CA2226728A1 - Compositions and method for modulation of gene expression in plants - Google Patents

Abstract

An enzymatic nucleic acid molecule with RNA cleaving activity, wherein said nucleic acid molecule modulates the expression of a gene in a plant. A
transgenic plant comprising nucleic acids encoding for an enzymatic nucleic acid molecule with RNA cleaving activity, wherein said nucleic acid molecule modulates the expression of a gene in said plant.

Description

PCT~US96/11689 DESCRIPTION
COMPOSITIONS AND METHOD FOR MODULATIO~I OF GEi\E
EXPRESSION ~N PLA~\'TS
This application is a continuation-in-part of: l) a Non-l'rovisioll.ll a~ lic.l~ioll by 5 Edington, entitled "Method for the production of tralls~cllic l11.lllts clcflciclll ilm ~ rcll granule bound glucose starch ~lycosyl transfcMsc activi~y" filc(l 011 ~Scr~lclllbcr 2, 1~)')4 ~lS
U.S.S.N. 08/300,726; and 2) a Provisional application by Zwick et al., entitled "Composition and method for modification of fatty acid saturation profile in plants" filed on July 13, 1995, as U.S.S.N 60/001,135. Both of thesc ar~plicatiolls in thcir cntircty, 10 including drawings, are hereby incorporated by reference herein.
Back~round of the Invention The present invention concerns compositions and methods for the modulation of gene c;Ay~es~ion in plants, specific~lly using enzymatic nucleic acid molecules.
The following is a brief description of regulation of gene e,~yl~s~ion in plants. The ;u~j~ion is not meant to be complete and is provided only for understanding of the invention that follows. This s~ y is not an aAmic~ion that any of the work described below is prior art to the claimed invention.
There are a variety of strategies for mod~ ting gene e~yl~ssion in plants.
Tr~ on~lly~ ~nti~?n~e RNA (reviewed in Bourque, 1995 Plant Sci 105, 125-149) and co-su~pression (reviewed in Jorgel1sen, 1995 Science 268, 686-691) approaches have been used to modulate gene e~ylession. Insertion mutagenesis of genes have also been used to silence gene e,~,e;.~ion. This approach, however, cannot be ~esign.-d to specifically-inactivate the gene of interest. Applicant believes that ribozyme technology offers an attractive new means to alter gene expression in plants.
Naturally occumng ~nticence RNA was first discovered in bacteria over a decade ago (Simons and Kleckner, 1983 Cell 34, 683-691). It is thought to be one way in which bacteria can regulate their gene e,~,ession (Green et al., 1986 Ann. Rev. Biochem. 55: 567-597; Simons 1988 Gene 72: 35-44). The first demonstration of antisense-nle~ ted rl 30 inhibitionofgenee~y-~ ionwasreportedinm~mm~ ncells(IzantandWeintraub 1984 Cell 36: 1007-1015). There are many examples in the literature for the use of antisense A to modulate gene e~y~ession in plants. Following are a few examples:

SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 Shewmaker et al., U.s. Patent Nos 5,107.065 and 5. ~53,566 disclose methods for regulating gene e~p~ssion in plants using antisense RNA.
It has been shown that an antisense gene expressed in plants can act as a dominallt suppressor gene. Transgenic potato plants have been produced which exprcss RNA
5 an~icen~e to potato or cassava granule bound starch synthasc (~SS). hl holh ol ~hcsc cases, transgenic plants have becn constructcd whicll havc rccl(lccd or no (il~ C~iVily or protein. These transgenic plants give rise to potatoes containing starch with dramatically reduced amylose levels (Visser et al. 1991, Mol. Gen. Genet. 225: 2889-296;
~s7lleh~ A~n~ll et al. 1993, PlantMol. Biol. 23: 947-962).
Kull et al., 1995, J. Genet. & Breed 49, 69-~6 reported inhibition of amylose biosynthesis in tubers from transgenic potato lines m~ t~d by the expression of ;c~ e sequences of the gene for granule-bound starch synthase (GBSS). The authors, however, inrlic~ttod a failure to see any in vivo activity of ribozymes targeted against the GBSS RNA.
,~nticence RNA constructs targeted against A-9 desaturase enzyme in canola have been shown to increase the level of stearic acid (C18:0) from 2% to 40% (Knutzon et. al., 1992 Proc. Natl. Acad. Sci. 89, 2624). There was no de~ ase in total oil content or ion efficiency in one of the high stearate lines. Several recent reviews are available which illustrate the utility of plants with modified oil composition (Ohlrogge, J.
B. 1994 Plant Physiol. 104, 821; Kinney, A. J. 1994 Curr. Opin. Cell Biol. 5, 144; Gibson et al. 1994 Plant Cell Envir. 17, 627).
Homologous transgene inactivation was first doc~mçnted in plants as an unexpected result of inserting a transgene in the sense orientation and finding that both the gene and the ~ g~-e were down-regul~te~l (Napoli et al., 1990 Plant Cell 2: 279-289). There appears to be at least two "~ for inactivation of homologous genetic sequences.
One appears to be llal1sc,i~tional inactivation via methylation, where duplicated DNA
regions signal endogenous mech~ni~m~ for gene silencing. This approach of gene modt~ on involves either the introduction of multiple copies of transgenes or l~a~sru~ ation of plants with transgenes with homology to the gene of interest (Ronchi et al 1995 EMBO J. 14: 5318-5328). The other mechanism of co-suppression is post-,ls.,.;~lional, where the combined levels of expression from both the gene and the ,ansgel-e is thought to produce high levels of transcript which triggers threshold-induced SUBSTITUTE SHEET (RULE 26) degradation of both messages (van Bokland et al, 1994 Plant J 6: 861-877). The exact molecular basis for co-suppression is unknown.
Unfortunately, both antisense and co-suppression technologies are subject to problems in heritability of the desired trait (Finnegan and McElroy 1994 Bio/Tec*nolo~y 12: 883-888). Currently, there is no easy way to specifically inactivatc a L~cnc nf in~crcst ~, at the DNA level in plants (Pazkowski et al., 1988 kM~O~/. 7: 4021-4026). l rallsposoll mutagenesis is inefficient and not a stable event, while chemical mutagenesis is highly non-specific.
Applicant believes that ribozymes present an attractive alternative and because of their catalytic "~ ;cm of action, have advantages over competing technologies.
However, there have been difficulties in demonstrating the effectiveness of ribozymes in mo~ fing gene eA~ res.,ion in plant systems ( Mazzolini et al., 1992 Plant Mol. Biol. 20:
715-731; Kull et al., 1995 J. Genet. & Breed. 49: 69-76). Although there are reports in the IiL~lUI~ of ribozyme activity in plants cells, almost all of them involve down re~l~tion of exogenously introduced genes, such as reporter genes in transient assays (S~e;~r~L~ et al., 1992 EMBO J. 1 1: 1525-1530; P~ .lilllall et al., 1993 Antisense Res. Dev.
3: 253-263; P.,.l;l~ et al., 1995, Proc. Natl. Acad. Sci. USA, 92, 6165).
There are also several publications, te.g, Lamb and Hay, 1990, J. Gen. Virol. 71, 2257-2264; Gerlach et al., T..l. .-~I;onal PCT Publication No. WO 91/13994; Xu et aL, 1992, Science in China ~Ser. BJ 35, 1434-1443; Edington and Nelson, 1992, in Gene Regulation: Biology of antisense RNA and DNA, eds. R. P. Erickson and J. G. Izant, p p 209-221, Raven Press, NY.; Atkins et al., International PCT Publication No. WO
94/00012; Lenee et al., International PCT Publication Nos. WO 94/19476 and WO
9503404, Atkins et al., 1995, J. Gen. Virol. 76, 1781-1790; Gruber et al., 1994, J. Cell.
Biochem. Suppl. 18A, 110 (X1-406) and Feyter et al., 1996, Mol. Gen. Genet. 250, 329-338], tnat l)ro~ose using h~.. ~.l.P~cl ribozymes to modulate: virus replication, ~A~.cssion of viral genes and/or reporter genes. None of these publications report the use of ribozymes to modulate the e~ ,sion of plant genes.
Mazzolini et al., 1992, Plant. Mol. Bio. 20, 715-731; Steinecke et al., 1992, EMBO.
J. Il, 1525-1530; Pc~ dl- et al., 1995, Proc. Natl. Aead. Sci. USA., 92, 6175-6179;
Wegener et al., 1994, Mol. Gen. Genet. 245, 465-470; and Stein~clce et al., 1994, Gene, 149, 47-54, describe the use of h~rnmerhead ribozymes to inhibit expression of reporter genes in plant cells.

SUBSTITUTE SHEET (RULE 26) CA 02226728 l99X-01-13 Bennett and Cullimore, 1992 Nucleic Acids Res. 20, 831-837 demonstrate h~mmrrhe~d ribozyme-mediated in vitro cleavage of glna, glnb, gl~.~g and glnd RNA, coding for glut~mine svnthetase enzyme in Phaseolus v~lgaris.
Hitz et al., (WO 91/18985) describe a method for usl~ng the soybcall a-9 dcsaturasc 5 enzyme to modify plant oil composition. The applicatiol1 clcscrihcs tl-c usc of soybcal1 A-9 desaturase sequence to isolate ~-9 desaturasc gcncs f'rol1l oll1cl sr)ccics.
The lefe,~.lces cited above are distinct from the presently claimed invention since they do not disclose and/or contemplate the use of ribozymes in maize. Furthermore, Applicant believes that the references do not disclose and/or cnablc thc usc Or riboizylllcs 10 to down regulate genes in plant cells, let alone plants.

Summary Of The Invention The invention fea~ s modulation of gene expression in plants specifically using enzymatic nucleic acid molecules. Preferably, the gene is an endogenous gene. The enzymatic nucleic acid molecule with RNA cleaving activity may be in the forrn of, but 15 not limited to, a ha~ -l-ead, hairpin, hepatitis delta virus, group I intron, group ~1 intron, RNaseP RNA, Neurospora VS RNA and the like. The enzymatic nucleic acid molecllle with RNA cleaving activity may be encoded as a monomer or a multimcr, preferably a mllltim~n The nucleic acids encoding for the enzymatic nucleic acid molec~,.le with RNA cleaving activity may be operably linked to an open reading frame. Gene20 e~yl~ssion in any plant species may be modified by transformation of the plant with the nucleic acid encoding the enzymatic nucleic acid molec-lles with RNA cleaving activity.
There are also numerous technologies for tl~nsrol'l,illg a plant: such technologies include but are not limited to transf~.llllation with Agrobacterium, bonlba,di~g with DNA coated microprojectiles, whiskers, or electroporation. Any target gene may be modified with the 25 nucleic acids Pnrodin~ the enzymatic nucleic acid.molecules with RNA cleaving activity.
Two targets which are exemplified herein are delta 9 desaturase and granule bound starch synthase (GBSS).
Until the discovery of the inventions herein, nucleic acid-based reagents, such as enzymatic nucleic acids (ribozymes), had yet to be demonstrated to modulate and/or 30 inhibit gene ~ c~.sion in plants such as monocot plants (e.g., cornJ. Ribozymes can be used to modulate a specific trait of a plant cell, for example, by modulating the activity of an enzyme involved in a biochemical pathway. It may be desirable, in some instances, to SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 decrease the level of expression of a particular gene, rather thall shutting down expression completely: ribozymes can be used to achieve this. Enzymatic nucleic acid-based techniques were developed herein to allow directed modulation of gene exr~rcssion to generate plant cells, plant tissues or plants with altered phenotype.
Ribozymes (i.e., enzymatic nucleic acids) arc nuclcic acid n1olcculcs h.lvil1g aenzymatic activity which is able to rcpcatcdly clcavc oll1cl sc~ c I~N/~ ok:e~llcs ilml nucleotide base sequence-specific manner. Such cnzyl11atic RN/~ InOICcLllC~i cal~ bc targeted to virtually any RNA transcript, and efficient cleava~e has been achieved in vitro and in vivo (Zaug et al., 1986, Nature 324, 429; Kim et al., 1987, Proc. Nu~l. Acad. Sci.
USA 84, 8788; Dreyfus, 1988, Einstein Quarterly J. Bio. Med., 6, 92; Hascloff and Gerlach, 1988, Nature 334 585; Cech, 1988, JAM~ 260, 3030; Murphy and Cech, 1989, Proc. Natl. Acad. Sci. USA., 86, 9218; Jefferies et al., 1989, Nucleic Acids Research 17, 1371).
ReC~ce of their sequence-specificity, trans-cleaving ribozymes may be used as efficient tools to modulate gene e~u,e~sion in a variety of organisms including plants, ~nim~lc snd h.~ c (Bennett et al., supra; F~lineton et al., supra; Usman & McSwiggen, 1995 Ann. ~ep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem.
38, 2023-2037). Ribozymes can be deci~cl to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the mRNA non-functional and abrogates protein ~,Lpre~sion from that RNA. In this manner, synthesis of a protein associated with a particular phenotype and/or disease state can be selectively inhibited.
Other fealul~s and advantages of the invention will be apparent from the following deswit,Lion ofthe plefel,ed embod;..,~ ; thereof, and from the claims.

Brief Descl i~,Lion of the Fi~ures Figure 1 is a ~ ic repreSçnt~tion of the hammerhead ribozyme domain known in the art. Stem II can be 2 2 base-pairs long. Each N is any nucleotide and each -represents a base pair.
Figure 2a is a dia~ ;c .~.res~,llL~tion of the ha-,--..e-l-ead ribozyme domain known in the art; Figure 2b is a diagrammatic le~.ese~ tion of the hammerhead ribozyme as divided by Uhlenbeck (1987, Nature, 327, 596-600) into a substrate and enzymeportion; Figure 2c is a similar ~ ~m showing the h~mmerhead divided by Haseloff and SUBSTITUTE SHEET (RULE 26) Gerlach (1988, Nature, 334, 585-~91) into t~o portions; and Figure 2d is a similar diagram showing the hammerhead divided by Jeffries and Symolls (1989, Nucl. Acids.
Res., 17, 1371-1371) into two portions.
Figure 3 is a dia~-d~ -atic representation of the gcllcral struct~lre of a llairpin ribozyme. Helix 2 (H2) is provided with a least 4 base pairs (i.e., n is 1, 2, 3 or 4) and helix 5 can be optionally provided of Icngth 2 or morc b~scs (~rclcrably 3 - 20 b~l~cs, i.~., m is from 1 - 20 or more). Helix 2 and helix 5 may be covalcntly linkcd by onc or morc bases (i.e., r is ~ I base). Helix 1, 4 or 5 may also be extended by 2 or more base pairs (e.g, 4 - 20 base pairs) to stabilize the ribozyme structure, and preferably is a r~rotein binding site. In each instance, each N and N' independcntly is any nomlal or modificd base and each dash lel,lescl.ts a potential base-pairing interaction. These nucleotides may be modified at the sugar, base or phosphate. Complete base-pairing is not required in the helices, but is plefe,.cd. Helix 1 and 4 can be of any size (i.e. o and p is each in.l~pçndPntly from 0 to any number, e.g., 20) as long as some base-pairing is maintained.
F.~slonti~l bases are shown as specific bases in the structure, but those in the art will rCCO~li~c that one or more may be modified chemic~lly (abasic, base, sugar and/or phosph~fr modifications) or replaced with another base without significant effect. Helix 4 can be formed from two separate molecules, i.e., without a connecting loop. Thc c~-nec~ g Ioop when present may be a ribonucleotide with or without modifications to its base, sugar or phosphate. "q" is 2 2 bases. The connecting loop can also be replaced with a non-nucleotide linker molecule. H refers to bases A, U, or C. Y refers topyrimidine bases. " " refers to a covalent bond.
.
Figure 4 is a representation of the general structure of the hepatitis ~ virus ribozyme domain known in the art.
Figure S is a represlont~tion of the general structure of the self-cleaving VS RNA
ribozyme domain.
Figure 6 is a schematic rcp.es~ lion of an RNaseH accessibility assay.
Specifically, the left side of Figure 6 is a diagram of complementary DNA
oligonucleotides bound to arcessible sites on the target RNA. Complementary DNA
oligonucleotides are represented by broad lines labeled A, B, and C. Target RNA is .c~.ci,e..ted by the thin, twisted line. The right side of Fi~lre 6 is a schematic of a gel separation of uncut target RNA from a cleaved target RNA. Detection of target RNA is by autoradiography of body-labeled, T7 transcript. The bands common to each lane S~ JTE SHEET (RULE 26) represent uncleaved target RNA; the bands unique tO eacll lalle represellt the clcaved products.
Figure 7 is a graphical representation of RNaseH accessibility of GBSS RNA.
Figure 8 is a graphical representation of GBSS RNA Clc.lvagC ~y ri~)OZylllC~i al5 different temperatures.
Figure 9 is a graphical representation of GBSS RNA cleavage by multiple ribozymes.
Figure 10 lists the nucleotide sequence of A-9 desaturasc cDN~ isolatcd from 7,ea mays.
Figures 11 and 12 are dia~ Lic Ic~,resentatiolls of fatty acid biosynthesis in plants. Figure I I has been adapted from Gibson et al., 1994, Plant Cell f~;nvir. 17, 627.
Figures 13 and 14 are graphical ~ cs~.~t~tions of RNaseH accessibility of A-9 desaturase RNA.
Figure 15 shows cleavage of A-9 desaturase RNA by ribozymes in vitro. 10/10 15 r~,~Jles~ thelengthofthebindingarmsofah~ I.ead(HH)ribozyme. 10/10means hdix 1 and helix 3 each form 10 base-pairs with the target RNA (Fig. 1). 4/6 and 6/6, eyles~;nL helix2~elixl interaction between a hairpin ribozyme and its target. 4/6 means the hairpin (HP) ribozyme forrns four base-paired helix 2 and a six base-paired helix I
complex with the target (see Fig. 3). 6/6 means, the hairpin ribozyme forms a 6 base-20 paired helix 2 and a six base-paired helix 1 complex with the target. The cleavage reactions were carried out for 120 min at 26~C.
Figure 16 shows the effect of arm-length variation on the activity of HH and HP
ribozymes in vitro. 7/7, 10/10 and 12/12 are e~senti~lly as described above for the HH
ribozyme. 6/6, 6/8, 6/12 lepl~s, .-t~ varying helix 1 length and a constant (6 bp) helix 2 for 25 a hairpin ribozyme. The cleavage reactions were carried out essentially as described above.
Figures 17, 18, 19 and 23 are diagrammatic representations of non-limiting strategies to construct a transcript comprising multiple ribozyme motifs that are the same or different, targeting various sites within A-9 desaturase RNA.

SUBSTITUTE SHEET (RULE 26) Figures 20 and 21 show in vitro cleavage of a-s desaturase RNA bv ribozymes thatare transcribed from DNA templates using bacteriophage T7 RNA polymerase enzyme.
Figure 22 dia~,d-,llllatic representation of a non-limiting strategy to construct a transcript comprising multiple ribozyme motifs that arc the samc or diffcrcnt tar~ctillL~
various sites within GBSS RNA. L
Figure 24 shows cleavage of a-g desaturase RNA by rihozyl1lcs. 453 M~ cr, lep,esel-ls a multimer ribozyme construct targeted against ~l~mm~-rhead ribozyme sites 453, 464, 475 and 484. 252 Multimer, represents a multimer ribozyme construct targeted againsth~mmçrhead ribozyme sites 252, 271, 313 and 326. 23Pi M ultimcr,rcprc~cllts a multimer ribozyme construct targeted against three hammerhead ribozyme sites 252, 2S9 and 271 and one hairpin ribozyme site 238 (HP). 259 Multimer, represents a multimer ribozyme construct targeted against two h~mmerhead ribozyme sites 271 and 313 and one hairpin ribozyme site 259 (HP).
Figuré 25 illustrates GBSS mRNA levels in Ribozyme minus Controls (C, F, I, J, N, P, Q) and Active Ribozyme ~PA63 Transformants (AA, DD, EE, FF, GG, HH, JJ, KK).
Figure 26 illustrates ag desaturase mRNA levels in Non-transformed plants (NT), 85-06 High Stearate Plants (1, 3, 5, 8, 12, 14), and Transformed (irrélevant ribozyme) Control Plants (RPA63-33, RPA63-51, RPA63-65).
Figure 27 illustrates ag desaLul~se mRNA levels in Non-transformed plants (NTO), 85- 15 High Stearate Plants (01, 06, 07, 10, 11, 12), and 85- 15 ~'or nal Stearate Plants (02, 05, 09, 14).
Figure 28 illustrates /~9 desaturase mRNA levels in Non-transformed plants (NTY), 113-06 Inactive Ribozyme Plants (02, 04, 07, 10,11).
Figures 29a and 29b illustrate ag desaturase protein levels in maize leaves (R0). (a) Line HiII, plants a-e nontransforrned and ribozyme inactive line RPA113-17, plants 1-6.
(b) Ribozyme active line RPA85- I S, plants I - 15.
Figure 30 illustrates stearic acid in leaves of RPA85-06 plants.
Figure 31 illustrates stearic acid in leaves of RPA85-15 plants, results of three assays.

SUBSTITUTE SHEET (RULE 26) Figure 32 illustrates stearic acid in leaves of RPA 113-06 plants.
Figure 33 illustrates stearic acid in leaves of RPA113-17 plants.
Figure 3~ illustrates stearic acid in leaves of control plants.
Figure 35 illustrates leaf stearate in Rl plants from a lligll stearate r~lant cross (RPA85-15.07 self).
. Figure 36 illustrates ~9 desaturase levels in next generation maize leaves (Rl).
* indicates those plants that showed a high stearate content.
Figure 37 illustrates stearic acid in individual somatic embryos from a culture (308/430-012) transformed with ~nti~ence ~9 desaturase.
Figure 38 illustrates stearic acid in individual somatic cmbryos from a culture (308/430-015) transformed with anticen~e A9 desaturase.
Figure 39 i~ sLlàles stearic acid in individual leaves from plants ~ atcd from aculture (308/430-012) transformed with ~ e~ce A9 desaturase.
Figure 40 illu~tlates amylose content in a single kernel of untransrul,llcd control line (Q806 and ~ntjsence line 308/425-12.2.1.
Figure 41 ill~ ates GBSS activity in single kernels of a southern negative line (RPA63-0306) and Southern positive line RPA63-0218.
Figure 42 ill-lsl~alts a Lldllsfullildlion vector that can be used to express the enzymatic nucleic acid of the present invention.

Detailed Descli~.tion Of The Invention The present invention collc~,.lls compositions and methods for the modulation ofgene eA~ sjion in plants ~pe~ ifically using enzymatic nucleic acid molecules.
The followin~ phrases and terrns are defined below:
By "inhibit" or "modulate" is meant that the activity of enzymes such as GBSS and 25 ~-9 desaturase or level of mRNAs encoded by these genes is reduced below that observed in the ~bs~n~ e of an enzymatic nucleic acid and preferably is below that level observed in SUBSTITUTE SHEET (RULE 26~

the presence of an inactive RNA molecule able to bind to the same site on the mRNA, but unable to cleave that RNA.
By "enzymatic nucleic acid molecule" it is meant a nucleic acid molecule which has complementarity in a substrate bindin~ region to a specificd gCIlC targct, and also llas an 5 enzymatic activity which is active to specifically clcavc that targcl. Tllat is, ll~c enzymatic nucleic acid molecule is ablc to intcrmolccul~rly clc~lv(: I~NA (or I~NA) all(l thereby inactivate a target RNA molecllle This complcmcntarity functions to allow sufficient hybridization of the enzymatic nucleic acid molecule to the target RNA to allow the cleavage to occur. One hundred percent complementarity is preferrcd, but 10 complementarity as low as 50-75% may also be useful in tllis inventioll. Thc nuclcic acids may be modified at the base, sugar, and/or phosphate groups. The tenn enzymatic nucleic acid is used interchangeably with phrases such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, nucleozyme, DNAzyme, RNA enzyme, RNAzyme, polyribozymes, molecular scissors, self-splicing RNA, self-cleaving RNA, cis-cleaving 15 RNA, autolytic RNA, endoribonuclease, minizyme, leadzyme or DNA enzyme. All of these terminologies describe nucleic acid moleculfs with enzymatic activity. Thc term encomp~sses enzymatic RNA molecule which include one or more ribonucleotides andmay include a majority of other types of nucleotides or abasic moieties, as described below.
By "compk ~~f ~~ iLy" is meant a nucleic acid that can form hydrogen bond(s) with other RNA sequences by either traditional Watson-Crick or other non-traditional types (for example, Hoogsteen type) of base-paired interactions.
By "vectors ' is meant any nucleic acid- and/or viral-based technique used to deliver and/or express a desired nucleic acid.
By "gene" is meant a nucleic acid that encodes an RNA.
By "plant gene" is meant a gene encoded by a plant.
By "endogenous' gene is meant a gene normally found in a plant cell in its natural location in the genome.
By "foreign ' or "heterologous" gene is meant a gene not normally found in the host 30 plant cell, but that is introduced by standard gene transfer techniques.

SUBSTITUTE SHEET (RULE 26) W O 97/10328 11 PCT~US96/11689 By ''nucleic acid is meant a molec-lle whicll can bc single-strallcied or double-stranded, composed of nucleotidcs col~ail~ g a s-lL~ar, a phos~ ate and either a purine or pyrhllidine base wllicll may be sallle or different, and may be modified or unmodified.
By "genome ' is meant genetic material contailled in each cell of an organism and/or a 5 virus.
By "mRNA" is meant RNA that can be translated hlto protein by a cell.
By "cDNA is meant DN~ that is complementaly to and dcrived from a mRNA.
By "dsDNA" is meant a double stranded cDNA.
By "sense' RNA is meant RNA transcript that comprises the mRNA sequence.
By "antisense RNA" is meant an RNA transcript that comprises sequences complementary to all or part of a target RNA and/or mRNA and that blocks the e~ylession of a target gene by interfering with the processing, transport and/or translation of its primary transcript and/or mRNA. The complementarity may exist with any part of the target RNA, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or 15 the coding seq~lence. ~ntis~n~e RNA is normally a mirror image of the sense RNA.
By "expression", as used herein, is meant the transcription and stable accum~ tion of the enymatic nucleic acid molecules, mRNA and/or the antisense RNA inside a plant cell. Expression of genes involves transcription of the gene and translation of the mRNA
into precursor or mature proteins.
By "cosuppression" is meant the expression of a foreign gene, which has s~kst~ntial homology to an gene, and in a plant cell causes the reduction in activity of the foreign and/or the endogellous protein product.
By "altered levels" is meant the level of production of a gene product in a transgenic organism is different from that of a normal omlon-trallsgellic organism.
By "promoter' is meallt nucleotide sequence element within a gene which controlsthe expression of that gene. r'romoter sequence provides the recognition for RNApolymerase and other transcription factors required for efficient transcription. Promoters from a variety of sources can be used efficiently in plant cells to express ribozymes. For example, promoters of bacterial orighl, such as the octopine synthetase promoter, the SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 nopaline synthase promoter, the manopine synthetase promoter; promoters of viralorigin, such as the cauliflower mosaic vims (35S); plant promoters, such as the ribulose-1,6-biphosphate (RUBP) carboxylase small subunit (ssu), the beta-conglycinin promoter, the phaseolin promoter, the ADH promoter, heat-shock promoters, and tissue specific 5 promoters. Promoter may also contain certain enhancer sequence elemcnts tllat may improve the transcription efficiency.
By "enhancer is meant nucleotide sequence elcmcnt whicll can stimulatc l~romolc activity (Adh).
By "constitutive promoter is meant promoter element that directs continuous gene10 ~ e;,~ion in all cells types and at all times (actin, ubiquitin, CaMV 35S).
By "tissue-specific promoter is meant promoter element responsible for gene e,~c~lcs:,ion in specific cell or tissue types, such as the leaves or seeds (zein, oleosin, napin, ACP).
By "development-specific promoter is meant promoter element responsible for 15 gene e~ ress~on at specific plant developmental stage, such as in early or late embryogenesls.
By "inducible promoter" is meant promoter element which is responsiblc for e ,~ cs~-on of genes in response to a specific signal, such as: physical stimulus (heat shock genes); light (RUBP carboxylase); hormone (Em); metabolites; and stress.
By a "plant' is meant a photosynthetic ol~allisln, either eukaryotic and prokaryotic.
By "angiosperm" is meant a plant having its seed enclosed in an ovary (e.g., coffee, tob~cco, bean, pea).
By "gymnosperm" is meant a plant having its seed exposed and not enclosed in an ovary (e.g, pine, spruce).
By "monocotyledon" is meant a plant characterized by the presence of only one seed leaf (primary leaf of the embryo). For example, maize, wheat, rice and others.
By "dicotyledon" is meant a plant producing seeds with two cotyledons (primary Ieaf of the embryo). For example, coffee, canola, peas and others.

SUBSTITUTE SHEET (RULE 26) By "transgenic plant" is meant a plant expressing a foreign gene.
By "open reading frame is meant a nucleotide sequence, without introns, encodingan amino acid sequence, with a defined translation initiation and termination region.
The invention provides a method for producing a class of cnzylnatic clcaving a~c5 which exhibit a high degree of specificity for thc RNA of a dcsilc(l ~arucL. l llc cllzylllalic nuc!eic acid molecule may be targeted to a highly specific se~uence region of a targct SLICIl that specific gene inhibition can be achieved. Alternatively, enzymatic nucleic acid can be La~ ,ted to a highly conserved region of a gene family to inhibit gene expression of a family of related enzymes. The ribozymes can be expresscd in plants that havc bccn 10 transformed with vectors which express the nucleic acid of the present invention.
The enzymatic nature of a ribozyme is advantageous over other technologies, since the concentration of ribozyme necessary to affect a therapeutic treatment is lower. This advantage reflects the ability of the ribozyme to act enzymatically. Thus, a single ribozyme molecule is able to cleave many molecules of target RNA. In addition, the 15 ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base-pairing ~I~f''f~ lll of binding to the target RNA, but also on the n;~... of target RNA cleavage. Single mi~m~tches, or base-substitutions, near the slte of cleavage can completely eli...;.-~t~ catalytic activity of a ribozyme.
Six basic varieties of naturally-occurring enzymatic RNAs are known presently.
20 Each can catalyze the hydrolysis of RNA phosphodiester bonds in trans (and thus can cleave other RNA molecules) under physiological conditions. Table I ~ ;S some of the characteristics of these ribozymes. In general, enzymatic nucleic acids act by first binding to a target RNA. Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the 25 molerllle that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base~pairing, and once bound to the correct site, acts enzym~tic~lly to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein.
After an enzymatic nucleic acid has bound and cleaved its RNA targct, it is rclcascd from 30 that RNA to search for another target and can repeatedlybind and cleave new targets.
In one of the p,~if~ d embodiments of the inventions herein, the enzymatic nucleic acid molecule is formed in a ~ e.llead or hairpin motif, but may also be formed in the SUBSTITUTE SHEET (RULE 26) CA 02226728 l99X-0l-l3 motif of a hepatitis ~ virus, group I intron, group 11 intron or RNaseP RNA (in association with an RNA guide sequence) or Ne~'rospora VS RNA. Examples of such hammerhead motifs are described by Dreyfus, supra, Rossi e~ al., l 992, AIDS Research and Human Retroviruses 8, 183; of hairpin motifs by Hampel e~ al., EP0360257, Hampel and Tritz, 1989 Biochemistrv 28, 4929, Feldstein e~ al., 19~9, ~ nc~ ~2, 53, 1~ iclofI.IIld Gerlach, 1989, Gene, ~2, 43, and Hampcl el al., 199n ~(IC~ .s. IX, -)')(); of 1l"~
hepatitis ~ virus motif is described by Perrotta and Bccn, l~)92 l~ioc*emi.slry 31, i6; of the RNaseP motif by Guerrier-Takada et al., 1983 Cell 3~, 849; Forster and Altman, 1990, Science 249, 783; Li and Altman, 1996, ~ucleic Acids Res. 24, ~35; Neuro.~Jru VS
Rl~A ribozyme motif is described by Collins (Saville and Collins, 1990 Ccll ~ X5-h9~;
Saville and Collins, 1991 Proc. Na~l. Acad. Sci. USA 88, 8826-8830; Collins and Olive, 1993 Biochemistry 32, 2795-2799; Guo and Collins, 1995, ~;MBO. J. 14, 363); Group ~I
introns are described by Griffin et al. , 1995, Chem. Biol. 2, 761; Michels and Pyle, 1995, Biochemis-ry 34, 2965; and of the Group I intron by Cech et al., U.S. Patent 4,987,071.
These specific motifs are not limiting in the invention and those skilled in the art will recognize that all that is h,l~oll~nt in an enzymatic nucleic acid molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.
The enzymatic nucleic acid molecules of the instant invention will be exple;,sedwithin cells from eukaryotic promoters [e.g, Gerlach et al., International PCT Publication No. WO 91/13994; Edington and Nelson, 1992, in Gene Regulation: Biology of Antisense ~NA and DNA, eds. R. P. ~l;ck~ol1 and J. G. Izant, pp 209-221, Raven Press, NY.;Atkins et al., Tntf-m~tional PCT Publication No. WO 94/00012; Lenee et al., Intern~tion~l PCT Publication Nos. WO 94/19476 and WO 9503404, Atkins et al., 1995, J. Gen. Yirol.
76, 1781-1790; McElroy and Brettell, 1994, TIBTECH 12, 62; Gruber et al., 1994, J. Cell.
Biochem. Suppl. 18A, 110 (X1406)and Feyter et al., 1996, Mol. Gen. Ger~et. 250, 329-338; all of these are incorporated by reference herein]. Those skilled in the art will realize from the te~rhin~C herein that any ribozyme can be eAI,iessed in eukaryotic plant cells from an a~lol,-iate promoter. The ribozymes ~ ssion is under the control of a consliluli~e promoter, a tissue-specific promoter or an inducible promoter.
To obtain the ribozyme me~i~ted moA~ tion, the ribozyme RNA is introduced into the plant. Although examples are provided below for the construction of the plasmids used in the Ll~ rc,llllation eA~e,ilnents illustrated herein, it is well within the skill of an S~JD5 111 ~)TE SHEET (RULE 26) artisan to desi~n numerous different types of plasmids which can be used in the lldllarollllation of plants,_see Bevan, 1984, Nucl. Acids ~2es. 12, 8711-8721, which is incorporated by reference. There are also numerous ways to transform plants. ln the examples below embryogenic maize cultures were helium blasted. In addition to ~lsin6 tllc gene gun (US Patents 4,945,0S0 to Cornell and 5,141,13 1 to Dowl~lallco), plallLS m.ly bc transformed usingAgrohacterium technology, scc US r'atcllt 5,177,()10 lo UlliVclsily ol Toledo, 5,104,310 to Texas A&M, European Patent Application 0131-S24~1, LLlror)can Patent Applications 120516, 159418Bl and 176,1 12 to Schilperoot, US Patents 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to Schilperoot, Europcan Patent Applications 11 671 8, 290799, 320500 all to MaxPlanck, Europcan l'atcnt Applications 604662 and 627752 to Japan Tobacco, European Patent Applications 0267159, and 0292435 and US Patent 5,231,019 all to Ciba Geigy, US Patents 5,463,174 and 4,762,785 both to C~le~ne~ and US Patents 5,004,863 and 5,159,135 both to Agracetus; whiskers technology, see US Patents 5,302,523 and 5,464,765 both to 7.onPc~
electroporation technology, see WO 87/06614 to Boyce Thompson Institute, 5,472,869 and 5,384,253 both to Dekalb, W09209696 and W09321335 both to PGS; all of which are incQrporated by reference herein in totality. In addition to numerous technologies for transforming plants, the type of tissue which is cont~rte~ with the foreign material (typically plasmids c~ ;..;..g RNA or DNA) may vary as well. Such tissue would 20 include but would not be limited to embryogenic tissue, callus tissue type I and II, and any tissue which is receptive to transÇo, ll,alion and subsequent ~ ~gc~ dlion into a transgenic plant. Another variable is the choice of a select~ble marker. The y~;r~ nce for a particular marker is at the discretion of the artisan, but any of the following select~ble ",~ c,s may be used along with any other gene not listed herein which could function as a 25 select~kle marker. Such selectable ll~ include but are not limited to chlorosulfuron, hygromyacin, PAT and/or bar, bromoxynil, kanamycin and the like. The bar gene may be isolated from Strptomuces, particularly from the hygroscopicus or viridochromogenes species. The bar gene codes for phosphinothricin acetyl transferase (PAT) that inactivates the active ingradient in the herbicide bialaphos phosphinothricin (PPT). Thus, 30 llullle~olls combinations of technologies may be used in employing ribozyme mediated modulation.
The ribozymes may be expressed individually as monomers, i.e., one ribozyme targeted against one site is ~yl essed per transcript. Alternatively, two or more ribozymes targeted against more than one target site are expressed as part of a single RNA
35 transcript. A single RNA tlanscl;yt comprising more than one ribozyme targeted against SU..;~ l 11 UTE SHEET (RULE 26) PCT~US96/11689 ~nore than one cleavage site are readily generated to achieve efficient modulation of gene e~y~ession~ Ribozymes within these multimer constructs are the same or different. For example, the mIIItimer construct may comprise a plurality of hammerhead ribozymes or hairpin ribozymes or other ribozyme motifs. Alternatively, the multimer construct may 5 be designed to include a plurality of different ribozyme motifs, sucll as llamIllcrllca(l an~l hairpin ribozymes. More specifically, multimer rihozyllle constr~lc~s ~rc dcsigl7ccl, wherein a series of ribozyme motifs are linked togctl1cr in tal1dclll in a SillL!IC I~N/\
transcript. The ribozymes are linked to each other by nucleotide linker sequence wherein the linker sequence may or may not be complementary to the target RNA. Multimcr 10 ribozyme constructs (polyribozymes) are likely to improvc the cffcctivcncss of ribozyme-mediated modulation of gene ek,ulession.
The activity of ribozymes can also be augmented by their release from the primary kans.,lilJt by a second ribozyme (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595, both hereby incorporated in their totality by reference herein;Ohkawa,J.,etal., 1992, Nucleic~cidsSymp.Ser., 27, 15-6;Taira,K., etal., 1991,Nucleic Acids Res., 19, 5125-30; Ventura, M., et al., 1993, Nucleic Acids Res., 21, 3249-55;
Chowrira et al., 1994 J. Biol. Chem. 269, 25856).
Ribozyme-rnedi~ted modulation of gene e~l"es~ion can be practiced in a wide variety of plants inr!~I-ling angiosperms, gymnosperrns, monocotyledons, and 20 dicotyledons. Plants of interest include but are not limited to: cereals, such as rice, wheat, barley, maize; oil-producing crops, such as soybean, canola, sunflower, cotton, maize, cocoa, safflower, oil palm, coconut palm, flax, castor, peanut; plantation crops, such as coffee and tea; fmits, such as pincap~le, papaya, mango, banana, grapes, oranges, apples;
vegetables, such as cauliflower, c~bb~ge, melon, green pepper, tornatoes, carrots, lettuce, 25 celery, potatoes, broccoli; le~ c, such as soybean, beans, peas; flowers, such as c~m~tions, chrys~nth~m~Im, daisy, tulip, gypsophila, al~l~o~ ia, marigold, petunia, rose;
trees such as olive, cork, poplar, pine; nuts, such as walnut, pistachio, and others.
Following are a few non-1imitin~ examples that describe the general utility of ribozymes inIno~ tionofgenee~l"e~ion.
Ribozyme-m~ t~d down regulation of the ex~leç~ion of genes involved in caffeine synthesis can be used to signific~ntly change caffeine concentration in coffee beans.
Expression of genes, such as 7-methyl~nthosine and/or 3-methyl transferase in coffee plants can be readily modulated using ribozymes to decrease caffeine synthesis (Adams and Zarowitz, US Patent No. 5,334,529; incorporated by reference herein).

SUBSTITUTE SHEET (RULE 26) W O 97/10328 17 PCTrUS96/11689 Transgenic tobacco plants expressing ribozymes targeted against genes involved in nicotine production, such as N-methylputrescine oxidase or putrescine N-methyl transferase (Shewmaker et al., supra), ~ould produce leaves with altered nicotine concentration.
Transgenic plants expressing ribozymes targeted against L~enes involvccl h1 ripcning of fruits, such as ethylene-forming enzyme, pectin mcthyltransfcrasc, pCC~ill cstcrasc, polyg~l~ct~ronase, l-aminocyclopropane carboxylic acid (/~CC) syntl1asc, ~CC oxiclasc genes (Smith et al., 1988, Nature, 334, 724; Gray et al., 1992, Pl. Mol. Biol., 19, 69;
Tieman et al., 1992, Plant Cell, 4, 667; Picton et al., 1993, The Plant ~. 3, 469; Shewmaker et al., supra; James et al., 1996, Bio/Technology, 14, 56), would dclay thc ripcnil1~ Or fruits, such as tomato and apple.
Transgenic plants eAIJ~c~sillg ribozymes targeted against genes involved in flower pi~ ;on, such as chalcone synthase (CHS), chalcone flavanone isomerase (CHI), phenylalanine ~mmclni~ Iyase, or dehydroflavonol (DF) hydroxylases, DF reductase (Krol van der, et al., 1988, Nature, 333, 866; Krol van der, et al., 1990, Pl. Mol. Biol., 14, 457;
Shewmaker et al., supra; Jolgc.~sell, 1996, Science, 268, 686), would produce flowers, such as roses, petunia, with altered colors.
Lignins are organic compounds Fc~f ll;~l for l~ lg l,.cc~ strength of cell walls in plants. Although e ss~ l lignins have some disadvantages. They cause indigestibility of sillage crops and are undesirable to paper production from wood pulp and others. T.al~sgc.lic plants eAI,lcssil,g ribozymes targeted against genes involved in lignin production such as, O-methyltransferase, cinnamoyl-CoA:NADPH reductase orcil~lallloyl alcohol dehydrogenase (Doorssel~ere et al., 1995, The Plant J. 8, 855;
Atanassova et aL, 1995, The Plant J. 8, 465; Shewmaker et al., supra; Dwivedi et al., 1994, Pl. Mol. Biol., 26, 61), would have altered levels of lignin.
Other useful targets for useful ribozymes are disclosed in Draper et al., ~nt~ tional PCT Publication No. WO 93/23569, Sullivan et al., International PCT
Publication No. WO 94/02595, as well as by Stinchcomb et al., International PCT
Publication No. WO 95/31541, and hereby incorporated by reference herein in totality.
30 Modulation of ~ranule bound starch svnthase ~ene expression in plants:
In plants, starch biosynthesis occurs in both chloroplasts (short term starch storage) and in the amyloplast (long tenn starch storage). Starch granules normally SIJD~ JTE SHEET (RULE 26) W O 97/10328 18 PCTrUS96/11689 consist of a linear chain of a(l-4)-linked a-D-glucose UllitS (amylose) and a brallchcd form of amylose cross-linked by a(1-6) bonds (amylopectin). An enzyme involved in the synthesis of starch in plants is starch synthase which produces linear chains of a (1-4)-glucose using ADP-glucose. Two main forms of starch synthase are found in plants:
granule bound starch synthase (GBSS) and a soluble form locatcd in tllc slrol1la of chloroplasts and in amyloplasts (solublc starch syntllasc). I~otll lorms ol' ll)is e~ yl~c utilize ADP-D-glucose while the granular bound form also ~lliliizcs lJl~ lcosc, wilh a ~rcif~,.cnce for the former. The GBSS, known as waxy protein, has a molecular mass of between 55 to about 70 kDa in a variety of plants in which it has becn charactcrizcd.
Mutations affecting the GBSS gene in several plant spccics has rcsultcd in tllc loss Or amylose, while the total amount of starch has remained relatively unchan~cd. In addition to a loss of GBSS activity, these mutants also contain altered, reduced levels, or no GBSS
protein (Mac Donald and Preiss, Plant Physiol. 78: 849-852 (1985), Sano, Theor. Appl.
Genet. 68: 467-473 (1984), Hovenkamp-Hermelink et al. Theor. Appl. Genet. 75: 217-221 91987), Shure et al. Cell 35, 22~-233 (1983), Echt and Scllwa~ Genetics 99: 275-284 (1981) ). The presence of a br~cl,i,lg enzyme as well as a soluble ADP-glucose starch glycosyl transferase in both GBSS mlltAntc and wild type plants indicates the e~ tonA~e of independent pathways for the fommation of the branched chain polymer amylopectin and the straight chain polymer amylose.
The Wx (waxy) locus encodes a granule bound glucosyl t,dn~rti,ase involved in starch biosynthesis. Expression of this enzyme is limited to endosperm, pollen and the embryo sac in maize. Mutations in this locus have been temmed waxy due to the appeA~ re of mutant k~rn~lc, which is the phenotype res~lting from an reduction in amylose composition in the kern~lC. In maize, this enzyme is transported into the amyloplast of the developing endosperm where it catalyses production of amylose. Com kemels are about 70% starch, of which 27% is linear amylose and 73% is amylopectin.
Waxy is a recessive m-ltAtion in the gene enco~ling granule bound starch synthase (GBSS).
Plants homozygous for this recessive mutation produce kemels that contain 100% of their starch in the form of amylopectin.
Ribozymes, with their catalytic activity and increased site specificity (as described below), represent more potent and perhaps more specific inhibitory molecules than Anti~en~e oligonucleotides. Moreover, these ribozymes are able to inhibit GBSS activity and the catalytic activity of the ribozymes is required for their inhibitory effect. For those of ordinary skill in the art, it is clear from the examples that other ribozymes may SUBSTITUTE SHEET (RULE 26) CA 02226728 l99X-01-13 be designed that cleave target mRNAs required for GBSS activity in plant species othcr than maize.
Thus, in a prefel.ed embodiment, the invention features ribozvmes that inhibit enzymes involved in amylose production, e.g., by rcd~lcil1L~ G~3SS activity. Tl1c~;c 5 endogenously expressed RNA molecules contain substratc bin(lillg (lOm ~ s l~ hin(i lo accessible regions of the target mRNA. Thc RNA molcc-llc~ ~lso COlltaill (It)lll~lillS t~
catalyze the cleavage of RNA. The RNA molecules are prefcrably ribozymcs of thc han~ .llead or hairpin motif. Upon binding, the ribozyllles cleave the target mRN~s, preventing translation and protein accumulation. In the absence of the expression of thc 10 target gene, amylose production is rcduccd or inhibitcd. Spccillc cxam~lc~; ~rc l~rovidcd below infra.
Plcre.led embodiments include the ribozymes having binding arrns which are compl~ .y to the binding sequences in Tables IIIA, VA and VB. Examples of such ribozymes are shown in Tables IIIB - V. Those in the art will recognize that while such 15 e~al--ples are rlesignçd to one plant's (e.g., maize) mRNA, similar ribozymes can be made complem~nt~ry to other plant species' mRNA. By complc...l - .t~ ~ is thus meant that the binding arms enable ribozymes to interact with the target RNA in a sequence-specific manner to cause cleavage of a plant mRNA target. E~ les of such ribozymes consist ly of sequences shown in Tables IIIB - V.
P,c~.lcd embo~;.. L.I~ are the ribozymes and methods for their use in the inhibition of starch granule bound ADP (UDP)-glucose: a-1,4-D-glucan 4-a-glucosyl l,alls~.dse i.e., granule bound starch synthase (GBSS) activity in plants. This is accomplished through the inhibition of genetic ek~l-,s~ion, with ribozymes, which results in the reduction or elimin~tion of GBSS activity in plants.
In another aspect of the invention, ribozymes that cleave target molecules and inhibit arnylose production are expressed from transcription units hls~ cd into the plant genl7m~ Preferably, the lecullll,hldllL vectors capable of stable integration into the plant genome and selection of transforrned plant lines e~lessi,lg the ribozymes are e~lcssed either by constitutive or inducible promoters in the plant cells. Once expressed, the ribozymes cleave their target mRNAs and reduce amylose production of their host cells.
The riboymes ex~,lessed in plant cells are under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter.

51.~ 1 1 UTE SHEET (RULE 26) PCTrUS96/11689 Modification of corn starch is an important application of ribozyme tecllnology which is capable of reducing specific gene expression. A high level of amylopectin is desirable for the wet milling process of corn and there is also some evidence that high amylopectin corn leads to increased digestibility and therefore enerL~y availability in fccd.
5 Nearly 10% of wet-milled corn has the waxy phenotypc, but bccausc of its rcccssivc nature the traditional waxy varieties are very diffic~llt for thc ~rowcr t~ h,~
Ribozymes targeted to cleave the GBSS mRNA and tl1~ls rcclLlcc Cil~SS aclivily il1 p l.ll~ls, and in particular, corn cndosperm will act as a dominal1L trait and produce corn plants with the waxy phenotype that will be easier for the grower to handle.
10 Modification of fattv acid saturation profilc in plallts Fatty acid biosynthesis in plant tissues is initiated in the chloroplast. Fatty acids are synthesized as thioesters of acyl carrier protein (ACP) by the fatty acid synthase complex (FAS). Fatty acids with chain lengths of 16 carbons follow one of three paths:
1) they are released, immediately after synthesis, and transferred to glycerol 3-phosphate 15 (G3P) by a chloroplast acyl transferase for further modification within the chloroplast; 2) they are released and transferred to Co-enzyme A (CoA) upon export from the plastid by thioe;".,.ases; or3) they are further elongated to C18 chain lengths. The C18 chains are rapidly desaturated at the C9 position by stearoyl-ACP desaturase. This is fotlowed by ;.. ~eJ; ~le transfer of the oleic acid (18:1) group to G3P within thc chloroplast, or by export from the chloroplast and conversion to oleoyl-CoA by thioesterases (Somerville and Browse, 1991 Science 252: 80-87). The majority of C16 fatty acids follow the third pathway.
In corn seed oil the predominant triglycerides are produced in the endoplasmic reticulllrn Most oleic acids (18:1) and some palmitic acids (16:0) are transferred to G3P
from phoSph~ti~ic acids, which are then converted to diacyl glycerides and phosphatidyl choline. Further desatu~alion of the acyl chains on phosphatidyl choline by ~ b~bound desaLu~ases takes place in the endoplasmic retic~ m Di- and tri-unsaturated chains are then released into the acyl-CoA pool and transferred to the C3 position of the glycerol backbone in diacyl glycerol in the production of triglycerides (Frentzen, 1993 in Lipid Metabolism in Plants., p.l95-230, (ed. Moore,T.S.) CRC Press, Boca Raton, FA.).
A sch~om~tic of the plant fatty acid biosynthesis pathway is shown in Figures l l and 12.
The three prer~omin~nt fatty acids in com seed oil are linoleic acid (18:2, ~59%), oleic acid (18:1, ~26%), and palmitic acid (16:0, ~11%). These are avesge values and may besomewhat dir~l~nt depending on the genotype; however, composite samples of US Corn S~.l~ 111 ~JTE SHEET (RULE 26) Belt produced oil analyzed over the past ten years have consistently had this composition (Glover and Mertz, 1987 in: Nutritional Quality of Cereal Grains: genetic and agronomic improvement., p 183-336, (eds. Olson, R.A. and Frey, K.J.) Am. Soc.
Agronomy. Inc. Madison, WI; Fitch-H~ n, 1985 J Am. Oil Chem. Soc. 62: 1524-1531; Strecker et al., 1990 in Edible fats and oils processin~: basic llrinciplc~ all(l modcrl1 practices (ed. Erickson, D.R.) ~m. Oil Chcmi~t~ Snc. C'll~lltllraiL~ll, Il,). l'lli~i predominance of C18 chain lenL~ths lnay rcflcct ~hc abuncLll1~:c ancl ~l~;LiviLy ol ~ v~r.ll kcy enzymes, such as the fatty acid synthase responsible for production of C18 carbon chains, the stearoyl-ACP desaturase (~-9 desaturase) for production of 18: 1 and a microsomal ~-12 desaturase forconversion of 18:1 to 18:2.
A_9 desaturase (also called stearoyl-ACP desaturase) of plants is a soluble chloroplast enzyme which uses C18 and occasionally C16-acyl chains linked to acyl ca~ier protein (ACP) as a substrate (McKeon, T.A. and Stumpf, P.K., 1982 J. Biol.
Chem. 257: 12141-12147). This contrasts to the "-~ "~ r" lower eukaryotic and 15 cyannb~cterial ~-9 desalu-ases. Rat and yeast ~-9 desaturases are mell-~lane bound ..l;c-osolnal enzymes using acyl-CoA chains as subsLlal.,s, whereas cyanobacterial ~-9 dejaLulase uses acyl chains on diacyl glycerol as substrate. To date several ~-9desalu-~se cDNA clones from dicotelydenous plants have been isolated and chara.;le.i~.ed (Sh~nklin and Somerville, 1991 Proc. Natl. Acad Sci. USA 88: 2510-2514; Knutzon et al., 1991 Plant Physiol. 96: 344-345; Sato et al., 1992 Plant Physiol. 99: 362-363; Sh~n~lin et al., 1991 PlantPhysiol. 97: 467-468; Sloconll~e et al., 1992 Plant. Mol. Biol. 20: 151-155;
Tayloretal., 1992PlantPhysiol. 100: 533-534; Thompson et al., 1991 Proc. Natl. Acad.
Sci. USA 88: 2578-2582). Comparison of the dirr~ ,.,t plant a-s desaturase sequ~orces suE~estc that this is a highly conserved enzyme, with high levels of identity both at the 2~ amino acid level (~90%) and at the nucleotide level (--80%). However, as might be e,.~e~,t~,d from its very dir~.l ~1t physical and enzymological l)lo~,lLies, no s~.lu~ ce similarity exists ~ w.,~,.l plant and other ~-9 desaturases (~h~nklin and Somerville, supra).
Purification and characte.i~lion of the castor bean desaturase (and others) indicates that the ~-9 de-sa~u,ase is active as a homodimer; the subunit molecular weight is ~ 41 kDa. The enzyme le~ui.~s molecular oxygen, NADPH, NADPH ferredoxin oxidored~ t~ce and ferredoxin for activity in vitro. Fox et al., 1993 (Proc. Matl. Acad. Sci.
USA 90: 2486-2490) showed that upon ~A~ ssion in E. coli the castor bean enzyme cont~inC four catalytically active ferrous atoms per homodimer. The oxidized enzyme SUBSTITUTE SHEET (RULE 26) PCT~US96/11689 contains two identical diferric clusters, which in the presence of dithionite are reduced to the diferrous state. In the presence of stearoyl-CoA and ~2 the clusters return to the diferric state. This suggests that the desaturase belongs to a group of ~2 activating proteins cont~inin~ diiron-oxo clusters. Other members of this group are ribonucleotide 5 reductase and methane monooxygenase hydroxylase. Comparison of thc r~rcdictc(lprimary structure for these catalytically diverse r~rotcins Sl10W.S thal all COllt~till .1 conserved pair of amino acid sequences (Asp/Glu)-Glu-Xaa-Arg-~-lis scparatcd by ~~0-100 amino acids.
Traditional plant breeding programs have shown that increased stearate levels can 10 be achieved without deleterious consequences to the plant. In saMowcr (Lacld and Knowles, 1970 Crop Sci. 10: ~25-~27) and in soybean (Hammond and Fehr, 1984 J.
Amer. Oil Chem. Soc. 61: 1713-1716; Graef et al., 1985 Crop Sci. 25: 1076-1079) stearate levels have been increased significantly. This demonstrates the flexibility in fatty acid cGl,.posilion of seed oil.
Increases in A-9 desaturase activity have been achieved by the transformation oftobacco with the A-9 desaturase genes from yeast (Polashock et al., 1992 Plan~ Physiol.
100, 894) or rat (Grayburn et. al., 1992 BioTechnology 10, 67~). Both sets of l~alls~enic plants had si~r~ ch~nges in fatty acid composition, yet were phenotypically Id~ntic~l to control plants.
Corn (maize) has been used minim~lly for the production of 1~ g~illC products ~ecau~e it has tr~ition~lly not been utilized as arl oil crop and because of the relatively low seed oil content when COIllpds ed with soybean snd canola. However, corn oil has low levels of linolenic acid (18:3) and relatively high levels of palmitic (16:0) acid (desirable in C). Applicant believes that reduction in oleic and linoleic acid levels by down-re~ tion of ~-9 desaturase activity will make corn a viable alte~n~tive to soybean and canola in the ~ oil marlcet.
Margarine and confectionary fats are produced by rh~mic~l hydrogenation of oil from plants such as soybean. This process adds cost to the production of the ",a~""e and also causes both cis and trans isomers of the fatty acids. Trans isomers are not naturally found in plant derived oils and have raised a concern for potential health risks.
Applicant believes that one way to elimin~t~ the need for cl~ ..ic~l hydrogenation is to g~nf-tic~lly ~ ;,.P~l the plants so that desaturation enzymes are down-regulated. ~-9 SIJV~ JTE SHEET (RULE 26) -desaturase introduces the first double bond into 18 carbon fatty acids and is the key step effecting the extent of desaturation of fatty acids.
Thus, in a preferred embodiment, the invention concellls compositions (and methods for their use) for the modification of fatty acid colllposition in E~lants. Tllic is 5 accomplished through the inhibition of genetic expression, Witll riboi!ymCS, al7~i!;cllsc nucleic acid, cosuppression or triplcx DN~, Which rcsults ill Ihc lC(I~lC~iOl) or ~ illnlioll of certain enzyme activities in plants, such as ~-9 desaturasc. Such activity is rc~uccd in monocotyledon plants, such as maize, wheat, rice, palm, coconut and others. ~-9 desanlrase activity may also be reduced in dicotyledon plants such as sunflowcr,10 safflower, cotton, peanut, olive, sesame, cuphea, flax, jojoba, grapc and othcrs.
Thus, in one aspect, the invention features ribozymes that inhibit enzymes involved in fatty acid unsaturation, e.g, by reducing A-9 desaturase activity. These endogenously e~l.fessed RNA molecules contain substrate binding domains that bind to aGcçssible regions of the target mRNA. The RNA molecules also contain ~lnrn~inc that 15 catalyze the cleavage of RNA. The RNA molecules are preferably ribozymes of the l-~.. head or hairpin motif. Upon binding, the ribozymes cleave the target mRNAs, preventing tr~nCl~tion and protein accumulation. In the ~bs~once of the e~c~"~ ision of the target gene, stearate levels are increased and unsaturated fatty acid production is reduced or inhibited. Specific examples are provided below in the Tables listed directly below.
In plefell~;d embo(~ r~l~, the ribozymes have binding arrns which are comple~n~nt~ry to the sequences in the Tables VI and VIII. Those in the art willrecoE~i7e that while such examples are designe~ to one plant's (e.g, corn) mRNA, similar ribozymes can be made compl~ y to other plant's mRNA. By complementary is thus meant that the binding arms of the ribozymes are able to interact with the target RNA in a sequence-specific ~ ne~ and enable the ribozyme to cause cleavage of a plant mRNA target. Examples of such ribozymes are typically sequences defined in Tables VII
and VIII. The active ribozyme typically.cont~inc an enzymatic center equivalent to those in the examples, and binding arms able to bind plant mRNA such that cleavage at the target site occurs. Other sequences may be present which do not h,.~.r~.~ with such binding and/or cleavage.
The sequences of the ribozymes that are particularly useful in this study, are shown in Tables VII and VIII.
,~

SUBSTITUTE SHEET (RULE 26) Those in the art will recognize that ribozyme sequences listed in the Tables arelc:pl~selltative only of many more such sequences where the enzymatic portion of the ribozyme (all but the binding arms) is altered to affect activity. For example, stem-loop II sequence of hammerhead ribozymes listed in Table lV (5'-GGCG~AAGCC-3') can bcaltered (substitution, deletion, and/or inscrtioll) to conLIill ally ~cq~ ecs, pl-c~ ly provided that a minimum of a two base-paircd stcm stmct~lrc c.ln form .Silllil.lrly, ~ilclll-loop IV sequence of hairpin ribozymes listed in Tables V and Vlll (S'-C~CGUUC'JU~i-3' can be altered (substitution, deletion, andtor insertion) to contain any scquence, preferably provided that a minimum of a two base-paired stem structure can foml. Such 10 ribozymes are equivalent to the ribozymes described spccif~cally in thc Tahlc~
In another aspect of the invention, ribozymes that cleave target molecules and reduce unsaturated fatty acid content in plants are expressed from transcription units inserted into the plant genome. Preferably, the recombinant vectors capable of stable hlL~ dLion into the plant genome and selection of transformed plant lines e~yles~ g the 15 ribozymes are expressed either by co~lsliLL~ e or inducible promoters in the plant cells.
Once expressed, the ribozymes cleave their target mRNAs and reduce unsat~lralcd fatty acid production of their host cells. The ribozymes expressed in plant cells are under the control of a constitutive promoter, a tissue-specific promoter or an inducible promoter.
Modification of fatty acid profile is an important application of nuclcic acid-based 20 technologies which are capable of reducing specific gene expression. A high level of s;~ dted fatty acid is desirable in plants that produce oils of commercial importance.
In a related aspect, this invention fealules the isolation of the cDNA sequ~nre ~nrQding A-9 desaturase in maize.
In plerc.lGd embo-3;.. ~-- ~L~, hairpin and h~.. "llead ribozymes that cleave ~-9 25 de~alulase mRNA are also described. Those of ordillaly skill in the art will understand from the eY~mples described below that other ribozymes that cleave target mRNAs required for A-9 desaturase activity may now be readily designed and are within the scope of the invention.
While specific examples to corn RNA are provided, those in the art will recognize 30 that the te?~cllingc are not limited to corn- Furthermore, the same target may be used in other plant species. The complementary arms suitable for targeting the specific plant RNA sequences are utilized in the ribozyme targeted to that specific RNA. The examples SUBSTITUTE SHEET (RULE 26~

PCTrUS96/11689 and teachin~ herein are meant tO be non-limiting, and tilose skilled in tlle art will . recognize that slmilar embodiments can be readily generated in a variety of different plants to modulate expression of a variety of different genes, using the teachings herein, and are within the scope of the inventions.
Standard molecular biology techniques were followcd in tllc cxamr)lc.~ crcin.
Additional hlfol---ation may be found in Sambrook, J., I:ritscl1, 1~ ., al1d M,ll~
(1989), Molecular Cloning a Laboratory Manual, second cdition, Cold Sl~rin~ llarbor:
Cold Spring Harbor Laboratory Press, which is incorporated herein by reference.
Examples Example 1: Isolation of ~ 9 desaturase cDNA from Zea mavs Degenerate PCR primers were designe~ and synthesi7ed to two conserved peptides involved in diiron-oxo group binding of plant /~-9 desaturases. A 276 bp DNA fragment was PCR amplified from maize embryo cDNA and was cloned in to a vector. The predicted amino acid sequence of this fragment was similar to the sequence of the region scpd~ate~ by the two conserved peptides of dicot ~-9 desaturase proteins. This was used to screen a maize embryo cDNA library. A total of 16 clones were isolated; further restriction mapping and hybridization identified one clone which was sequenced.
Features of the cDNA insert are: a 1621 nt cDNA; 145 nt 5' and 294 nt 3' untranslated regions including a 18 nt poly A tail; a 394 amino acid open reading frame encoding a 44.7 kD polypeptide; and 85% amino acid identity with castor bean ~-9 desaturase gene for the predicted mature protein. The complete sequence is plesen~d in Figure 10.
ExamPle 2~ entifiç~tion of Potential Ribo_vme Cleava~e Sites for ç~9 desaturase Approxim~t~ly two hundred and fifty HH ribo_yme sites and approximately forty three HP sites were identified in the corn ~-9 desaturase mRNA. A HH site consists of a 2S uridine and any nucleotide except guanosine (UH). Tables VI and VIII have a list of HH
and HP ribo yme cleavage sites. The numbering system starts with I at the ~' end of a ~-9 desaturase cDNA clone having the sequence shown in Fig. 10.
Ribozymes, such as those listed in Tables VII and VIII, can be readily designed and syr~theci7~d to such cleavage sites with between 5 and 100 or more bases as substrate binding arrns (see Figs. 1 - 5). These substrate binding arms within a ribozyme allow the ribozyme to interact with their target in a sequence-specific manner.

SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 Example 3: Selection of RibozYme Cleava~e Sites for ~9 desaturase The secondary structure of ~-9 desaturase mRNA was assessed by computer analysis using algorithms, such as those developed by M. Zuker ( Zuker, M., 1989Science, 244, 48-52). Regions of the mRNA that did not fonn sccondary folding 5 structures with RNA/RNA stems of over ei~ht nucIcotidcs and cont<~ c(l l)otcnli.
h~mmerhead ribozyme clcavage SitcS wcrc idcnLiI;c(l.
These sites were ~sessed for oligonucleotide accessibility by RNase H assays (see Example 4 infra).
Example 4: RNaseH Assavs for ~9 desaturase Forty nine DNA oligonucleotides, each twenty one nucleotides long were used in RNase H assays. These oligonucleotides covered 108 sites within A-g desaturase RNA.
RNase H assays (Fig. 6) were performed using a full length transcript of the J~-9 des~LulasecDNA. RNA was screened for acce~ihle cleavage sites by the method described generally in Draper et al., supra. Briefly, DNA oligonucleotides reprcsentirlg 15 ribozyme cleavage sites were syrlthesi7e~ A polymerase chain reaction was used to ~er,e.~le a substrate for T7 RNA polymerase hanscl.l,tion from corn cDNA clones.T ~heled RNA transcripts were synshçsi~e~l in vitro from these templates. The oligonucleotides and the labeled transcripts were ~nn~le~l RNAseH was added and the IlliA~ were ;~ b~ted for 10 I-lillut~_s at 37~C. Reactions were stopped and RNA
20 seL~alated on seqU~rrin~ polyacrylamide gels. The pe.~ ge of the substrate cleaved was deterInined by autoradiographic quantitation using a Molecular Dynamics phosphor im~inE~ system (Figs. 13 and 14).
Exam~le 5: ~i.. ~. l.ead and Hairpin Ribozymes for ~9 desaturase Ha.~ .llead (HH) and hairpin (HP) ribozymes were ~le~ d to the sites covered by the oligos which cleaved best in the RNase H assays. These ribozymes were then subjected to analysis by conlpuLtl folding and the ribozymes that had significant second~y structure were rejected.
The ribozymes were chemically synthesized. The general procedures for RNA
synthesis have been described previously (Usman et al., 1987, J. Am. Chem. Soc., 109, 7845-7854 and in Scaringe et al., 1990, Nucl. Acids Res., 18, 5433-5341; Wincott et al., 1995, Nucleic ,4cids Res. 23, 2677). Small scale syntheses were con~ cted on a 394 SUBSTITUTE SHEFT ~RULE 26) PCTrUS96/11689 Applied Biosystems, Inc. synthesizer using a modified 2.5 ~mol scale protocol with a 5 min coupling step for alkylsilyl protected nucleotides and 2.5 min coupling step for 2'-O-methylated nucleotides. Table II outlines the amounts, and the contact times, of the reagents used in the synthesis cycle. A 6-5-fold excess (163 ~IL of 0.1 M = 16.3 ~mol) of phosphoramidite and a 24-fold excess of S-ethyl tetra7.01c (23~ ~L of 0.25 M = 59.5 mol) relative to polymer-bound 5'-hydroxyl was uscd in cach couplillL~ cyclc. Avcr.lgc coupling yields on the 394, determined by colorimetric qualltitatio1l of thc trityl liaclions, was 97.5-99%. Other oligonucleotide synthesis reagents for the 394: Detritylation solution was 2% TCA in methylene chloride (ABI); capping was performed with 16% N-Methyl imid~7Ole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF
(ABI); oxidation solution was 16.9 mM I2, 49 mM pyridinc, 9n/o watcr in Tl l l:
(Millipore). B & J Synthesis Grade acetonitrile was used directly from the reagent bottle.
S-Ethyl tetrazole solution (0.25 M in acetonitrile) was made up from the solid obtained from Am~,.ical. International Chemical, Inc.
D~ c,tcction of the RNA was pc.ru~ ed as follows. The polymer-bound oligoribonucleotide, trityl-off, was transferred from the synthesis column to a 4 mL L~lass screw top vial and suspended in a solution of methylamine (MA) at 65~C for 10 min.
After cooling to -20~C, the sUpe~t~nt was removed from the polymer support. The support was washed three times with l.0 mL of EtOH:MeCN:H20/3:l:1, vortexed and the supernatant was then added to the first supernatant. The combined supernatants, ct nt~inin~ the oligoribonucleotide, were dried to a white powder.
The base-deprotected oligoribon-lcleotide was res--spend~d in anhydrous TEA-HF/NMP solution (250 ~LL of a solution of 1.5 rnL IV-methylpyrrolidinone, 750 ~lL
TEA and 1.0 mL TEA-3HF to provide a 1.4 M HF concentration) and heated to 65~C for 1.5 h. The reSlllting~ fully deprotected, oligom~r was quenched with 50 mM TEAB (9 mL) prior to anion ~-Yeh~nge des~ltine For arlion e~ .ge des~lting of the deprotected oligomer, the TEAB solution was loaded onto a Qiagen 500~) anion ~Yrh~n~ cartridge (Qiagen Inc.) that was prewashed with 50 mM TEAB (10 mL). After washing the loaded cartridge with 50 mM TEAB (10 mL), the R~A was eluted with 2 M TEAB (10 mL) and dried down to a white powder.
Inactive h~mm-orhead ribozymes were synthesized by substituting a U for Gs and aU for A 14 (numbering from (Hertel, K. J., et al., 1992, Nucleic Acids Res., 20, 3252).

SUBSTITUTE SHEET (R~JLE 26) -PCT~US96/11689 The hairpin ribozymes were synthesized as described above for the hammerhead ~As.
Ribozymes were also synthesized from DNA templates using bacteriophaL~e T7 R~A polymerase (Milligan and Uhlenbeck, 19~9, ~v~ethods Enzyn~o~ n 51).
Ribozymes were purified by gel electrophoresis using gcncral mclhods or wcrc pllriilc(l by high pressure liquid chromatography (IIPLC; Scc Wincolt e~ fJl., 1')()~), .sU/Jrcl, lllc totality of which is hereby incorporated herein by reference) and were resuspended in water. The sequences of the chemically synthesized ribozyllles uscd in this stlldy arc shown below in Tables Vll and VIII.
ExamDle 6: Lon~ substrate tests for ~9 desaturase ribozvmes Target RNA used in this study was 1621 nt long and con-~intod cleavage sites for all the HH and HP ribozymes targeted against ~-9 desaturase RNA. A template containing T7 RNA polymerase promoter IlpsLr~anl of ~-9 desaturase target sequencel was PCR~mrlifif~d from a cDNA clone. Target RNA was transcribed from this PCR amplifiedtemplate using T7 RNA polymerase. The llanscli~t was internally labeled during l~allscli~,tion by inr,l~ in8 [o~ 32p] CTP as one of the four ribonucleotide triphosphates.
The ll~lls~ yliOnl~ LLul~ was treated with DNase-I, following kal,s~iylion at 37~C for 2 hours, to digest away the DNA template used in the transcription. The transcription mixture was resolved on a d~ a~ g polyacrylamide gel. Bands corresponding tO full-length RNA was isolated from a gel slice and the RNA was ~lGci~ al. d with isopropanol and the pellet was stored at 4~C.
Ribozyme cleavage reactions were carried out under ribozyme excess (kCat/KM) conditions (Herschlag and Cech, 1990, Biochemistry 29, 10159-10171). Briefly, I mM
ribozyme and c 10 nM intern~lly labeled target RNA were del~alul~d separately byheating to 65~C for 2 min in the ~l~sencc of 50 mM Tris.HCI, pH 7.5 and 10 mM
MgC12. The RNAs were renatured by cooling to the reaction t~ ,.dLul~ (37~C, 26~C or 20~C) for 10-20 min. Cleavage reaction was initi~ted by mixing the ribozyme and target RNA at applo~-iate reaction tt~ e~alLIlcs. Aliquots were taken at regular intervals of time and the reaction was quenrhecl by adding equal volume of stop buffer. The samples were resolved on 4 % sequencing gel.
The results from ribozyme cleavage reactions, at 26~C or 20~C, are summarized inTable IX and Figures 1~ and 16. Of the ribozymes tested, seven h~mmerheads and two SUBSflTUTE SHEET (RULE 26) PC~AUS96/11689 hairpins showed significant cleavage of ~-9 desaturase RNA (Figures 15 and 16).
Ribozymes to other sites showed varied levels of activity.
Example 7: Cleava~e of the tar~et RNA usin~ multiple ribozvme combinations for ~9 desaturase Several of the above ribozymes were incorporatcd illtO a multimcl ribo;zylllc construct which contains two or more ribozymes embeddcd in a contiguous strctcll Or compl~ y RNA sequence. Non-limiting examples of multimer ribozymes are shown in Figures 17, 18, 19 and 23. The ribozymes were made by annealling complementary oligonucleotides and cloning into an ~ .res~ion vector containing thc Cauliflowcr Mosaic Virus 35S ~r h~n~ed promoter (Franck et al., 1985 Cell 21, 285), the maize Adh I intron (Dennis et al., 1984 Nucl. ~cids Res. 12, 3983) and the Nos polyadenylation signal (DePicker et al., 1982 J. Molec. ~ppl. Genet. 1, 561). Cleavage assays with T7 transcripts made from these multimer-cont~ining transcription units are shown in Figures 20 and 21.
These are non-limiting examples; those skilled in the art will r~,co~ that similar embodi~ll.,.ll~, co~ .g of other ribozyme combinations, introns and promoter elements, can be readily gellc,~ted using techniques known in the art and are within the scope of this nvention.
Exam~le 8: Construction of Ribozvme e,~ sin~ Lldn~c~ lion units for ~9 desaturase Ribozymes targeted to cleave ~\-9 desaturase mRNA are endogenously expressed in plants, either from genes inserted into the plant genome (stable transforrnation) or from episomal transcription units (transient e~y~s~ion) which are part of plasmid vectors or viral sequences. These ribozymes can be e~p,essed via RNA polymerase I, II, or III
plant or plant virus promoters (such as CaMV). Promoters can be either constitutive, tissue specific, or developm~.tS~lly e~ ,ssed.
Q9 259 Monomer Ribozvme Constructs (RPA 114, 115) These are the ~-9 desaturase 259 monnrn~r h~.. l~ead ribozyme clones. The ribozymes were d~o~igned with 3 bp long stem II and 20 bp (total) long substrate binding arms targeted against site 259. The active version is RPA 114, the inactive is RPA 115.
The parent plasmid, pDAB367, was ~i~ect~d with Not I and filled in with Klenow to 30 make a blunt acceptor site. The vector was then fli~çsted with Hind III restriction enzyme. The ribozyme containing plasmids were cut with ~:co R~, filled-in with Klenow and recut with Hind III. The insert cont~inin~ the entire ribozyme transcription unit was SUBSTITUTE SHEET (RULE 26) PCT~US96/11689 gel-purified and ligated into the pDAB 367 vector. The constructs are checked by. digestion with Sgf I/Hind III and Xba I/Sst I and confirmed by sequencing.
~9 4~3 Multimer Ribozvme Constructs (RPA 118. 119) These are the ~-9 desaturase 453 Multimer hammcrllcad ribozymc CIOllCS (SCC
Figure 17). The ribozymes were designed with 3 bp long stc111 il rcgions. Total lc~
the substrate binding arms of the m~lltimer construct was 42 bp. The aclivc vcrsion is RPA 118, the inactive is 119. The constructs were made as described above for the 259 onolllei. The multimer construct was ~esigned with four hammerhead ribozymes ed against sites 453, 464, 475 and 484 within ~-9 desaturase RNA.
~9 252 Multimer Ribozvme Constructs (RPA 85. 113) These are the ~-9 desaturase 252 mllltimer ribozyme clones placed at the 3'end of bar (phosphoinothricin acetyl transferase; Thompson et al., 1987 EMBO J. 6: 2519-2523) open reading frame. The m-lltimPr contructs were d~ci~d with 3 bp long stem II
regions. Total length of the ~ul~hdte binding arms of the mlllti~er construct was 91 bp.
RPA 85 is the active ribozyme, RPA 113 is the inactive. The vector was constructed as follows: The parent plasmid pDAB 367 was partially ~igected with Bgl 11 and the single cut plasmid was gel-purified. This was recut with ~:co Rl and again gel-purified to isolate the correct Bgl ITJ~:co RI cut fr~gm~Pnt The Bam HI/ Eco R~ inserts from the ribozyme corlshu~ were gel-isolated (this contains the ribozyme and the NOS poly A region) and ligated into the 367 vector. The identitiy of positive plasmids were conr.-l,.ed by pr ~ a Nco I / Sst I digest and sequ~n~ing Useful l~dnsg~,lic plants can be j~A~ntified by standard assays. The l~dnsg~,.lic plants can be evaluated for reduction in A-9 desaturase e~ ion and A 9 desaturase activity as Ai~c~l~sed. in the examples infra. .
Fy~mr-le9~ Pntific~tion of Potential RibozYme Cleava~e Sites in GBSS RNA
Two hundred and forty one hammer-head ribozyme sites were identified in the com GBSS mRNA polypeptide coding region (see table IIIA). A h~mmer-head site consists of a uridine and any nucleotide except guanine (UH). Following is the sequence of GBSS
coding region for corn (SEQ. I.D. No. 25). The numbering system starts with I at the 5' end of a GBSS cDNA clone having the following sequence (5 ' to 3 '):

SUBSTITUTE SHEET (RULE 26) GAccGATcGATcGccAcAGccAAcAccAcccGccGAGGcGAcGcGAcAGccGccA
GGAGGAAGGAATAAACT

CACTGCCAGCCAGTGAAGGGGGAGAAGTGTACTGcTccGTccAcCAGTGCGCGCA
CCGCCCGGCAGGGCTGC
145 21(.
TCATCTCGTCGACGACCAGTGGATTAATCGGcA I GGCGGCTCl /~GCCACGTCC;~/~
GCTCGTCGCAACGCGCG
217 2%~
10 CCGGCCTGGGCGTCCCGGACGcGTccAcGTTccGccGcGGCGCCGCGCAGGGCCT
GAGGGGGGGCCGGACGG

CGTCGGCGGCGGACACGCTCAGCATTCGGACCAGCGCGCGCGCGGCGCCCAGGCT
CCAGCACCAGCAGCAGC

AGcAGGcGcGccGcGGGGccAGGTTcccGTcGcTcGTcGTGTGcGccAGcGccGG
CATGAACGTCGTCTTCG

TCGGCGCCGAGATGGCGCCGTGGAGCAAGACCGGCGGCCTCGGCGACGTCCTCGG
CGGCCTGCCGCCGGCCA

TGGCCGCGAATGGGCACCGTGTCATGGTCGTCTCTCCCCGCTACGACCAGTACAA
GGACGCCTGGGACACCA

2S GcGTcGTGTccGAGATcAAGATGGGAGAcAGGTAcGAGAcGGTcAGGTTcTTccA
CTGCTACAAGCGCGGAG

TGGACCGCGTGTTCGTTGACCACCCACTGTTCCTGGAGAGGGTTTGGGGAAAGAC
CGAGGAGAAGATCTACG

GGCCTGACGCTGGAACGGACTACAGGGACAACCAGCTGCGGTTCAGCCTGCTATG
CCAGGCAGCACTTGAAG

CTCCAAGGATCCTGAGCCTCAACAACAACCCATACTTCTCCGGACCATACGGGGA
GGACGTCGTGTTCGTCT

Sl~ 111 UTE SHEE~ (RULE 26) 32 PCTrUS96/11689 GcAAcGAcTGGcAcAccGGcccTcTcTcGTGcTAccTcAAGAGcAAcTAccAGTcc CACGGCATCTACAGGG

AcGcAAAGAccGcTTTcTGcATccAcAAcATcTccTAccAGGGccGGTTcGccTTc TCCGACTACCCGGAGC
1009 I t)xt) TGAAccTcccGGAGAGATTC~AGTcGTccT rCci~ r I I ~AIC'(;A~(i(i(lAC(iA(i~A
GCCCGTGGAAGGCCGGA

10 AGATcAAcTGGATGAAGGccGGGATccTcGAGGccGAcAGGGTccTcAccGTcAG
CCCCTACTACGCCGAGG

AGcTcATcTccGGcATcGccAGGGGcTGcGAGcTcGAcAAcATcATGcGccTcAc CGGCATCACCGGCATCG

TCAACGGCATGGACGTCAGCGAGTGGGACCCCAGCAGGGACAAGTACATCGCCGT
GAAGTACGACGTGTCGA

CGGCCGTGGAGGCCAAGGCGCTGAACAAGGAGGCGCTGCAGGCGGAGGTCGGGC
TCCCGGTGGACCGGAACA
1369 . 1~0 TCCCGCTGGTGGCGTTCATCGGCAGGCTGGAAGAGCAGAAGGGACCCGACGTCAT
GGCGGCCGCCATC~
1441 . 1512 AGcTcATGGAGATGGTGGAGGAcGTGcAGATcGTTcTGcTGGGcAcGGGcAAGA
AGAAGTTCGAGCGCATGC
1513 . 1584 TCATGAGCGCCGAGGAGAAGTTCCCAGGcAAGGTGcGcGccGTGGTcAAGTTCAA
CGCGGCGCTGGCGCACC

AcATcATGGccGGcGccGAcGTGcTcGccGTcAccAGccGcTTcGAGcccTGcGGc CTCATCCAGCTGCAGG

GGATGCGATACGGAACGCCCTGCGCcTGcGcGTccAccGGTGGAcTcGTCGACAC
CATCATCGAAGGCAAGA

SUBSTITUTESHEET(RULE26) W O 97110328 33 PCTrUS96/11689 CCGGGTTCCACATGGGCcGccTcAGcGTcGAcTGcAAcGTcGTGGAGCCGGCGGA
CGTCAAGAAGGTGGCCA

CCACCTTGCAGCGCGCCATcAAGGTGGTcGGcAcGccGGcGTACGAGGAGATGGT
GAGGAACTGCATGATCC
18?3 1')44 AGGATcTcTccTGGAAGGGcccTGccAAGAAcTGGG/~GAAcGTGc~ c-l'c~ cT
CGGGGTCGCCGGCGGCG

10 AGccAGGGGTcGAAGGcGAGGAGATcGcGccGcTcGccAAGGAGAAcGTGc'Jccc' CGCCCTGAAGAGTTCGGC

CTGCAGGCCCCCTGATCTCGCGCGTGGTGCAAACATGTTGGGACATCTTCTTATAT
ATGCTGTTTCGTTTAT

GTGATATGGACAAGTATGTGTAGCTGCTTGcTTGTGcTAGTGTAATATAGTGTAG
TGGTGGCCAGTGGCACA

AccTAATAAGcGcATGAAcTAATTGcTTGcGTGTGTAGTTAAGTAccGATcGGTA
ATTTTATATTGCGAGTA

AATAAATGGAccTGTAGTGGTGGAAAAAAAAAAAA(sEQI.D~No.2s).

Thcre are a~yloxil~ s3 potential hairpin ribozyme sites in the GBSS mRNA.
25 The ribozyme and target sequences are listed in Table V.

Ribozymes can be readily d~Ci~n~d and s~ Pd to such sites with between 5 and 100 or more bases as aubaLIate binding arms (see Figs. 1 - 5) as described above.

30 r~ 10: Sel~ -- of Ribozvrne Cleava~e Sites for GBSS
The seco~ structure of GBSS mRNA was ~ssPcced by computer analysis using foldingalg~ l",ls, such as the ones developed by M- Zuker ( Zuker, M., 1989 Science, 244, 48-52. Regions of the mRNA that did not form secondary folding structures with RNAtRNA stems of over eight nucleotides and cont~ined potential 1-,.. . " . . l,~:ad 35 ribozyme cleavage sites were id~PntifiP~l SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 These sites which were then assessed for oligonucleotide accessibility with RNasc H assays (see Fig. 6). Fifty-eight DNA oligonucleotides, each twenty one nucleotides long were used in these assays. These oligonucleotides covered 85 sites. The position and decign~tion of these oligonucleotides were 195, 205, 240, 307, 390, 424, 472, 4~
5 539, 592, 625, 636, 678, 725, 741, 811, 859, 891, 897, 912, 91 ~, 92~, 951, 95~, 9(~9, 993, 999, 1015, 1027, 1032, 1056, 1084, 1105, 1156, 116~ )5, 12()4, 121~, 1222,1240, 1269, 1284, 1293, 1345, 1351, 1420, 1471, 1533, ~563, 1714, 1750, 17~6, 1806, 1819, 1921, 1954, and 1978. Secondary sites were also covered and included 202, 394, 384, 38S, 484, 624, 627, 628, 679, 862, 901, 930, 950, 952, 967, 990, 991, 1026, 1035, 101108, 1159, 1225,1273, 1534, 1564, 1558,and 1717.
Example 11: RNaseH Assavs for GBSS
RNase H assays (Fig. 7) were pc.rul.ned using a full length transcript of the GBSS
coding region,3' noncoding region, and part of the 5' noncoding region. The GBSS RNA
was s.irccned for ncc~ scible cleavage sites by the method described generally in Draper et 15 al., supra. hereby incorporated by reference herein. Briefly, DNA oligonucleotides l~,plt,s~ h~....... ~,l,ead ribozyme cleavage sites were synth~osi7~ A polymerase chain reaction was used to generate a substrate for T7 RNA polymerase transcription from corn cl~A~cTones. Labeled RNA trans~ were synthesi7et~ in vitro from these templates.The oligonucleotides and the labeled ll~nscli~ts were annealed, RNAseH was added and 20 the llli~Lu-~_S were incubated for 10 min~-tes at 37~C. Reactions were stopped and RNA
s~pal~l~d on sequencing polyacrylamide gels. The pe..,~ ge of the substrate cleaved was d~h-l--i-lcd by autoradiographic ~luantil~lion using a phosphor ill.a~illg system (Fig.
7).
Exarnple 12: E~ .. ..I ~F Pd Ribozymes for GBSS
."".~ d ribozymes with 10/10 (i.e., able to form 10 base pairs on each arrn of the riboyme) mlcleotide binding arms were dloci~ç(l to the sites covered by the oligos which cleaved best in the RNase H assays. These ribozymes were then subjected toanalysis by cor..~ hl folding and the ribozymes that had significant secondary structure were rejected. As a result of this sc,e.,~ lg procedure 23 ribozymes were d~sign~od to the 30 most open regions in the GBSS mRNA, the sequences of these ribozymes are shown in Table IV.
The ribozymes were chemically synthesized. The method of synthesis used "
follows the procedure for normal RNA synthesis as described above (and in Usman et al., SUBSTITUTESHEET(RULE26) WO 97/10328 PCTrUS96/11689 supra. Scarin~e et al., and Wincott el al, supra) and are incorpolatcd bv rcfcrcllcc l1crcill, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end, and phosphoramidites at the 3'-end. The average stepwise coupling yields were >98%. Inactive ribozymes were synthesized by substituting a U for G5 and a U for A14 (numbering from (Hertel e~ al., supra). I-Tairpill ribo~ymcs wcrc synthesized in two parts and annealed to reconstruct thc activc rih07~ylnc ~Chowril;l all(i Burke, 1992, NucleicAcids Res., 20, 2835-). All ribozymcs wcrc modificd to cnl)allcc stability by modification of five ribonucleotides at both tllc 5' and 3' cnds with 2'-C)-methyl groups. Ribozymes were purified by gel electrophoresis using general methods.
10 (Ausubel et al., 1990 Current Protocols in Molecular Biology Wiley & Sons, NY) or were purified by high pres~u~ liquid chromatography, as dcscribcd abovc and wcrc resuspended in water.
Example 13: Lone Substrate Tests for GBSS
Target RNA used in this shldy was 900 nt long and contained cleavage sites for all 15 the 23 HH ribozymes lal~.,t.d against GBSS RNA. A template containing T7 RNA
polymerase promoter upstream of GBSS target sequence, was PCR amplified from a cDNA clone. Target RNA was transcribed from this PCR amplified template using T7RNA polymerase. The L.dlls~ t was internally labeled during transcription by incln~ine [a-32P] CTP as one of the four ribnn~cleotide triphosphates. The l~al~sc~il lion mixture 20 was treated with DNase-l, following transcription at 37~C for 2 hours, to digest away the DNA template used in the transcription. The transcription mixture was resolved on a df~ lfr polyacrylamide gel. Bands cG"~ ,ollding to full-length RNA was isolated from a gel slice and the RNA was pl~ . iyilated witb isoprol,allol and the pellet was stored at4~C
Ribozyme cleavage reactions were carried out under ribozyme excess (kCat/KM) c~n-TitiQr~c (Herschl~g and Cech, supra). Briefly, 1000 nM ribozyme and < 10 nM
intern~lly labeled target RNA were denatured separately by heating to 90~C for 2 min. in the p~es~,.cc of 50 mM Tris.HCI, pH 7.5 and 10 mM MgC12. The RNAs were r~.,atul~d by cooling to the reac~ion tcmp.,lalu,e (37~C, 26~C and 20~C) for 10-20 min. Cleavage reaction was initi~ted by mixing the ribozyme and target RNA at appropriate reaction t.,,~,l.e.a~ es. Alquots were taken at regular intervals of time and the reaction was q". ~.~hF~ by adding equal volume of stop buffer. The samples were resolved on 4%
SC~ gel.

SUBSTITUTE SHEET (RULE 26) W O 97/10328 PCTrUS96/11689 The results from ribozyme cleavage reactions, at the three different temperatures, are s~ A~i~ed in Figure 8. Seven lead ribozymes were chosen (425, 892, 919, 959, 968, 1241, and 1787). One of the active ribozymes (811) produced a strange pattern ofcleavage products; as a result, it was not chosen as one of our lead ribozymcs.
5 Example 14: Cleava~e of the GBSS RNA Usin~ Multiplc Ribozvmc Combinaliolls Four of the lead ribozymes (892, 919, 959, 1241) wcrc incubatcci witll inlcrllally labeled target RNA in the following combinations: 892 alone; 892 + 919; 892 + 919 +
959; 892 + 919 + 959 + 1241. The fraction of RNA cleavage increascd in an additivc manner with an increase in the number of ribozymes used in the cleavagc rcaction (~ig. 9).
10 Ribozyme cleavage reactions were carried out at 20~C as described above. These data suggest that multiple ribozymes targeted to dirr~,.e.lt sites on the same mRNA will increase the reduction of target RNA in an additive manner.
Example 15: Construction of Ribozvme E~rcssill~ Transcription Units for GBSS
Cloning of GBSS Multimer Ribozymes RPA 63 (active) and RPA64 (inactive) A mllltim~r ribozyme was constructed which contained four ha.",.,~,.l.ead ribozymes targeting sites 892, 919, 959 and 968 of the GBSS mRNA. Two DNA oligonucleotides(Macromolecular Resourses, Fort Collins, CO) were ordered which overlap by 18 nucleotides~ The sequences were as follows:
Oligo 1: CGC GGA TCC TGG TAG GAC TGA TGA GGC CGA AAG GCC GAA
ATG TTG TGC TGA TGA GGC CGA AAG GCC GAA ATG CAG AAA GCG GTC
1 T ~ GCG TCC CTG TAG ATG CCG TGG C

25 Oligo 2: CGC GAG CTC GGC CCT CTC '1 TT CGG CCT TTC GGC CTC ATC AGG
TGC TAC CTC AAG AGC AAC TAC CAG TTT CGG CCT TTC GGC CTC ATC
AGC CAC GGC ATC TAC AGG G

Inactive versions of the above were made by substituting T for G5 and T for A 14 within 30 the catalytic core of each ribozyme motif.

These were annealed in I X Klenow Buffer (Gibco/BRL) at 90~C for 5 minutes and slow cooled to room t~ c~dture (22~C). ~TPs were added to 0.2 mM and the oligos SUBSTITUTE SHEET (RULE 26) W O 97/10328 PCTrUS96/11689 extended with Klenow enzyme at lunitlul for one hour at 37~C. Tilis was phenol/chloroform extracted and ethanol precipitated, then resuspended in lX React 3 buffer (Gibco/BRL) and digested with Bam HI and Sst I for I hour at 37~C. The DNA
was gel purified on a 2% agarose gel using the Qiagen gel extraction kit.
The DNA fragments were ligated into BamHI/S.st I digcstcd r~r)AI~ ~53. 'l'llc li~.tlioll W;lS
transformed into competent DHSa F' bactcria (Gibco/13RL). l'otcnLial cloncs wcrcscreened by digestion with Bam HJ/~co RI. Clones were confirrned by sequencing. The total length of homology with the target sequence is 96 nucleotides.
919 Monomer Ribozyme (RPA66) Asingle ribozyme to site 919 of the GBSS mRNA was constructed with 10/10 anns asfollows. Two DNA oligos were ordered:
Oligo 1: GAT CCG ATG CCG TGG CTG ATG AGG CCG AAA GGC CGA AAC
TGG TAG TT

Oligo 2: AAC TAC CAG TTT CGG CCT TTC GGC CTC ATC /~GC Cl~C GGC ATC

The oligos are phosphorylated individually in lX kinase buffer (Gibco/BRL) and heat den~Lul~,d and ~nnP~l~(l by colllb;~ lg at 90~C for 10 min, then slow cooled to room L~ .,.aLule (22~C). The vector was ,~,le~aled by digestion of pDAB 353 with Sst I and 25 blunting the ends with T4 DNA polymerase. The vector was redigested with Bam HI and gd purified as above. The ~nnç~ oligos are ligated to the vector in lX ligation buffer (GibcotBRL) at 16~C ovemight. Potential clones were digested with Bam HI/Eco RI and c~ by sequ~n~inE~

FY~mrle 16: Plant Tlall,Çollllation Plasmids pDAB 367, Used in the ~9 Ribozyme E,~e.illl~, ,t~ and pDAB353 used in the GBSS Ribozvme E~Je~;llle~lL~

Part A pDAB367 Plasmid pDAB367 has the following DNA structure: be~innin~ with the base after the final C residue ofthe Sph I site of pUC 19 (base 441; Ref. 1), and reading on the strand conti~ous to the LacZ gene coding strand, the linker sequence CTGCAGGCCGGCC

SUBSTITUTE SHEET (RULE 26) CA 02226728 l99X-01-13 TTAATTAAGcGGccGcGTTTAAAcGcccGGGcATTTAAATGGcGcGccGc GATCGCTTGCAGATCTGCATGGGTG. nucleotides 7093 to 7344 of CaMV DNA
(2), the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAGGATCCAG, nucleotides 167 to 186 of MSV (3), nucleotides 188 to 277 of MSV (3), a C residue followed by nuclcotidcs 119 to 209 of maize Adh IS containing parts of exon I and intron I (4), nLlclcoli(lc.~i 5~S~ lo fi72 r corlt~ining parts of Adh lS intron I and exon 2 (4), the linkcr scqucllcc G~CGCi~'l'C'I'Ci, and nucleotides 278 to 317 of MSV. This is followed by a modified BAR coding region from pIJ4104 (5) having the AGC serine codon in the second position replaced by a GCC
10 alanine codon, and nucleotide 546 of the coding region changed from G to A to eliminate a Bgl II site. Next, the linker sequence TGAGATcTGAGcTcG~/\TTTcccc~
nucleotides 1298 to 1554 of Nos (6), and a G residue followed by the rest of the pUC 19 sequence (including the Eco RI site).

15 Part B pDAB353 Plasmid pDAB353 has the following DNA structure: beginning with the base after the final C residue ofthe Sph I site of pUC 19 (base 441; Ref. 1), and reading on the strand contiguous to the LacZ gene coding strand, the linker sequellce CTGCAGATCTGCATGGGTG, nucleotides 7093 to 7344 of CaMV DNA (2), the 20 linker se~ .re CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker scq~lencc GGGGACTCTAGAG, nucleotides 119 to 209 of maize Adh I S cont~inin~r parts of exonI and intron I (4), nucleotides 555 to 672 cont~inin~ parts of Adh IS intron I and exon 2 (4~, and the linker sequ~nre GACGGATCCGTCGACC, where GGATCC let,lesGnts the recognihon se~ c for BamH I restriction enzyme. This is followed by the beta-25 glu~:ulunidase (GUS) gene from pRAJ275 (7), cloned as an Nco I/Sac I fr~grn~nt, the linker sequence GAAITTCCCC, the poly A region in nucleotides 1298 to 1554 of Nos(6), and a G residue followed by the rest of the pUC 19 sequence (including the Eco RI
site).

30 The following are herein incoll~ulahd by reference:

1. Messing, J. (1983) in "Methods in Enzymology" (Wu, R. et al., Eds) 101 :20-78.
2. Franck, A., H. Guilley, G. Jonard, K. Richards, and L. Hirth (1980) Nucleotide sequenre of Cauliflower Mosaic Virus DNA. Cell 21 :285-294.

SUBSTITUTE SHEET (RULE 26) 3. ~lllline~ c, P. M., J. Donson, B. A. M. Morris-Krsinich. M. I. Boulton, and J W.
Davies (1984) The nucleotide sequence of Maize Streak Virus DN~. EMBO J. 3:3063-3068.

4. Dennis, E. S., W. L. Gerlach, A. J. Pryor, J. L. Bennetzen, A. In~lis, D. Llewellyn, M.
M. Sachs, R. J. Ferl, and W. J. Peacock (1984) Molccular analysis of ~hc alcol-ol dehydrogenase (Adhl) gene of maize. Nucl. Acids Res. 12:39X3-4()()().

5. White, J., S-Y Chang, M. J. Bibb, and M. J. Bibb (1990) ~ casscttc containill~ ll1c ~ur gene of Streptomyces hygroscopicus: a selectable marker for plant transformation. Nucl.
Acids. Res. 18: 1062.

6. DePicker, A., S. Stachel, P. Dhaese, P. Zambryski, and 11. M. Goodm~ll (1982)Nopaline Synthase: Transcript mapping and DNA seq~lencc. J. Molec. ~ppl. Gcnct:
1 :561-573.

7. Jt;rr.,.~on, R. A. (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant Molec. Biol. Reporter ~:387-405.
Example 17: Plasmid pDAB359 a Plant Tran~ro"llalion Plasmid which Contains the Gamma-Zein Promoter. the ~nti~n~e GBSS. and a the Nos Polvadenvlation Sen~l~nre Plasmid pDAB359 is a 6702 bp double-stranded, circular DNA that contains the following seqle~lce clf ~ : nucleotides 1-404 from pUC18 which include lac operon se.~ e from base 238 to base 404 and ends with the HindIII site of the M13mpl8 polylinker (1,2); the Nos polyadenylation se~ cc from nucleotides 412 to 668 (3); a synthetic adapter se.~ e from nucleotides 679-690 which converts a Sac I site to an Xho I site by ch~n~ng GAGCTC to GAGCTT and adding CTCGAG: maize ~ranule bound starch synthase cDNA from bases 691 to 2953, collej,uonding to nucleotides 1-2255 of SEQ. I.D. No. 25. The GBSS sequence in plasmid pDAB359 was modified fromthe original cDNA by the ~dclition of a 5' Xho I and a 3' Nco I site as well as the deletion of intemal Nco I and Xho I sites using Klenow to fill in the enzyme recognition se.lu~,nccs. Bases 2971 to 4453 are 5' untr~ncl~t~d sequence of the maize 27 kD gamma-zein gene coll~,s~nding to nucleotides 1078 to 2565 of the published sequence (4). The gamrna-zein sequence was modified to contain a 5' Kpn I site and 3' BarnH/SalltNco I
sites. Additional changes in the gamma-zein sequence relative to the published sequence include a T deletion at nucleotide 104, a TACA deletion at nucleotide 613, a C to T
conversion at nucleotide 812, an A deletion at nucleotide 1165 and an A insertion at nucleotide 1353. Finally, nucleotides 4454 to 6720 of pDAB359 are identical to pucl8 bases 456 to 2686 including the Kpn I/Eco~/Sac I sites of the M13/mpl8 polylinker SUBSTITUTE SHEET (RULE 26) PCTAJS96/116~9 from 4454 to 4471, a lac operon fra_ment from 4471 to 4697,andthel3-lacatlllase L~ene from 5642 to 6433 (1, 2).

The following are incorporated by reference herein:
pUC18- Norrander, J., Kempe, T., Messing, J. Gene (1983) 2t~: 101-10~; Pnuwcls. 1'.11 Enger-Valk, B.E., Brammar, W. J. Cloning Vectors, Elscvicr 19~5 and supr)lclllc NosA - DePicker, A., Stachel, S., Dhaese, P., Zambryski, P., and Goodman, H.M.
(1982) Nopaline Synthase: Transcript Mapping and DNA Sequence J. Molec. Appl.
Genet. 1:561-573.

Maize 27kD gamma-~ein - Das, O.P., Poliak, E.L., Ward, K., Messing, J. Nucleic Acids Research 19, 3325 - 3330 (1991).
Example 18: Construction of Plasmid pDAB430. containin~ Antisense ~9 Desaturase,E~ressed bv the Ubiquitin Promoter/intron (Ubi 1) Part A Construction of plasmid pDAB421 Plasmid pDAB421 cont~inc a unique blunt-end Srp cloning site flanlced by the maize Ubiquitin promote./i~ un and the nopaline synthase polyadenylation sequences pDAB421 was p~ arcd as follows~ ction of pDAB355 with restriction enzymes KpnI and BamHI drops out the R coding region on a 2.2 kB fr~gm~nt Following gel purification, the vector was ligated to an adapter composed of two annP~I~d oligonucleotides OF235 and OF236. OF235 has the sequence 5' - GAT CCG CCC GGG
GCC CGG GCG GTA C - 3' and OF236 has the seqlI~nre 5' - CGC CCG GGC CCC
GGG CG - 3'. Clones co..I;.;..;..g this adapter were id~ntifiecl by digestion and lînca.,zation of plasmid DNA with the enzymes Srp and SmaI which cut in the adapter, but not elsewhere in the plasmid. One rt,~les~ntative clone was sequenced to verify that 30 only one adapter was inserted into the plasmid. The resulting plasmid pDAB421 was used in subsequent construction of the /~9 desaturase antisense plasmid pDAB430.
Part B Construction of plasmid pDAB430 (~nticence ~9 desaturase) The antic~nce ~9 desaturase construct present in plasmid pDAB430 was produced by35 cloning of an amplification product in the blunt-end cloning site of plasmid pDAB421.
Two constructs were produced simult~r,eQusly from the same experiment. The first SUBSTITUTE SHEET (RULE 263 PCTrUS96/11689 construct contains the ~9 desaturase gene in the sense orientation behilld the ubiquitin promoter, and the c-myc tag fused to the C-terminus of the ~9 desaturase open reading frame for imm--nological detection of overproduced protein il1 transgenic lines This construct was int.-n-le(l for testing of ribozymes in a systeln which did not express maize 5 ~9 desaturase. This construct was never used, but thc primcrs uscd to amplify an(~
construct the ~9 desaturase antisense gene were thc sal11c Thc ~9 (lcs.lltll,l~c cl)NA
sequence described herein was amplified with two primcrs. Tl1c N-tcrmin~l pril1lcr OF279 has the sequence 5'- GTG CCC ACA ATG GCG CTC CGC CTC AAC GAC -3'. The underlined bases correspond to nucleotides 146-166 of the cDN~ scqucncc. C-10 terminal primer OF280 has the sequence 5' - TCA TCA CAG GTC CTC CTC GCT
GAT CAG CTT CTC CTC CAG TTG GAC CTG CCT ACC GTA - 3' and is the reverse complement of the sequence 5' - TAC GGT AGG GAC GTC CAA CTG GAG
GAGAAG CTGATCAGC GAG GAG GAC CTG TGA TGA - 3'. In this sequence the underlined bases correspond to nucleotides 1304-1324 of the cDNA sequence, the bases 15 in italics correspond to the sequence of the c-myc epitope. The 1179 bp of amplification product was purified through a 1.0% agarose gel, and ligated into plasmid pDAB421 which was lineari~d with the restriction enzyme Srf I. Colony hybridization was used to select clones c~ g the pDAB421 plasmid with the insert. The orientation of the insert was deterrnined by restriction digestion of plasmid DNA with ~ nos~ic enzymes 20 KpnI and BamHI. A clone co..~ .;..g the A9 desaturase coding sequence in thc scnse orientation relative to the Ubiquitin promote./inllon was recovered and was named pDAB429. An additional clone co~ g the ~9 desaturase coding sequence in the ce orientation relative to the promoter was named pDAB430. Plasmid pDAB430 was subjected to sequerl~e analysis and it was d. te.uli,.ed that the sequence co,l~ cd 25 three PCR indllce~l errors compared to the expected sequence. One error was found in the S~ u~llCC co"~sponding to primer OF280 and two nucleotide çh~ng,~c were observedinternal to the coding se~ cc. These errors were not corrected, because antisense dow~ tion does not require 100% sequence identity between the ~ntic~n~e transcript and the dowl~e~ tion target.
Example 19: Helium Blastin~ of Embryo~enic Maize Cultures and the Subsequent Re~e~ aliOn of Trans~enic Pro~eny Part A Establi~hment of embryogenic maize cultures. The tissue cultures employed in 35 l.all:,Ç~llllalion e~ e,lts were initiated from imm~tl~re zygotic embryos of the genotype "Hi-II". Hi-II is a hybrid made by illtellllalillg 2 R3 lines derived from a SlJ~s l 11 ulTE SHEET (RULE 26) PCTrUS96/11689 B73xA188 cross (Arrnstrong et al. 1990). When cultured, this genotype produces callus tissue known as Type II. Type II callus is friable, grows quickly, and exhibits the ability to maintain a high level of embryogenic activity over an eYtended time period.

5 Type II cultures were initiated from 1.5-3.0 mm immaturc cmbryos rcsulti~ fromcontrolled pollinations of greenhouse grown Hi-lI plants. Thc initiatiOIl mcdiulll u.~iccl w,l~
N6 (Chu, 1978) which contained 1 0mg/L 2,4-D, 25 mM L-prolinc, 1()0 m~/L casCillhydrolysate, 10 mg/L AL~No3~ 2.5 ~/L gelrite and 2% sucrose adjusted to pH 5.8. For approximately 2-8 weeks, selection occurred for Type I1 callus and against non-10 embryogenic and/or Type I callus. Once Type II callus was sclccted, it was transrcrrcd toa ,,~ lce medi~lln in which AgNO3 was omitted and L-prolinc reduccd to ~mM.

After approximately 3 months of subculture in which the quantity and quality of embryogenic cultures was increased, the cultures were deemed acceptablc for usc in 15 L~ar,s~ll..alion e~c~.c,.,..~

Part B Preparation of plasmid DNA. Plasmid DNA was adsorbed onto the surface of gold particles prior to use in transformation c~ ncl~La. The experiments for the GE~SS
target used gold particles which were sphclical with ~ met~ors ranging from 1.5-3.0 20 ~lliClOIls (Aldrich Chemical Co., Milwaukee, WI). T.a.,~rolnation e~,."i",c"ts for the ~9 dcs&L-I-dse target used 1.0 micron spherical gold particles (Bio-Rad, Hercules, CA). All gold particles were surface-sterilized with ethanol prior to use. Adsorption wasaccomplished by adding ?4 ~LI of 2.5 M calcium chloride and 30 ~1 of 0.1 M spermidine to 300 ~1 of plasmid DNA and sterile H20. The co~ e~ aLion of plasmid DNA was 140 2~ ~g. The DNA-coated gold particles were ;.~ ccl;~ ly vortexed and allowed to settle out of sUspen~ior~ The res~ ng clear sup~rn~ter~t was removed and the particles were-c..us~ended in 1 ml of 100% ethanol. The final dilution of the suspension ready for usein helium blasting was 7.5 mg DNA/gold per ml of ethanol.

30 Part C Ple~aLion and helium blasting of tissue targets. Approximately 600 mg of embryogenic callus tissue per target was spread over the surface of petri plates containing Type II callus m~ e ~ cd;~ plus 0.2 M sorbitol and 0.2 M mannitol as an osmoticum. After an approximately 4 hour pr~hcaLl.lent, all tissue was transferred to petri plates co-~ g 2% agar blasting ",cdiu", (m~inten~rlce medium plus osmoticum 35 plus 2% agar).

SUBSTITUTE SHEET (RULE 26) CA 02226728 l99X-01-13 PCTtUS96/1 1689 Helium blasting involved accelerating the suspended DNA-coated ~old particles towards and into ple~ared tissue targets The device used was an earlier prototype to the one described in a DowElanco U.S. Patent (#5,141,131) which is incorporated herein by reference, although both function in a similar manner. The device consisted of a high 5 pressure helium source, a syringe containing the DN~/L~old susr)cnsio~l, and .pJlrllm~tically-operated multipurpose valve which providcd conlrt llcd lillkaL~c bC~WCCIl the helium source and a loop of pre-loaded DNA/gold suspension.

Prior to blasting, tissue targets were covered with a sterile 104 micron stainless steel 10 screen, which held the tissue in place during impact. Next, tar~ets wcrc l~laccd ulldcr vacuum in the main clla,.,be. of the device. The DNA-coated L~old particlcs wcreaccelerated at the target 4 times using a helium pressure of 1500 psi. Each blast delivered 20 ~1 of DNA/gold ~u~ sion T.~ qdi~tely post-blasting, the targets were placed back on .,.~;..t~ nce medium plus osmoticum for a 16 to 24 hour recovery period.
Part D Selection of transformed tissue and the r~.,"c.alion of plants from ll~nsg~,nic cultures. After 16 to 24 hours post-blastin~, the tissue was dividcd Into small picccs and transferred to selection .,~e~;u~ e ~-re ~,PAi.l~,- plus 30 mg/L BastaTM). Every 4 weeks for 3 months, the tissue pieces were non-selectively transferred to fresh selection 20 ,,.f~ "" After 8 weeks and up to 24 weeks, any sectors found proliferating against a background of growth inhibited tissue were removed and isolated. Putatively transfonned tissue was subc~ ed onto fresh selection medium. Transgenic cultures were established after I to 3 additional subcultures.

25 Once BastaTM resistant callus was established as a line, plant regeneration was initiated by han~r~ callus tissue to petri plate cc,..~ cytokinin-based induction l..ed;,.."
which were then placed in low light (125 ft-candles) for one week followed by one week in high light (325 ft-candles). The intlllrtion .,~e~ " was composed of MS salts and vitamins (Ml~chi~e and Skoog, 1962), 30 glL sucrose, 100 mg/L myo-inositol, S mg/L 6-benzylh~ yuline~ 0.025 mg/L 2,4-D, 2.5 g/L gelrite adjusted to pH 5.7. Following the two week induction period, the tissue was non-selectively llan~.lcd to hormone-free ~e~ ion mP~illm and kept in high light. The regeneration mP~lium was composed ofMS salts and vit~min~, 30 g/L sucrose and 2.5 g/L gelrite adjusted to pH 5.7. Both in-lnrtion and leg~..elalion media cnnt~ined 30 m~/L BastaTM. Tissue began dirr~ iating shoots and roots in 2-4 weeks. Small (1.5-3 cm) plantlets were removed and placed in ~ tubes co~ g SH medium. SH medium is composed of SH salts and vitamins (Schenk SUBSTITUTE SHEET (RULE 26) P ~ rUS96/11689 and Hildebrandt, 1972). 10 g/L sucrose, 100 mg/L myo~ ositol, S mL/L FeEDTA, andeither 7 g/L Agar or 2.5 ~/L Gelrite adjusted to pH 5.8. Plantlets were transferred to 10 cm pots cont~ining approximately 0.1 kg of Metro-Mix(~) 360 (The Scotts Co., Marysville, OH) in the greenhouse as soon as they exhibited growth and developed a sufficient root system (1-2 weeks). At the 3-5 leaf staL~e, plants wcrc tran.sfclrc(l to 5 gallon pots containing approximately 4 kg Metro-Mix~o ~ n(l L~IOWIl to Ill.l~lllily.
These Ro plants were sclf-pollinatcd and/or cross-pollinal-:cl willl l)oll-~ransL~ellie inbrc(ls to obtain transgenic progeny. In the case of transgenic plants produced for the GBSS
target, Rl seed produced from Ro pollinations was replanted. The Rl plants were grown 0 tO maturity and pollinated to produce R2 seed in the quantities needcd for thc analyscs.

Example 20: Production and Re~eneration of ~9 Trans~enic Material.

Part A Tlallsçollllalion and isolation of embryo~enic callus. Six ribozyme constructs, de,,r ;hcd previously, Lal~L._d to /\9 desaturase were transformed into .~ge.le.dble Type II callus cultures as described herein. These 6 constructs consisted of 3 active/inactive pairs; namely, RPA85/RPA113, RPA114/RPA115, and RPA118/RPAIl9. A total of 1621 tissue targets were p~ a ed, blasted, and placed into selection. From these blasting w~ye~ e~ 334 independent Basta(~-resistant transformation events ("lines") were isolated from selectisn Apprsxim~tely 50% of these lines were analyzed via DNA PCR
or GC/FAME as a means of deL~ ing which ones to move forward to ~g~"lc.a~ion andwhich ones to discard. The r~ g 50% were not analyzed either because they had become non-embryogenic or C~ A

Part B Reg~ ,-alioll of ~9 plants from LI~ CgF~;C callus. Following analyses of the Llal~SgC.liC callus, twelve lines were chosen per ribozyme construct for rcg~ ,.d.Lion, with 15 Ro plants to be produced per line. These lines generally conci~ted of 10 analysis-positive lines plus 2 negative controls, however, due to the poor lc~ ability of some of the cultures, plants were produced from less than 12 lines for constructs RPA113, RPA115, RPA118, and RPA119. An overall total of 854 Ro plants were ~ e~e~al~d from 66 individual lines (see Table X). When the plants reached maturity, self- or sib-pollinations were given the highest priority, however, when this was not possible, cross-pollin~tion~ were made using the inbreds CQ806, CS716, OQ414, or HOI as pollen donors, and occasionally as pollen recipients. Over 715 controlled pollinations have been made, with the majority (55%) being comprised of self- or sib-pollinations and the SUBSTITUTE SHEET (RULE 26) -PCTAUS96tl1689 minority (45%) being comprised of Fl crosses. Rl seed was collected approximately 45 days post-pollination.

Example 21: Production and Re~eneration of Trans~enic Maize for the GBSS

Part A Transformation of embryogenic maize callus and thc suhscqucltt SclCCtioll .llld establishment of transgenic cultures. RPA63 and RPA64, an active/inactivc r~air of ribozyme multimers l~lgeLed to GBSS, were inserted along with bar selection plasmid pDAB308 into Type II callus as described herein. A total of 115 BastaTM-rcsistant independent tlal~srullllation events were recovered from the selection of 590 blastcd tissue targets. Southern analysis was performed on callus samples from established cultures of a!l events to deterrnine the status of the gene of interest.

Part B Reg~n~lalion of plants from cultures transformed with ribozymes targeted to GBSS as well as the ad~ t to the R2 gellc,dtion. Plants were i~ge~ ated from Southern "positive" transgenic cultures and grown to maturity in a greenhouse. The primary lege,.~ t~,;, were pollinated to produce Rl seed. From 30 to 45 days after pollination, seed was harvested, dried to the correct moisture content, and replanted. A
total of 752 Rl plants, r~ 5~ .g 16 original lines, were grown to sexual maturity and pollin~tlo~ Approximately 19 to 22 days after pollination, ears wcrc harvcstcd and 30 kemels were randomly excised per ear and frozen for later analyses.

F~ mT~le 22: Testin~ of GBSS-Tar~eted Riboz~,rmes in Maize Black Mexican Sweet (BMS) Stably T~ r,l,l.ed Callus Part A Production of BMS callus stably transformed with GBSS and GBSS-~ .ted ribozyrnes. BMS does not produce a GBSS mRNA which is homologous to that found endor,.,-~o,J~Iy in maize. Therefore, a double transrulnlalion system was developed to produce hal~rol~lal~L~ which e~lessed both target and ribozymes. "ZM" BMS
~u~ (obtained from Jack Widholm, University of Illinois, also see W. F. Sheridan, "Black MeAi~l Sweet Corn: Its Use for Tissue Cultures in Maize for Biological Research, W. F. Sheridan, editor. University Press. University of North Dakokta, Grand Forks, ND, 1982, pp. 385-388) were p~ al~d for helium blasting four days after sl~bculhl~e by h~n~r.,l to a 100 x 2û mm Petri plate (Fisher Scientific, PiU~buly,h, PA) and partial removal of liquid medium, forming a thin paste of cells. Targets consisted of 100-125 mg fresh weight of cells on a 1/2" antibiotic disc (Schleicher and Srlmell, Keene, NH) S~ JTE SHEET (RULE 26) placed on blastin~g medium, DN6 ~N6 salts and vitamins (Chu el al., 197g), )0 g!L
sucrose, 1.5 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D). 25 mM L-proline; pH= 5.~3 before autoclaving 20 minutes at 1~1~C] solidified with 2% TC agar (JRH Bioscicnces, T en~ox~ Kansas) in 60 x 20 mm plates. DNA was precipitated onto gold particles. For the first transformation, pDAB 426 (Ubi1GBSS) and pDAB 30% (35T/r3ar) wcrc uscd.Targets were individually shot using DowElanco Helium Blasting Dcvicc ~. Will1 avacuum pressure of 650 mm Hg and at a dict~nce of 15.5 cm from tar~ct to dcvicc noz~lc, each sample was blasted once with DNA/gold mixture at 500 psi. Tmmedi~tely afterblasting, the antibiotic discs were llallsf~ d to DN6 medium made with O.g% TC agar for one week of target tissue recovery. After recovery, each target was spread onto a 5.5 cm Whatman #4 filter placed on DN6 medium minus proline with 3 mg~L Basta(~
(Hoechst, Frankfort, Germany). Two weeks later, the filters were transferred to fresh se~ecti-n ~n~ ,... with 6 mg/L Basta~). Subsequent transfers were done at two week intervals. Isolates were picked from the filters and placed on AMCF-ARM mcriin-n (N6 salts and vil~ s, 20 g/L sucrose, 30 g/L .~ ;lQI~ 100 mg/L acid casein hydrolysate, and 1 mg/L 2,4-D, 24 mM L-proline; pH= 5.8 before autoclaving 20 ~ t~s at 121~C) solidified with 0.8% TC agar co~ 6 m~/L Basta(l~. Isolates were m~int~ined by s-lhc~ -re to fresh medium evcry two weeks.

Basta~)-.es~ t isolates which e,~l.leisGd GBSS were subjected to a second hal,~r~ nalion. As with BMS suspensions, targets of transgenic callus were p.e~.aIed 4 days after subculture by spreading tissue onto 1/2" filters. However, AMCF-ARM with 2% TC agar was used for blacting, due to n~ t~ e of transforrnants on AMCF-ARM
s~ ction media. Each sample was covered with a sterile 104 llm mesh screen and blasting was done at 1500 psi. Target tissue was co-bombarded with pDAB 319 (35S-ALS; 35T-GUS) and RPA63 (active ribozyme mlJltimPr) or pDAB319 and RPA64 (inactive ribozyme ml-ltimf~r), or shot with pDAB 319 alone. Tmr~leAi~t~ly after blasting, all targets were ll~lsr~ d to nol-c~ re ..~Ji~ . (AMCF-ARM) for one week of recovery.
Subsequently, the targets were placed on AMCF-ARM medium corlt~ining two selection 30 agents, 6 mg/L Basta~ and 2 ~Ig/L clllors-llfil~on (CSN). The level of CSN was h.w~ as~d to 4 ug/L after 2 weeks. ContinlleA transfer of the filters and generation of isolates was done as described in the first tran~rolmalion, with isolates being maintained on AMCF-ARM ~ J;.~.. cu..~ 6 mg/L Basta and 4 ~Lg/L CSN.

35 Part B Analysis of BMS stable transformants e~cpl, ~si,.g GBSS and GBSS-targeted ribozymes. Isolates from the first transforrnation were evaluated by Northern blot SUBSTITUTE SHEET (RULE 26) , PCT~US96/11689 analysis for detection of a functional target gene (GBSS) and to detennine relative levels of eA~;ssion. In 12 of 2~ isolates analyzed, GBSS transcript was detected. A range of e~prGs~ion was observed, in-lic~tin~ an independence of transformation events. Isolates generated from the second transformation were evaluated by Northern blot analysis for detection of continued GBSS exprcssion and by RT-J'CR to ~crccll rOr thc l~r~ c ol ribozyme transcript. O~ 19 isolatcs tested from onc r~rcvio~lsly lrallslornlc(l lhlc, IX
expressed the active ribozyme, RPA63, and all exprcssed GBSS. G13SS was dctcclcd in each of 6 vector controls; ribozyme was not ex~rcssed in these samples. As described herein, RNase protection assay (RPA) and Northern blot analysis were pcrformcd on 10 ribozyme-e~ ssillg and vector control tissues to comparc Icvcls of G~SS transcril~t in the presence or absen~e of active ribozyme. GBSS values were normalizcd to an intcrnal control (A9 desaturase); Northern blot data is shown in Figure (25). Northern blot results revealed a significantly lower level of GBSS message in the presence of ribozyme, as co".~a,cd to vector controls. RPA data showed that some of the individual samples 15 ~,~p,.,..si"g active ribozyme ("L" and "O") were significantly different from vector controls and similar to a nontransformed control.

Exam~le 23: Analysis of Plant and Callus Materials Plant material co-L~al~sfo~-"cd with the pDAB308 and one of the following ribozyrne co..~ g vectors, pRPA63, pRPA64, pRPA85, pRPAI 13, pRPAI 14, pRPAl 15, pRPAl 18 or pRPAl 19 were analyzed at the callus level, Ro level and select lincs analyzed at the Fl level. Leaf material was harvested when the plantlets reached the 6-8 leaf stage. DNA from the plant and callus material was prepared from Iyophilized tissue as described by Saghai-Maroof et al.(supra). Eight micrograms of each DNA was ~lig~ste~ with the restriction enzymes specific for each construct using conditions 5~g~,G~d by the m~mlf~c1~lrer (Bethçs~1~ Research Laboratory, Gaith~ ,~bu, ~" MD) and s~ ak~d by agarose gel electrophoresis. The DNA was blotted onto nylon l"~ ."b,anc as des~;,il,ed by Southern, E. 1975 "Detection of specific sequences among DNA fr~gm~nts sG~Jalàlcd by gel clc~.l uphoresis, J Mol. Biol. 98:503 and Southern, E. 1980 "Gel cle~l,o~horesis of restriction fr~gm~nt~ Methods Enzmol. 69:152, which are incc"~o~ahd by reference herein.

Probes specific for the ribozyme coding region were hybridized to the membranes.Probe DNA was ~ret)artd by boiling 50 ng of probe DNA for 10 minutes then quick cooling on ice before being added to the Ready-To-Go DNA labeling beads (Pharmacia SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 LKB, Piscataway, NJ) with 50 microcuries of o!32P-dCTP (Amersham Life Science, Arlington Heights, IL) Probes were hybridized to the genomic DNA on tlle nylon membranes. The membranes were washed at 60~C in 0.25X Ssc and 0.2% SDS for 45 nlinutec, blotted drv and exposed to XAR-5 film overnight with two intensifying screens.
The DNA from the RPA63 and RP~tS4 was digcstccl witl~ tllc rcslri(:lioll CllZyll1cs HindIII and EcoRI and the blots cont~ ing these samples were hybridized to the RPA63 probe. The RPA63 probe consists of the RPA63 ribozyme multimer coding region andshould produce a single 1.3 kb hybridization product when hybridized to thc RPA63 or RPA64 materials. The 1.3 kb hybridization product should contain the enhanccd 35S
promoter, the AdhI intron, the ribozyme coding region and the nopaline synthase poly A
3' end. The DNA from the RPA85 and RPA113 was digested with the restriction enzymes HindIII and EcoRI and the blots cont~inin~ these samples were hybridized to the RPA122 probe. RPA 122 is the 252 multimtor ribozyme in pDAB 353 replacing the GUS r~p~lL~_~. The RPA122 probe consists of the RPA122 ribozyme mllltim~r codingregion and the nopaline synthase 3' end and should produce a single 2.1 kb hybridization product when hybridized to the RPA85 or RPA113 materials. The 2.1 kb hybridi7~tiotl product should contain the ~nh~nred 35S promoter, the AdhI ir.;ron, ~he bar gene, the ribozyme coding region and the nopaline synthase poly A 3' end. The DNA from theRPA114 and RPA115 was digested with the restriction enzymes HindTII and SmaI andthe blots co~t~inin~ these samples were hybridized to the RPA115 probe. The RPA115 probe consist of the RPA 115 ribozyme coding region and should produce a single 1.2 kb hybridization product when hybridized to the RPA114 or RPA115 materials. The 1.2 kb hybridization product should contain the enh~n~e~l 35S promoter, the AdhI intron, the ribozyrne coding region and the nopaline synthase poly A 3' end. The DNA from the RPA118 and RPA119 was digested with the restriction enzymes HindIII and SmaI andthe blots Co~ g these samples were hybridized to the RPA 118 probe. The RPA 118 probe consist of the RPA 118 ribozyme coding region and should produce a single 1.3 kb hybridization product when hybridized to the RPA 118 or RPAl l 9 materials. The I 3 kb hybridization product should contain the tonh~nced 35S promoter, the AdhI intron, the ribozyme coding region and the nopaline synthase poly A 3' end.

Exam~le 24: Extraction of Genomic DNA from Transeenic Callus Three hundred mg of actively growing callus were quick frozen on dry ice. It wasground to a fine powder with a chilled Bessman Tissue Pulverizer (Spectrum, Houston, SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 PCTrUS96/11689 TX) and extracted with 4oolll of 2x CTAB buffer (2% ~lexadecyltrimet}lylamlllollium Bromide, 100 mM Tris pH 8.0, 20 mM EDTA, 1.4 M NaCI, 1% polyvinylpyrrolidone).
The suspension was Iysed at 65~C for 25 minutes, then extracted witl1 an equal ~olume of chloroform:isoamyl alcohol. To the aqueous phase was added 0.1 volumes of 10%
5 CTAB buffer (10% Hexadecyltrimethylammonium Bromidc, 0.7 M NaCI) ~ oliowin extraction with an equal volume of chloroform:isoamyl alcohol, ().fi volumc~ of col(l isopropyl alcohol was added to the aqueous phasc, and placcd at -20~C for 3() IllillUlCS.
After a 5 minute centrifugation at 14,000 rpm, the resulting precipitant was dried for 10 s undervacuum. It was resuspended in 200 ~11 TE (lOmM Tris, ImMEDTA, p1-1 8.0) at 65~C for 20 minutes. 20% Chelex (Biorad, ) was added to the DN~ to a final co~ .l. ation of 5% and incuhat~1 at 56~C for 15-30 minutes to rcmovc impuritics. Thc DNA co,~rc ~L~alion was measured on a Hoefer Fluorimeter (Hoefer, San Francisco).

Example 25: PCR Analvsis of Genomic Callus DNA
Use of Polymerase Chain Reaction (PCR) to demonstrate the stable insertion of ribozyme genes into the clllul~oso..~c of l~ p.- ~ic maize calli.

Part A Method used to detect ribozvme DNA The Polymerase Chain Reaction (PCR) was ~c.rolll,ed as described in the suppliers protocol using AmpliTaq DNA Polymerase (GeneAmp PCR kit, Perkin Elmer, Cetus). Aliquots of 300 ng of g~ nic callus DNA,1 ~1 of a 50 ~lM do~ Ll~alll primer (5' CGC AAG ACC GGC AAC AGG 3' ), 1~1 of an u~sl~ealll primer and 1~LI of Perfect Match (Str~t~nç, Ca) PCR t .h~r~ were mixed with the co,l~o~ents of the kit. The PCR reaction was pc.r~,.llled for 40 cycles using the following IJal~ dcllalulation at 94~C for 1 minute, ~nn~linE~ at 55~C for 2 ...;...~lf s and eYt~ncion at 72~C for 3 mins. An aliquot of 0.2x vol. of each PCR reaction was cle~,L u~uho,e~ised on a 2% 3:1 Agarose (FMC) gel using standard TAE agarose gel contlition~

30 Part B U~slr~aln primer used for detection of A9 desaturase ribozyme ~enes RPA85/RPA 113 251 multimer fused to BAR 3' ORF
RPA114/RPA115 258 ribozyme monomer RPA118/RPA119 452 ribozyme multimer 5' TGG ATT GAT GTG ATA TCT CCA C 3' 35 This primer is used to amplify across the Eco RV site in the 35S promoter.

SUBSTITUTE SHEET (RULE 26) Primers were prepared using standard oligo synthesis protocols on an Applied Biosystems Model 394 DNA/RNA synthesizer.

Example 26: Ple,,al~tion of Total RNA from Trans~enic Maize Calli and Plant Part A Preparation of total RNA from transgenic non-regcncrablc alld rcgcl1crahlc callus tissue. Three hundred milligrams of actively growin~ callus was quick frozcl1 Oll ~Iry icc.
The tissue was ground to a fine powder with a chilled Bessman Tissue Pulverizer (~pccl-ull~, Houston, TX) and extracted with RNA Extraction Buffer (50 mM Tris-HCI
10 pH 8.0, 4% para-amino salicylic acid, 1% Tri-iso-propylnapthalenesulfonic acid, lO mM
dithiothreitol, and 10 mM Sodium meta-bisulfite) by vigorous vortcxin~. Thc homogcnatc was then extracted with sn equal volume of phenol co~ 0.1% 8-hydroxyquinoline.
A*er centrifilgPtion~ the aqueous layer was exL~o~chd with an equal volume of phenol co..l~;..;..g chlG,ofol~ isoamyl alcohol (24:1), followed by extraction with chloroform:octanol (24:1). Subsequently, 7.5 M Ammonium acetate was added to a final co.~ Lion of 2.S M, the RNA was precipitated for I to 3 hours at 4~C. Following 4~C centrifugation at 14,000 rpm, RNA was resuspended in sterile water, precipitated with 2.5 M NH40Ac and 2 volumes of 100% ethanol and incubated overnite at -20~C.The harvested RNA pellet was washed with 70% ethanol and dried under vacuum. RNA20 was r~u~,e"ded in sterile H20 and stored at -80~C.
.

Part B Pr~aldLion of total RNA from transgenic maize plants. A five cm section (~150 mg) of actively growing maize leaf tissue was excised and quick frozen in dry ice. The leaf was ground to a fine powder in a chilled mortar. Following In~ lf~ctorers 25 instructions, total RNA was purified from the powder using a Qaigen RNeasy Plant Total RNA kit (Qiagen Inc., ChaL~wollh, CA). Total RNA was released from the RNeasy columns by two sequential elution spins of p~ led (50~C) sterile water (30 ~LI each) and stored at - 80~C.

30 Example 27: Use of RT-PCR AnalYsis to Demonstrate Expression of Ribozvme RNA in Trans~enic Maize Calli and Plants Part A Method used to detect ribozyme RNA. The Reverse Transcription-Polymerase Chain Reaction (RT-PCR) was performed as described in the suppliers protocol using a 35 thermostable rTth DNA Polymerase (rTth DNA Polymerase RNA PCR kit, Perkin Elmer Cetus). Aliquots of 300 ng of total RNA (leaf or callus) and 1 ~1 of a 15 ~LM

SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 downstream primer (5' CGC AAG ACC GGC AAC=AGG 3' ) were mixed witll thc RT
components of the kit. The reverse transcription reactioll was perfonned in a 3 step ramp up with 5 minute incubations at 60~C, 65~C, and 70~C. For the PCR reaction, ~
of upstream primer specific for the ribozyme RNA beillg analyzcd was addcd to tllc RT
reaction with the PCR components The PCR rcaction was r)cl formcd for 3~ cyclcs usillL
the following parameters; incubation at 96~C for I mill~ltc, clcn.~l~lr.~ti(ln .~t ~4'( lol 3() seconds, ~nne~ling at 50~C for 30 seconds, and extension at 72~C for 3 mills. /~n aliquol of O.2x vol. of each RT-PCR reaction was electrophoresed on a 2% 3:1 A~arose (FMC) gel using standard TAE agarose gel conditions.
Part B Specific u~all~alll primers used for detection of GBSS ribozymes.
GBSS Active and Inactive Multimer 5' CAG ATC AAG TGC AAA GCT GCG GAC GGA TCT G 3' This primer covers the Adh I intron footprint upsll~;a,~ of the first ribozyme ann.
GBSS 918 Intron (-) Monomer:
5' ATC CGA TGC CGT GGC TGA TG 3' This primer covers the lO base pair ribozyme arm and the first 6 bases of the ribozyme catalytic dom~in GBSS ribozyme e~rc~,~ion in transgenic callus and plants was confirrned by RT-PCR.
GBSS mllltimçr ribozyme ~A~esjion in stably transforrned callus was also deterrnined by Ribonuclease Protection Assay.

Part C Specific u~ ea~ lilllE~ used for detection of ~9 desaturase ribozymes.
RPA85/RPAl 13 252 multimer fused to BAR 3' ORF
5' GAT GAG ATC CGG TGG CAT TG 3' This primer spans the junction of the BAR gene and the RPA85/l l3 ribozyme.
RPAl 14/RPAl 15 259 ribozyme monomer 5' ATC CCC TTG GTG GAC TGA TG 3' This primer covers the lO base pair ribozyme arm and the first 6 bases of the ribozyme catalytic ~om~in RPA l l 8/RPA l l 9 453 ribozyme multimer 5' CAG ATC AAG TGC AAA GCT GCG GAC GGA TCT G 3' This primer covers the Adh I intron footprint u,~.~k~alll of the first ribozyme arm.
Expression of ~9 desaturase ribozymes in transgenic plant lines 85-06, 1 l 3-06 and 85- l 5 were confirmed by RT-PCR.

SUBSTITUTE SHEET (RULE 26) PCT~US96111689 Primers were prepared using standard oligo synthesis protocols on an Applied Biosystems Model 394 D~A/RNA synthesizer.

Example 28: Demonstration of Ribozvme Mediated Reduction in TarL~et mRNA Levels 5 in Trans~enic Maize Callus and Plants Part A Northern analysis method which was uscd to dcmollstralccl rcclue~ ; in largel mRNA levels. Five ~lg of total RNA was dried under vacuuln, resuspended in loading buffer (20mM phosphate buffer pH 6.8, 5mM EDTA; 50% fonnamide: 16%
forrn~ yde: 10% glycerol) and denatured for 10 minutes at 65~C. Electrophoresis was at 50 volts through I % agarose gel in 20 mM phosphate buffer (pll 6.8) with buffcr recirculation. BRL 0.24-9.5 Kb RNA ladder (Gibco/BRL, Gaithersburg, MD) were stained in gels with ethiduim bromide. RNA was transferred to GeneScreen ~ ...h".n~
filter ( DuPont NE?~, Boston MA) by capillary transfer with sterile water.
Hybridization was ~,,rulllled as described by DeLeon et al. (1983) at 42 ~C, the filters were washed at 55 ~C to remove non-hybridized probe. The blot was probed sequentially with cDNA fr~gm~nts from the target gene and an internal RNA control gene.
The internal RNA standard was utilized to distinguich variation in target mRNA levels due to loading or h~n~l1ine errors from true ribozyme me~ tecl RNA reductions. For each 20 sample the level of target mRNA was con".a,ed to the level of control mRNA within that sample. Fr~gm~nt~ were purified by Qiaex resin (Qaigen Inc. Chatsworth, CA) from lx TAE agarose gels. They were nick-trancl~ted using an Amersham Nick Translation Kit (Amersham Co~olation7 Arlington Heights, Ill.) with alpha 32p dCTP.
Autoradiography was at -70~ C with i-~Le~.sirying screens (DuPont, Wi1mingtnn DE) for 25 one to three days. Autoradiogram signals for each probe were IlleasulGd after a 24 hour e~o~ul~ by d~ oll-eL~l and a ratio of l~lget/in~ al control mRNA levels was c~lrlll~t~"l Ribonuclease protection assays were pc.Çul...ed as follows: RNA was prcpar~d using the Qiagen RNeasy Plant Total RNA Kit from either BMS protoplasts or callus material.
The probes were made using the Ambion Maxiscript kit and were typically 10~ cpm/microgram or higher. The probes were made the same day they were used. They were gel purified, resuspended in RNase-freelOmM Tris (pH 8) and kept on ice. Probes werediluted to Sx 1 05cpm/ul immerli~tely before use. 5 ~g of RNA derived from callus or 20 ~lg of RNA derived from protoplasts was inc~bat~cl with 5 x 105 cpm of probe in 4M
Guanidine Buffer. ~4M Guanidine Buffer: 4M Guanidine Thiocyanate/0.5%

SUBSTITUTE SHEET (RULE 26) CA 02226728 1998-01-13 .

Sarcosyl/25mM Sodium Citrate (pH 7.4)] 40 ul of PCR millcral oil ~tcls adclcd to cacl7 tube to prevent evaporation. The samples were heated tO 95~ for 3 minutes and placed immedi~tely into a 45~ water bath. Incubation continued ovemight. 600 ,ul of RNase Treatment Mix was added per sample and incubated for 30 minutes a~ 37~C (RNase Treatment Mix: 400 mM NaCl, 40 units/m! RNa~c A .In(l 11). 12 ~1 ol 2()'~ i w~:r~
added per tube, immediately followed by addition of 12 Ul (2() Ill~/nll) l'rolcil~ K lo each tube. The tubes were vortexed gently and incubatcd for 3() minulcs at 37~C. 7S0 ul of room te,lll)c~ature RNase-free isopropanol was added to each tube, and mixed by inverting repeatedly to get the SDS into solution. The samples were then microfu~cd at top speed at room tc~ eldture for 20 minuteS The pellets were air dried for 45 minutes.
15 ul of RNA Running Buffer was added to each tube, and vortcxed hard for 30 seconds.
(RNA Running Buffer: 95% Form~nid~/20mM EDTA/0.1% Bromophenol Blue/0.1%
Xylene Cyanol ). The sample was heated to 95~ C for 3 minutes, and loaded onto an 8%
d~l~aLulillg acrylamide gel. The gel was vacuum dried and exposed to a phosphorimager screens for 4 to l 2 hours.

Part B Results ~mcnctrating reductions in GBSS mRNA ievels in nonglonerable cal1us CAplc~ g both a GBSS and GBSS targeted ribozyme RNA. Tbe productior, cf nol~legell~,.dble callus e~le,,sillg RNAs for the GBSS target gene and an active multimer ribozyme L~ GICd to GBSS mRNA was ptL~Ill-ed. Also produced were transgenics e~ e;~ai~lg GBSS and a ribozyme (-) control RNA. Total RNA was ple~)ar-,d from the Ll,.,-~gG,.;c lines. Northern analysis was pc.ru,llled on 7 ribozyme (-) controltlan:~rulll~anL~ and 8 active RPA63 lines. Probes for this analysis were a full length maize GBSS cDNA and a maize ~9 cDNA fr~gm~-nt To distinguish variation in GBSS mRNA
levels due to loading or h~ntlling errors from ttue ribozyme me~i~ted RNA reductions, the level of GBSS mRNA was cu.~lp~d to the level of ~9 mRNA within that sample. The level of full length GBSS transcript was colll~alet between ribozyme ~ ,s~ g andribozyme minus calli to identify lines with ribozyme me~ teci target RNA reductions.
Blot to blot variation was controlled by performing duplicate analyses.
A range in GBSS/ ~9 ratio was observed b.,L~c_.1 ribozyme (-) transgenics. The target mRNA is produced by a tr~nC~ne and may be subject to more variation in e.~ .ssion then the endogenous ~9 mRNA. Active lines (RPA 63) AA, EE, KK, and JJwere shown to reduce the level of GBSS/~9 most significantly, as much as 10 fold as compared to ribozyme (-) control transgenics this is graphed in Figure 25. Those active SUBSTITUTE SHEET (RULE 26) -PCTrUS96/11689 lines were shown to be ~,~pl~s~ g GBSS targeted ribozyme by RT-PCR as described herein.

Reductions in GBSS mRNA compared to ~9 mRNA were also seen by RNAse protection assay. v Part C Demonstration of reductions in ~9 desaturasc lcvcls in transgcnic l~lantse,.~.e;,sil.g ribozymes targeted to t~9 desaturase mRNA. The high stearate tr~n~gerlics, RPA85-06 and RPA85- 15, each contained an intact copy of the fused ribozyme multhner gene. Within each line, plants were screened by RT-PCR for the presence of ribozymc RNA. Using the protocol described in Example 27. RP~5 ribozymc cxprcssion was tl~mo~cl~aLcd in plants of the 85-06 and 85-15 lines which cont~ined high stearic acid in their leaves. Northern analysis was p~.lrc".led on the six high stearate plants from each line as well as non-transformed (NT) and transformed control (TC) plants. The probes for this analysis were cDNA fr~ nt~ from a maize ~9 desaturase cDNA and a maize actin cDNA. To distinguish variation in A9 mRNA levels due to loading or h~n~ g errors from true ribozYme ~-.eAiAlf~ RNA redllctionc, the level of a9 mRNA was c~ alcid to the level of actin mRNA within that sample. Using densitometer ~~,adi-.~,~
described above a ratio was c~lc~ t~d for each sample. ~9/actin ratio values ranging from 0.55 to 0.88 were c~le~ te~l for the 85-06 plants. The average ~9/actin value for non-n~fol-lled controls was 2.7. There is an appal~,A~t 4 fold reduction in ~9/actin ratios ~c~een 85-06 and NT leaves. Conlpalil.g ~9/actin values between 85-06 high stearate and TC plants, on average a 3 fold reduct*on in /~9/actin was observed for the 85-06 plants. This data is gldi)hed in Figure 26. Ranges in ~9/actin ratios from 0.35 to 0.53, with an average of 0.43 were c~ ted for the RPA85-15 high stearate transgenics. In this ~ ,,hl~ the average /~9/actin ratio for the NT plants was 1.7. COlllpalillg the average ~9/actin ratio between NT controls and 85-15 high stearate plants, a 3.9 fold redl~c*on in 85-15 ~9 mRNA was ~emo~ .dted. An apparent 3 fold reduction in /~9 mRNA level was observed for RPA85-15 high stearate lldlls~,..ics when ~9/actin ratios 30 were co-llparcd between 85-15 high stearate and normal stearate (TC) plants. These data are graphed in Figure 27. These data indicate ribozyme-medi~ted reduction of ag-desaturase mRNA in transgenic plants e~les~il-g RPA85 ribozyme, and producing increased levels of stearic acid in the leaves.

35 Example 29: Evidence of ~9 Desaturase Down Re~ulation in Maize Leaves as a Result of Active Ribozyme Activity Sl~ JTE SHEET (RULE 26) PCT~US96/11689 Plants were produced which were transformed with inactive ~ersions of the ~9 desaturase ribozyme genes. Data ~as presented demo1lstratillg control Icvcls of Icaf stearate in the inactive ~9 ribozylne transgenic lines RPA! 13-06 and 1 13-17. Ribozyme 5 e~pl~ssion and northern analysis was perfiorllled for thc RPA I 13-()~ linc. ~9 dc.c,llurasc protein levels were detennined in r)lants of ~llC RPAI 1:~-17 lille. I~ ozylllc c.~ lc!iciol1 was rneasured as describcd herein. r'lants 113-06-04, -()7, alld -1() cxprcssc~ CLCC~ IC
levels of RPAl 13 inactive A9 ribozyme. Northern analysis was perfonned on 5 plants of the 113-06 line with leaf stearate ranging from 1.8 - 3.9 %, all of which fall within the 10 range of controls. No reduction in A9 desaturase mRNA corrclating with ribozylIlc exy~ssion or elevations in leaf stearate were found in the RPA I 13-06 plants as compared to controls~ hcd in Figure 28. Protein analysis did not indicate any reduction in A9 desaturase protein levels correlating with elevated leaf stearate in the RPAl 13-17 plants.
This data is graphed in Figure 29(a). Taken together, the data from the two RPAI 13 15 inactive llans8~ lic lines inrlicate ribozyme activity is responsible for the high ~llG~late phenotype observed in the RPA85 lines. The RPA8~ ribozyme is the active version of the RPAI 13 ribozyme.

Example 30: Demonstration of Ribozyme Mediated Reduction in Stearoyl-ACP ~9 20 Desaturase levels in Maize Leaves (RO) ~A9 Desaturase Levels in Maize Leaves (R0) Part A Partial purification of stearoyl-ACP /~9-desaturase from maize leaves. All procedures were p~,~ru~ll-ed at 4~C unless stated otherwise. Maize leaves (50 mg) were harvested and ground to a fine powder in liquid N2 with a mortar and pestle. Proteins 25 were extracted in one equal volume of Buffer A conci~ting of 25 mM sodium-phosphate pH 6.5, 1 mM ethyle~rJ;~ el ~ l~aacetic acid, 2 mM dithiothreitol, 10 mM
phenylmethylsulfonyl fluoride, 5 mM l~u~c"lh~, and 5 mM antipapin. The crude homogenate was centrifuged for 5 min~1tes at 10,û00 x g. The supernatant was assayed for total protein co..~ .ation by Bio-Rad protein assay kit (Bio-Rad Laboratonesj 30 Hercules, CA). One hundred micrograms of total protein was brought up to a final volume of 500 ~1 in Buffer A, added to 50 111 of mixed SP-sepharose beads (Pharrnacia Biotech Inc., Piscataway, NJ), and resuspended by ~..lL~illg briefly. Proteins were allowed to bind to sepharose beads for 10 minutes while on ice. After binding, the A9 desaturase-sepharose material was centrifuged (10,000 x g) for 10 seconds, dec~nted, washed three times with Buffer A (500 11l), and washed one time with 200 mM sodium chloride (500 ~LI). Proteins were eluted by boiling in 50 ~LI of Treatment buffer ( 125 m M

SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 Tris-CI pH 6.8, 4% sodium dodecyl sulfate, 20% glycerol, and 10% 2-mercaptoethanol) for ~ min1~1es. Samples were centrifuged (10,000 x g) for 5 minutes. The supernatant was saved for Western anaylsis and the pellet consisting of sepharose beads was discarded.

5 Part B Western analysis method which was used to dcmo11stratc rcduc~ in xlcaroyl-ACP ~9 desaturase. Partially purified proteins were separatcd on sodi~llll do(lccyl s~llf.llc (SDS)-polyacrylamide gels ( 10% PAGE) as dcscribcd by Lacn1ll~ U. K. ( 197()) C'lcavagc of structural proteins during assembly of the head of phage T4, Nc~re Z27, 660-685. To distinguish variation in ~9 desaturase levels, included on each blot as a reference was 10 purified and quantified ove,~ ssed ~9 desaturase from E. coli as described hereforth.
Proteins were electrophoretically transferred to ECL nitrocellulose mcmbranes (~...- .il.~... Life Sciences, Arlington Heights, Illinois) using a Pharmacia Semi-Dry Blotter (Pllal-l'acia Biotech Inc., Piscataway, NJ), using Towbin buffer (Towbin et al. 1979).
The nolls~,c~ c binding sites were blocked with 10% dry milk in phosphate buffer saline 15 for 1 h. Tmmllnoreactive polypeptides were detect~d using the ECLTM Western Blotting Detection Reagent (Amersham Life Sciences, Arlington Heights, Illinois) with rabbit antiserum raised against E. coli e~ esjed maize ~9 desaturase. The antibody was produced according to standard protocols by Berkeley Antibody Co. The secondary antibody was goat antirabbit serum conjugated to horseradish peroxidase (BioRad).
20 Autoradiograms were scanned with a densito,lleter and quantified bascd on thc rclativc amount of purified E. coli ~9 desaturase. These ex,~el;",ents were duplicated and the mean reduction was l~,cGlded.

Part C Demonstration of Reductions in ~9 desaturase levels in R0 maize leaves 25 exl"cs~ing ribozymes lalgeh,d to A9 desaturase mRNA. The high stearate hànsg~l,ic line, RPA85-15, cQr~t~inC an intact copy of the fused mllltim-or gene. ~9 desaturase was partially purified from R0 maize leaves, using the protocol described herein. Western analysis was pc.~lll.cd on ribozyme active (RPA85-1~) and ribozyme inactive (RPAl 13-17) plants and nol~LIa~ ~llllcd (HiII) plants as described above in part B. The 30 natural variation of ~9 d~,SaLu~aSe was determined for the nontransformed line (HiII) by Western analysis see Figure 29 A. No reduction in A9 desaturase was observed with the ribozyme inactive line RPAI 13-17, all of which fell within the ran~e as comparcd to thc nont~a~ orrned line (HiII). An apparent 50% reduction of ~9 desaturase was observed in six plants of line RPA85-15 (Figure 29 B) as compared with the controls. Concurrent 35 with this, these same six plants also had increased stearate and reduced ~9 desaturase mRNA (As described in Examples 28 and 32) However, nine active ribozyme plants SUBSTITUTE SHEET (RULE 26) _ _ from line RPA85- 15 did not have anv significant reduction as compared with nontransformed line (HiII) and inactive ribozyme line (RPA 113- 17) (Figures 29 A and B).
Collectively, these results suggest that the ribozyme activity in tlle six plallts from linc RPA85- 15 is responsible for the reduced ~9 desaturase.

Example 31: E. coli Expression and Purification of Maizc a-9 dc.saturclsc Cll;'.ylllC
Part A The mature protein encoding portion of the maize ~-9 desaturase cDNA was inserted into the bacterial T7 e~,rcssion vector pET9D (Novagen Inc., Madison, WI).
The mature protein t~ncotlin~ region was de~1uced from the maturc castor bcan polypeptide sequence. The alanine at position 32 (nts Z39-241 of cl)NA) was dcsiL~Ilatc(t as the first residue. This is found within the sequence Ala.Val.Ala.Ser.Met.Thr.Restriction enflon~cle~ce Nhe I site was ~nein,~red into the maize sequence by PCR, modifying GCCTCC to GCTAGC and a BamHI site was added at the 3' end. This does not change the amino acid sequence of the protein. The cDNA sequence was cloned into pET9d vector using the Nhe I and Bam HI sites. The recombinant plasmid is design~te~
as pDAB428. The maize ~-9 desaturase protein e~ sed in bacteria has an additional m-~thiorlin~ residue at the S' end. This pDAB428 plasmid was transformed into the bacterial strain BL21 (Novagen, Inc., Madison, WI) and plated on LB/kanamycin plates (25 mg/ml). Colonies were resuspended in 10 ml LB with kanamycin (25 mg/ml) and IPTG (ImM) and were grown in a shaker for 3 hours at 37~C. The cells were harvestcd by centrifugation at lOOOxg at 4~C for 10 minlltes. The cells were Iysed by freezing and thawing the cell pellet 2X, followed by the addition of 1 ml Iysis buffer (10 mM Tris-HCI
pH 8.0, 1 mM EDTA, 150 mM NaCI, 0.1 % Triton X100, 100 ug/ml DNAse I, 100 ug/ml RNAse A, and 1 mg/ml Iysozyme). The mixture was in~Ub~t~l for 15 minlltes at 37~C and then centrifuged at 1000 Xg for 10 mimltes at 4~C. The supernatant is used as the soluble protein fraction.
The supematant, adjusted to 25 mM sodium phosphate buffer (pH 6.0), was chilled on ice for I hr. An~ ds, the resulting flocculant precipitant was removed by centrif~ tion The ice incubation step was rtpeatcd twice more after which the solution ~ -rd clear. The clarified solution was loaded onto a Mono S HR 10/10 column (Ph~ ) that had been equilibrated in 25 mM sodium phosphate buffer (pH 6.0).
Basic proteins bound to the column matrix were eluted using a 0-500 mM NaCI gradient over 1 hr (2 mVmin; 2 ml fractions). The putative protein of interest was subjected to SDS-PAGE, blotted onto PVDF membrane, visualized with coomassie blue, excised, and sent to Harvard Microchem for amino-terrninal sequence analysis. Comparison of the SU~;~ 111 UTE SHEET (RULE 26) W O 97/10328 PCTrUS96/11689 protein's amino terminal sequence to that encoded by the cDNA clone revcalcd that tllc protein was indeed ~ 9. Spectrophotometric analysis of the diiron-oxo component associated with the expressed protein (Fox et al., 1993 Proc. Natl. Acad. Sci. USA. 90, 2486-2490), as well as identification using a specific nonhellle iron stain (Lcong et al., 1992 ~nal. Biochem. 207, 317-320) confirmed that the purificd protcin W,IS a-s.
Part B Production of polyclonal antiserum The E. coli produced ~-9 protein, as determined by amino terminal sequcncing, was gel purified via SDS-PAGE, excised, and sent in the gel matrix to Bcrkclcy ~ntibody Co., Ric~lmon~ CA, for production of polyclonal sera in rabbits. Titcrs of tllc alltibodics against ~-9 were performed via western analysis using thc ECL Dctcction systcm (,~m~r~h~m? Inc.) Part C Purification of ~9 desaturase from corn kernels Protein Precipitation: ~\9 was purified from corn kemels following homogenization using a Warring blender in 25 mM sodium phosphate buffer (pH 7.0) co~ ;";"g 25 mM
sodium bisulfite and a 2.5% polyvinylpolypyrrolidone. The crude homogenate was filtered through cheesecloth, centrifuged ( I 0,OOOxg) for 0.25 h and the resulting supernatant was filtered once more through cheesecloth. In some cases, the supernatant was fractionated via saturated ammonium sulfate precipitation by precipitation at 20%
v/v followed by 80% v/v. Extracts obtained from high oil germplasm were fractionated by adding a 50% polyethylene glycol solution (mw--8000) at final concentrations of 5- and 25% v/v. In all cases, the ~9 protein prc~ ted at either 80% a~.. o.. il.. sulfate or 25% polyethylene glycol. The resulting pellets were then dialyzed extensively in 25mM
sodium phosphate buffer (pH 6.0).
Cation Exchange Chromotography: The solubilized pellet material described above was 25 clarified via centrifugation and applied to Mono S HRI0/I0 colulnn equilibrated in 25 mM sodium phosph~te buffer (pH 6.0). After extensive column washing, basic proteins bound to the column matrix were eluted using a 0-500 mM NaCI gradient over 1 hr (2 ml/min: 2 ml fractions). Typically, the ~9 protein eluted between 260-and 350 mMNaCI., as determined by enzymatic and western analysis. After dialysis, this material 30 was further fracionated by acyl carrier protein (ACP)- sepharose and phenyl superose chromatography.

SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 ,4c~yl Carrier Protein-Sepharose C hro~7~atography: ACP was purchased from Si~naCh.omi~l Company and purified via precipitation at pH 4.1 (Rock and Cronan~ 1981 J.
Biol. Chem. 254, 7116-7122) before linkage to the beads. ACP-sepharose was prepared by covalently binding 100 mg of ACP to cyanogen bromide activated sepharose 4B beads, essenti~lly as described by Pharmacia, Inc., in the packa~c inscr~ ftcr link,lgc an(l blocking of the remaining sites with glycinc, thc ACr-scr)l1.lrosc n7.llcri~l1 was p.lckc(l h)lo a HR 5/5 column (Pharrnacia, Inc.) and equilibratcd in 25 mM so(liulll pllospllalc buf-~cr (pH 7.0). The dialyzed fractions identified above were then loaded onto the column (McKeon and Stumpf, 1982 J. Biol. Chem. 257, 12141 - 12147; Thompson el al. 19910 Proc. Natl. Acad. Sci. USA 88, 2578-2582). After extensive column washillg, I~CP-binding proteins were eluted using I M NaCI. Enzymatic and westcrn analysis, followcd by amino terminal sequencing, intlic~ted that the eluent contained ~-9 protein. The A-9 protein purified from corn was del~,l..illed to have a molecular size of approximately 38 kDa by SDS-PAGE analysis (Hames, 1981 in Gel Electrophoresis of Proteins: A
Practical Approach, eds Hames BD and Rickwood, D., IRL Press, Oxford).
Phenyl Sepharose Chromatography: The fractions containing A9 obtained from the ACP-Sepharose column were adjusted to 0.4 M ammonium sulfate (25 mM sodium phosphate, pH 7.0) and loaded onto a Pharmacia Phenyl Superose column (HR 10/10). Proteins were eluted by running a gradient (0.4 - 0.0 M ~mmonium sulfate) at 2 ml/min for I hour. The ~9 protein typically eluted between 60- and 30 mM ammonium sulfate as detennined by enzymatic and wt~te.ll analysis.
F.Y~m~ le 32: Evidence for the Increase in Stearic Acid in Leaves as a Result ofTransformation of Plants with ~9 Desaturase Ribozvmes PartA Method used to d~L~ c the stearic acid levels in plant tissues. The procedure for extraction and esterification of fatty acids from plant tissue was modified from a desclil)ed procedure (Browse et. al., 1986, Anal. Biochem. 152, 141-145). One to 20 mg of plant tissue was placed in Pyrex 13 mm screw top test tubes. After addition of I ml of mçth~nolic HCL (Supelco, Bellefonte, PA), the tubes were purged with nitrogen gas and sealed. The tubes were heated at 80~C for 1 hour and allowed to cool. The heating in the presence of the meth~n~ lic HCL results in the extraction as well as the esterification of the fatty acids. The fatty acid methyl esters were removed from the reaction mixture by extraction with hexane. One ml of hexane a~nd I ml of 0 9% (w/v) NaCI was added followed by vigorous ~h~kin~ of the test tubes. After centrifugation of the tubes at Z000 rpm for 5 minutes the top hexane layer was removed and used for fatty acid methyl ester SUBSTITUTE SHEET (RULE 26) analysis. Gas chromatograph analysis was performed by injection of I ~1 of the sample on a Hewlett Packard (Wilmin~ton, DE) Series ~I model 5890 gas chromatograph equipped with a flame ionization detector and a J&W Scientific (Folsom, CA) DB-23 column. The oven t~ .,.at~re was 150~C throughout the run and the flow of thc carrier gas (helium) was 80 cm/sec. The run time was 20 minutc~s. Thc conditions ~ owc(l rOr r the separation of the 5 fatty acid methyl esters of intcrcst: C l 6:(), r)allllityl mc~llyl cstcr;
C18:0, stearyl methyl ester; C18:1, oleoyl mcthyl estcr; C1~:2, linolcoyl mctl1yl cstcr;
and C18:3, linolenyl methyl ester. Data collection and analysis was performcd with a Hewlett Packard Series II Model 3396 integrator and a PE Nclson (Pcrkin Elmcr, Norwalk, CT) data collection system. The percentage of each fatty acid in the sample was taken directly from the readouts of the data collection systcm. Quantitativc ~mounts of each fatty acid were calculated using the peak areas of a standard (Matreya, Pleasant Gap, PA) which col..ci~led of a known amount of the five fatty acid methyl esters. The amount calculated was used to estimate the percentage, of total fresh weight, represcnted by the five fatty acids in the sample. An adjustment was not made for loss of fatty acids during the extraction and esterification procedure. Recovery of the standard sample, after subjecting it to the extraction and esterification procedure (with no tissue present), ranged from 90 to 100% depending on the original amount of the sample. The presence of plant tissue in the extraction mixture had no effect on the recovery of the known amount of standard.

Part B Demonstration of an increase in stearic acid in leaves due to introduction of A9 desaturase ri'oozymes. Leaf tissue from individual plants was assayed for stearic acid as described in Part A. A total of 428 plants were assayed from 35 lines transformed with active ~9 desat.-lase ribozymes (RPA85, *PA114, RPA118) and 406 plants from 31 lines transformed with ~9 desaturase inactive ribozymes (RPA113, RPA115, RPAI I9). .
Table XI ~7~ Gs the results obtained for stearic acid levels in these plants. Seven percent of the plants from the active lines had stearic acid levels greater than 3%, and 2%
had levels greater than 5%. Only 3% of the plants from the inactive lines had stearic acid levels greater than 3%. Two percent of the control plants had leaves with stearate greater than 3%. The controls included 49 non-transformed plants and 73 plants transforrned with a gene not related to Ag desaturase. There were no plants from the inactive lines or controls that had leaf stearate greater than 4%. Two of the lines transformed with the active ~9 desaturase ribozyme RPA85 produced many plants which exhibited increased stearate in their leaves. Line RPA85-06 had 6 out of the 15 plants assayed with stearic acid levels which were between 3 and 4 %, about 2-fold greater than the average of the SUBSTITUTE SHEET (RULE 26) PCTrUS96/11689 controls (Figure 30) The average stearic acid content of the control plants (122 plants) was 1.69% (SD+/-0.49%). The average stearic acid content of leaves from line RPA85-06 was 2.86% (+/-0.57%). Line RPA85-15 had 6 out of 15 plants assayed with stearic acid levels which were approximately 4-fold greater than the average of the controls (Figure 31). The average leaf stearic acid content of line RPA85-15 was 3.83n/. ( 1/-2.5:~n/,).
When the leaf analysis was repeated for RPA85- 15 plants, thc stcaric aci~l lcvcl in lcavcs from plants previously shown to havc normal stcaric aci(l lcvcls rcmaillccl norl1lal an~
leaves from plants with high stearic acid were again found to be high (Figure 31). The stearic acid levels in leaves of plants from two lines which were transformed with an inactive ~9 desaturase ribozyme, RPAI 13, is shown in Figures 32 and 33. Rr'A I 13-0 had three plants with a stearic acid content of 3% or lli~hcr. Tllc avcra~c stcaric acid content of leaves from line RPA113-06 was 2.26% (+/-0.65%). RPA 113-17 had no plants with leaf stearic acid content greater than 3%. The average stearic acid content of leaves from line RPAI 13-17 was 1.76% (+/-0.29%). The stearic acid content of leaves from lS control plants is shown in Figure 34. The average stearic acid content for these 15 control plants was 1.70% (+/-0.6%). When compared to the control and inactive ~9 desaturase ribozyme data, the results obtained for stearic acid content in RPA85-06 and RPA85-15 demonstrate an increase in stearic acid content due to the introduction of the ~9 desaL~l,dse ribozyme.
Example 33: In}.e,;Lal,ce of the HiPh Stearic Acid Trait in Leaves Part A Results obtained with stearic acid levels in leaves from offspring of high stearic acid plants. Plants from line RPA85-15 were pollinated as described herein. Twenty days after pollination zygotic embryos were excised from imm~ re kernels from these RPA85-15 plants and placed in a tube on media as described herein for growth of l~f.,~ 1 plantlets. After the plants were transferred to the greenhouse, fatty acid analysis was y~lrulllled on the leaf tissue. Figure 3S shows the stearic acid levels of leaves from I û ~ cr~llt plants for one of the crosses, RPA85- 15.07 selfed. Fifty percent of the plants had high leaf stearic acid and 50% had norrnal leaf stearic acid. Table XII
shows the results from 5 dirr~l~nt crosses of RPA8S-15 plants. The number of plants with high stearic acid ranged from 20 to S0%.

- Part B Results demonstrating reductions in ~9 desaturase levels in next generation (Rl) 35 maize leaves ~x~le~sillg ribozymes targeted to ~9 desaturase mRNA. In next generation maize plants that showed a high stearate content (see above Part A), ~9 desaturase was SUBSTITUTE SHEET (RULE 26) partially purified from Rl maize leaves, usin_ the protocol described hereil1. Western analysis was performed on several of the high stearate plants. ~n leaves of next generation plants, a 40-50% reduction of ~9 desaturase ~vas observed in those plants tllat had high stearate content (Figure 36). The reduction was comparable to R0 maize leaves. This reduction was observed in either OQ414 plants crosscd with RrA85-15 pt)llcl1 or RPA85-1~ plants crossed with self or siblin~s. Thercfore, this sugL!cSts tllat thc gcnc encoding the ribozyme is heritablc.

Example 34: Increase in Stearic Acid in Plant Tissues Usin~ Antisense- ~9 Desaturase Part A Method for culturing somatic embryos of maize. The production and ltg~ elalion of maize embryogenic callus has been described herein. Somatic embryos make up a large part of this ernbryogenic callus. The somatic embryos continued to form in callus becdusc the callus was transferred every two weeks. The somatic embryos in embryogenic callus continued to proliferate but usually remained in an early stage of embryo development because of the 2,4-D in the culture m~ m The somatic embryos ,~eg~ t~d into plantlets be~,d.l~e the callus was subjected to a regenc~alion procedure described herein. Duting regeneration the somatic embryo formed a root and a shoot, and ceases development as an embryo. Somatic embryos were made to develop as seed embryos, i.e., beyond the early stage of development found in embryogenic callus and no ,.lcldLion, by a specific medium tre~tment This medium treatment involved transfer of the embryogenic callus to a Murashige and Skoog ".~.1;u~., (MS; described by Murashige and Skoog in 1962) which contains 6% (w/v) sucrose and no plant hormones.
The callus was grown on the MS meclillm with 6% sucrose for 7 davs and then the somatic emblyos were individually transferred to MS medium with 6% sucrose and 10 ~LM abscisic acid (ABA). The somatic embryos were assayed for fatty acid composition as described herein after 3 to 7 days of growth on the ABA medium. The fatty acid composition of somatic embryos grown on the above media was col.lpa.ed to the fatty acid co.nl o~iLion of embryogenic callus and maize zygotic embryos 12 days afterpollination (Table XIII). The fatty acid composition of the somatic embryos was dirr~ t than that of the embryogenic callus. The embryogenic callus had a higherpe.c~.lLage of C16:0 and C18:3, and a lower percentage of C18:1 and C18:2. The pc.~;~nlage of lipid ,el,lesel1ted by the fresh weight was different for the embryo~enic callus when co-"pa-ed to the somatic embryos; 0.4% versus 4.0%. The fatty acid composition of the zygotic embryos and somatic embryos were very similar and their percentage of lipid represented by the fresh weight ~vere nearly identical. It was SUBSTITUTESHEET(RULE26~

PCT~US96/11689 concluded that the somatic embryo culture sys~em described abo~e would be an useful in vitro system for testin~ the effect of certain genes on lipid svnthesis in developing embryos of maize.

5 Part B Increase in stearic acid in somatic cmbryos of m~i7c a.s .l rcs~ of' Illc inllodLlclion of an antisense- ~9 desarurase gene Somatic cmbryos wcrc ~ro(lucccl ~ iinL~ thc IllC~IlOd described herein from embryogenic callus transformed witll r)D~B308/pDAB43(). Tl~c somatic embryos from 16 different lines were assayed for fatty acid composition. Two lines, 308/430-12 and 308/430-15, were found to produce somatic embryos Witll lli~ll 10 levels of stearic acid. The stearic acid content of somatic embryos from these two lines is coln~)a,~d to the stearic acid content of somatic embryos from their control lincs in Figures 37 and 38. The control lines were from the same culture that tlle transformed lines came from except that they were not transforrned. For line 308/430-12, s~earic acid in somatic embryos ranged from I to 23% while the controls ranged from 0.5 to 3%. For line 308/430-15, stearic acid in somatic emblyos ranged from 2 to 15% while the controls ranged from 0.5 to 3%. More than 50% of the somatic embryos had stearic acid levels which were above the range of the controls in both the transformed lines. The above results indicate that an antisense- ~\9 desaturase gene can be used to raise the stearic acid levels in somatic embryos of maize.
Part C Demonstration of an increase in stearic acid in leaves due to introduction of an ic~n~e- A9 desaL~lase gene. Embryogenic cultures from lines 308/430-12 and 308/430-15 were used to rege.,l,~ate plants. Leaves from these plants were analyzed for fatty acid composition using the method previously described. Only 4 plants were obtained from the 308/430-15 culture and the stearic acid level in the leaves of these plants were normal, 1-2%. The stearic acid levels in leaves from plants of line 308/430-12 are shown in Figure 39. The stearic acid levels in leaves ranged from 1 to 13% in plants from line 308/430-12.
About 30% of the plants from line 308/430-12 had stearic acid levels above the range observed in the controls, 1-2%. These results iTl(liC~te that the stearic acid levels can be raised in leaves of maize by introduction of an ~nt ~çnce- ~\9 desaturase gene.

By "~ntis~on~e~ is meant a non-enzymatic nucleic acid molecule that binds to a RNA
(target RNA) by means of RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid;
- Egholrn et al., 1993 Nature 365, 566) interactions and alters the activity of the target RNA (for a review see Stein and Cheng, 1993 Science 261, 1004).

S~ l l l UTE SHEET (RULE 26) - -Exam~le 35: Amvlose Content Assav of Maize Pooled Starch Sample and Sin~!le Kernel The amylose content was assayed by the method of Hovenkamp-Hennelink et al.
(Potato Research 31:241-246) with modifications. For pooled starch sample, 10 Illg to 100 mg starch was dissolved in 5 ml 45% perchloric acid in plastic cLtlturc tubc. Tllc solution was mixed occasionally by vortexinL~ Aftcr onc hnLIr, ().2 nll of tllc slarcll solution was diluted to 10 ml by H20. 0.4 ml of the dilutcd solution was thcn IlliXCd with 0.5 ml diluted Lugol's solution (Sigma) in I ml cuvet. Readings at 618 nm and 550 nm were immediately taken and the R ratio (618 nm/550 nm) was calculatcd. Usin~
standard equation P (percentage of amylose) = (4.5R-2.6)/(7.3-3R) gcncratc(l from l-otato amylose and maize amylopectin tsigma~ St. Louis), amylose contcnt was dctcrmillcd. For frozen single kernel sample, same procedure as above was used except it was extracted in 45% perchloric acid for 20 min instead for one hour.

Example 36: Starch Purification and Granular Bound Starch S~nthase (GBSS) Assay The purification of starch and following GBSS activity assay were modified from the ~etho~c of Shure et al. (Cell, 35:225-233, 1983) and Nelson et al. (Plant Physiology, 62:383-386, 1978). Maize kernel was homogenized in 2 volume (v/w) of 50 mM Tris-HCI, pH 8.0, 10 mM EDTA and filtrated through 120 ,um nylon membrane. The material was then centrifuged at 5000 g for 2 min and the supernatant was discarded. The pellet was washed three times by resuspending in water and removing supernatant by centrifugation. After washing, the starch was filtrated through 20 ~Im nylon membrane and centrifuged. Pellet was then Iyophilized and stored in - 20 ~C until used for activity assay.

A standard GBSS reaction mi,.Lurt contained 0.2 M Tricine, pH 8.5, 25 mM
Glutathione, 5 mM EDTA, 1 mM 14C ADPG (6 nci/,umol), and 10 mg starch in a totalvolume of 200 ,ul. Reactions were c~nflucted at 37 ~C for S min and termi-l~ted by adding 200 ,ul of 70% ethanol (vfv) in 0.1 M KCI. The material was centrifuged and unincol~,o~aled ADPG in the supernatant is removed. The pellet was then washed four time with lml water each in the same fashion. After washing, pellet was suspended in 500 111 water, placed into scintillation vial, and the incorporated ADPG was counted by a Beckman (Fullerton, CA) scintillation counter. Specific activity was given as pmoles of ADPG incorporated into starch per min per mg starch.

SUBSTITUTE SHEET (RULE 26) PCT~US96/11689 Example 37: Analvsis of Antisense-GBSS Plants Because of the segregation of R2 seeds, single kernels should therefore be analyzed for amylose content to identify phenotype Because of the lar~e amount of sampleso generated in this study, a two-step screening stratc~y was LlSC(I, ~ hC flrS~ SlCp, 3() kernels were taken randomly from the same ear, freezc-dricd and 11ol11oL~CIliXC~ O St.lrCIl flour. Amylose assays Oll the starch flours wcrc carricd Olll. Lincs will~ rc(luccd amylosc content were identified by statistical analysis. ln the second step, amylose content of the single kernels in the lines with reduced amylose content was further analyzed (25 to 50 10 Icernels per ear). Two sets of controls were used in the screening, one of the scts wcrc untransforrned lines with the same genetic background and the other were transformed lines which did not carry transgene due to segregation (Southern analysis negative line).

81 lines ~c;pr~_s~l.ting 16 transformation events were examined at the pooled starch 15 level. Among those lines, six with si~ific~nt reduction of amylose content by statistical analysis were identified for further single kernel analysis. One line, 308/425-12.2.1, showed significant reduction of amylose content (Figure 40).

Twenty five individual kernels of CQ806, a conventional maize inbred line, were analyzed. The amylose content of CQ806 ranged from 24.4% to 32.2%, av~ .. ,g 29.1%. The single kernel distribution of amylose content is skewed slightly towards lower amylose co~ ts Forty nine single kernels of 308/425-12.2.1.1 were analyzed.
Given that 308/425-12.2.1.1 resulted from self pollination of a hemizygous individual, the e~r~ec~d distribution would consist of 4 distinct genetic classes present in equal 25 frequ~n~ies since endosperrn is a triploid tissue. The 4 genetic classes consist of individuals carrying 0, 1, 2, and 3 copies of the ~nti~ence construct. If there is a lat~e dosage effect for the t~ then the distribution of amylose contents would betetramodal. One of the modes of the resulting distribution should be indi~tinguich~hle from the non-tr~n~ nic parent. If there is no dosage effect for the transgene (individuals 30 carrying 1, 2 or 3 copies of the llallsg.,.le are phenotypically equivalent), then the distribution should be bimodal with one of the modes identical to the parent. The number of individuals included in the modes should be 3: 1 of transgenic:parental. The distribution for308/42~-12.2.1.1 isdistinctlytrimodal. The central mode is approximately twice the size of either other mode. The two distal modes are of approximately equal size.35 Goodness of fit to a 1 :2: 1 ratio was tested and the fit was excellent.

SUBSTITUTE SHEET (RULE 26) Further evidence was available demonstrating tl1at the mode ~ i~l1 the hi~hest amylose content was identical to the non-transgenic parent. This was done using discriminant analysis. The CQ806 and 308/425-12.2.1.1 data sets were combined for this analysis. The distance metrics used in the analysis were calculated usin~ amylose contents only. The estimates of variance from the individ~lal allalyscs wcrc usc(l ill all r tests. No pooled estimate of variance was emr)loyc(l. Thc origill,ll d.lt.l w".~. tcslc(l ~Or reclassification. Based on the discriminant analysis, thc cnlirc IllOdC ol- tllC 3()X/42S-12.2.1.1 distribution with the highest amylose content would be more appropriately cl~ssifi~cl as parental. This is strong confirrnation that this mode of the distribution is parental. Of the remaining two modes, the central mode is approxil1latcly twicc tllc sizc of the lowest amylose content mode. This would be cxpcctcd if tl1c ccntlal mo~lcin~ (k-s two genetic classes: individuals with 1 or 2 copies of the antisense construct.
The mode with the lowest amylose content thus represents those individuals which are fully homozygous (3 copies) for the antisense construct. The 2:1 ratio was tested and could not be rejected on the basis of the data.

This analysis indicates that the anti~ence GBSS gene as functioning in 308/425-12.2.1.1 demonstrates a dosage dependent reduction in amylose content of maize kernels.

Example 38: Analysis of Ribozyme-GBSS Plants The same two-step screening strategy as in the antisense study (Example 37) was used to analyze ribozyme-GBSS plants. 160 lines ~ senting 11 transformation events were ~ in the pooled starch level. Among the control lines (both untransformed line and Southem negative line), the amylose content varied from 28% to 19%. No si~ific~n~ reduction was observed arnong all lines carrying ribozyme gene (Southern positive line). More than 20 selected lines were further analyzed in the single kernel level, no signifir~nt amylose reduction as well as se~l~,galion pattern were found. It was ap~a~nL that ribozyme did not cause any alternation in the phenotypic level.
Tl~sns~,-,-ed lines were further examined by their GBSS activity (as described in Example 36). For each line, 30 kemels were taken from the frozen ear and starcll was purified. Table XIV shows the results of 9 plants r~pleSel1ting one transformation event ofthe GBSS activity in the pooled starch samples, amylose content in the pooled starch samples, and Southem analysis results. Three southern negative lines: RPA63.0283, RPA63.0236, and RPA63.0219 were used as control.

SUE~STITUTE SHEET (RULE 26) PCTnJS96J11689 The GBSS activities of control lines RPA63.0283,RPA63.0236,andRPA63.0219 were around 300 units/mg starch In lines RPA63.0211,RPA63.0218,RPA63.0209, and RPA63.0210, a reduction of GBSS activity to more than 30% was observed. The 5 correlation of varied GBSS activity to the Southcm analysis in tlli.s L~rour) (rrom RPA63.0314 to RPA63.0210 of Tablc XlV) inclicatcd tl-a~ c rc(lllccd ~ .S.S .I~:livily was caused by the expression of ribozymc ~cnc incorr)oralcd inlo Illc maii~c gcllolllc.

GBSS activities at the single kernel level of line RPA ~3.021~ (Soutllcrl1 r)ositivc and reduced GBSS activity in pooled starch) was further examincd. using RPA63.030f (Southern negative and GBSS activity normal in poolcd stalcll)ascolllrol. About30 kemels from each line were taken, and starch samples were purified from each kernel individually. Figure 41 clearly indicated reduced GBSS activity in line RPA63.0218 co~ a~ ~d to RPA63.0306.
Other embo~ .L~i are within the following claims.

SUBSTITUTE SHEET (RULE 26) Tablel 6 Characteristics of naturally OC~ur. illg ribozvmes Group I Introns ~ Size: ~150 to >1000 nucleotides.
~ Requires a U in the target Sc4ucllCc imme~ tPIy 5' of the cleavage site.
~ Binds 4-6 nucleotides at the 5'-side of the cleavage site.
~ Reaction mech~nicm: attack by the 3'-OH of guanosine to ge~ alc cleavage pl~nlUI,,I:~ with 3'-OH and 5 -.,u~nos;..e, ition~l protein cofactors required in some cases to help folding and m~int~in~n~e ofthe active sll u-,lu- c ['].
~ Over 300 known members of this class. Found as an intervening sequence in ~I~uh,,..._,.a thermophila rRNA. fungal mitochondria. chloroplasts. pha e T4. blue-green algae. and others.
~ Major structural features largely established through phylogenetic comparisons. mut~geneSiC
and biochPnnic~l studies [2,3].
~ Complete kinetic framework established for one ribozyme [4,5,6,7].
~ Studies of ribozyme folding and :.ub:,llale docking underway [~,9,~0].
~ ChPmi~l modification invPstig~tion of ;Illp~ residues well established [",~'].~ The small (4-6 nt) binding site may make this ribozyme too non-specific for targeted RNA
cleavage. however, the Tetrahymena group I intron has been used to repair a "defective"
b-g~l~rtc-si~ce ...- c5~p~, by the ligation of new b-g~ tosi~i~ce seyu- -~ es onto the defective mecc~e [13].
RNAse P RNA (M1 RNA) ~ Size: ~290 to 400 nn~ leoti(ies ~ RNA portion of a ubiquitous ribonucleQ~ Ic;.. enzyme.
~ Cleaves tRNA ylc~.ulaOI~ to fomm mature tRNA [14].
~ Reaction me~-h~nicm: possible attack by M2 -OH to generate cleavage products with 3'-OH and S -pho5ph:~tP
~ RNAse P is found throughout the prokaryotes and eukaryotes. The RNA subunit has been s~ ed from bacteria~ yeast, rodents, and primates.
~ Rcc. uil~ ,uL of endogenous RNAse P for IL~,,alJ~ LiC applications is possible through hybridization of an Extemal Guide .Seq~Pnre (EGS) to the target RNA [15,'6]
~ I..lpGI~alll phosph~tP and 2' OH contacts recently identified [~ ]
Group ll Introns ~ Size: >1000 nucleotides.
~ Trans cleavage of target RNAs recentlv demoll~llalcd [~9,'0].
~ Sequence n,~uilc.llents not fully deterrnined.
~ Reaction ~..ecl-~ni~ 2'-OH of an internal ~f~Prlocine generates cleavage products with 3'-OH
and a "lariat" RNA cont~ining a 3'-5 and a 2'-5' branch point.
~ Only natural ribozyme with demonstrated pa.lic;~,ation in DNA cleavage [1l,''] in addition to RNA cleavage and ligation.
~ Major structural features largelv established through phvlo_enetic cou.pa.,sons [' ].

SUBSTITUTE SHEET (RULE 26) W O 97/10328 PCT~US96/11689 Tablel ~ Important ' OH contacts besinnins to be identified [24]
~ Kinetic framework under development [25]
Neurospora VS RNA
~ Size: -144 nucleotides.
~ Trans cleavage of hairpin target RNAs recently demonstrated [26]
~ SequPn~e ~c.luilements not full,v determined.
~ Reaction me~h~nicm attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosrh~tP and 5'-OH ends.
~ Binding sites and structural requh.~ not fully determined.
~ Only 1 known member of this class. Found in Neulu~Jola VS RNA.
I l~.. erl.~cl R;bG~ e (see text for .ef."~,.ccs) ~ Size: ~13 to 40 nucleotides.
~ Requires the target sequence UH imm~di~t~Ply 5' of the cleavage site.
~ Binds a variable number nucleotides on both sides of the cleavage site.
~ Reaction ...e l.~ attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phocl.l~ and 5'-OH ends.
~ 14 known members of this class. Found in a number of plant p~thngPnc (virusoids) that use RNA as the infectious agent.
Fcc~nfi~l slru~,lul~l features largely defined, inrl~rling 2 crystal allu~;lulci~ []
~ Minimal ligation activity ~~emoricl ~ ah~d (for e,.gi..e~" ing through in vitro selection) []
~ Complete kinetic framework established for two or more ribozymes [].
~ . Ch~mi~ l modircdlion investig~tion of hllpollallL residues well established 1].
Ilai.~in Rit G~...e ~ Size: ~50 nucleQti~l~os ~ Requires the target seq~nee GUC immP~ t~ly 3' of the cleavage site.
~ Binds 4-6 n~rl~otirlPs at the 5'-side of the cleavage site and a variable number to the 3'-side of the cleavage site.
~ Reaction meH.~ attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosrh~te and 5'-OH ends.
~ 3 kno vn members of this class. Found in three plant p~thngen (satellite RNAs of the tobacco ~;~7lJot virus, arabis mosaic virus and chicory yellow mottle virus) which uses RNA as the infectious agent.
O F.ccf~rlti~ llu~lulal features largely defined [27,28,29,30]
~ T .ig~tion activity (in a-l~iiti- n to cleavage activity) makes ribozvme amenable to en~,hle~"ing through in vilro selection [31]
~ Complete kinetic framework established for one ribozyme [32]
~ Ch~mi~l modification investigation of hll~,ul~lll residues begun [33,34].
He~dlili:> Dettd Virus (HDV) Ribozyme ~ Size: ~60 nUcl~oti~pc ~ Trans cleavage of target RNAs demc,..sL~ al~d [35].
~ Binding sites and ~llu~;lulàl requh~nl.,.ll~ not fullv determined. ~Ithou~sh no se~ u~c 5~ of cleavage site are required. Folded ribozvme contains a rceud~ n-~t ~llu~Lul~ t3~']

SUBSTITUTE SHEET (RULE 26) WO 97/10328 PCTrUS96/11689 Tablel ~ Reaction me~~h~nicm: attack b~ 2'-OH 5' to the scissile bond to Penerate cleava~e products with 3'-cyclic phosphate and o'-OH ends.
~ Only 2 known members of this class. Found in human HDV.
~ Circular forrn of HDV is active and shows i-l~,- . asc-d nuclease stability [37]
1. Mohr, G.: Caprara. M.G.: Guo, Q.; LalllbowiL~ A.M. Nature, ~Q. 147-150 (1994).
2. Michel. Francois: Westhof. Eric. Slippery aul,ahai.a. Nat. Struct. Biol. (1994), 1(1), 5-7.
3. Lisacek, Fn,d.,. iyu.,. Di~ Yolande: Michel. Francois. ~ntom~tir i~ -, ;on of group I intron coresin genomic DNA se~ Pc J. Mol. Biol. (1994), 235(4). 1206-17.
4 ~Pr~crhla~ Daniel; Cech. Thomas R.. Catalysis of RNA cleavage by the Tetrahymena ~ ,hil~
ribozyme. I . Kinetic dea~ ion of the reaction of an RNA substrate cu...pl....~..~ y to the active site.
R~ l.y (1990), 29(44), 10159-71.
~lPtC~ hl~ Daniel; Cech. Thomas R.. Catalysis of RNA cleavage bv the Tetrahymena ~l-P ~..ot~
ribozyme. '7. Kinetic dea~ l iyliu-- of the reaction of an RNA substrate that forms a micm~mh at the active site.
Bio~ y (1990). 29(44), 10172-80.
6. Knitt, Deborah S.: Herschlag. Daniel. pH D~ of the Tetrahvmena Ribozyme Reveal an U...,on~_..Liullal Origin of an Apparent pKa. BiorhPmictry ( 1996). 35(5). 1560-70.
7. Bevilacqua, Philip C.: Sugimotc~ Naoki: Turner. Douglas H.. A - ' - La l,_.. ulk for the second s~ep of splicing catalyzed by the Tetrahvmena ribozyme. BiochPmictrv ( 1996), 35(2), 648-58.
8. Li, Yi; Bevilacqua, Philip C.: Mathews. David; Turner. Douglas H.. Thermodynamic and a~li./d~i - for binding of a ~ ,.-c-labeled substrate by the Tetrahymena ribozyme: docking is not diffusion-controlled and is driven by a L~,~,.able entropy change. Bio~h .~ . y (1995), 34(44), 14394-9.

9. Banerjee, Aloke Raj; Turner. Douglas H.. The time ~ ~, .,d~ ~e of chemical ~..n.l;r;. _l;.~., reveals slow steps in the folding of a group I ribozyme. Bin- ~ -y (1995), 34(19), 6504-12.10. Zarrinkar, Patrick P.. Willi ~mcnn James R.. The P9. 1 -P9.2 ~.,. i,Jh~.al ~ . l~ -,, . helps guide folding of the Tct~ahy..._..a ~ il,o ~..le. Nucleic Acids Res. ( 1996). 24(5). 854-8.
I I. Strobel. Scott A.; Cech. Thomas R.. Minor groove ~~cc~ ;GII of the con~ _d G.cntdot.U pair at the Tetrahymena .il,u~...c reaction site. Science (WZ_I ;~ , D. C.) (1995). 267(5198), 675-9.
12. Strobel, Scott A.; Cech, Thomas R.. Exocyclic Amine of the Conserved G.cntdot.U Pair at the Cleavage Site ofthe TLt al.~..._..a Ribo_yme Cu.n-iL to 5'-Splice Site Selectinn and Transition State S~ ili7~inn E~;~l.. ~..;~-.y (1996), 35(4), 12ûl-11.
13. S~llPnpP~, Bruce A.: Cech, Thomas R.. Ribo_vme-mediated repair of defective mRNA by targeted trans-splicing. Nature (London) (1994). 371(6498), 619-22.
14. Robertson. H.D.: Altman, S.: Smith, J.D. J. Biol. Chem., _47. 5243-5251 (1972).
15. Forster, Anthony C.; Altman. Sidney. Extcrnal guide 5~ s for an RNA en_yme. Science (W~ . D. C., 1883-) (1990), 249(4970), 783-6.
16. Yuan, Y.; Hwang. E. S.; Altman. S. Targeted cleavage of mRNA by human RNase P. Proc. Natl. Acad.
Sci. USA (1992) 89, 8006-10.
17. Harris, Michael E.: Pace. Norman R.. kl~ -- of ~I-o~ . involved in catalysis by the ribo_yme RNase P RNA. RNA (1995), 1(2). 210-18.
18. Pan, Tao: Loria. Andrew; Zhong. Kun. Probing of tertiary illt~a~,Liu~l~ in RNA: 2'-hydroxyl-base contactcbetween she RNace P RNA and pre-tRNA Proc. Natl= Acad= Sci U. S. A (1995), 92(26). !25!0-!4.
19. Pyle, Anna Marie; Green. Justin B.. Building a ICinetic Fra...~ o-k for Group II Intron Ribozyme Activity: Q ~~ --;ul, of Illte.-lulllaill Binding and Reaction Rate. Bio- hPmictTy (1994). 33(9). 2716-25.
20. Michels, William J. Jr.; Pyle, Anna Marie. Conversion of a Group 11 Intron into a New Multiple-Turnover Ribozyme that Selectively Cleaves OliPnn~cleoti~ Flllr~ n of Reaction Merh~nicm and Structure/Function p~pl~ nchipc BiorhPmictTy (1995). 34(9). 2965-77.
21. Zimmerly, Steven; Guo. Huatao: Eskes. Robert; Yan~. Jian: Perlman. Philip S.: Lambowitz Alan M..
A group 11 intron RNA is a catalytic c ~ l of a DNA L lull~l~ Ir~c~= involved in intron mobility. Cell (Cal..b.;dge. Mass.) (1995), 83(4). 5:29-38.
22. Griffin. Edmund A.. Jr.; Qin. Zhifeng; Michels. Williams J.. Jr.: Pyle. Anna Marie. Group 11 intron ribozymes that cleave DNA and RNA linkages with similar efficiency. and lack contacts with substrate 2'-hydroxyl groups. Chem. Biol. (1995). 2(11). 761-70.

SU~, 111 ~JTE SHEET (RULE 26) WO 97/10328 PCTrUS96/l1689 TablCI

23. Michel. Francois: Ferat. Jean Luc. Structure and activities of _roup 11 introns. Annu. Rev. Biochem.
(1995). 6~. 435-61.
24. Abramovitz. Dana L.: Friedman. Richard A.; Pyle. Anna Marie. Catalvtic role of 2'-hvdroxyl groups within a group 11 intron active site. Science (W~chin_ton D. C.) ( 1996). 271 (5254). 1410- 13.
25. Daniels. Danette L.: Michels, William J.. ~r.; Pyle. Anna Marie. Two cr....r~l;..g pathwavs for self-splicing by group 11 introns: a ~ /e analysis of in vitro reaction rates and products. J. Mol. Biol.
(1996), 256(1). 31-49.
26. Guo. Hans C. T.: Collins, Richard A. Efficient trans-cleavage of a stem-loop RNA substrate by a ril~u~ c derived from NcL..va,uula VS RNA. EMBO J. (1995). 14(2). 368-76.
27. Hampel. Arnold; Tritz. Richard; Hicks. Ma.~a..~. Cruz. Phillip. 'Hairpin' catalytic RNA model:
evidence for helixes and sequence ~.~ui,~...c..~ for substrate RNA. Nucleic Acids Res. (1990). 18(2), 299-304.
28. Chowrira, Bharat M.: Berzal Ill..la-~ Alfredo; Burke. ~ohn M.. Novel gn~nnc~ cyuh~ for câtalysis by the hairpin ribozyme. Nature (London) (1991), 354(6351),320-2.
29. Berzal Ilc.la l~ Alfredo; Joseph, Simrson Chowrira. Bharat M.: Butcher. Samuel E.: Burke, John M..
Essential ~ ul ;~F 5~ 1 ~'f 5 and secu--.lcu y structure elements of the hairpin ribozyme. EMBO J. (1993), 12(6), 2567-73.
30. Joseph, Simrsnn Berzal Ilc~a~ Alfredo: Chowrira, Bharat M.: Butcher. Samuel E.. Substrate selection rules for the hairpin ribozyme determined by in vitro selectinn mllt~tion and analysis of m;~ t~ I-rd ~uL.LIat~,. Genes Dev. (1993), 7(1), 130-8.
31. Berzal Ilc..anz. Alfredo; Joseph, Simpson, Burke. ~ohn M.. In vitro selection of active hairpin libU~ s by 5~ RNA-catalyzed cleavage and ligation reactions. Genes Dev. (1992), 6(1). 129-34.
32. Hegg. Lisa A.; Fedor, Martha J.. Kinetics and Thermodynamics of I~IL~ Oh l~r Catalysis by Hairpin Ribozymes. Pjo. I.. ;~l.y (1995), 34(48), 15813-28.
33. Grasby, Jane A.; M~ ---- Karin; Singh, MoLiu.-l~.., Gait, Michael J.. Purine Fu-~ I Groups in Essential Residues of *e Hairpin Ribozyme Required for Catalvtic C!eavage of RNA Bi~ (1995) 34(12), 4068-76.
34. Schmidt. Sabine; Re :~ f 1~ Leonid; Karpeisky, Alexander; Usman. Nassim; Sorensen, Ulrik S.; Gait, Michael J.. Base and sugar r.,.lui~.l,e.~la for RNA cleavage of essential I~ 'IFO' '1~ residues in intemal loop B of the hairpin ribozyme: implir~tir nc for seconda.y structure. Nucleic Acids Res. (1996), 24(4), 573-81.
35. Perrotta. Anne T.: Been, Michael D.. Cleavage of oli~c..;l,~,.,~.ck~,(id. ~ by a riboyrne derived from the hepatitis .delta. virus RNA s~q~l~nre R;ocl~ y (1992), 31(1), 16-21.
36. Perrotta. Anne T.; Been, Michael D.. A 1~ -ot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature (London) (1991),350(6317), 434-6.
37. Puttaraju. M.; Perrotta. Anne T.; Been, Michael D.. A circular trans-acting hepatitis delta virus ribozyme. Nucleic Acids Res. (1993), 21(18), 4253-8.

SUBSTITUTE SHEET ~RULE 26) W O 97/10328 PCTrUS96/11689 Tablell Table 11: 2.5 ,L~mol RNA Synthesis Cycle Reagent Equivalents Amount Wait Time~
Pllospl)u,d,, ' - 6.5 163 ~L 2.5 S-EthylTetrazole 23.8 238 ~L 2.5 Acetic Anhydride 100 233 ~L 5 sec N-Methyl Irll ' '-. 186 233 ~lL 5 sec TCA 83.2 1.73 mL 21 sec lodine 8.0 1.18 mL 45 sec Acelul ;'~ NA 6.67 mL NA

Wait time does not include contact time during delivery.

SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 TablclllA
. 73 Table IIIA: GBSS H~ erhead Substrate SeclL~..ce nt. Substrate Seq. ID nt. Substrate Seq.
Position No. Position No 146Gr,GCUGCUC AUCUCGUC 38 593UCCGAGAUC AAGAUGGG 39 188r,cGr;cuCUA GCCACGUC 54 661cçGcGur;uu CGUUGACC 55 196AGCCACGUC GCAGCUCG 56 662CGCr,ur,uuc GUUGACCA 57 206CAGCUÇGUC GCAACGCG 60 679CCCACUGUU CCUGGAGA 61 247GUCCACGUU CCGCCGCr~ 66 693AGAGr;GUUU GGGGAAAG 67 248UCCACGUUC CGCCGCGI; 68 716GAGAAGAUC UACGGGCC 69 292GA~t;r~Cr;UC GGCC3GCGG 70 718GAAGAUCUA C~:3GGCCUG 71 314CUCAGCAUU CGGACCAG 74 763GCUr,cl:;Guu CAr CCUGC 75 315UCAGCAUUC GGACCAGC 76 764cuGcr~Gl~JucAGccuGcu 77 398UCGCUCGUC GUGUr;CGC 88 826CAACCCAUA CUUCUCCG 89 428A~.CGuçr,uc uucGucr~r~ 92 830CCAUACUUC UCCGGACC 93 431GUCGUCUUC r UCGr~Gr~C 96 841CGGACCAUA CGGGGAGG 97 434GUCUUCr,UC G~CGCCr;~ 98 854GAGGACGUC GUGUUCGU 99 482GGCGACGUC CUCG(3CGG 102 860GUCGUr;UUC GUCUGCM 103 485GACr;UCCUC GGCGGCCU 104 863GUGUUCr;UC UGCMCGA 105 527C:ACCI;UGUC AUGGUCGU 106 888CCG~,CCCLJC UCUCGUGC 107 898CUCC;UrCU~CCUCAAGA 112 1241AUGGACGUCAGCGAGUG 113 ~ 902UGCUACCUCAAGAGCAA 114 1270GGACAAGUACAUCGCCG 115 931CGGCAUCUA CAGGGACG 122 1346GCGGAGGUC r;GGcuccc 123 951AGACCGCUU UCUGCAUC 124 1352Guçr~r~Gcuc CCGGUGGA 125 SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 WO 97/l03Z8 PCI'/US96/11689 TablelllA
7~

nt. Substrate Seq. ID nt. Substrate Se4. ID
Position No. Position No.

986GGCCr~GUUC GCCUUCUC 140 1472GUGCAGAUC GUUCUGCU 141 1039GUCGUCCUU CGAUUUCA 160 1565GUCAAGUUC A~CGCGGC 161 1046UUCGAUUUC AUCGACGG 168 1627CAGCCt;CUU CGAGCCCU 169 1049GAUUUCAUC GACGGCIJA 170 1628AGC::r~CVUC GAGCCCUC; 171 1085CGGAAGAUC AACUGGAU 174 1646GGCCUrAUC CAGCUGr-~ 175 1106GCCGG~UC CUCGAGGC 176 1666GAUGCGAUA CGGAACGC 177 1109GGGAUCCUC GAGGCCGA 178 1690cur,cr,cr,uc CACCGGUG 179 1127AGr'GUCCUC ACCGUCAG 182 1706GGACUCGUC GACACCAU 183 1133CUCACCGUCAGCCCCIl~ 184 1715GACACCAUCAUCGAAGG 185 1144CCCCUACUA CGCCGAGG 188 1735GArcGGr~uu CCACAUGG 189 1157GAGGAGCUC AUCUCCGG 190 1736~CCGr~r~UUC CACAUGGG 191 1160GAGCUCAUC UCCGGr~U 192 1751Gr'CCGCCUC AGcr-ucr~ 193 1205AUGCGCCUC ACCGC'r,AU 202 1820cr~cr,cr.~uc AAGGUGGU 203 1214Ar-cGGrAuc ACCGGr~U 204 1829AAGGUGGUC GGCACGCC 205 1223ACCGr~r~UC GUCAACGG 206 1843GCCGGCGUA CGAGGAGA 207 SUBSTITUTE SHEET (RULE 26) TablclllA
7~ -nt. Substrate Seq. ID nt. Substrate Seq. ID
Position No. Position No.

19~GUGCUGCUC AGCCUCGG 216 2223AAUUUUAUA UUGCGAGU 217 1934CUCGGGGUC GCCGGCGG ~o 2232UUGCGAGUAAAUAAAUG ~1 1970GAGGAGAUC rCt;CCGCU 224 2248GGACCUGUA GUGGUGGA 225 1979GCGCCI;CUC GCCAAGGA 226 2012UGAAGAGUU CC;GCCUGG 227 2033CCCCUGAUC UCGCGCC;U 229 2080UAUGCUGUU UCr~UU!JAU 239 2197GCC;U1:3UGUA GUUAAGUA 260 2215CGAIlCGGUA AUUUUAUA 265 SUBSTITUTE SHEET (RULE 26) WO97/10328 PCTrUS96/11689 TablelllB

Table III B: Hammerhead Ribozvme Sequence Targeted Against GBSS mRNA

nt. Position HH Ribo~c Sc.~._c ce Seq. ID
No.

SUBSTITUTESHEET(RULE26~

CA 02226728 l99X-01-13 WO 97/10328 PCI'/US96/11689 Tabie IIIB

nt.Position HH Ribo~ meSequence Seq.ID
No.

SUBSTITUTESHEET(RULE26) TablelllB

nt.Position HH Ribo~meSequence Seq.ID
No.

10~ CCGUCGAUGACUGAUGAXGAAAUCGAAGGAC 379 1106 CGGCCUCGAGCUGAUGAXGAAAUCCCr~GCCU 385 1109 UGUCGGCC~'~ ~J~AU&A X ~AA ~GGAUeCCGG 886 1370 CCACCAGCGGCUGAUGAXGAAAUGUUCCGGU 409 r SUBSTITUTE SHEET (RULE 26) WO 97/10328 PCTrUS96/11689 TablelllB

nt.Position HH Ribo~meSe~ cc Seq.ID
No.

1589 CGCCGGCCAUCUGAUGA.XGAAAUGUGGUGCG 427 1751 AGUCGACGCUCUGAUGAXGAAAGGCGG~CCA 442 1769 CCG~CUCCACCUGAUGAXGAAACGUUGCAGU 444 SUBSTITUTE SHEET (RULE 26~

, Table IIIB

nt. Position HH Ribozvme Sequence Seq ID

2~o CUCGCAAUAU CUGAUGA X GAA AAAUUACCGA 501 ~2~3 UUACUCGCAA CUGAUGA X GAA AUAAAAUUAC 503 2~5 AUUUACUCGC CUGAUGA X GAA AUAUAAAAUU 504 Where "X" ,c~l~;sclll~ stem II region of a HH riboyme (Hertel et al., 199~ I~ ucleic Acids Res. 20 3252). The length of stem II may be 2 2 base-pairs.

SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 Table IV

Table IV: HH Ribozyme Sequences Tested ~in.ct GBSS rnRNA
nt. HH I~ e Sequence ~}1 ~
Posif;ion I.D.

593 CUCCCAUCUU CUGAUG~c-.GCCc-.~AAGGCCGAA ArJcucc-~rArA 3 742 Cwuciucc~uci Cur~ArTr~AGGccGAAAGGccGAA AC;U~_CCjUUC C 4 812 ~uuciuucjuu cur-2~rr~rGccr~AAGGccGAA ArGcur~r~-A 5 892 GAr~jrTAC-r~r CU~AUG~G&CCGAAAGGCCGAA AGAGAGGGCC 6 913 GUGGGACUGG cu~ rr~ r~Gccr~AAAr~iccr~A Acjuucjc-uc uu 7 919 c.AIlcjccciu~j CUGAUGAc-,GCCc-.A~AGGCCGAA ACUGGUAGUU 8 953 uwr,r.~TTGrP, ~ ~CGAA A~jC~iu~-U 9 959 AGAu~uu~iu~j r-ur~TTr~rrccrz~AAGGccGAA AUGCAGAAAG 10 968 C~uw~GGA cuGAlTr~rGccrAAAGGccGAA A~KjUU~ '3 11 1016 Al ILuuuCC~G cuGAuG~rGcrr-~AAGGccG~A AGGWCAGCU 12 1028 ~r~ rr~ArqTu cur~rJrz~rrccr-~r-r~ccr~A AAU~ lCC~ 13 1085 UCAUCCAGW cur~rTr~r~iccrA~AGGccG~ Iuuu~l'GGC 14 1187 U~ ~uwu~ CUG~Ur-Ar~iCrr~AAr~GCCG~A ~ -uCG~ 15 1196 ur.~r~Gr~rT cuGATTr-~rGcr-r~AAAGGccG~ Au~juu~i~J~:G~. 16 1226 cr~rl(j~C-~uu cur~rTr~rricrrA~AcGccG~A ACGMTGCCGG 17 1241 CCr2~rUCGCU CUG~TTr-~r~iCrr-~AAGGCCGaA ACGUCCAUGC 18 1270 r~rr,Grr.ArTG cur-AT7r-Ar~cr~AAAr~GccG2~A A~:UU(jUCC--u 19 1352 r~;UcrP~rrc~i c~ur2~TTr2~rGccr~Ac~Gccr~A Ar~cccrArcu20 1421 ~ C-I~ArT cur~ Tr~r~Gccr~Ap~r~r~ccc~ C(jU~W~ 21 1534 ~ uu~u~i CUr-Z~lTr~ArGcc'r~A~Ar~ic~~ A~'UU~.'UL~'~' 22 1715 u~:~:uuu-GAU CUr-2~JrArGCC'r-~AAGGCCC~ A~Jwu~ju~-~' 23 1787 rr~ ~uu~uu cur~TTrz~rr~cr~AAGGccG~ ACGuu-CGCC~ 24 SUBSTITUTE SHEET (RULE 26) o C~ _ V~

~ v ~rj ~ ~ ~ 3 ~ ~ ~ ~ ~ ~ ~
V ~ ~ r~,~) J ~ ~ 3 C~ ~ C ~
c ~ v ~3 ~" v ,~ c , ~ ~. 3 'z: ~ ~ w ~ ~ w ' w c~ w ~ ~ ~ w ~
) w t~

-- o ~ O N ~t tD CO O N ~ rD CO O N ~ CD
G Z ~ N~ ~N ~ ~N N ~ ~ r~
C.Q
z ~,,,, 3,, ,,~, ~ ~ w ~ ~ c~ c~ ~ o c~
C V C) C) V C~ V (~ C) G C) ~ V C) ,,,,3333_3~333' C ~ ~ ~ Cl ~ 1: C ~ ~ ~ g c~ o c~ ~ w ~ ~ ~ o o c~ o ~ c~ w ~
~c ~ ~ ~ ~ ~ ~ c~ o o c~

~5 ~ ~ ~ o ~ w 5 ~ ~ - ~ ~ ' ~ ~ ~ ~ ~ ~ c ,J ~ 5 ~.-c, ~ o c 5 v ~ ~ , ~ = ~ ~ ~ , 5 c ~ ~ ~ ~ ~t~
~5 ~ ~ J ~ ~ ~ ~ ~ ~ , ~
V ~ ~ C
-_ _ 0 a~ CD CD ~ o t.~ 1~ O 1~ CD ~ I~

SUBSTITUTE SHEET (RULE 26) ~n o o c O ~ ~ ~ ~ - 3 ~3 ~3 e c ~ ~ ~ ~ o 3 3 ~ ~ ~ c c ~ ~ ~ ~ 3 ~ 3 c ~3 ~ ~ c ~ 3 ~ ~ O ~ ~

q~

-~ 0 0 o ~ ~r CD 0 1~n U~ ~ ~ 0 ~ C~ P 0 0 ~ ~ C~ 0 0 C~l ~r CD 0 0 0 ~ ~D 0 o ~ ~gg,g g~g5ggg~g j~gg ~ j~g~'' jg j~

c c c c c c c c c c c c 3 c c c c c c c c c O~'c c C~3 c .~ ~
, o y y o ~ ~ o y o y y o o ~ C C o C C C C o C C ~ C C C

v v v v v v v v vt ~v~ ,vs ~vc .~v ~vs ,v~ ~v ~vc ~v <~v ,vc ~vc ~v~ ~v v ~vs v~ ~v eV~ V

v ~ ~ V ~ C~ . ~ ~ C~ ~ v v ~ C~

~ ~ ~ vv '' V 8 ~ , ~, g C~ ~ ~ ~ ~ ~ ,~ ~ ~5 ~
3 ~ ~ ~ ~ ~ ~ ~ 5 V ~ ~ ~ ~ ~ ~ ~ ~ V V ~ ~ ~
~ ~ V ~ V _ ~ ~ ~ V ~ V ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 2~ ~ ~ ~ C
- ~ ~ ~ ~ ~ ~ ~ ~ C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ V ~ ~5 ~ O
~, ~5 ~ ~ ~ V ~ 5 ~ ~ ~ ~ ~ ~ ~ ~ _ ~ V
o SUBSTITUTE SHEET (RULE 26) W O 97tlO328 84 PCT~US96/~1689 ~ ~ ~ ~ ~D CD ~D CD co tD ~D CD tD OE~ CD tD CD CD tO ~D CD
a~ ~
a~

~-' '3 ~ ~ ~3 ~'~
~ 3~3 ~ ~ ~ ~ ~ O _ ~ ~ ~ O ~ ~ ~ -'~ ~ ~ ~ ~ ~ ~ ~ ~ ~ O ~ ~ ~ ~ ~- 5 ~ :
~3 ~ ~ ~ - ~ ~ C ~5 ~t3 3 ~ '~ 3 ~ , ~ 3 ~, ' . o N ~t ~ O N ~ ~D ~ O N ~ U:~ ~D O ~ P CO O N
~, z ~ ~ ~ ~ tD ~D ~D tD ~D CD CD ~ ~D ~D ~ ~ ~ ~ ~ ~ ~
U~

~ , , , , , , , , , , , , , , , , ~ , , , 8~

O ~ ~ ~ ~ ~ ~ ~ ~3 t~t~t~ ~t~t~ 5t~t~t~t~t~ ~t~t~ ~t~ Vt~t~t~
t~t~t~t~t~t~t~t~t~t~t~(3 ~t~t~t~t~t~t~t~ ~
~ ~ ~t~t~ ~ ~ ~ ~ ~ v ~ ~t~ ~3 ct~ 3 t~ ~t~ ~t~ ~ ~ ~ 't~ ~(3 ~ ~ ~ v ~ ~t~
~t~t~ ~ ~t~ ~t~ ~ ~ 5t~ ~t~
~t~t3 ~ ~ ~t~ ~ ~ ? v tO ~ el C~ J t~ ~ tO ~ t~ J ~) '1, C
D t~ V t~ V ~:C

8 ~ ~. ~. ~. ~ ~t $ ~ D ~ ~ 0 0 0 o o o _ ~
C~ -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- N N N N N
SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 TableVI
8~ ~, Table Vl: Delta-9 Desdlu~dse HH RiLG~"...e Target Sequences nt. S~bal~ Seq. ID nt. Substrate Seq. ID
P~siLion No.Posilion No.

169 AACGACGUCC;C5CUCU5 686 419 AGAAGUGUU GGCAGCCA 687 175 GUCGCt--CUC UGCCUCUC 688 434 CACAGGAUU UCCUCCCG 689 229 GGCAGGUUC GUCGCCI-~U 698 462 UGAAGGAUU UCAUGAUG 699 232 AGGUUCGUC GCCI;UCl;C 700 463 GAAGGAUUU CAUGAUGA 701 SUBSTITUTE SHEET (RULE 26) WO 97/10328 PCTrUS96/11689 TableVI
. 86 nt. Substrate Seq. ID nt. Substrate Seq. ID
Posilion No.Posilion No.

680AUGGUGAUC UGCUCAAC754 966GAAGCUGUU UGAGAUCG 755 "

788AGAAUAAUC CUUAUCUU792 1110Ut:GCGUUIJ~ CACCGCCA 793 816C~CCUCCUU CCAAGAGC814 1216GACUACCUU UGCACCCU 815 835GCGACCUUCAUCUCACA 820 1~9CCCUUGCUU CAAGAAUC 821 1292CGCU~CCUU UCAGCUGG 826 1494 UUUGAUGUACAACCUGU 827 1395CUCCAGGUU UUGAUCAA 860 1603 AGAUCUGUU AAAAAA~ 861 1396UCCAGGUUU UGAUCAAA 862 1604 GAUCUGUUA AAA~AAA 863 SUBSTITUTE SHEET (RULE 26) WO 97/10328 PCTrUS96/11689 TableVI 87 nt. Substrate Seq. ID
Fosition No.

SUBSTITUTE SHEET (RULE 26) CA 02226728 l998-0l-l3 .

WO 97/10328 PCTtUS96/1~689 Tablc Vll Table Vll: Delta-9 Dtsalu...se HH Ribozvme Sc.~. ~r--nt. Ribozvmese~ Se~. ID No.
Position 92 CCC;CCGCA CUGAUGA X GAA ACCCUGCU 905 160 AÇS3U5GUU GUS~ ;A~rJAAA!:3~Cr-r-4-- ;.14 181 GGCGGGI:A CUGAUGA X GAA AGGCAGAG 917 183 GC~;GCGC;G CUGAUGA X GAA AGAGGCAG 918 ~8 CGGCGACG CUGAUGA X GAA ACCUGCCG 920 ~g ACGGCGAC CUGAUGA X GAA AACCUGCC 921 SUBSTITUTE SHEET (RULE 26) _ W O 97tlO328 PCT~US96/11689 TableVII

nt. Ribozyme s~l. ~ e Seq. ID No.
Position Sll~S 111 I.ITE SHEET (RULE 26) W O97/10328 PCTrUS96/11689 TableVII

nt. Ribo~ meseq-:r-e Seq.lD No.
Position 817CGCUCUUG CUGAUGA X GAA AAGGAGGU 10~

83~iUGUGAGAU CUGAUGA X GAA AAGGUCGC1024 907CA~GC~'AU CUGAUGA X GAA AUGCCGCA1035 1083CGACCAUG CUGAUGA X GAA AGAAGUGC1054 "

SUBSTITUTE SHEET (RULE 26) .

WO 97/10328 PCI~/US96tll689 TableVII

nt. Ribozvmeseqn~ ~e Seq.ID No.
Position 1387AACCUG~A CUGAUGA X GAA ACCUAUGU 1091 SUBSTITUTE SHEET (RULE 26) TableVII
9, nt. Ribozvmeseqa- -e Seq.ID~io.
Position ~ere''X''~ c.l~stemllregionofaHHribv~...c(Herteletal., 1992 Nucleic Acids Res. 20 3252). The length of stem 11 may be 2 2 base-pairs.

SUBSTITUTE SHEET (RULE 26) WO 97/10328 93 PCT~US96/11689 -- ---- = = = = = = = = = = = = = =
C~ ~ C C~ V
~ ~ C C, ~ 3 'C ~ ~" v ~ ~
c~c~ C~ '3 U 3 ~ ~ ~ ~ ~ ~ ~ '~ ~ ~ ~ V
~ ~ ~ ~ ~ ~ ~ ~ 3 V ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~3 3 ~ c V r~ V~ ~ S 8 3 ~ ~ cj 3 3 ~c ~ ~ ~ ~ 3 ~ ~ 3 ~ C ~ ~3'3 ~ ~ ~ ~ ~ ~ C
2 tJ ~ 3 '~ ~ 8 'S CC> 0 0 N ~t CD 0 0 ~1 ~r CD 0 0 r.~ D 0 0 C~l ~ CD 0 0 C.~l ~ tD
o ~ er ~ 1~ 1~ 1' 0 0 0 0 0 rJ~ rJ~ rJ~ a~
.

~ ~ ~ t t v ~ v t t t o ~ ~ tv ~ t v v ~ o t ~ ~- V ~ ~ t~ ~ y t~ V, ~ t~ t,~ O y ~ V ~0 ~ ~ ~

o ~ ~ ~ O o o V ~ v ~O 3 c~ ~ ~ u ~ ~ u r ) ~S C) r~ ~S C ~ r~ er ~ r) ~ ~ ~S C~ C~ S C~
r~ ~ O ~ ~ ~ ~ C~ ~ ~r5 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ _ ~ ~
c~ ~ ~c~ ~ ~ ~ ~ rJ ~ ~ ~ ~ ~rJ ~ ~ ~ rJ
~ ~ r~ o ~ r~ c~ c~ ) ~ C ~ ~ ~) ~ r~ J C) r~ ~ ~ ~ ~ ~ r~ ~ ~ ~ ~ ~5 ~ O~
8 8 ~ 8 ~ ' ' 3 ~

o c --~r 1~ o r~~~J ~ tD D a0) CD oO o ~D o ~ 0 a~ ~ o ~~~ ~n ~ 0 _ rD C~ ~D
l N N C~l N C~l N ~ D CD CD ~D N tr~ --SUBSTITUTE SHEET (RULE 26) WO 97/10328 9~ PCTAUS96/11689 o D o o o o o ~ tJ~ C~) ~ ~ tD
~ Z -- ~ ~1 ~J ~ ~ ~ t~ N ~ ~ 'J t~
C~ --------------_ _ _ ~S y ~ ~ 5 3 ~ 3 3 ~ ~ 3 ~) 3 ~ ~:
3 3 ~ . 3 ~ ~ g ~ ?
~ J _ ~ ~ ~ '~ 3 ~, o cn 8 o o oD ~o O N ~r D ~ O N ~ tD ~D
~ Z -- N N N N N N N N N N N N N N N

~ ~ ~ ~ ~ ~ Q ~ ~ ~ , iy c~ ~ c~ o- o o y o' ~OOoO~O~OO~
~tJ ~ - ~ X
3 8 3 ~ 8 ~
~) ~ C~ C~ C~ C~ ~ C~ ~ C~ 3 ~ C~
c~c~c~c~c~c~c~c~c~c~c~c~c~c~

C~ ~ 5 Cl ~ ~ ~ C
C~) ~ C~C C~ ~ V

-~a ,~ ~ t.~ t.~ -- ~ ~ N r-- U~ tD 1~ tD ~ ~ et U~
o D 5~ ~ ~ ~ -- -- C~l t.~ C~ t~ ~ C~ ~ ~ It~

SUBSTITUTESHEET(RULE26) CA 02226728 l998-0l-l3 W O 97/10328 PCT~US96/11689 TableLK

Table IX: Cleavage of D elta-9 Desaturase RNA by HH ~ibozymes Percent Cleaved 20~C 26~C
nt. P~* -~ 10 min 120 min 10 min 120 min 183 6.3 7.0 10.45 11.8 252 25.2 51.2 33.1 52.9 259 20.3 41.3 24.8 44.0 271 17.2 52.4 21.5 56.3 278 9.9 25.7 13.3 33.6 307 10.3 24.2 9.2 32.4 313 16.9 43.0 23.8 53.4 320 10.6 23.6 15.0 31.3 326 5.7 14.6 8.0 17.1 338 10.0 17.5 10.4 12.9 353 10.2 11.3 10.7 14.7 390 8.6 8.9 7.8 9.8 419 6.3 10.1 5.8 10.9 453 7.3 29.0 8.0 33.8 484 7.8 28.9 6.9 29.2 545 4.8 8.5 3.6 8.9 773 4.5 11.5 4.4 8.9 1024 11.9 17.1 13.3 23.8 1026 11.6 12.6 13.1 17.2 1237 23.1 32.4 13.8 28.6 SUBSTITUTE SHEET (RULE 26) -WO 97/10328 PCTtUS96tll689 TABLE X:
ConstruaTargets Blasted Isolates RecoveredGreo~~o -se Lines Plants ~r. :' ~c~
Number Totals 1621 334 66 854 SUBSTITUTE SHEET (RULE 26) Table XI Stearic acid levels in leaves from plants transformed with active and inactive ribo~vmes compared to control leaves.
-Stearic Acid in Leaves Transformed with Active and Inactive Ribozvmes (Pcrc~..lage of total plants with certain levels of leaf stearic acid) Stearic AcidRibozyme Actives RibozymeControls Inactives (428 plants (406 plants(122 plants) from 35 lines) from 31 lines) >3% 7% 3% 2%
> 5% 2% 0 0 10% 0 0 0 SUBSTITUTE SHEET (RULE 263 -Table XII Inheritance of the high stearic acid trait in leaves from crosses of high stearic acid plants.

Inheritance of high stearate in leaves.
CrossRl Plants with RI Plantswith % of Plants with Normal High High Stearate Leaf StearateLeaf Stearate RPA85-15.06 x 6 3 33%
RPA85-15.12 RPA85-15.07 self 5 5 50%
RPA85-15.10 self 8 2 20%
OQ414 x RPA85-15.06 5 3 38%
OQ414 x RPA85-15.11 6 4 40%

SUBSTITUTE SHEET (RULE 26) Table XIII Comparison of fatty acid composition of embryogenic callus, somatic embrvos and zygotic embrvos.
Tissue and/or Media Fatty Acid Composition % Lipid Treatment of Fresh C16:0 C18:0 C18:1 C18:2C18:3Weight embryogenic callus 19.4 1.1 6.2 55.7 8.8 0.4 +/ +/ +/ +/_ 0.9 0.1 2.0 3.1 2.0 0.1 somatic embryo grown12.6 1.6 18.2 60.7 1.9 4.0 on MS + 6~ sucrose + 10 +/- +/- +/- +/- +/- +/-mM ABA 0.7 0.8 4.9 5.1 0.3 1.1 zygotic embryo 14.5 1.1 18.5 60.2 1.4 3.9 12 days a~ter +/- +/- +/- +/- +/- +/_ pollination 0.4 0.1 1.0 1.5 0.2 0.6 SUBSTITUTE SHEET (RULE 26) W O 97/10328 PCTrUS96/11689 Table XIV: GBSS activity, amylose content, and Southern analysis results of selcLIed Ribozyme Lim LineGBSS activity AmyloseContent Southern (Units/mg starch) (~/0) RPA63.0283321.5 _ 31.2 23.3 + 0.5 RPA63.0236314.6 _ 9.2 27.4 + 0.3 RPA63.0219299.8 _ 10.4 21.5 + 0.3 RPA63.0314440.4 _ 17.1 19.1 + 0.8 RPA63.0316346.5 _ 8.5 17.9 +0.5 RPA63.0311301.5 _ 17.4 19.5 + 0.4 RPA63.0309264.7 _ 19 21.7 _ 0.1 +
RPA63.0218190.8 _ 7.8 21.0 _ 0.3 +
RPA63.0209203 _ 2.4 22.6 + 0.6 +
RPA63.0306368.2 _ 7.5 19.0 + 0.4 RPA63.0210195.1 _ 7 22.1 + 0.2 +

SUBSTITUTE SHEET (RULE 26)

Claims (95)

Claims

1. An enzymatic nucleic acid molecule with RNA cleaving activity, wherein said nucleic acid molecule modulates the expression of a plant gene.

2. The enzymatic nucleic acid molecule of claim 1, wherein said plant is a monocotyledon.

3 . The enzymatic nucleic acid molecule of claim 1, wherein said plant is a dicotyledon.

4. The enzymatic nucleic acid molecule of claim 1, wherein said plant is a gymnosperm.

5. The enzymatic nucleic acid molecule of claim 1, wherein said plant is an angiosperm.

6. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid is in a hammerhead configuration.

7. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid is in a hairpin configuration.

8. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid is in a hepatitis .DELTA. virus, group I intron, group II intron, VS nucleic acid or RNaseP
nucleic acid configuration.

9. The enzymatic nucleic acid of any of claims 1-8, wherein said nucleic acid comprises between 12 and 100 bases complementary to RNA of said gene.

10. The enzymatic nucleic acid of any of claims 1-8, wherein said nucleic acid comprises between 14 and 24 bases complementary to RNA of said gene.

11. The enzymatic nucleic acid of claim 6, wherein said hammerhead comprises a stem II region of length greater than on equal to two base-pairs.

12 The enzymatic nucleic acid of claim 7, wherein said hairpin comprises a stem II
region of length between three and seven base-pairs.

13. The enzymatic nucleic acid of claim 7. wherein said hairpin comprises a stem IV
region of length greater than or equal to two base-pairs.

14. The enzymatic nucleic acid of claim 2, wherein said monocotyledon plant is selected from a group consisting of maize, rice, wheat, and barley.

15. The enzymatic nucleic acid of claim 3, wherein said dicotyledon plants is selected from a group consisting of canola, sunflower, safflower, soybean, cotton, peanut, olive, sesame, cuphea, flax, jojoba, and grape.

16. The enzymatic nucleic acid of claim 1, wherein said gene is involved in fatty acid biosynthesis in said plant.

17. The enzymatic nucleic acid of claim 16, wherein said gene is .DELTA.-9 desaturase.

18. The enzymatic nucleic acid of any of claims 16 or 17, wherein said plant is selected from a group consisting of maize, canola, flax, sunflower, cotton, peanuts, safflower, soybean and rice.

19. The enzymatic nucleic acid of claim 1, wherein said gene is involved in starch biosynthesis in said plant.

20. The enzymatic nucleic acid of claim 19, wherein said gene is granule bound starch synthase.

21. The enzymatic nucleic acid of any of claims 19 or 20, wherein said plant is selected from a group consisting of maize, potato, wheat, and cassava.

22. The enzymatic nucleic acid of claim 1, wherein said gene is involved in caffeine synthesis.

23. The enzymatic nucleic acid of claim 22, wherein said gene is selected from a group consisting of 7-methylguanosine and 3-methyl transferase.

24. The enzymatic nucleic acid of any of claims 22 or 23, wherein said plant is a coffee plant.

25. The enzymatic nucleic acid of claim 1, wherein said gene is involved in nicotine production in said plant.

26. The enzymatic nucleic acid of claim 25, wherein said gene is selected from a group consisting of N-methylputrescine oxidase and putrescine N-methyl transferase.

27. The enzymatic nucleic acid of any of claims 25 or 26, wherein said plant is a tobacco plant.

28. The enzymatic nucleic acid of claim 1, wherein said gene is involved in fruit ripening process in said plant.

29. The enzymatic nucleic acid of claim 28, wherein said gene is selected from agroup consisting of ethylene-forming enzyme, pectin methyltransferase, pectin esterase, polygalacturonase, 1-aminocyclopropane carboxylic acid (ACC) synthase, and ACC oxidase.

30. The enzymatic nucleic acid of any of claims 28 or 29, wherein said plant is selected from a group consisting of apple, tomato, pear, plum and peach.

31. The enzymatic nucleic acid of claim 1, wherein said gene is involved in flower pigmentation in said plant.

32. The enzymatic nucleic acid of claim 31, wherein said gene is selected from a group consisting of chalcone synthase, chalcone flavanone isomerase, phenylalanine ammonia lyase, dehydroflavonol hydroxylases, and dehydroflavonol reductase.

33. The enzymatic nucleic acid of any of claims 31 or 32, wherein said plant is selected from a group consisting of rose, petunia, chrysanthamum, and marigold.

34. The enzymatic nucleic acid of claim 1, wherein said gene is involved in lignin production in said plant.

35. The enzymatic nucleic acid of claim 34, wherein said gene is selected from a group consisting of O-methytransferase, cinnamoyl-CoA:NADPH reductase and cinnamoyl alcohol dehydrogenase.

36. The enzymatic nucleic acid of any of claims 34 or 35, wherein said plant is selected from a group consisting of tobacco, aspen, poplar, and pine.

37. A nucleic acid fragment comprising a cDNA sequence coding for maize .DELTA.-9 desaturase, wherein said sequence is represented by the sequence I.D. No. 1.

38. The enzymatic nucleic acid molecule of claim 17, wherein said nucleic acid specifically cleaves any of sequences defined in Table VI, wherein said nucleic acid is in a hammerhead configuration.

39. The enzymatic nucleic acid molecule of claim 17, wherein said nucleic acid specifically cleaves any of sequences defined in Table VIII, wherein said nucleic acid is in a hairpin configuration.

40. The enzymatic nucleic acid molecule of any of claims 38 or 39, consisting essentially of one or more sequences selected from the group shown in Tables VII and VIII.

41. The enzymatic nucleic acid molecule of claim 20, wherein said nucleic acid specifically cleaves any of sequences defined in Table IIIA, wherein said nucleic acid is in a hammerhead configuration.

42. The enzymatic nucleic acid molecule of claim 20, wherein said nucleic acid specifically cleaves any of sequences defined in Tables VA and VB, wherein said nucleic acid is in a hairpin configuration.

43. The enzymatic nucleic acid molecule of any of claims 41 or 42, consisting essentially of one or more sequences selected from the group shown in Tables IIIB, IV, VA and VB.

44. The enzymatic nucleic acid molecule of claim 41, consisting essentially of sequences defined as any of SEQ. I.D. NOS. 2-24.

45. A plant cell comprising the enzymatic nucleic acid molecule of any of claims 1-8, 11-17, 19-20, 22-23, 25-26, 28-29, 31-32, 34-35, 37-39, 41-42 or 44.

46. A transgenic plant and the progeny thereof, comprising the enzymatic nucleicacid molecule of any of claims 1-8, 11-17, 19-20, 22-23, 25-26, 28-29, 31-32, 34-35, 37-39, 41-42 or 44.

47. An expression vector comprising nucleic acid encoding the enzymatic nucleic acid molecule of any of claims 1-8, 11-17, 19-20, 22-23, 25-26, 28-29, 31-32, 34-35, 37-39, 41-42 or 44, in a manner which allows expression and/or delivery of that enzymatic nucleic acid molecule within a plant cell.

48. An expression vector comprising nucleic acid encoding a plurality of enzymatic nucleic acid molecules of any of claims 1-8, 11-17, 19-20, 22-23, 25-26, 28-29, 31-32, 34-35, 37-39, 41-42 or 44, in a manner which allows expression and/or delivery of said enzymatic nucleic acid molecules within a plant cell.

49. A plant cell comprising the expression vector of claim 47.

50. A plant cell comprising the expression vector of claim 48.

51. A transgenic plant and the progeny thereof, comprising the expression vector of claim 47.

52. A transgenic plant and the progeny thereof, comprising the expression vector of claim 48.

53. A plant cell comprising the enzymatic nucleic acid of any of claims 16 or 17.

54. The plant cell of claim 53, wherein said cell is a maize cell.

55. The plant cell of claim 53, wherein said cell is a canola cell.

56. A transgenic plant and the progeny thereof, comprising the enzymatic nucleic acid of any of claims 16 or 17.

57. The transgenic plant and the progeny thereof of claim 56, wherein said plant is a maize plant.

58. The transgenic plant and the progeny thereof of claim 56, wherein said plant is a canola plant.

59. A plant cell comprising the enzymatic nucleic acid of any of claims 19 or 20.

60. The plant cell of claim 59, wherein said cell is a maize cell

61. A transgenic plant and the progeny thereof, comprising the enzymatic nucleic acid of any of claims 19 or 20.

62. The transgenic plant and progeny thereof of claim 61, wherein said plant is a maize plant.

63. A method for modulating expression of an gene in a plant by administering to said plant the enzymatic nucleic acid molecule of any of claims 1-8.

64. The method of claim 63, wherein said plant is a monocot plant.

65. The method of claim 63, wherein said plant is a dicot plant.

66. The method of claim 63, wherein said plant is a gymnosperm.

67. The method of claim 63, wherein said plant is an angiosperm.

68. The method of claim 63, wherein said gene is .DELTA.-9 desaturase.

69. The method of claim 68, wherein said plant is a maize plant.

70. The method of claim 68, wherein said plant is a canola plant.

71. The method of claim 63, wherein said gene is granule bound starch synthase.

72. The method of claim 71, wherein said plant is a maize plant.

73. The expression vector of claim 47, wherein said vector comprises;
a) a transcription initiation region;
b) a transcription termination region;
c) a gene encoding at least one said enzymatic nucleic acid molecule; and, wherein said gene is operably linked to said initiation region and said termination region, in a manner which allows expression and/or delivery of said enzymatic molecule within said plant cell.

74. The expression vector of claim 47, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;

c) an open reading frame;
d) a gene encoding at least one said enzymatic nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame; and, wherein said gene is operably linked to said initiation region, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said enzymatic molecule within said plant cell.

75. The expression vector of claim 47, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;
c) an intron;
d) a gene encoding at least one said enzymatic nucleic acid molecule; and, wherein said gene is operably linked to said initiation region, said intron and said termination region, in a manner which allows expression and/or delivery of said enzymatic molecule within said plant cell.

76. The expression vector of claim 47, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;
c) an intron;
d) an open reading frame;
e) a gene encoding at least one said enzymatic nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame; and, wherein said gene is operably linked to said initiation region, said intron, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said enzymatic molecule within said plant cell.

77. The enzymatic nucleic acid of Claim 1, wherein said plant is selected from the group consisting of maize, rice, soybeans, canola, alfalfa, cotton, wheat, barley, sunflower, flax and peanuts.

78. A transgenic plant comprising nucleic acids encoding for an enzymatic nucleic acid molecule with RNA cleaving activity, wherein said nucleic acid molecule modulates the expression of a gene in said plant.

79. The transgenic plant of Claim 78, wherein said Plant is selected from the group consisting of maize, rice, soybeans, canola, alfalfa, cotton, wheat, barley, sunflower, flax and peanuts.

80. The transgenic plant of Claim 78, wherein said gene is granule bound starch synthase (GBSS).

81. The transgenic plant of Claim 78, wherein said gene is delta 9 desaturase.

82. The transgenic plant of Claim 78, wherein the plant is transformed with Agrobactenurn, bombarding with DNA coated microprojectiles, whiskers, or electroporation.

83. The transgenic plant of Claim 82, wherein said bombarding with DNA coated microprojectiles is done with the gene gun.

84. The transgenic plant of any of Claims 78 or 82, wherein said plant contains a selectable marker selected from the group consisting of chlorosulfuron, hygromycin, bar gene, bromoxynil, and kanamycin and the like.

85. The transgenic plant of any of Claims 78 or 82, wherein said nucleic acid isoperably linked to a promoter selected from the group consisting of octopine synthetase, the nopaline synthase, the manopine synthetase, cauliflower mosaic virus (35S); ribulose-1, 6-biphosphate (RUBP) carboxylase small subunit (ssu), the beta-conglycinin, the phaseolin promoter, napin, gamma zein, globulin, the ADH promoter, heat-shock, actin, and ubiquitin.

86. The transgenic plant of Claim 78, said enzymatic nucleic acid molecule is in a hammerhead, hairpin, hepatitis A virus, group I intron, group II intron, VS
nucleic acid or RNaseP nucleic acid configuration

87. The transgenic plant of Claim 86, wherein said enzymatic nucleic acid with RNA
cleaving activity encoded as a monomer.

88. The transgenic plant of Claim 86, wherein said enzymatic nucleic acid with RNA
cleaving activity encoded as a multimer.

89. The transgenic plant of Claim 78, wherein the nucleic acids encoding for said enzymatic nucleic acid molecule with RNA cleaving activity is operably linked to the 3' end of an open reading frame.

90. The transgenic plant of Claim 78, wherein said gene is an endogenous gene.

91. A transgenic maize plant comprising in the 5' to 3' direction of transcription:
a promoter functional in said plant;
a double strand DNA (dsDNA) sequence encoding for a delta 9 gene of SEQ ID. No. 1, wherein transcribed strand of said dsDNA is complementary to RNA endogenous to said plant; and a termination region functional in said plant.

92. A transgenic maize plant comprising in the 5' to 3' direction of transcription, a promoter functional in said plant;
a double strand DNA (dsDNA) sequence encoding for a granule bound starch synthase (GBSS) gene of SEQ ID NO. 25, wherein transcribed strand of said dsDNA is complementary to RNA endogenous to said plant; and a termination region functional in said plant.

93. The enzymatic nucleic acid molecule of claim 1, wherein said gene is an endogenous gene.

94. The method of modulating expression of a gene of claim 63, wherein siad gene is an endogenous gene.

95. The vector of Figure 42, wherein said vector is employed for transformation of a plant cell.