgt gtttcgattg atctcttccg cgtgttgaca 2400 SUBSTITUTE SHEET (RULE 26) gtgcgggtag tggttggaag tttggttgtg tcgggggata tctcgatggt ttgagaaaga 2460 cctccgacat gatgtaaaag caaggaaaat agtctccggg gtgtgaaggt ggtcatgtgc 2520 cttaagccgc cggcaagtgg tttcctattt ccttttctat gtatttttta aggcttccaa 2580 tcttagtttc ttgcgtttaa gtcaagttgg ggttcgggtt tgttggataa agtttcttcg 2640 tcgtaggacg atggaagcta tccggagtaa aggttgttgc ttgagcgaag cctcctcctt 2700 tggtcctcgt attgaattct ggcggatgag atctcggtat cgattgattc tctctgacat 2760 taggcggtcc tgggaggttt ggcgttcgtg gtgaaaaagg tgaggagtct atgggctccg 2820 1$
gtgaagcgta gtgaatcgat aggcgattct aaggtggttg ttgagttggt gcggttcgcg 2880 tgaaggcggc cgacatcacc ctttctctct tgggccggtg tagccttgtc ggcttacggt 2940 ttcgtttgtt tttgtttggt tgcccgttta gtgttgtggg cttttgtatt tgggcttcgg 3000 ccattgggct tggcccgtaa cttttaataa aataataact tgacggaaaa aaaaaaaaaa 3060 aaagcttgta gattcataat tcacgtgtca aagcaagtca acaagactcc acgggaccca 3120 actcaacgaa gacaaagagt caaaaaaacg gtcagacatt gttttcaaac gaccgttaat 3180 tagccacgtt agttactaca cgctccatct ctggaacgtg acatccaccc agaatatgtg 3240 gcagctaaat gtggtgtgtg tttacttcac tctcgttttt ttcgtaactg agaaacaact 3300 gtcgctaact aactgtaacg gagacaatgt ccgaaacact gtcgttttac tgattgagta 3360 acggaagtaa ctaacgtccc ccaccttgtt cgagcacctt caacaaaaaa atgtgggtcc 3420 gagaagacaa tccgacaaaa ctttgctatt gaaaaaacga cgccacgtgt atggtccagg 3480 SUBSTITUTE SHEET (RULE 26) gctccgacgt gtcacacttt ttctctccgc gcctctcacg tgcgagaccc ctccctcaca 3540 cgtatgattc actattagcc atcaacgaag tcgctcacat gcattggcta aagagggtcc 3600 accaaccact gagaccacgc cacgtgtctc ctctccctcg cgctcttttt ctataaatag 3660 cgctccattt aagagaagct caaacccaca caaactcgat tcaattaaaa accgagaaaa 3720 caaaagtctg tttaaaagat gttcatcgag agcttcaaag tcgagagccc gaacgtgaag 3780 tacacggaga atgag 3795 SUBSTITUTE SHEET (RULE 26)

Claims (13)

We claim:

1. A nucleotide sequence of SEQ ID NO 1 or an allelic variant or a fragment.
thereof or a genetic equivalent thereof according to the degeneracy of the genetic code coding for a peptide having a Brassica myo-inositol 1-phosphate synthase activity.

2. A nucleotide sequence, variant or fragment according to claim 1 in combination with a promoter sequence in reading frame alignment therewith.

3. A nucleotide sequence, variant or fragment according to claim 1 in combination with a promoter sequence in antisense reading frame alignment therewith.

4. A myo-inositol 1-phosphate synthase-active peptide sequence encoded by the nucleotide sequence of claim 1.

5. A cell transformed with a nucleotide according to claim 1.

6. A Brassica cell transformed with a nucleotide according to claim 1.

7. A plant, multicellular fragment of said plant or seed of said plant transformed with a nucleotide according to claim 1, said plant, multicellular fragment or seed having reduced myo-inositol 1-phosphate synthase activity when compared with an equivalent untransformed plant, multicellular fragment or seed, such that there is reduced phytate present in the plant, multicellular fragment or seed.

8. A multicellular fragment according to claim 7 in the form of seed meal.

9. A Brassica napus myo-inositol 1-phosphate synthase promoter sequence.

10. A method for reducing phytate in Brassica, which method comprises growing a Brassica plant comprising at least one of a myo-inositol 1-phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase cosuppression sequence thereby yielding a reduced amount of myo-inositol 1-phosphate synthase and consequently reduced phytate in said Brassica.

11. A method according to claim 10 wherein said Brassica is Brassica napus.

12. A method according to claim 10 wherein said Brassica comprises a myo-inositol 1-phosphate synthase antisense sequence.

13. A method according to claim 10 wherein said Brassica comprises a myo-inositol 1-phosphate synthase cosuppression sequence.