Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
  • C12N9/0083—Miscellaneous (1.14.99)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
  • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
  • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
  • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
  • C12N15/8255—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/1048—Glycosyltransferases (2.4)
  • C12N9/1051—Hexosyltransferases (2.4.1)

Definitions

• the present invention concerns compositions and methods for the modulation of gene expression in plants, specifically using enzymatic nucleic acid molecules
• Naturally occurring antisense RNA was first discovered in bacteria over a decade ago (Simons and Kleckner, 1983 Cell 34, 683-691). It is thought to be one way in which bacteria can regulate their gene expression (Green et al., 1986 Ann Rev Biochem 55: 567- 597; Simons 1988 Gene 72: 35-44) The first demonstration of antisense-mediated inhibition of gene expression was repo ⁇ ed m mammalian cells (Izant and Wemtraub 1984 Cell 36: 1007-1015). There are many examples m the literature for the use of antisense RNA to modulate gene expression in plants. Following are a few examples Shewmaker et al , U.S. Patent Nos. 5, 107.065 and 5. 453.566 disclose methods for regulating gene expression in plants using antisense RNA
• Transgenic potato plants have been produced which express RN ⁇ antisense to potato or cassava granule bound starch syntha.sc (GBSS)
• GBSS cassava granule bound starch syntha.sc
• transgenic plants have been constructed which have reduced oi no GBSS activity or protein. These transgenic plants give rise to potatoes containing starch with dramatically reduced amylose levels (Visser et al. 1991 , Mol. Gen Genet. 225. 2889-296, Salehuzzaman et al. 1993, Plant Mol. Biol. 23: 947-962)
• Antisense RNA constructs targeted against ⁇ -9 desaturase enzyme in canola have been shown to increase the level of stearic acid (C18:0) from 2% to 40% (Knutzon et. al., 1992 Proc. Natl. Acad. Sci. 89, 2624). There was no decrease in total oil content or germinanon efficiency in one of the high stearate lines.
• Several recent reviews are available which illustrate the utility of plants with modified oil composition (Ohlrogge, J. B. 1994 Plant Physiol. 104, 821; Kmney, A. J. 1994 Cwrr. Opin. Cell Biol. 5, 144; Gibson et al. 1994 Plant Cell Envir. 17, 627).
• Hitz et al, (WO 91/18985) describe a method for using the soybean ⁇ -9 dcsat-irasc enzyme to modify plant oil composition.
• the application describes the use of soybean ⁇ -9 desaturase sequence to isolate ⁇ -9 desaturasc genes from other species.
• references cited above are distinct from the presently claimed invention since they do not disclose and/or contemplate the use of ribozymes in maize. Furthermore, Applicant believes that the references do not disclose and/or enable the use of ribozymes to down regulate genes in plant ceils, let alone plants.
• the invention features modulation of gene expression in plants specifically using enzymatic nucleic acid molecules.
• the gene is an endogenous gene.
• the enzymatic nucleic acid molecule with RNA cleaving activity may be in the form of, but not limited to, a hammerhead, hai ⁇ in, hepatitis delta virus, group I intron, group II intron, RNaseP RNA, Neurospora VS RNA and the like.
• the enzymatic nucleic acid molecule with RNA cleaving activity may be encoded as a monomer or a multimcr, preferably a multimer.
• the nucleic acids encoding for the enzymatic nucleic acid molecule with RNA cleaving activity may be operably linked to an open reading frame.
• Gene expression in any plant species may be modified by transformation of the plant with the nucleic acid encoding the enzymatic nucleic acid molecules with RNA cleaving activity.
• technologies for transforming a plant include but are not limited to transformation with Agrobacterium, bombarding with DNA coated microprojectiles, whiskers, or electroporation.
• Any target gene may be modified with the nucleic acids encoding the enzymatic nucleic acid molecules with RNA cleaving activity.
• Two targets which are exemplified herein are delta 9 desaturase and granule bound starch synthase (GBSS).
• nucleic acid-based reagents such as enzymatic nucleic acids (ribozymes)
• Ribozymes can be used to modulate a specific trait of a plant cell, for example, by modulating the activity of an enzyme involved in a biochemical pathway. It may be desirable, in some instances, to Robinson,,93 alone,,. > PCT US96/11689 97/10328
• ribozymes can be used to achieve this Enzymatic nucleic acid-based techniques were developed herein to allow directed modulation of gene expression to generate plant cells, plant tissues or plants with altered phenotype.
• Ribozymes i.e., enzymatic nucleic acids
• enzymatic nucleic acids arc nucleic acid molecules having an enzymatic activity which is able to repeatedly cleave other separate RN ⁇ molecules in a nucleotide base sequence-specific manner.
• Such enzymatic RN ⁇ molecules can be targeted to virtually any RNA transcript, and efficient cleavage has been achieved in vitro and in vivo (Zaug et ⁇ l, 1986, Nature 324, 429; Kim et al., 1987, Proc. Natl Acad. Set USA 84, 8788; Dreyfus, 1988, Einstein Quarterly J.
• tr ⁇ /w-cleavmg ribozymes may be used as efficient tools to modulate gene expression in a variety of organisms including plants, animals and humans (Bennett et al, supra; Edington et al, supra; Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med Chem. 38, 2023-2037).
• Ribozymes can be designed to cleave specific R ⁇ A targets within the background of cellular R ⁇ A. Such a cleavage event renders the mR ⁇ A non-functional and abrogates protein expression from that R ⁇ A. In this manner, synthesis of a protein associated with a particular phenotype and/or disease state can be selectively inhibited.
• Figure 1 is a diagrammatic representation of the hammerhead ribozyme domain known in the art.
• Stem II can be > 2 base-pairs long.
• Each ⁇ is any nucleotide and each • represents a base pair.
• Figure 2a is a diagrammatic representation of the hammerhead ribozyme domain known the art
• Figure 2b is a diagrammatic representation of the hammerhead ribozyme as divided by Uhlenbeck (1987, Nature, 327, 596-600) into a substrate and enzyme portion
• Figure 2c is a similar diagram showing the hammerhead divided by Haseloff and Gerlach (1988, Nature, 334, 585-591) into two portions
• Figure 2d is a similar diagram showing the hammerhead divided by Jeffries and Symons (1989, Nucl. Acids Res., 17, 1371-1371) into two portions.
• FIG 3 is a diagrammatic representation of the general structure of a hairpin ribozyme.
• Helix 2 (H2) is provided with a least 4 base pairs (i.e., n is I , 2, 3 or 4) and helix 5 can be optionally provided of length 2 or more bases (preferably 3 - 20 bases, i. ., m is from 1 - 20 or more).
• Helix 2 and helix 5 may be covalently linked by one or more bases (i.e., r is > 1 base).
• Helix 1, 4 or 5 may also be extended by 2 or more base pairs (e.g., 4 - 20 base pairs) to stabilize the ribozyme structure, and preferably is a protein binding site.
• each N and N' independently is any no ⁇ nal or modified base and each dash represents a potential base-pairing interaction.
• These nucleotides may be modified at the sugar, base or phosphate.
• Complete base-pairing is not required in the helices, but is preferred.
• Helix 1 and 4 can be of any size (i.e.. o and p is each independently from 0 to any number, e.g., 20) as long as some base-pairing is maintained.
• Essential bases are shown as specific bases in the structure, but those in the art will recognize that one or more may be modified chemically (abasic, base, sugar and/or phosphate modifications) or replaced with another base without significant effect.
• Helix 4 can be formed from two separate molecules, i.e., without a connecting loop.
• the connecting loop when present may be a ribonucleotidc with or without modifications to its base, sugar or phosphate, "q" is > 2 bases.
• the connecting loop can also be replaced with a non-nucleotide linker molecule.
• H refers to bases A, U, or C.
• Y refers to pyrimidine bases.
• " " refers to a covalent bond.
• Figure 4 is a representation of the general structure of the hepatitis ⁇ virus ribozyme domain known in the art.
• Figure 5 is a representation of the general structure of the self-cleaving VS RNA ribozyme domain.
• Figure 6 is a schematic representation of an RNaseH accessibility assay. Specifically, the left side of Figure 6 is a diagram of complementary DNA oligonucleotides bound to accessible sites on the target RNA. Complementary DNA oligonucleotides are represented by broad lines labeled A, B, and C. Target RNA is represented by the thin, twisted line. The right side of Figure 6 is a schematic of a gel separation of uncut target RNA from a cleaved target RNA. Detection of target RNA is by autoradiography of body-labeled, T7 transcript. The bands common to each lane 97/10328
• Figure 7 is a graphical representation of RNaseH accessibility of GBSS RNA
• Figure 8 is a graphical representation of GBSS RN ⁇ cleavage by nbo/ymes at different temperatures.
• Figure 9 is a graphical representation of GBSS RNA cleavage by multiple ribozymes.
• Figure 10 lists the nucleotide sequence of ⁇ -9 desaturase cDN ⁇ isolated from 7.eu mays.
• Figures 1 1 and 12 are diagrammanc representations of fatty acid biosynthesis in plants.
• Figure 1 1 has been adapted from Gibson et al, 1994, Plant Cell Envir. 17, 627.
• Figures 13 and 14 are graphical representations of RNaseH accessibility of ⁇ -9 desaturase RNA.
• Figure 15 shows cleavage of ⁇ -9 desaturase RNA by ribozymes in vitro.
• 10/10 represents the length of the binding arms of a hammerhead (HH) ribozyme.
• 10/10 means helix 1 and helix 3 each form 10 base-pairs with the target RNA (Fig. 1).
• 4/6 and 6/6 represent helix2/helixl interaction between a hai ⁇ in ribozyme and its target.
• 4/6 means the hai ⁇ in (HP) ribozyme forms four base-paired helix 2 and a six base-paired helix 1 complex with the target (see Fig. 3).
• 6/6 means, the hai ⁇ in ribozyme forms a 6 base- paired helix 2 and a six base-paired helix 1 complex with the target.
• the cleavage reactions were earned out for 120 mm at 26°C.
• Figure 16 shows the effect of arm-length variation on the activity of HH and HP ribozymes in vitro. Ill, 10/10 and 12/12 are essentially as described above for the HH ribozyme. 6/6, 6/8, 6/12 represents varying helix 1 length and a constant (6 bp) helix 2 for a hai ⁇ in ribozyme. The cleavage reactions were earned out essentially as desc ⁇ bed above.
• Figures 17, 18, 19 and 23 are diagrammatic representations of non-limiting strategies to construct a transcript comprising multiple ribozyme motifs that are the same or different, targeting various sites within ⁇ -9 desaturase RNA.
• Figures 20 and 21 show in vitro cleavage of ⁇ -9 desaturase RNA by ribozymes that are transcribed from DNA templates using bacte ⁇ ophage T7 RNA polymerase enzyme
• Figure 22 diagrammatic representation of a non-limiting strategy to construct a transcript compnsing multiple ribozyme motifs that arc the same or different targeting various sites within GBSS RNA
• Figure 24 shows cleavage of ⁇ -9 desaturase RN ⁇ by ribozymes 453 Multimer, represents a multimer ribozyme construct targeted against hammerhead ⁇ bozyme sites 453, 464, 475 and 484.
• 252 Multimer represents a multimer ribozyme construct targeted against hammerhead ribozyme sites 252, 271 , 313 and 326 238 Multimer, represents a multimer ribozyme construct targeted against three hammerhead ⁇ bozyme sites 252, 259 and 271 and one hai ⁇ in ribozyme site 238 (HP).
• 259 Multimer represents a multimer ⁇ bozyme construct targeted against two hammerhead ribozyme sites 271 and 313 and one hai ⁇ in ⁇ bozyme site 259 (HP)
• Figure 25 illustrates GBSS mRNA levels in Ribozyme minus Controls (C, F, I, J, N, P, Q) and Active Ribozyme RPA63 Transformants (AA, DD, EE, FF, GG, HH, JJ, KK).
• Figure 26 illustrates ⁇ 9 desaturase mRNA levels in Non-transformed plants (NT), 85-06 High Stearate Plants (1, 3, 5, 8, 12, 14), and Transformed (irrelevant ribozyme) Control Plants (RPA63-33, RPA63-51, RPA63-65).
• Figure 27 illustrates ⁇ 9 desaturase mRNA levels in Non-transformed plants
• NTO 85-15 High Stearate Plants
• 02, 05, 09, 14 85-15 Normal Stearate Plants
• Figure 28 illustrates ⁇ 9 desaturase mRNA levels in Non-transformed plants (NTY), 113-06 Inactive Ribozyme Plants (02, 04, 07, 10,11).
• Figures 29a and 29b illustrate ⁇ 9 desaturase protein levels in maize leaves (R0) (a)
• Figure 30 illustrates stea ⁇ c acid in leaves of RPA85-06 plants
• Figure 31 illustrates stea ⁇ c acid in leaves of RPA85-15 plants, results of three assays.
• Figure 32 illustrates stearic acid in leaves of RPA 1 13-06 plants.
• Figure 33 illustrates stearic acid in leaves of RPA1 13-17 plants.
• Figure 34 illustrates stearic acid in leaves of control plants.
• Figure 35 illustrates leaf stearate in RI plants from a high stearate plant cross (RPA85- 15.07 self).
• Figure 36 illustrates ⁇ 9 desaturase levels in next generation maize leaves (RI ). * indicates those plants that showed a high stearate content.
• Figure 37 illustrates stearic acid in individual somatic embryos from a culture (308/430-012) transformed with antisense ⁇ 9 desaturase.
• Figure 38 illustrates stearic acid in individual somatic embryos from a culture
• Figure 39 illustrates stearic acid in individual leaves from plants regenerated from a culture (308/430-012) transformed with antisense ⁇ 9 desaturase.
• Figure 40 illustrates amylose content in a single kernel of untransformed control line (Q806 and antisense line 308/425- 12.2.1.
• Figure 41 illustrates GBSS activity in single kernels of a southern negative line (RPA63-0306) and Southern positive line RPA63-0218.
• Figure 42 illustrates a transformation vector that can be used to express the enzymatic nucleic acid of the present invention.
• the present invention concerns compositions and methods for the modulation of gene expression in plants specifically using enzymatic nucleic acid molecules.
• inhibitor or “modulate” is meant that the activity of enzymes such as GBSS and ⁇ -9 desaturase or level of mRNAs encoded by these genes is reduced below that observed in the absence of an enzymatic nucleic acid and preferably is below that level observed in the presence of an inactive RNA molecule able to bind to the same site on the mRNA, but unable to cleave that RNA.
• enzymatic nucleic acid molecule it is meant a nucleic acid molecule which has complementarity in a substrate binding region to a specified gene target, and also has an enzymatic activity which is active to specifically cleave that target That is, the enzymatic nucleic acid molecule is able to mtcrmolccularly cleave RN ⁇ (or DN ⁇ ) and thereby inactivate a target RNA molecule.
• nucleic acids may be modified at the base, sugar, and/or phosphate groups.
• enzymatic nucleic acid is used interchangeably with phrases such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, nucleozyme, DNAzyme, RNA enzyme, RNAzyme, poly ⁇ bozymes, molecular scissors, self-splicing RNA, self-cleaving RNA, cis-cleaving RNA, autolytic RNA, endoribonuclease, minizyme, leadzyme or DNA enzyme. All of these terminologies desc ⁇ be nucleic acid molecules with enzymatic activity.
• the term encompasses enzymatic RNA molecule which include one or more ribonucleotides and may include a majority of other types of nucleotides or abasic moieties, as desc ⁇ bed below.
• complementa ⁇ ty is meant a nucleic acid that can form hydrogen bond(s) with other RNA sequences by either traditional Watson-Crick or other non-traditional types (for example, Hoogsteen type) of base-paired interactions.
• vectors any nucleic acid- and/or viral-based technique used to deliver and/or express a desired nucleic acid.
• RNA RNA
• plant gene is meant a gene encoded by a plant.
• endogenous gene is meant a gene normally found in a plant cell in its natural location in the genome.
• nucleic acid is meant a molecule which can be single-stranded or double- stranded, composed of nucleotides containing a sugar, a phosphate and either a purine or pyrimidine base which may be same or different, and may be modified or unmodified.
• genomic is meant genetic material contained in each cell of an organism and/or a virus.
• RNA that can be translated into protein by a cell.
• cDNA is meant DN ⁇ that is complementary to and derived from a mRNA.
• dsDNA is meant a double stranded cDNA.
• RNA By “sense” RNA is meant RN ⁇ transcript that comprises the mRNA sequence.
• antisense RNA an RNA transcript that comprises sequences complementary to all or part of a target RNA and/or mRNA and that blocks the expression of a target gene by interfering with the processing, transport and/or translation of its primary transcript and/or mRNA.
• the complementarity may exist with any part of the target RNA, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
• Antisense RNA is normally a mirror image of the sense RNA.
• expression is meant the transcription and stable accumulation of the enzymatic nucleic acid molecules, mRNA and/or the antisense RNA inside a plant cell. Expression of genes involves transcription of the gene and translation of the mRNA into precursor or mature proteins.
• cosuppression is meant the expression of a foreign gene, which has substantial homology to an gene, and in a plant cell causes the reduction in activity of the foreign and/or the endogenous protein product.
• altered levels is meant the level of production of a gene product in a transgenic organism is different from that of a normal or non-transgenic organism.
• promoter nucleotide sequence element within a gene which controls the expression of that gene. Promoter sequence provides the recognition for RNA polymerase and other transcription factors required for efficient transcription. Promoters from a variety of sources can be used efficiently in plant cells to express ribozymes. For example, promoters of bacterial origin, such as the octopine synthetase promoter, the walnut, chalk, chalk, chalk, chalk, chalk, chalk, chalk, chalk, the like.
• nopaline synthase promoter the manopme synthetase promoter, promoters of viral o ⁇ gin, such as the cauliflower mosaic virus (35S); plant promoters, such as the ⁇ bulose- 1,6-biphosphate (RUBP) carboxylase small subunit (ssu), the beta-conglycinin promoter, the phaseolm promoter, the ADH promoter, heat-shock promoters, and tissue specific promoters.
• Promoter may also contain certain enhancer sequence elements that may improve the transcription efficiency.
• enhancer nucleotide sequence element which can stimulate promoter activity (Adh).
• constitutive promoter is meant promoter element that directs continuous gene expression in all cells types and at all times (actin, ubiquitin, CaMV 35S).
• tissue-specific promoter is meant promoter element responsible for gene expression in specific cell or tissue types, such as the leaves or seeds (zein, oleosin, napm, ACP).
• development-specific promoter is meant promoter element responsible for gene expression at specific plant developmental stage, such as in early or late embryogenesis.
• inducible promoter is meant promoter element which is responsible for expression of genes in response to a specific signal, such as: physical stimulus (heat shock genes); light (RUBP carboxylase); hormone (Em); metabolites; and stress.
• a “plant” is meant a photosynthetic organism, either eukaryotic and prokaryotic.
• angiosperm is meant a plant having its seed enclosed in an ovary (e.g., coffee, tobacco, bean, pea).
• gymnosperm is meant a plant having its seed exposed and not enclosed in an ovary (e.g., pine, spruce).
• seed leaf By “monocotyledon” is meant a plant characterized by the presence of only one seed leaf (primary leaf of the embryo). For example, maize, wheat, rice and others.
• cotyledon is meant a plant producing seeds with two cotyledons (primary leaf of the embryo). For example, coffee, canola, peas and others. -. thorough speaking,, revision PCT/US96/11689 97/10328
• transgenic plant is meant a plant expressing a foreign gene.
• open reading frame is meant a nucleotide sequence, without introns, encoding an ammo acid sequence, with a defined translation initiation and termination region.
• the invention provides a method for producing a class of enzymatic cleaving agents which exhibit a high degree of specificity for the RN ⁇ of a desired target.
• the cn/.ymaiic nucleic acid molecule may be targeted to a highly specific sequence region of a target such that specific gene inhibition can be achieved.
• enzymatic nucleic acid can be targeted to a highly conserved region of a gene family to inhibit gene expression of a family of related enzymes.
• the ribozymes can be expressed in plants that have been transformed with vectors which express the nucleic acid of the present invention.
• ribozyme The enzymatic nature of a ribozyme is advantageous over other technologies, since the concentration of ribozyme necessary to affect a therapeutic treatment is lower. This advantage reflects the ability of the ribozyme to act enzymatically.
• a single ribozyme molecule is able to cleave many molecules of target RNA.
• the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base-pairing mechanism of binding to the target RNA, but also on the mechanism of target RNA cleavage. Single mismatches, or base-substitutions, near the site of cleavage can completely eliminate catalytic activity of a ribozyme.
• enzymatic nucleic acids act by first binding to a target RNA. Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA.
• the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RN ⁇ target, it is released from that RNA to search for another target and can repeatedly .bind and cleave new targets.
• the enzymatic nucleic acid molecule is formed in a hammerhead or hai ⁇ in motif, but may also be formed in the 97/10328
• Group II introns are described by Griffin et al, 1995, Chem. Biol. 2, 761 ; Michels and Pyle, 1995, Biochemistry 34, 2965; and of the Group I intron by Cech et al, U.S. Patent 4,987,071. These specific motifs are not limiting in the invention and those skilled in the art will recognize that all that is important in an enzymatic nucleic acid molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.
• the enzymatic nucleic acid molecules of the instant invention will be expressed within cells from eukaryotic promoters [e.g., Gerlach et al. International PCT Publication No. WO 91/13994; Edington and Nelson, 1992, in Gene Regulation: Biology of Antisense RNA and DNA, eds. R. P. Erickson and J. G. Izant, pp 209-221, Raven Press, NY.; Atkins et al, International PCT Publication No. WO 94/00012; Lenee et al, International PCT Publication Nos. WO 94/19476 and WO 9503404, Atkins et al, 1 95, J. Gen. Virol.
• eukaryotic promoters e.g., Gerlach et al. International PCT Publication No. WO 91/13994; Edington and Nelson, 1992, in Gene Regulation: Biology of Antisense RNA and DNA, eds. R. P. Erickson and
• any ribozyme can be expressed in eukaryotic plant cells from an appropriate promoter.
• the ribozymes expression is under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter.
• the ⁇ bozyme RNA is introduced into the plant.
• plants may be transformed using Agrobacterium technology, sec US Patent 5, 177.010 to University of Toledo, 5,104,310 to Texas A&M, European Patent Application 0I 3 I 624B I , European Patent Applications 120516, 159418B1 and 176,1 12 to Schilperoot, US Patents 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to Schilperoot, European Patent Applications 1 16718, 290799, 320500 all to MaxPlanck, European Patent Applications 604662 and 627752 to Japan Tobacco, European Patent Applications 0267159, and 0292435 and US Patent 5,231,019 all to Ciba Geigy, US Patents 5,463,174 and 4,762,785 both to Calgene, and US Patents 5,004,863 and 5,159,135 both to Agracetus; whiskers technology, see
• tissue which is contacted with the foreign material (typically plasmids containing RNA or DNA) may vary as well.
• tissue would include but would not be limited to embryogenic tissue, callus tissue type I and II, and any tissue which is receptive to transformation and subsequent regeneration into a transgenic plant.
• Another variable is die choice of a selectable marker. The preference for a particular marker is at the discretion of the artisan, but any of the following selectable markers may be used along with any other gene not listed herein which could function as a selectable marker.
• selectable markers include but are not limited to chlorosulfuron, hygromyacin, PAT and/or bar, bromoxynil, kanamycin and the like.
• the bar gene may be isolated from Strptomuces, particularly from the hygroscopicus or viridochromogenes species.
• the bar gene codes for phosphinothricin acetyl transferase (PAT) that inactivates the active ingradient in the herbicide bialaphos phosphinothricin (PPT).
• PAT phosphinothricin acetyl transferase
• PPT herbicide bialaphos phosphinothricin
• the ribozymes may be expressed individually as monomers, i.e., one ribozyme targeted against one site is expressed per transcript. Alternatively, two or more ribozymes targeted against more than one target site are expressed as part of a single RNA transcript. A single RNA transcript comprising more than one ribozyme targeted against more than one cleavage site are readily generated to achieve efficient modulation of gene expression. Ribozymes within these multimer constructs are the same or different.
• the multimer construct may comprise a plurality of hammerhead ribozymes or hai ⁇ in ribozymes or other ⁇ bozyme motifs.
• the multimer construct may be designed to include a plurality of different ⁇ bozyme motifs, such as hammerhead and hai ⁇ in ribozymes. More specifically, multimer ribozyme constructs arc designed, wherein a series of ribozyme motifs are linked together in tandem in a single RN ⁇ transcript. The ribozymes are linked to each other by nucleotide linker sequence, wherein the linker sequence may or may not be complementary to the target RNA. Multimer ribozyme constructs (polyribozymes) are likely to improve the effectiveness of ribozyme-mediated modulation of gene expression.
• ribozymes can also be augmented by their release from the primary transcript by a second ribozyme (Draper et al, PCT WO 93/23569, and Sullivan et al, PCT WO 94/02595, both hereby inco ⁇ orated in their totality by reference herein; Ohkawa, J., et al., 1992, Nucleic Acids Symp. Ser. , 27, 15-6; Taira, K., et ⁇ ., 1991 , Nucleic Acids Res., 19, 5125-30; Ventura, M., et al, 1993, Nucleic Acids Res., 21 , 3249-55; Chowrira et c/., 1994 J. Biol. Chem. 269, 25856).
• Ribozyme-mediated modulation of gene expression can be practiced in a wide variety of plants including angiosperms, gymnosperms, monocotyledons, and dicotyledons.
• Plants of interest include but are not limited to: cereals, such as rice, wheat, barley, maize; oil-producing crops, such as soybean, canola, sunflower, cotton, maize, cocoa, saf lower, oil palm, coconut palm, flax, castor, peanut; plantation crops, such as coffee and tea; fruits, such as pineapple, papaya, mango, banana, grapes, oranges, apples; vegetables, such as cauliflower, cabbage, melon, green pepper, tomatoes, carrots, lettuce, celery, potatoes, broccoli; legumes, such as soybean, beans, peas; flowers, such as carnations, chrysanthemum, daisy, tulip, gypsophila, alstromeria, marigold, petunia, rose; trees such as olive, cork, poplar
• Ribozyme-mediated down regulation of the expression of genes involved in caffeine synthesis can be used to significantly change caffeine concentration in coffee beans.
• Expression of genes, such as 7-methylxanthos ⁇ ne and/or 3-methyl transferase in coffee plants can be readily modulated using ribozymes to decrease caffeine synthesis (Adams and Zarowitz, US Patent No. 5,334,529; inco ⁇ orated by reference herein).
• Transgenic plants expressing ribozymes targeted against genes involved in ripening of fruits such as ethylene-form g enzyme, pectin mcthyltransfcrasc, pectin cstcrasc, polygalacturonase, 1 -am ⁇ nocyclopropane carboxylic acid ( ⁇ CC) syntha.sc, ⁇ CC oxidase genes (Smith et al, 1988, Nature, 334, 724; Gray et al, 1992, Pl. Mol. Biol, 19, 69; Tieman et al, 1992, Plant Cell, 4, 667; Picton et al, 1993, The Plant J. 3, 469; Shewmaker et al, supra; James et al, 1996, Bio/Technology, 14, 56), would delay the ripening of fruits, such as tomato and apple.
• ethylene-form g enzyme pectin mcthyltransfcrasc, pectin cstcrasc,
• Transgenic plants expressing ribozymes targeted against genes involved in flower pigmentation such as chalcone synthase (CHS), chalcone flavanone isomerase (CHI), phenylalanme ammonia lyase, or dehydroflavonol (DF) hydroxylases, DF reductase (Krol van der, et al, 1988, Nature, 333, 866; Krol van der, et al. 1990, Pl. Mol Biol. 14, 457; Shewmaker et al, supra; Jorgensen, 1996, Science, 268, 686), would produce flowers, such as roses, petunia, with altered colors.
• CHS chalcone synthase
• CHI chalcone flavanone isomerase
• DF dehydroflavonol
• DF reductase Krol van der, et al, 1988, Nature, 333, 866; Krol van der, et al. 1990, Pl. Mol Biol. 14, 4
• Lignins are organic compounds essential for maintaining mechanical strength of cell walls in plants. Although essential, lignins have some disadvantages. They cause indigestibility of sillage crops and are undesirable to paper production from wood pulp and others. Transgenic plants expressing ribozymes targeted against genes involved in lignin production such as, O-methyltransferase, cinnamoyI-CoA:NADPH reductase or cinnamoyl alcohol dehydrogenase (Doorsselaere et al, 1995, The Plant J. 8, 855; Atanassova et al, 1995, The Plant J. 8, 465; Shewmaker et al, supra; Dwivedi et al, 1994, Pl. Mol. Biol, 26, 61 ), would have altered levels of lignin.
• starch biosynthesis occurs in both chloroplasts (short te ⁇ n starch storage) and in the amyloplast (long term starch storage).
• Starch granules normally consist of a linear chain of ⁇ ( l -4)-l ⁇ nked ⁇ -D-glucose units (amylose) and a branched form of amylose cross-linked by ⁇ ( l-6) bonds (amylopectin)
• An enzyme involved in the synthesis of starch in plants is starch synthase which produces linear chains of ⁇ (l - 4)-glucose using ADP-glucose.
• starch synthase Two mam forms of starch synthase are found in plants: granule bound starch synthase (GBSS) and a soluble form located in the stroma of chloroplasts and in amyloplasts (soluble starch syntha.sc) Both lorms ol this cii/yme utilize ADP-D-glucose while the granular bound form also utilizes UD -D-glucosc, with a preference for the former.
• GBSS granule bound starch synthase
• soluble form located in the stroma of chloroplasts and in amyloplasts
• the GBSS known as waxy protein
• the Wx (waxy) locus encodes a granule bound glucosyl transferase involved in starch biosynthesis. Expression of this enzyme is limited to endosperm, pollen and the embryo sac in maize. Mutations in this locus have been termed waxy due to the appearance of mutant kernels, which is the phenotype resulting from an reduction in amylose composition m the kernels. In maize, this enzyme is transported into the amyloplast of the developing endosperm where it catalyses production of amylose. Com kernels are about 70% starch, of which 27% is linear amylose and 73% is amylopectin.
• Waxy is a recessive mutation in the gene encoding granule bound starch synthase (GBSS). Plants homozygous for this recessive mutation produce kernels that contain 100% of their starch in the form of amylopectin.
• GBSS granule bound starch synthase
• Ribozymes with their catalytic activity and increased site specificity (as desc ⁇ bed below), represent more potent and perhaps more specific inhibitory molecules than antisense oligonucleondes. Moreover, these ribozymes are able to inhibit GBSS activity and the catalytic activity of the ⁇ bozymes is required for their inhibitory effect. For those of ordinary skill in the art, it is clear from the examples that other ribozymes may ⁇ ⁇ -,,. n ,- o PCT/US96/11689 O 97/10328
• the invention features ⁇ bozymes that inhibit enzymes involved in amylose production, e.g., by reducing GBSS activity
• RNA molecules contain substrate binding domains that bind to accessible regions of the target mRNA.
• the RN ⁇ molecules also contain domains that catalyze the cleavage of RNA.
• the RNA molecules are preferably ribozymes of the hammerhead or hai ⁇ in motif. Upon binding, the ribozymes cleave the target mRNAs, preventing translation and protein accumulation. In the absence of the expression of the target gene, amylose production is reduced or inhibited. Specific examples arc provided below infra.
• Preferred embodiments include the ribozymes having binding arms which are complementary to the binding sequences in Tables IIIA, VA and VB. Examples of such ribozymes are shown in Tables IIIB - V. Those in the art will recognize that while such examples are designed to one plant's (e.g.. maize) mRNA, similar ribozymes can be made complementary to other plant species' mRNA. By complementary is thus meant that the binding arms enable ribozymes to interact with the target RNA in a sequence-specific manner to cause cleavage of a plant mRNA target. Examples of such ribozymes consist essentially of sequences shown in Tables IIIB - V.
• Preferred embodiments are the ribozymes and methods for their use in the inhibition of starch granule bound ADP (UDP)-glucose: ⁇ -l,4-Z)-glucan 4- ⁇ -glucosyl transferase i.e.. granule bound starch synthase (GBSS) activity in plants.
• UDP starch granule bound ADP
• GBSS granule bound starch synthase
• ribozymes that cleave target molecules and inhibit amylose production are expressed from transcription units inserted into the plant genome.
• the recombinant vectors capable of stable integration into the plant genome and selection of transformed plant lines expressing the ribozymes are expressed either by constitutive or inducible promoters in the plant cells. Once expressed, the ribozymes cleave their target mRNAs and reduce amylose production of their host cells.
• the ribozymes expressed in plant cells are under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter. Modification of com starch is an important application of ribozyme technology which is capable of reducing specific gene expression.
• a high level of amylopectin is desirable for the wet milling process of corn and there is also some evidence that high amylopectin corn leads to increased digestibility and therefore energy availability in feed.
• Nearly 10% of wet-milled com has the waxy phenotype, but because of its recessive nature the traditional waxy varieties are very difficult for the grower lo handle Ribozymes targeted to cleave the GBSS mRNA and thus reduce GBSS activity in plants, and in particular, corn endosperm will act as a dominant trait and produce corn plants with the waxy phenotype that will be easier for the grower to handle.
• Fatty acid biosynthesis in plant tissues is initiated in the chloroplast.
• Fatty acids are synthesized as thioesters of acyl carrier protein (ACP) by the fatty acid synthase complex (FAS).
• ACP acyl carrier protein
• FAS fatty acid synthase complex
• Fatty acids with chain lengths of 16 carbons follow one of three paths: 1) they are released, immediately after synthesis, and transferred to glycerol 3-phosphate (G3P) by a chloroplast acyl transferase for further modification within the chloroplast; 2) they are released and transferred to Co-enzyme A (CoA) upon export from the plastid by thioesterases; or 3) they are further elongated to C18 chain lengths.
• G3P glycerol 3-phosphate
• CoA Co-enzyme A
• the C18 chains are rapidly desaturated at the C9 position by stearoyi-ACP desaturase. This is followed by immediate transfer of the oleic acid (18:1) group to G3P within the chloroplast, or by export from the chloroplast and conversion to oleoyl-CoA by thioesterases (Somerville and Browse, 1991 Science 252: 80-87). The majority of C16 fatty acids follow the third pathway.
• Di- and tri-unsaturated chains are then released into the acyl-CoA pool and transfe ed to the C3 position of the glycerol backbone in diacyl glycerol in the production of triglycerides (Frentzen, 1993 in Lipid Metabolism in Plants., p.195-230, (ed. Moore.T.S.) CRC Press, Boca Raton, FA.).
• a schematic of the plant fatty acid biosynthesis pathway is shown in Figures 1 1 and 12.
• the three predominant fatty acids in co seed oil are linoleic acid (18:2, ⁇ 59%), oleic acid (18:1 , ⁇ 26%), and palmitic acid (16:0, -11%).
• This predominance of C18 chain lengths may reflect the abundance and activity of several key enzymes, such as the fatty acid synthase responsible for production of CI 8 carbon chains, the stearoyl-ACP desaturase ( ⁇ -9 desaturase) for production of 18: 1 and a microsomal ⁇ - 12 desaturase for conversion of 18: 1 to 18:2.
• the fatty acid synthase responsible for production of CI 8 carbon chains the stearoyl-ACP desaturase ( ⁇ -9 desaturase) for production of 18: 1
• ⁇ - 12 desaturase for conversion of 18: 1 to 18:2.
• ⁇ -9 desaturase also called stearoyl-ACP desaturase
• ACP acyl carrier protein
• Rat and yeast ⁇ -9 desaturases are membrane bound microsomal enzymes using acyl-CoA chains as substrates, whereas cyanobacterial ⁇ -9 desaturase uses acyl chains on diacyl glycerol as substrate.
• Com (maize) has been used minimally for the production of margarine products because it has traditionally not been utilized as an oil crop and because of the relatively low seed oil content when compared with soybean and canola.
• com oil has low levels of linolenic acid (18:3) and relatively high levels of palmitic (16:0) acid (desirable in margarine).
• Applicant believes that reduction in oleic and linoleic acid levels by down- regulation of ⁇ -9 desaturase activity will make com a viable alternative to soybean and canola in the saturated oil market.
• Margarine and confectionary fats are produced by chemical hydrogenation of oil from plants such as soybean. This process adds cost to the production of the margarine and also causes both cis and trans isomers of the fatty acids. Trans isomers are not naturally found in plant de ⁇ ved oils and have raised a concern for potential health risks. Applicant believes that one way to eliminate the need for chemical hydrogenation is to genetically engineer the plants so that desaturation enzymes are down-regulated. ⁇ -9 desaturase introduces the first double bond into 18 carbon fatty acids and is the key step effecting the extent of desaturation of fatty acids.
• the invention concerns compositions (and methods for their use) for the modification of fatty acid composition in plants. This is accomplished through the inhibition of genetic expression, with ribozymes, antisense nucleic acid, cosuppression or triplex DN ⁇ , which results in the reduction or elimination of certain enzyme activities in plants, such as ⁇ -9 desaturase Such activity is reduced in monocotyledon plants, such as maize, wheat, rice, palm, coconut and others. ⁇ -9 desaturase activity may also be reduced in dicotyledon plants such as sunflower, saffiower, cotton, peanut, olive, sesame, cuphea, flax, jojoba, grape and others.
• the invention features ribozymes that inhibit enzymes involved in fatty acid unsaturation, e.g., by reducing ⁇ -9 desaturase activity.
• RNA molecules contain substrate binding domains that bind to accessible regions of the target mRNA.
• the RNA molecules also contain domains that catalyze the cleavage of RNA.
• the RNA molecules are preferably ribozymes of the hammerhead or hai ⁇ in motif. Upon binding, the ribozymes cleave the target mRNAs, preventing translation and protein accumulation. In the absence of the expression of the target gene, stearate levels are increased and unsaturated fatty acid production is reduced or inhibited. Specific examples are provided below in the Tables listed directly below.
• the ribozymes have binding arms which are complementary to the sequences in the Tables VI and VIII.
• binding arms of the ribozymes are able to interact with the target RNA in a sequence-specific manner and enable the ribozyme to cause cleavage of a plant mRNA target.
• Examples of such ribozymes are typically sequences defined in Tables VII and VIII.
• the active ribozyme typically contains an enzymatic center equivalent to those in the examples, and binding arms able to bind plant mRNA such that cleavage at the target site occurs. Other sequences may be present which do not interfere with such binding and/or cleavage.
• ⁇ bozymes that cleave target molecules and reduce unsaturated fatty acid content in plants are expressed from transcription units inserted into the plant genome.
• the recombinant vectors capable of stable integration into the plant genome and selection of transformed plant lines expressing the ribozymes are expressed either by constitutive or inducible promoters in the plant cells. Once expressed, the ribozymes cleave their target mRN ⁇ s and reduce unsaturated fatty acid production of their host cells.
• the ribozymes expressed in plant cells are under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter.
• Modification of fatty acid profile is an important application of nucleic acid-based technologies which are capable of reducing specific gene expression.
• a high level of saturated fatty acid is desirable in plants that produce oils of commercial importance.
• this invention features the isolation of the cDNA sequence encoding ⁇ -9 desaturase in maize.
• hai ⁇ in and hammerhead ribozymes that cleave ⁇ -9 desaturase mRNA are also described.
• Those of ordinary skill in the art will understand from the examples described below that other ⁇ bozymes that cleave target mRNAs required for ⁇ -9 desaturase activity may now be readily designed and are within the scope of the invention.
• com RNA While specific examples to com RNA are provided, those in the art will recognize that the teachings are not limited to com. Furthermore, the same target may be used in other plant species.
• RNA sequences are utilized in the ribozyme targeted to that specific RNA.
• Example 1 Isolation of ⁇ .9 desaturase cDNA from Zea mays
• PCR primers were designed and synthesized to two conserved peptides involved in diiron-oxo group binding of plant ⁇ -9 desaturases.
• a 276 bp DNA fragment was PCR amplified from maize embryo cDNA and was cloned in to a vector. The predicted amino acid sequence of this fragment was similar to the sequence of the region separated by the two conserved peptides of dicot ⁇ -9 desaturase proteins. This was used to screen a maize embryo cDNA library. A total of 16 clones were isolated; further restriction mapping and hybridization identified one clone which was sequenced.
• cDNA insert is: a 1621 nt cDNA; 145 nt 5' and 294 nt 3' untranslated regions including a 18 nt poly A tail; a 394 amino acid open reading frame encoding a 44.7 kD polypeptide; and 85% amino acid identity with castor bean ⁇ -9 desaturase gene for the predicted mature protein.
• the complete sequence is presented in Figure 10.
• HH ribozyme sites Approximately two hundred and fifty HH ribozyme sites and approximately forty three HP sites were identified in the com ⁇ -9 desaturase mRNA.
• a HH site consists of a uridine and any nucleotide except guanosine (UH).
• UH guanosine
• Tables VI and VIII have a list of HH and HP ribozyme cleavage sites. The numbering system starts with 1 at the 5' end of a ⁇ -
• Ribozymes such as those listed in Tables VII and VIII, can be readily designed and synthesized to such cleavage sites with between 5 and 100 or more bases as substrate binding arms (see Figs. 1 - 5). These substrate binding arms within a ribozyme allow the ribozyme to interact with their target in a sequence-specific manner.
• Example 3 Selection of Ribozvme Cleavage Sites for 9 desaturase
• RNase H assays These oligonucleotides covered 108 sites within ⁇ -9 desaturase RNA.
• RNase H assays (Fig. 6) were performed using a full length transcript of the ⁇ -9 desaturase cDNA.
• RNA was screened for accessible cleavage sites by the method described generally in Draper et al, supra. Briefly, DNA oligonucleotides representing ribozyme cleavage sites were synthesized. A polymerase chain reaction was used to generate a substrate for T7 RNA polymerase transcription from co cDNA clones. Labeled RNA transcripts were synthesized in vitro from these templates.
• RNAseH was added and the mixtures were incubated for 10 minutes at 37°C. Reactions were stopped and RNA separated on sequencing polyacrylamide gels. The percentage of the substrate cleaved was determined by autoradiographic quantitation using a Molecular Dynamics phosphor imaging system (Figs. 13 and 14).
• HH and hai ⁇ in (HP) ribozymes were designed to the sites covered by the oligos which cleaved best in the RNase H assays. These ribozymes were then subjected to analysis by computer folding and the ribozymes that had significant secondary structure were rejected.
• RNA synthesis was chemically synthesized.
• the general procedures for RNA synthesis have been desc ⁇ bed previously (Usman et al, 1987, J. Am. Chem. Soc, 109, 7845-7854 and in Scaringe et al., 1990, Nucl Acids Res., 18, 5433-5341 ; Wincott et al ,
• oligonucleotide synthesis reagents for the 394 Det ⁇ tylation solution was 2% TCA in methylene chloride (ABI); capping was performed with 16% N- Methyl imidazole in THF (ABI) and 10% acetic anhydride/ 10% 2,6-lut ⁇ d ⁇ ne in THF (ABI); oxidation solution was 16.9 mM l2, 49 mM pyridine, 9% water in THF
• Deprotection of the R ⁇ A was performed as follows.
• TEA and 1.0 mL TEA*3HF to provide a 1.4 M HF concentration were heated to 65°C for 1.5 h.
• the resulting, fully deprotected, oligomer was quenched with 50 mM TEAB (9 mL) prior to anion exchange desalting.
• the TEAB solution was loaded onto a Qiagen 500® anion exchange cartridge (Qiagen Inc.) that was prewashed with 50 mM TEAB (10 mL). After washing the loaded cartridge with 50 mM TEAB (10 mL), the R ⁇ A was eluted with 2 M TEAB (10 mL) and dried down to a white powder.
• Qiagen 500® anion exchange cartridge Qiagen Inc.
• Inactive hammerhead ribozymes were synthesized by substituting a U for G5 and a U for A 14 (numbering from (Hertel, K. J., et al, 1992, Nucleic Acids Res., 20, 3252) The hai ⁇ in ribozymes were synthesized as described above for the hammerhead RNAs.
• Ribozymes were also synthesized from DNA templates using bacte ⁇ ophage T7 RNA polymerase (Milligan and Uhlenbeck, 1989, Methods Enzymol 180, 51 ). Ribozymes were purified by gel electrophoresis using general methods or were purified by high pressure liquid chromatography (HPLC; Sec Wincott et al, 1996, supra, the totality of which is hereby inco ⁇ orated herein by reference) and were resuspended in water. The sequences of the chemically synthesized ribozymes used in this study arc shown below in Tables VII and VIII.
• Target RNA used in this study was 1621 nt long and contained cleavage sites for all the HH and HP ribozymes targeted against ⁇ -9 desaturase RNA.
• a template containing T7 RNA polymerase promoter upstream of ⁇ -9 desaturase target sequence was PCR amplified from a cDNA clone.
• Target RNA was transcribed from this PCR amplified template using T7 RNA polymerase.
• the transcript was internally labeled during transcription by including [ ⁇ - 32 P] CTP as one of the four ribonucleotide triphosphates.
• the transcription mixture was treated with DNase-I, following transcription at 37°C for 2 hours, to digest away the DNA template used in the transcription.
• the transcription mixture was resolved on a denaturing polyacrylamide gel. Bands corresponding to full- length RNA was isolated from a gel slice and the RNA was precipitated with isopropanol and the pellet was stored at 4°C.
• Ribozyme cleavage reactions were carried out under ribozyme excess (k at/KM) conditions (Herschlag and Cech, 1990, Biochemistry 29, 10159-10171). Briefly, 1 mM ribozyme and ⁇ 10 nM internally labeled target RNA were denatured separately by heating to 65°C for 2 min in the presence of 50 mM Tris.HCl, pH 7.5 and 10 mM
• RNAs were renatured by cooling to the reaction temperature (37°C, 26°C or
• Cleavage reaction was initiated by mixing the ribozyme and target RNA at appropriate reaction temperatures. Aliquots were taken at regular intervals of time and the reaction was quenched by adding equal volume of stop buffer. The samples were resolved on 4 % sequencing gel.
• Example 7 Cleavage of the target RNA using multiple ribozvme combinations for ⁇ 9 desaturase
• ribozymes were incorporated into a multimer ribozyme construct which contains two or more ribozymes embedded in a contiguous stretch of complementary RNA sequence.
• Non-limiting examples of multimer ribozymes are shown in Figures 17, 18, 19 and 23.
• the ribozymes were made by annealling complementary oligonucleotides and cloning into an expression vector containing the Cauliflower Mosaic Virus 35S enhanced promoter (Franck et al. 1985 Cell 21, 285), the maize Adh 1 intron (Dennis et al, 1984 Nucl Acids Res.
• Ribozymes targeted to cleave ⁇ -9 desaturase mRNA are endogenously expressed in plants, either from genes inserted into the plant genome (stable transformation) or from episomal transcription units (transient expression) which are part of plasmid vectors or viral sequences. These ribozymes can be expressed via RNA polymerase I, II, or III plant or plant virus promoters (such as CaMV). Promoters can be either constitutive, tissue specific, or developmentally expressed.
• the ribozymes were designed with 3 bp long stem II and 20 bp (total) long substrate binding arms targeted against site 259.
• the active version is RPA 114, the inactive is RPA 1 15.
• the parent plasmid, pDAB367 was digested with Not I and filled in with Klenow to make a blunt acceptor site.
• the vector was then digested with Hind III restriction enzyme.
• the ribozyme containing plasmids were cut with Eco RI, filled-in with Klenow and recut with Hind III.
• the insert containing the entire ribozyme transcription unit was 97/10328 3Q
• the ⁇ bozymes were designed with 3 bp long stem fl regions Total length ol the substrate binding arms of the multimer construct was 42 bp.
• the active version is RPA 118, the inactive is 119
• the constructs were made as described above for the 259 monomer.
• the multimer construct was designed with four hammerhead ribozymes targeted against sites 453, 464, 475 and 484 within ⁇ -9 desaturase RNA
• transgenic plants can be identified by standard assays.
• the transgenic plants can be evaluated for reduction tn ⁇ -9 desaturase expression and ⁇ -9 desaturase activity as discussed in the examples infra.
• GBSS mRNA polypeptide coding region (see table IIIA).
• a hammer-head site consists of a undine and any nucleotide except guanine (UH).
• UH guanine
• sequence of GBSS coding region for com SEQ. I.D. No.25.
• the numbe ⁇ ng system starts with I at the 5' end of a GBSS cDNA clone having the following sequence (5' to 3')
• Ribozymes can be readily designed and synthesized to such sites with between 5 and 100 or more bases as substrate binding arms (see Figs. 1 - 5) as described above.
• the secondary structure of GBSS mRNA was assessed by computer analysis using folding algorithms, such as the ones developed by M. Zuker ( Zuker, M., 1989 Science,
• RNA RNA stems of over eight nucleotides and contained potential hammerhead ribozyme cleavage sites were identified. These sites which were then assessed for oligonucleotide accessibility with RNase H assays (see Fig. 6). Fifty-eight DNA oligonucleotides, each twenty one nucleotides long were used in these assays.
• oligonucleotides covered 85 sites The position and designation of these oligonucleotides were 195, 205, 240, 307, 390, 424, 472, 481 , 539, 592, 625, 636, 678, 725, 741 , 81 1 , 859, 891 , 897, 912, 918, 928, 951 , 958, 969 , 993, 999, 1015, 1027, 1032, 1056, 1084, 1 105, 1 156, 1 168, 1 186, 1 195, 1204, 1213.
• Example 1 RNaseH Assays for GBSS
• RNase H assays were performed using a full length transcript of the GBSS coding region, 3' noncoding region, and part of the 5' noncoding region.
• the GBSS RNA was screened for accessible cleavage sites by the method desc ⁇ bed generally in Draper et al, supra, hereby inco ⁇ orated by reference herein. Briefly, DNA oligonucleotides representing hammerhead ribozyme cleavage sites were synthesized. A polymerase chain reaction was used to generate a substrate for T7 RNA polymerase transcription from com cDNA clones. Labeled RNA transcripts were synthesized in vitro from these templates.
• RNAseH was added and the mixtures were incubated for 10 minutes at 37°C. Reactions were stopped and RNA separated on sequencing polyacrylamide gels. The percentage of the substrate cleaved was determined by autoradiographic quantitation using a phosphor imaging system (Fig. 7)*
• the ⁇ bozymes were chemically synthesized.
• the method of synthesis used follows the procedure for normal RNA synthesis as described above (and in Usman et al , supra, Sca ⁇ nge et al, and Wincott et al, supra) and are incorporated by reference herein, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end.
• the average stepwise coupling yields were >98%.
• Inactive ribozymes were synthesized by substituting a U for G5 and a U for A14 (numbering from (Hertel et al, supra).
• Hairpin ⁇ bozymes were synthesized in two parts and annealed to reconstruct the active ribozyme (Chow ⁇ ra and Burke, 1992, Nucleic Acids Res., 20, 2835-). All ribozymes were modified to enhance stability by modification of five ribonucleotides at both the 5' and 3' ends with 2'-0- methyl groups. Ribozymes were purified by gel electrophoresis using general methods. (Ausubel et al, 1990 Current Protocols in Molecular Biology Wiley & Sons, NY) or were purified by high pressure liquid chromatography, as described above and were resuspended in water.
• Target RNA used in this study was 900 nt long and contained cleavage sites for all the 23 HH ribozymes targeted against GBSS RNA.
• a template containing T7 RNA polymerase promoter upstream of GBSS target sequence was PCR amplified from a cDNA clone.
• Target RNA was transcribed from this PCR amplified template using T7 RNA polymerase.
• the transcript was internally labeled during transcription by including [ ⁇ -32p] CTP as one of the four ribonucleotide triphosphates.
• the transcription mixture was treated with DNase-1 , following transcription at 37°C for 2 hours, to digest away the DNA template used in the transcription.
• the transcription mixture was resolved on a denaturing polyacrylamide gel. Bands corresponding to full-length RNA was isolated from a gel slice and the RNA was precipitated with isopropanol and the pellet was stored at 4°C.
• Ribozyme cleavage reactions were carried out under ribozyme excess (kcat/K ) conditions (Herschlag and Cech, supra). Briefly, 1000 nM ribozyme and ⁇ 10 nM internally labeled target RNA were denatured separately by heating to 90°C for 2 min. in the presence of 50 mM Tris.HCl, pH 7.5 and 10 mM MgCl2- The RNAs were renarured by cooling to the reaction temperature (37°C, 26°C and 20°C) for 10-20 min. Cleavage reaction was initiated by mbcing the ribozyme and target RNA at appropriate reaction temperatures.
• RNA cleavage reaction Four of the lead ⁇ bozymes (892, 919, 959, 1241 ) were incubated with internally labeled target RNA in the following combinations: 892 alone; 892 + 919; 892 + 919 + 959; 892 + 919 + 959 + 1241.
• the fraction of RNA cleavage increased in an additive manner with an increase in the number of ribozymes used in the cleavage reaction (Fig. 9) Ribozyme cleavage reactions were earned out at 20°C as described above.
• a multimer ribozyme was constructed which contained four hammerhead ribozymes targeting sites 892, 919, 959 and 968 of the GBSS mRNA.
• Two DNA oligonucleotides (Macromolecular Resourses, Fort Collins, CO) were ordered which overlap by 18 nucleotides. The sequences were as follows:
• Oligo 1 CGCGGA TCC TGG TAG GAC TGA TGA GGC CGA AAG GCC GAA ATGTTGTGCTGATGAGGCCGAAAG GCCGAAATGCAGAAAGCG GTC TTTGCGTCCCTGTAGATG CCGTGGC
• Oligo2 CGCGAGCTCGGCCCTCTCTTTCGGCCTTTCGGCCTC ATC AGG TGCTAC CTC AAG AGC AAC TAC CAG TTT CGG CCTTTC GGC CTC ATC AGCCACGGCATCTACAGGG
• the DNA fragments were ligated into BamVWS.st I digested pD ⁇ B 353.
• the gaiion was transformed into competent DH5 ⁇ F' bacteria (Gibco/BRL). Potential clones were screened by digestion with Bam UEco RI. Clones were confirmed by sequencing. The total length of homology with the target sequence is 96 nucleotides.
• a single ribozyme to site 919 of the GBSS mRNA was constructed with 10/10 a ⁇ ns as follows. Two DNA oligos were ordered:
• Oligo 1 GAT CCG ATG CCGTGG CTG ATG AGG CCG AAA GGC CGA AAC TGG TAG TT
• Oligo2 AACTACCAGTTTCGGCCTTTCGGCCTC ⁇ TC ⁇ GC CACGGC ⁇ TC G
• the oligos are phosphorylated individually in IX kinase buffer (Gibco/BRL) and heat denatured and annealed by combining at 90°C for 10 min, then slow cooled to room temperature (22°C).
• the vector was prepared by digestion of pDAB 353 with Sst I and blunting the ends with T4 DNA polymerase. The vector was redigested with Bam HI and gel purified as above.
• the annealed oligos are ligated to the vector in IX ligation buffer (Gibco/BRL) at 16°C overnight. Potential clones were digested with Bam HVEco RI and confirmed by sequencing.
• Example 16 Plant Transformation Plasmids pDAB 367. Used in the ⁇ .9 Ribozyme Experiments, and pDAB353 used in the GBSS Ribozvme Experiments
• Plasmid pDAB367 has the following DNA structure: beginning with the base after the final C residue of d e Sph I site of pUC 19 (base 441 ; Ref. 1 ), and reading on the strand contiguous to the LacZ gene coding strand, the linker sequence CTGCAGGCCGGCC TTAATTAAGCGGCCGCGTTTAAACGCCCGGGCATTTAAATGGCGCGCCGC GATCGCTTGCAGATCTGCATGGGTG, nucleotides 7093 to 7344 of CaMV DNA (2), the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAGGATCCAG, nucleotides 167 to 186 of MSV (3), nucleotides 188 to 277 of MSV (3), a C residue followed by nucleotides 1 19 to 209 of maize Adh IS containing parts of exon 1 and intron I (4), nucleotides 555 to 672 containing
• Plasmid pDAB353 has the following DNA structure: beginning with the base after the final C residue of the Sph I site of pUC 19 (base 441; Ref. 1), and reading on the strand contiguous to the LacZ gene coding strand, the linker sequence CTGCAGATCTGCATGGGTG, nucleotides 7093 to 7344 of CaMV DNA (2), the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAG, nucleotides 119 to 209 of maize Adh IS containing parts of exon 1 and intron 1 (4), nucleotides 555 to 672 containing parts of Adh IS intron 1 and exon 2 (4), and the linker sequence GACGGATCCGTCGACC, where GGATCC represents the recognition sequence for BamH I restriction enzyme.
• GUS beta- giucuronidase
• Example 17 Plasmid pDAB359 a Plant Transformation Plasmid which Contains the Gamma-Zein Promoter, the Antisense GBSS. and a the Nos Polvadenvlation Sequence
• Plasmid pDAB359 is a 6702 bp double-stranded, circular DNA that contains the following sequence elements: nucleotides 1-404 from pUC18 which include lac operon sequence from base 238 to base 404 and ends with the Hindlll site of the M 13mpl 8 polylinker (1,2); the Nos polyadenylation sequence from nucleotides 412 to 668 (3); a synthetic adapter sequence from nucleotides 679-690 which converts a Sac I site to an Xho I site by changing GAGCTC to GAGCTT and adding CTCGAG: maize granule bound starch synthase cDNA from bases 691 to 2953, corresponding to nucleotides 1- 2255 of SEQ.
• the GBSS sequence in plasmid pDAB359 was modified from the original cDNA by the addition of a 5' Xho I and a 3' Nco I site as well as the deletion of internal Nco I and Xho I sites using Klenow to fill in the enzyme recognition sequences.
• Bases 2971 to 4453 are 5' untranslated sequence of the maize 27 kD gamma- zein gene corresponding to nucleotides 1078 to 2565 of the published sequence (4).
• the gamma-zein sequence was modified to contain a 5' Kpn I site and 3' BamH/Sall/Nco I sites.
• nucleotides 4454 to 6720 of pDAB359 are identical to pucl 8 bases 456 to 2686 including the Kpn I/EcoRI/Sac I sites of the M13/mpI 8 polylinker from 4454 to 4471 , a lac operon fragment from 4471 to 4697, and the ⁇ -lacatmase gene from 5642 to 6433 (1 , 2).
• Example 18 Construction of Plasmid pDAB430. containing Antisense ⁇ 9 Desaturase, Expressed bv the Ubiquitin Promoter/intron (Ubi 1 )
• Plasmid pDAB421 contains a unique blunt-end Srfl cloning site flanked by the maize Ubiquitin promoter/intron and the nopaline synthase polyadenylation sequences.
• pDAB421 was prepared as follows: digestion of pDAB355 with restriction enzymes Kpnl and BamHI drops out the R coding region on a 2.2 kB fragment. Following gel purification, the vector was ligated to an adapter composed of two annealed oligonucleotides OF235 and OF236.
• OF235 has the sequence 5' - GAT CCG CCC GGG GCC CGG GCG GTA C - 3' and OF236 has the sequence 5' - CGC CCG GGC CCC GGG CG - 3'.
• Clones containing this adapter were identified by digestion and linearization of plasmid DNA with the enzymes Srfl and Smal which cut in the adapter, but not elsewhere in the plasmid.
• One representative clone was sequenced to verify that only one adapter was inserted into the plasmid.
• the resulting plasmid pDAB421 was used in subsequent construction of the ⁇ 9 desaturase antisense plasmid pDAB430.
• plasmid pDAB430 (antisense ⁇ 9 desaturase)
• the antisense ⁇ 9 desaturase construct present in plasmid pDAB430 was produced by cloning of an amplification product in the blunt-end cloning site of plasmid pDAB421. Two constructs were produced simultaneously from the same experiment.
• the first construct contains the ⁇ 9 desaturase gene in the sense orientation behind the ubiquitin promoter, and the c-myc tag fused to the C-terminus of the ⁇ 9 desaturase open reading frame for immunological detection of ove ⁇ roduced protein in transgenic lines This construct was intended for testing of ribozymes in a system which did not express maize ⁇ 9 desaturase.
• the ⁇ 9 desaturase cl)N ⁇ sequence described herein was amplified with two primers
• the N-tcrmmal primer OF279 has the sequence 5'- GTG CCC ACA ATG GCG CTC CGC CTC AAC GAC - 3'.
• the underlined bases correspond to nucleotides 146- 166 of the cDNA sequence
• C- terminal primer OF280 has the sequence 5' - TCA TCA CAG GTC CTC CTC GCT GAT CAG CTT CTC CTC CAG TTG GAC CTG CCT ACC GTA - 3' and is the reverse complement of the sequence 5' - TAC GGT AGG GAC GTC CAA CTG GAG GAG AAG CTG ATC AGC GAG GAG GAC CTG TGA TGA - 3'.
• the underlined bases correspond to nucleotides 1304-1324 of the cDNA sequence, the bases in italics correspond to the sequence of the c-myc epitope.
• the 1179 bp of amplification product was purified through a 1.0% agarose gel, and ligated into plasmid pDAB421 which was linearized with the restriction enzyme Srfl. Colony hybridization was used to select clones containing the pDAB421 plasmid with the insert.
• the orientation of the insert was determined by restriction digestion of plasmid DNA with diagnostic enzymes Kpnl and BamHl. A clone containing the ⁇ 9 desaturase coding sequence in the sense orientation relative to the Ubiquitin promoter/intron was recovered and was named pDAB429.
• Plasmid pDAB430 was subjected to sequence analysis and it was determined that the sequence contained three PCR induced errors compared to the expected sequence. One error was found in the sequence corresponding to primer OF280 and two nucleotide changes were observed internal to the coding sequence. These errors were not corrected, because antisense downregulation does not require 100% sequence identity between the antisense transcript and the downregulation target.
• Example 19 Helium Blasting of Embryogenic Maize Cultures and the Subsequent Regeneration of Transgenic Progeny
• Hi-II is a hybrid made by lntermating 2 R3 lines derived from a B73xA 188 cross (Armstrong et al. 1990). When cultured, this genotype produces callus tissue known as Type II. Type II callus is friable, grows quickly, and exhibits the ability to maintain a high level of embryogenic activity over an extended time period.
• Type II cultures were initiated from 1.5-3.0 mm immature embryos resulting from controlled pollinations of greenhouse grown Hi-II plants.
• the initiation medium used was N6 (Chu, 1978) which contained I .Omg/L 2,4-D, 25 mM L-prolinc, 1 0 mg L casein hydrolysate, 10 mg L AgNO3, 2.5 g L gel ⁇ te and 2% sucrose adjusted to pH 5.8.
• N6 Cho, 1978
• L-prolinc 1 0 mg L casein hydrolysate
• 10 mg L AgNO3, 2.5 g L gel ⁇ te and 2% sucrose adjusted to pH 5.8.
• selection occurred for Type II callus and against non- embryogenic and or Type I callus.
• Type II callus was transferred to a maintenance medium in which AgNO3 was omitted and L-prolinc reduced to 6mM.
• Plasmid DNA was adsorbed onto the surface of gold particles prior to use in transformation experiments.
• the experiments for the GBSS target used gold particles which were spherical with diameters ranging from 1.5-3.0 microns (Aldrich Chemical Co., Milwaukee, WI).
• Transfomation experiments for the ⁇ 9 desaturase target used 1.0 micron spherical gold particles (Bio-Rad, Hercules, CA). All gold particles were surface-sterilized with ethanol prior to use. Adso ⁇ tion was accomplished by adding 74 ⁇ l of 2.5 M calcium chloride and 30 ⁇ l of 0.1 M spermidine to 300 ⁇ l of plasmid DNA and sterile H2O.
• the concentration of plasmid DNA was 140 ⁇ g.
• the DNA-coated gold particles were immediately vortexed and allowed to settle out of suspension. The resulting clear supematent was removed and the particles were resuspended in 1 ml of 100% ethanol. The final dilution of the suspension ready for use in helium blasting was 7.5 mg DNA gold per ml of ethanol.
• Helium blasting involved accelerating the suspended DNA-coated gold particles towards and into prepared tissue targets.
• the device used was an earlier prototype to the one described in a DowElanco U.S. Patent (#5,141 ,131) which is inco ⁇ orated herein by reference, although both function in a similar manner.
• the device consisted of a high pressure helium source, a syringe containing the DN ⁇ /gold suspension, and a pneumatically-operated multipurpose valve which provided controlled linkage between the helium source and a loop of pre-loaded DNA/gold suspension.
• tissue targets Prior to blasting, tissue targets were covered with a sterile 104 micron stainless steel screen, which held the tissue in place du ⁇ ng impact. Next, targets were placed under vacuum in the main chamber of the device. The DNA-coated gold particles were accelerated at the target 4 times using a helium pressure of 1500 psi. Each blast delivered 20 ⁇ l of DNA/gold suspension. Immediately post-blasting, the targets were placed back on maintenance medium plus osmoticum for a 16 to 24 hour recovery period.
• BastaTM resistant callus was established as a line, plant regeneration was initiated by transferring callus tissue to petri plate containing cytokinin-based induction medium which were then placed in low light (125 ft-candles) for one week followed by one week in high light (325 ft-candles).
• the induction medium was composed of MS salts and vitamins (Murashige and Skoog, 1962), 30 g L sucrose, 100 mg/L myo-inositol, 5 mg/L 6- benzylaminopurine, 0.025 mg L 2,4-D, 2.5 g/L gelrite adjusted to pH 5.7.
• the tissue was non-selectively transfe ⁇ ed to hormone-free regeneration medium and kept in high light.
• the regeneration medium was composed of MS salts and vitamins, 30 g/L sucrose and 2.5 g/L gelrite adjusted to pH 5.7. Both induction and regeneration media contained 30 mg/L BastaTM.
• Tissue began differentiating shoots and roots in 2-4 weeks. Small (1.5-3 cm) plantlets were removed and placed in tubes containing SH medium.
• SH medium is composed of SH salts and vitamins (Schenkillon worth endeavour_._ PCT/US96/11689 97/10328
• Ro plants were sclf-pollinatcd and/or cross-pollinated with non-iransgenic inbrcds to obtain transgenic progeny.
• Ri seed produced from Ro pollinations was replanted.
• the R] plants were grown to maturity and pollinated to produce R2 seed in the quantities needed for the analyses.
• Example 20 Production and Regeneration of ⁇ .9 Transgenic Material.
• BMS does not produce a GBSS mRNA which is homologous to that found endogenously in maize. Therefore, a double transformation system was developed to produce transformants which expressed both target and ribozymes.
• "ZM" BMS suspensions obtained from Jack Widholm, University of Illinois, also see W. F. Sheridan, "Black Mexican Sweet Com: Its Use for Tissue Cultures” in Maize for Biological Research, W. F. Sheridan, editor. University Press. University of North Dakokta, Grand Forks, ND, 1982, pp.
• 385-388 were prepared for helium blasting four days after subculture by transfer to a 100 x 20 mm Petri plate (Fisher Scientific, Pittsburgh, PA) and partial removal of liquid medium, forming a thin paste of cells.
• Targets consisted of 100- 125 mg fresh weight of cells on a 1/2" antibiotic disc (Schleicher and Schuell, Keene, NH) placed on blasting medium, DN6 [N6 salts and vitamins (Chu ei al, 1978), 20 g ' L sucrose, 1.5 mg L 2,4-dichlorophenoxyacet ⁇ c acid (2,4-D).
• the antibiotic discs were transferred to DN6 medium made with 0.8% TC agar for one week of target tissue recovery. After recovery, each target was spread onto a 5.5 cm Whatman #4 filter placed on DN6 medium minus proline with 3 mg/L Basta® (Hoechst, Frankfort, Germany). Two weeks later, the filters were transferred to fresh selection medium with 6 mg/L Basta®. Subsequent transfers were done at two week intervals.
• Isolates were maintained by subculture to fresh medium every two weeks.
• Basta®-resistant isolates which expressed GBSS were subjected to a second transformation.
• targets of transgenic callus were prepared 4 days after subculture by spreading tissue onto 1/2" filters.
• AMCF-ARM with 2% TC agar was used for blasting, due to maintenance of transformants on AMCF-ARM selection media.
• Each sample was covered with a sterile 104 ⁇ m mesh screen and blasting was done at 1500 psi.
• Target tissue was co-bombarded with pDAB 319 (35S-ALS; 35T- GUS) and RPA63 (active ribozyme multimer) or pDAB319 and RPA64 (inactive ribozyme multimer), or shot with pDAB 319 alone.
• AMCF-ARM nonselective medium
• CSN chlorsulfuron
• GBSS functional target gene
• RNase protection assay RPA
• Northern blot analysis were performed on ribozyme-expressing and vector control tissues to compare levels of GBSS transcript in the presence or absence of active ribozyme.
• GBSS values were normalized to an internal control ( ⁇ 9 desaturase); Northern blot data is shown in Figure (25).
• Northern blot results revealed a significantly lower level of GBSS message in the presence of ribozyme, as compared to vector controls.
• RPA data showed that some of the individual samples expressing active ribozyme ("L" and "O") were significantly different from vector controls and similar to a nontransformed control.
• Plant material co-transformed with the pDAB308 and one of the following ribozyme containing vectors, pRPA63, pRPA64, pRPA85, pRPA1 13, ⁇ RPA1 14, pRPAl 15, pRPAl 18 or pRPAl 19 were analyzed at the callus level, Ro level and select lines analyzed at the Fl level.
• Leaf material was harvested when the plantlets reached the 6-8 leaf stage.
• DNA from the plant and callus material was prepared from lyophilized tissue as described by Saghai-Maroof et al(supra).
• Probes specific for the ribozyme coding region were hybridized to the membranes. Probe DNA was prepared by boiling 50 ng of probe DNA for 10 minutes then quick cooling on ice before being added to the Ready-To-Go DNA labeling beads (Pharmacia 7/10328
• the DNA from the RPA63 and RPA64 was digested with the restriction enzymes Hindlll and EcoRI and the blots containing these samples were hybridized to the RPA63 probe.
• the RPA63 probe consists of the RPA63 ribozyme multimer coding region and should produce a single 1.3 kb hybridization product when hybridized to the RP ⁇ 63 or RPA64 materials.
• the 1.3 kb hybridization product should contain the enhanced 35S promoter, the Adhl intron, the ribozyme coding region and the nopaline synthase poly A 3' end.
• RPA 122 is the 252 multimer ribozyme in pDAB 353 replacing the GUS reporter.
• the RPA 122 probe consists of the RPA 122 ribozyme multimer coding region and the nopaline synthase 3' end and should produce a single 2.1 kb hybridization product when hybridized to die RPA85 or RPA113 materials.
• the 2.1 kb hybridization product should contain the enhanced 35S promoter, the Adhl intron, the bar gene, the ribozyme coding region and the nopaline synthase poly A 3' end.
• the DNA from the RPA114 and RPA115 was digested with the restriction enzymes Hindlll and Smal and the blots containing these samples were hybridized to the RPA 115 probe.
• the RPA 115 probe consist of the RPA115 ribozyme coding region and should produce a single 1.2 kb hybridization product when hybridized to the RPA114 or RPA115 materials.
• the 1.2 kb hybridization product should contain the enhanced 35S promoter, the Adhl intron, the ribozyme coding region and the nopaline synthase poly A 3' end.
• the DNA from the RPA118 and RPA119 was digested with the restriction enzymes Hindlll and Smal and the blots containing these samples were hybridized to the RPA1 18 probe.
• the RPA1 18 probe consist of the RPA118 ribozyme coding region and should produce a single 1.3 kb hybridization product when hybridized to the RPA1 18 or RPA119 materials.
• the 1.3 kb hybridization product should contain the enhanced 35S promoter, the Adhl intron, the ribozyme coding region and the nopaline synthase poly A 3' end.
• PCR Polymerase Chain Reaction
• PCR Polymerase Chain Reaction
• RPA1 14/RPA1 15 258 ribozyme monomer
• This primer is used to amplify across the Eco RV site in the 35S promoter. Primers were prepared using standard oligo synthesis protocols on an Applied Biosystems Model 394 DNA/RNA synthesizer.
• RNA Extraction Buffer 50 mM Tris-HCl pH 8.0, 4% para-amino salicylic acid, 1% Tri-iso-propylnapthalenesulfonic acid, 10 mM dithiothreitol, and 10 M Sodium meta-bisulfite
• RNA pellet was washed with 70% ethanol and dried under vacuum. RNA was resuspended in sterile H2O and stored at -80°C.
• RT-PCR thermostable rTth DNA Polymerase
• the PCR reaction was performed for 35 cycles using the following parameters; incubation at 96°C for I minute, dcnaiuraiion ai 94"C for 0 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 3 mins. ⁇ n aliquot of 0.2x vol. of each RT-PCR reaction was electrophoresed on a 2% 3: 1 Agarose (FMC) gel using standard TAE agarose gel conditions.
• FMC Agarose
• This primer covers the 10 base pair ribozyme arm and the first 6 bases of the ribozyme catalytic domain.
• GBSS ribozyme expression in transgenic callus and plants was confirmed by RT-PCR.
• GBSS multimer ribozyme expression in stably transformed callus was also determined by Ribonuc lease Protection Assay.
• This primer spans the junction of the BAR gene and the RPA85/113 ribozyme.
• This primer covers the 10 base pair ribozyme arm and the first 6 bases of the ribozyme catalytic domain.
• RPA118/RPA1 19 453 ribozyme multimer
• This primer covers die Adh I intron footprint upstream of the first ribozyme arm.
• Expression of ⁇ 9 desaturase ribozymes in transgenic plant lines 85-06, 1 13-06 and 85-15 were confirmed by RT-PCR.
• P ⁇ mers were prepared using standard oligo synthesis protocols on an Applied Biosystems Model 394 DNA/RNA synthesizer.
• RNA was dried under vacuum, resuspended in loading buffer (20mM phosphate buffer pH 6.8, 5mM EDTA; 50% formamide: 16% formaldehyde: 10% glycerol) and denatured for 10 minutes at 65°C. Electrophoresis was at 50 volts through 1 % agarose gel in 20 mM phosphate buffer (pH 6.8) with buffer recirculation. BRL 0.24-9.5 Kb RNA ladder (Gibco/BRL, Gaithersburg, MD) were stained in gels with ethiduim bromide.
• the probes were made using the Ambion Maxiscript kit and were typically 10 s cpm/ microgram or higher. The probes were made the same day they were used. They were gel purified, resuspended in RNase-freelOmM Tris (pH 8) and kept on ice. Probes were diluted to 5xl0 5 cpm/ul immediately before use. 5 ⁇ g of RNA derived from callus or 20 ⁇ g of RNA derived from protoplasts was incubated with 5 x 10 5 cpm of probe in 4M Guanidine Buffer.
• RNA Running Buffer 95% Formamide/20mM EDTA/0.1% Bromophenol Blue/0.1% Xylene Cyanol ). The sample was heated to 95° C for 3 minutes, and loaded onto an 8% denaturing acrylamide gel. The gel was vacuum dried and exposed to a phosphorimager screens for 4 to 12 hours.
• Part B Results demonstrating reductions in GBSS mRNA levels in nongenerable callus expressing both a GBSS and GBSS targeted ribozyme RNA.
• the production of nonregenerable callus expressing RNAs for the GBSS target gene and an active multimer ribozyme targeted to GBSS mRNA was performed. Also produced were transgenics expressing GBSS and a ribozyme (-) control RNA. Total RNA was prepared from the transgenic lines. Northern analysis was performed on 7 ribozyme (-) control transformants and 8 active RPA63 lines. Probes for this analysis were a full length maize GBSS cDNA and a maize ⁇ 9 cDNA fragment.
• GBSS mRNA levels due to loading or handling errors from true ribozyme mediated RNA reductions
• level of GBSS mRNA was compared to the level of ⁇ 9 mRNA within that sample.
• the level of full length GBSS transcript was compared between ribozyme expressing and ribozyme minus calli to identify lines with ribozyme mediated target RNA reductions. Blot to blot variation was controlled by performing duplicate analyses.
• a range in GBSS/ ⁇ 9 ratio was observed between ribozyme (-) transgenics.
• the target mRNA is produced by a transgene and may be subject to more variation in expression men the endogenous ⁇ 9 mRNA.
• Active lines (RPA 63) AA, EE, KK, and JJ were shown to reduce the level of GBSS/ ⁇ 9 most significantly, as much as 10 fold as compared to ribozyme (-) control transgenics this is graphed in Figure 25. Those active lines were shown to be expressing GBSS targeted ⁇ bozyme by RT-PCR as desc ⁇ bed herein.
• the probes for this analysis were cDNA fragments from a maize ⁇ 9 desaturase cDNA and a maize actin cDNA.
• the level of ⁇ 9 mRNA was compared to the level of actin mRNA within that sample.
• a ratio was calculated for each sample.
• ⁇ 9/actin ratio values ranging from 0.55 to 0.88 were calculated for the 85-06 plants.
• the average ⁇ 9/actm value for non- transformed controls was 2.7. There is an apparent 4 fold reduction in ⁇ 9/actm ratios between 85-06 and NT leaves.
• Plants were produced which were transformed with inactive versions of the ⁇ 9 desaturase ribozyme genes. Data was presented demonstrating control levels of leaf stearate in the inactive ⁇ 9 ribozyme transgenic lines RPA 1 13-06 and 1 13- 17. Ribozyme expression and northern analysis was performed for the RP ⁇ 1 13-06 line. ⁇ 9 dcsaiurasc protein levels were dete ⁇ nined in plants of the RP ⁇ I 13- 17 line Kibo/ymc expression was measured as described herein. Plants 1 13-06-04, -07, and - 10 expressed detectable levels of RPA 1 13 inactive ⁇ 9 ribozyme.
• the supernatant was assayed for total protein concentration by Bio-Rad protein assay kit (Bio-Rad Laboratories, Hercules, CA). One hundred micrograms of total protein was brought up to a final volume of 500 ⁇ l in Buffer A, added to 50 ⁇ l of mixed SP-sepharose beads (Pharmacia Biotech Inc., Piscataway, NJ), and resuspended by vortexing briefly. Proteins were allowed to bind to sepharose beads for 10 minutes while on ice.
• the ⁇ 9 desaturase-sepharose material was centrifuged (10,000 x g) for 10 seconds, decanted, washed three times with Buffer A (500 ⁇ l), and washed one time with 200 mM sodium chloride (500 ⁇ l). Proteins were eluted by boiling in 50 ⁇ l of Treatment buffer (125 mM Tris-Cl pH 6.8, 4% sodium dodecyl sulfate, 20% glycerol. and 10% 2-mercaptoethanol) for 5 mintues. Samples were centrifuged (10,000 x g) for 5 minutes. The supernatant was saved for Western anaylsis and the pellet consisting of sepharose beads was discarded.
• Treatment buffer 125 mM Tris-Cl pH 6.8, 4% sodium dodecyl sulfate, 20% glycerol. and 10% 2-mercaptoethanol
• Part B Western analysis method which was used to demonstrate reductions in stearoyl- ACP ⁇ 9 desaturase.
• Partially purified proteins were separated on sodium dodecyl sulfate (SDS)-polyacrylamide gels (10% PAGE) as described by Lacmmli, U. K. ( 1 70) Cleavage of structural proteins during assembly of the head of phage T4, Nature 227, 660-685.
• SDS sodium dodecyl sulfate
• Proteins were electrophoretically transferred to ECL 1M nitrocellulose membranes (Amersham Life Sciences, Arlington Heights, Illinois) using a Pharmacia Semi-Dry Blotter (Pharmacia Biotech Inc., Piscataway, NJ), using Towbin buffer (Towbin et al. 1979). The nonspecific binding sites were blocked with 10% dry milk in phosphate buffer saline for 1 h. Immunoreactive polypeptides were detected using the ECLTM Western Blotting Detection Reagent (Amersham Life Sciences, Arlington Heights, Illinois) with rabbit antiserum raised against E. coli expressed maize ⁇ 9 desaturase. The antibody was produced according to standard protocols by Berkeley Antibody Co.
• the secondary antibody was goat antirabbit serum conjugated to horseradish peroxidase (BioRad). Autoradiograms were scanned with a densitometer and quantified based on the relative amount of purified E. coli ⁇ 9 desaturase. These experiments were duplicated and the mean reduction was recorded.
• RPA85-15 contains an intact copy of the fused multimer gene. ⁇ 9 desaturase was partially purified from R0 maize leaves, using the protocol described herein. Western analysis was performed on ribozyme active (RPA85-15) and ribozyme inactive
• Example 31 E. coli Expression and Purification of Maize ⁇ .-9 desaturase enzyme
• the mature protein encoding portion of the maize ⁇ -9 desaturase cDNA was inserted into the bacterial T7 expression vector pET9D (Novagen Inc., Madison, WI).
• the mature protein encoding region was deduced from the mature castor bean polypeptide sequence.
• the alanine at position 32 (nts 239-241 of cDN ⁇ ) was designated as die first residue. This is found within the sequence Ala.Val.Ala.Ser.Met.Thr. Restriction endonuciease Nhe I site was engineered into the maize sequence by PCR, modifying GCCTCC to GCTAGC and a BamHl site was added at the 3' end. This does not change the amino acid sequence of the protein.
• the cDNA sequence was cloned into pET9d vector using die Nhe I and Bam HI sites.
• the recombinant plasmid is designated as pDAB428.
• the maize ⁇ -9 desaturase protein expressed in bacteria has an additional methionine residue at the 5' end.
• This pDAB428 plasmid was transformed into the bacterial strain BL21 (Novagen, Inc., Madison, WI) and plated on LB/kanamycin plates (25 mg/ml). Colonies were resuspended in 10 ml LB with kanamycin (25 mg/ml) and IPTG (ImM) and were grown in a shaker for 3 hours at 37°C.
• the cells were harvested by centrifugation at lOOOxg at 4°C for 10 minutes.
• the cells were lysed by freezing and thawing the cell pellet 2X, followed by the addition of 1 ml lysis buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 150 mM NaCl, 0.1 % Triton XI 00, 100 ug/ml DNAse I, 100 ug ml RNAse A, and 1 mg/ml lysozyme).
• the mixture was incubated for 15 minutes at 37°C and then centrifuged at 1000 Xg for 10 minutes at 4°C. The supernatant is used as the soluble protein fraction.
• the supernatant adjusted to 25 mM sodium phosphate buffer (pH 6.0), was chilled on ice for 1 hr. Afterwards, d e resulting flocculant precipitant was removed by centrifugation. The ice incubation step was repeated twice more after which the solution remained clear.
• the clarified solution was loaded onto a Mono S HR 10/10 column (Pharmacia) that had been equilibrated in 25 mM sodium phosphate buffer (pH 6.0). Basic proteins bound to the column matrix were eluted using a 0-500 mM NaCl gradient over 1 hr (2 ml min; 2 ml fractions).
• the putative protein of interest was subjected to SDS-PAGE, blotted onto PVDF membrane, visualized with coomassie blue, excised, and sent to Harvard Microchem for amino-terminal sequence analysis. Comparison of the protein's amino terminal sequence to that encoded by the cDNA clone revealed that the protein was indeed ⁇ 9.
• Spectrophotomet ⁇ c analysis of the duron-oxo component associated with the expressed protein (Fox et al., 1993 Proc. Natl. Acad. Sci USA. 90. 2486-2490), as well as identification using a specific ⁇ onheme iron stain (Lcong et al., 1992 Anal. Biochem. 207, 317-320) confirmed that the purified protein was ⁇ -9
• Protein Precipitation ⁇ 9 was purified from com kernels following homogenization using a Warring blender in 25 mM sodium phosphate buffer (pH 7.0) containing 25 mM sodium bisulfite and a 2.5% polyvinylpolypyrrolidone. The crude homogenate was filtered through cheesecloth, centrifuged (10,000xg) for 0.25 h and the resulting supernatant was filtered once more through cheesecloth. In some cases, the supernatant was fractionated via saturated ammonium sulfate precipitation by precipitation at 20% v/v followed by 80% v/v.
• Acyl Carrier Protein-Sepharose Chromatography AC? was purchased from Sigma Chemical Company and purified via precipitation at pH 4.1 (Rock and Cronan. 1981 J. Biol. Chem. 254, 71 16-7122) before linkage to the beads.
• ACP-sepharose was prepared by covalently binding 100 mg of ACP to cyanogen bromide activated sepharose 4B beads, essentially as desc ⁇ bed by Pharmacia, Inc., in the package insert After linkage and blocking of the remaining sites with glycine, the ⁇ CP-scpharose material was packed into a HR 5/5 column (Pharmacia, Inc.) and equilibrated in 25 mM sodium phosphate buffer (pH 7.0).
• the ⁇ -9 protein purified from com was determined to have a molecular size of approximately 38 kDa by SDS-PAGE analysis (Hames, 1981 in Gel Electrophoresis of Proteins: A Practical Approach , eds Hames BD and Rickwood, D. , IRL Press, Oxford).
• Phenyl Sepharose Chromatography The fractions containing ⁇ 9 obtained from the ACP- Sepharose column were adjusted to 0.4 M ammonium sulfate (25 mM sodium phosphate, pH 7.0) and loaded onto a Pharmacia Phenyl Superose column (HR 10/10). Proteins were eluted by running a gradient (0.4 - 0.0 M ammonium sulfate) at 2 ml min for 1 hour. The ⁇ 9 protein typically eluted between 60- and 30 mM ammonium sulfate as detennmed by enzymatic and western analysis.
• Example 32 Evidence for the Increase in Stearic Acid in Leaves as a Result of Transformation of Plants with ⁇ 9 Desaturase Ribozymes
• the fatty acid methyl esters were removed from the reaction mixture by extraction with hexane.
• One ml of hexane aid 1 ml of 0.9% (w/v) NaCl was added followed by vigorous shaking of the test tubes. After centrifugation of the tubes at 2000 ⁇ m for 5 minutes the top hexane layer was removed and used for fatty acid methyl ester analysis.
• Gas chromatograph analysis was performed by injection of 1 ⁇ l of the sample on a Hewlett Packard (Wilmington, DE) Series II model 5890 gas chromatograph equipped with a flame lonization detector and a J&W Scientific (Folsom, CA) DB-23 column.
• the oven temperature was 150°C throughout the run and the flow of the carrier gas (helium) was 80 cm/see The run time was 20 minutes
• the conditions allowed for the separation of the 5 fatty acid methyl esters of interest C I 0, palmityl methyl ester; C18:0, stearyl methyl ester; C18.1 , oleoyl methyl ester; C I :2, linolcoyl methyl ester; and C18:3, linolenyl methyl ester.
• Data collection and analysis was performed with a Hewlett Packard Se ⁇ es II Model 3396 integrator and a PE Nelson (Pcrkm Elmer, Norwalk, CT) data collection system.
• the percentage of each fatty acid in the sample was taken directly from the readouts of the data collection system. Quantitative amounts of each fatty acid were calculated using the peak areas of a standard (Matreya, pleasant Gap, PA) which consisted of a known amount of the five fatty acid methyl esters. The amount calculated was used to estimate the percentage, of total fresh weight, represented by the five fatty acids in the sample. An adjustment was not made for loss of fatty acids during the extraction and esterification procedure. Recovery of the standard sample, after subjecting it to the extraction and esterification procedure (with no tissue present), ranged from 90 to 100% depending on the original amount of the sample. The presence of plant tissue in the extraction mixture had no effect on the recovery of the known amount of standard.
• Part B Demonstration of an increase in steanc acid in leaves due to introduction of ⁇ 9 desaturase ribozymes.
• Leaf tissue from individual plants was assayed for stearic acid as described in Part A.
• a total of 428 plants were assayed from 35 lines transformed with active ⁇ 9 desaturase nbozymes (RPA85, RPA 1 14, RPA 1 18) and 406 plants from 31 lines transformed with ⁇ 9 desaturase inactive ribozymes (RPA1 13, RPA1 15, RPA1 19).
• Table XI summarizes the results obtained for stearic acid levels in these plants. Seven percent of the plants from the active lines had stearic acid levels greater than 3%, and 2% had levels greater than 5%.
• Part B Results demonstrating reductions m ⁇ 9 desaturase levels in next generation (RI ) maize leaves expressing ribozymes targeted to ⁇ 9 desaturase mRNA
• RI next generation
• ⁇ 9 desaturase was partially purified from RI maize leaves, using the protocol described herein. Western analysis was performed on several of the high stearate plants. In leaves of next generation plants, a 40-50% reduction of ⁇ 9 desaturase was observed in those plants that had high stearate content ( Figure 36). The reduction was comparable to RO maize leaves. This reduction was observed in either OQ414 plants crossed with RP ⁇ 85- I 5 pollen or RPA85-15 plants crossed with self or siblings. Therefore, this suggests that the gene encoding the ribozyme is heritable.
• Somatic embryos make up a large part of this embryogenic callus.
• the somatic embryos continued to form in callus because e callus was transferred every two weeks.
• the somatic embryos in embryogenic callus continued to proliferate but usually remained in an early stage of embryo development because of the 2,4-D in the culture medium.
• the somatic embryos regenerated into plantlets because the callus was subjected to a regeneration procedure described herein. During regeneration the somatic embryo formed a root and a shoot, and ceases development as an embryo.
• Somatic embryos were made to develop as seed embryos, i.e., beyond the early stage of development found in embryogenic callus and no regeneration, by a specific medium treatment.
• This medium treatment involved transfer of the embryogenic callus to a Murashige and Skoog medium (MS; described by Murashige and Skoog in 1962) which contains 6% (w/v) sucrose and no plant hormones.
• MS Murashige and Skoog medium
• ABA abscisic acid
• the somatic embryos were assayed for fatty acid composition as described herein after 3 to 7 days of growth on the ABA medium.
• the fatty acid composition of somatic embryos grown on the above media was compared to the fatty acid composition of embryogenic callus and maize zygotic embryos 12 days after pollination (Table XIII).
• the fatty acid composition of the somatic embryos was different than that of the embryogenic callus.
• the embryogenic callus had a higher percentage of C16.0 and C18:3, and a lower percentage of Cl 8: 1 and Cl 8:2.
• the percentage of lipid represented by the fresh weight was different for the embryogenic callus when compared to the somatic embryos; 0.4% versus 4.0%.
• the fatty acid composition of the zygotic embryos and somatic embryos were very similar and their percentage of lipid represented by the fresh weight were nearly identical. It was 97/10328
• somatic embryo culture system desc ⁇ bed above would be an useful in vitro system for testing the effect of certain genes on lipid synthesis in developing embryos of maize.
• Somatic embryos were produced using th method described herein from embryogenic callus transformed with pD ⁇ B308/pD ⁇ B430
• the somatic embryos from 16 different lines were assayed for fatty acid composition.
• the stearic acid content of somatic embryos from these two lines is compared to the stearic acid content of somatic embryos from their control lines in Figures 37 and 38.
• the control lines were from the same culture that the transformed lines came from except that they were not transformed.
• stearic acid in somatic embryos ranged from 1 to 23% while the controls ranged from 0.5 to 3%.
• steanc acid in somatic embryos ranged from 2 to 15% while the controls ranged from 0.5 to 3%. More than 50% of the somatic embryos had stearic acid levels which were above the range of the controls m both the transformed lines. The above results indicate that an antisense- ⁇ 9 desaturase gene can be used to raise the stearic acid levels in somatic embryos of maize.
• Part C Demonstration of an increase in stearic acid in leaves due to introduction of an antisense- ⁇ 9 desaturase gene.
• Embryogenic cultures from lines 308/430-12 and 308/430- 15 were used to regenerate plants. Leaves from these plants were analyzed for fatty acid composition using the method previously described. Only 4 plants were obtained from the 308/430-15 culture and the stearic acid level in the leaves of these plants were normal, 1-2%).
• the stearic acid levels in leaves from plants of line 308/430-12 are shown in Figure 39. The stearic acid levels in leaves ranged from 1 to 13% in plants from line 308/430-12.
• antisense is meant a non-enzymatic nucleic acid molecule that binds to a RNA (target RNA) by means of RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid; Egholm et al., 1993 Nature 365, 566) interactions and alters the activity of the target RNA (for a review see Stein and Cheng, 1993 Science 261, 1004).
• target RNA RNA
• RNA-RNA or RNA-DNA or RNA-PNA protein nucleic acid
• amylose content was assayed by the method of Hovenkamp-Hermelink et al.
• the matenal was then centnfuged at 5000 g for 2 mm and the supernatant was discarded The pellet was washed three times by resuspending in water and removing supernatant by centrifugation After washing, die starch was filtrated through 20 ⁇ m nylon membrane and centnfuged. Pellet was then lyophilized and stored in - 20 °C until used for activity assay.
• a standard GBSS reaction mixture contained 0.2 M T ⁇ cine, pH 8.5, 25 mM Glutathione, 5 mM EDTA, 1 mM ⁇ 4 C ADPG (6 nci/ ⁇ mol), and 10 mg starch in a total volume of 200 ⁇ l. Reactions were conducted at 37 °C for 5 min and terminated by adding 200 ⁇ l of 70% ethanol (v/v) m 0.1 M KCI.
• CQ806 Twenty five individual kernels of CQ806, a conventional maize inbred line, were analyzed. The amylose content of CQ806 ranged from 24.4% to 32.2%, averaging 29.1%). The single kernel distribution of amylose content is skewed slightly towards lower amylose contents. Forty nine single kernels of 308/425-12.2.1.1 were analyzed. Given that 308/425-12.2.1.1 resulted from self pollination of a hemizygous individual, the expected distribution would consist of 4 distinct genetic classes present in equal frequencies since endosperm is a triploid tissue. The 4 genetic classes consist of individuals carrying 0, 1, 2, and 3 copies of the antisense construct.
• the dist ⁇ bution of amylose contents would be tetramodal.
• One of the modes of the resulting distribution should be indistinguishable from the non-transgenic parent. If there is no dosage effect for the transgene (individuals carrying 1, 2 or 3 copies of the transgene are phenotypically equivalent), then the distribution should be bimodal with one of the modes identical to the parent The number of individuals included in the modes should be 3:1 of transgenieparental The distribution for 308/425-12.2.1.1 is distinctly trimodal. The central mode is approximately twice the size of either other mode. The two distal modes are of approximately equal size. Goodness of fit to a 1 :2: 1 ratio was tested and the fit was excellent. 97/10328
• the central mode includes two generic classes: individuals with 1 or 2 copies of the antisense construct.
• the mode with the lowest amylose content thus represents those individuals which are fully homozygous (3 copies) for the antisense construct.
• the 2: 1 ratio was tested and could not be rejected on the basis of the data.
• Example 37 The same two-step screening strategy as in the antisense study (Example 37) was used to analyze ribozyme-GBSS plants. 160 lines representing 1 1 transformation events were examined in the pooled starch level. Among the control lines (both untransformed line and Southem negative line), the amylose content varied from 28% to 19%. No significant reduction was observed among all lines carrying ribozyme gene (Southem positive line). More than 20 selected lines were further analyzed in the single kernel level, no significant amylose reduction as well as segregation pattern were found. It was apparent that ribozyme did not cause any alternation in the phenotypic level.
• Transformed lines were further examined by their GBSS activity (as described in Example 36). For each line, 30 kernels were taken from the frozen ear and starch was purified. Table XIV shows the results of 9 plants representing one transformation event of the GBSS activity in the pooled starch samples, amylose content in the pooled starch samples, and Southem analysis results. Three southem negative lines: RPA63.0283, RPA63.0236, and RPA63.0219 were used as control. The GBSS activities of control lines RPA63.0283, RPA63.0236, and RPA63.0219 were around 300 units/mg starch.
• GBSS activities at the single kernel level of line RP ⁇ 63.021 was further examined, using RP ⁇ 63.0306 (Southern negative and GBSS activity normal in pooled starch) as control. About 30 kernels from each line were taken, and starch samples were purified from each kernel individually. Figure 41 clearly indicated reduced GBSS activity in line RPA63.0218 compared to RPA63.0306.
• the small (4-6 nt) binding site may make this ribozyme too non-specific for targeted RNA cleavage, however, the Tetrahymena group I intron has been used to repair a "defective" b-gaiactosidase message by the ligation of new b-galactosidase sequences onto the defective message ["].
• RNAse P RNA M1 RNA
• RNA portion of a ubiquitous nbonucleoprotein enzyme • RNA portion of a ubiquitous nbonucleoprotein enzyme.
• Reaction mechanism possible anack by M* * -OH to generate cleavage products with 3'-OH and 5 " -phosphate.
• RNAse P is found throughout the prokaryotes and eukaryotes.
• the RNA subunit has been sequenced from bacteria, yeast, rodents, and primates.
• Reaction mechanism attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2 ⁇ 3'-cyclic phosphate and 5'-OH ends.
• Reaction mechanism attack by 2 -OH 5' to the scissile bond to generate cleavage products with 2', 3 '-cyclic phosphate and 5' -OH ends.
• RNA RNA as the infectious agent.
• Ligation activity (in addition to cleavage activity) makes ribozyme amenable to engineering through in vitro selection [ 3I ]
• HDV Hepatitis Delta Virus
• Circular form of HDV is active and shows increased nuclease stability [ 37 ]
• a group II intron RNA is a catalytic component of a DNA endonuclease involved in intron mobility. Cell (Cambridge. Mass.) (1995), 83(4). 529-38.
• X represents stem II region of a HH ribozyme (Hertel et al., 1992 Nucleic Acids Res. 20 3252).
• the length of stem II may be ⁇ 2 base-pairs.
• X represents stem II region of a HH ribozyme (Hertel et al.. 1992 Nucleic Acids Res. 20 3252).
• the length of stem II may be ⁇ 2 base-pairs.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Nutrition Science (AREA)
• Cell Biology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Medicinal Chemistry (AREA)
• Virology (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=21694555

Family Applications (1)

Country Status (8)

Families Citing this family (25)

Family Cites Families (9)

• 1996
  • 1996-07-12 BR BR9610402-3A patent/BR9610402A/pt unknown
  • 1996-07-12 EP EP96927999A patent/EP0842286A2/en not_active Withdrawn
  • 1996-07-12 AU AU67617/96A patent/AU6761796A/en not_active Abandoned
  • 1996-07-12 CN CN 96196925 patent/CN1196091A/zh active Pending
  • 1996-07-12 MX MX9800454A patent/MX9800454A/es not_active Application Discontinuation
  • 1996-07-12 JP JP9506989A patent/JPH11509733A/ja active Pending
  • 1996-07-12 CA CA 2226728 patent/CA2226728A1/en not_active Abandoned
  • 1996-07-12 WO PCT/US1996/011689 patent/WO1997010328A2/en not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events