NZ235789A

NZ235789A - Rna having endonuclease and antisense activity, genes encoding it and use

Info

Publication number: NZ235789A
Application number: NZ235789A
Authority: NZ
Inventors: Hubert Mullner; Rudolf Schneider; Eugen Uhlmann; Bernadus Uijtewaal; Peter Eckes
Original assignee: Hoechst Ag
Priority date: 1989-10-25
Filing date: 1990-10-23
Publication date: 1992-07-28
Also published as: DE59009334D1; KR910008136A; DK0428881T3; JPH044877A; EP0428881A1; IE903825A1; AU6499590A; HUT58794A; DE3935473A1; IE67653B1; ES2076275T3; ATE124450T1; EP0428881B1; HU906538D0; AU627944B2

Abstract

Host cells can be transformed so that they express ribozyme RNA and antisense RNA, which are linked together in the loop of the ribozyme. The RNA molecules can, for example, be complementary to a particular viral RNA. Plants transformed with genes coding for such RNA display significantly improved defences against viruses.

Description

<div class="application article clearfix" id="description"> New Zealand Paient Spedficaiion for Paient Number £35789 23578c •'riorny I { Class: * ' Pubiicstian TjU: i :!A --'St c> ■ ■-. ,: : I 2 S j 'OT *932 N.Z. No. NEW ZEALAND Patents Act 1953 COMPLETE SPECIFICATION RNA HAVING ENDONUCLEASE AND ANTISENSE ACTIVITY. THE PREPARATION THEREOF AND THE USE THEREOF We, HOECHST AKTIENGESELLSHAFT, a Corporation organized under the laws of the Federal Republic of Germany, of D-6230 Frankfurt am Main 80, Federal Republic of Germany, do hereby declare the invention, for which we pray that a patent may be granted to us. and the method by which it is to be performed, to be particularly described in and by the following statement:- - 1 - (Followed by 1A) 235 7 3 HOECHST AKTIENGESELLSCHAFT HOE 89/F 348 Dr. IQI/gm Bescription - 1A - RNA having endonuclease and antisense activity, the preparation thereof and the use thereof RNA molecules can, under suitable conditions, catalyze reactions on other RNA molecules or autocatalytically cleave fragments from their own molecules without the participation of proteins. Thus an intron having 413 5 nucleotides is autocatalyically deleted from the 3' end of the 23S rRNA of Tetrahymena thermophila and converted into circular form. This takes place by a number of phosphoester-transfer reactions with the participation of guanosine cofactors (Cech, T.R., Nature .30, 578-583 10 (1983)). Depending on the RNA substrate or the reaction conditions chosen, the intron can function as specific ribonuclease, terminal transferase, phosphotransferase or acid phosphatase. In this connection an RNA molecule can carry out several reactions without being changed itself 15 and, in this respect, behave like an enzyme. For this reason the term ribozyme has been coined for RNA molecules having these properties. It has also been possible to show similar reactions without the participation of proteins for some viroid 20 RNAs and satellite RNAs. Thus self-processing seems to be a reaction essential for the multiplication for avocado sunblotch viroid (ASBV) (Hutchins, C.J. et al. Nucleic Acids Res. 14, 3627-3640 (1986)), satellite RNA of tobacco ringspot virus (sTobRV) (Prody, G.A. et al., 25 Science 231. 1577-1580 (1986)) and satellite RNA of lucerne transient streak virus (sLTSV) (Forster A.C. et al., Cell 49., 211-220 (1987)). During the replication of these RNAs, circular forms which, as templates, lead to the synthesis of RNAs with extensions are presumably 30 formed. These transcripts are cut to the right genomic length by the autocatalytic endonucleolytic reactions. 23 5 7 - 2 - The structures of the RNAs which the latter presumably assume for the reaction have been described as "hammerheads" (Forster A.C. et al., Cell 49., 211-220 (1987); Haseloff, J. et al., Nature 334, 585-591 (1988)). 5 The cleavage sites for these RNA enzymes are specific and have to have certain structural characteristics so that processing can take place. It has now been found that host cells of any desired organism can be transformed using vectors which contain 10 DNA coding for ribozymes coupled to antisense RNA, so that the said RNA is expressed. It is known that antisense RNA inhibits gene expression in a number of prokaryotic and eukaryotic cells, inter alia also in plant cells (Green, P., et al., Ann. Res. 15 Biochem. 55, 569 (1986)). The mechanism of inhibition is still largely unclear. It is presumed that double-stranded RNA which interferes with the transport of the mRNA to the cytoplasm is formed in eukaryotic systems. Rezaian, M. et al., Plant Mol. Biol. .11, 463 (1988) 20 investigated, for example, the possibility of using anti- sense RNA as antiviral agent against cucumber mosaic virus (CMV). However, the authors observed that the antiviral activity of the antisense RNA was unsatisfactory. 25 However, the coupling of the appropriate ribozyme RNA in the loop (see below for diagram) with an appropriate antisense RNA now results in a more effective resistance to viruses than Rezaian was able to show. Such a coupling of the RNA molecules thus effects an increased activity, 30 which is directed against a substrate, in transformed organisms not only in relation to the activity as antiviral agent in plants but also in general. The invention thus relates to: 1. A gene coding for a ribozyme RNA sequence which is coupled in the loop of the ribozyme to an antisense RNA sequence. 2. Host cells which contain the gene defined under 1. 3. The use of the RNA encoded by the gene defined under 1. as an agent r which is directed against a substrate RNA, in host cells. The invention will be described in detail below, in particular in its preferred embodiments. The invention is furthermore defined by the contents of the claims. The ribozyme/antisense RNA can be directed against substrates such as, for example, RNA coding for selectable marker genes (resistance to antibiotics) or RNA coding for any desired cell functions, such as, for example, dihydrofolate reductase, thymidine kinase, the ripening enzymes polygalacturonase, pectin esterase etc., proteins responsible for differentiation and development, or hormone receptors. In particular types of viruses which are harmful to plants can be combated advantageously by the system according to the invention. For this purpose the procedure described below is used, for example. A ribozyme/antisense RNA which is directed against other substrates can also be constructed in an analogous way. The ribozyme moiety can be synthesized on the basis of the RNA sequence of the substrate to be inhibited. In the case of a virus as substrate, this RNA sequence is either the genome of RNA viruses or an RNA sequence which has been derived from the DNA sequence of a DNA virus. Any virus harmful to plants can therefore be.used as basis. Preferred types of viruses are pathogenic viruses, in particular cucumber mosaic virus, brome mosaic viru^r-^=> alfalfa mosaic virus, tobacco mosaic virus, potato^ferus - 'N/ ■*2 1 MA'.' 8 23 5 7 8i X or Y, tomato ringspot virus, tomato aspermy virus or tobacco rattle virus. In particular the RNA sequences RNA1, RNA2 and/or RNA3 of cucumber mosaic virus are used as template, corresponding to the sequence from the 5 publications by Rezaian, M. et al. Eur. J. Biochem. 150, 331 (1985), Eur. J. Biochem. 143> 277 (1989) and Gould, J. et al., Eur. J. Biochem. 126. 217, (1982) or in each case parts therefrom. At least 10 consecutive nucleotides, in particular 14 to 20 nucleotides, advant-10 ageously selected from the middle of the RNA sequence of the appropriate virus, are preferred for the synthesis. The ribozyme-encoding oligonucleotides are synthesized in such a way that the initial and terminal sequences which, in each case, consist of at least 5 nucleotides, advan-15 tageously 7 to 10 nucleotides, are complementary to the RNA of the virus to be inhibited. The intermediate sequence consists in part of specific nucleotides which are predetermined for the functioning of the ribozyme, and in part of variable nucleotides. 20 Corresponding procedures are used for the preparation of the antisense RNA but the oligonucleotides are synthesized in such a way that they code for an RNA in the appropriate antisense orientation. The ribozyme oligonucleotide is provided with an appro-25 priate linker in the loop. Linkers of this kind have, for example, cleavage sites of EcoRI, Sail, BamHI, Hindlll, EcoRV, Smal, Xhol, Kpnl, preferably Xbal or Pstl. The synthesized ribozyme oligonucleotide is then coupled via these linkers to the oligonucleotide coding for the 30 antisense RNA in the ribozyme loop. The ribozyme/antisense RNA system hybridized with substrate RNA may be represented diagrammatically as follows: - 5 - 23 5 7 8 5-NNNNNNNNNNNNNGUC NNNNNNNNNNNNNN-3 substrate RNA 3-KKKKKKKKCA KKKKKKKK-5 A A C A UG G A A CG G yy V ) ribozyme VY where N are nucleotides of the substrate RNA, A, C, G or T, K are nucleotides complementary to N in the ribozyme, V are variable nucleotides in the ribozyme and 5 VL are variable nucleotides in the loop of the ribozyme. The number of VL nucleotides can be 0-550. VL nucleotides are chosen such that a cleavage site into which the sequences can be inserted is produced at the DNA level. 10 The assembled oligonucleotides are cloned with the aid of the vectors pUC19, pUC18 or pBluescript (Stratagene, Heidelberg, Product Information) and sequenced. The confirmed oligonucleotide is cloned into an intermediary vector having a plant promoter. Vectors of this 15 type are, for example, the plasmids pPCV701 (Velten J. et al., EMBO J. 3, 2723-2730 (1984)), pNCN (Fromm H. et al. PNAS 82, 5824-5826 (1985)) or pNOS (An, G. et al., EMBO J. 4, 277-276 (1985)). The vector pDH51 (Pietrzak, M. et al., NAR lA, 5857, (1986)) which has a 35S promoter is 20 preferably used. After subsequent transformation of E. coli, such as, for example, E. coli MC 1061, DH1, DK1, GM48 or XL-1, positive clones are identified by methods known per se (Maniatis et al., Lab. Manual), such as plasmid mini-25 preparations and cleavage with an appropriate restriction enzyme. - 6 - 23 5 7 These positive clones are then subcloned into a binary plant vector. As plant vectors, pGV3850 (Zambrysk, P. et al., EMBO J. 2, 2143-2150 (1983)) or pOCA18 (Olszewski, N., NAR 16, 10765-10782, (1988)) can be employed. Advan-5 tageously pOCAl8 is used. The resulting binary plant vectors which contain a plant promoter with the attached DNA fragment for the ribozyme production in the T-DNA are used to transform plants. This can be carried out by techniques such as electro-10 poration or microinjection. The cocultivation of protoplasts or the transformation of leaf pieces using agrobacteria is preferably employed. For this purpose the plant vector construct is transferred by transformation with purified DNA or, mediated 15 by a helper strain such as E. coli SM10 (Simon R. et al., Biotechnology 1, 784-791 (1983)), into Agrobakterium tumefaciens, such as A282, having a Ti plasmid via a triparental mating. Direct transformation and triparental mating were carried out as described in "Plant Molecular 20 Biology Manual" (Kluwer Academic Publishers, Dordrecht ( 1988)). In principle, all plants can be transformed by the binary plant vectors carrying the DNA constructed according to the invention. Dicotyledonous plants, in particular 25 useful plants, which produce or store starch, other carbohydrates, proteins or fats in usable amounts in their organs or which produce fruit and vegetables or supply spices, fibers and technically usable products or medicaments, dyes or waxes, and also fodder plants. 30 Examples which may be mentioned are tomato, strawberry, avocado, and plants which carry tropical fruit, for example papaya, mango, but also pear, apple, nectarine, apricot or peach. Furthermore, examples which may be listed as plants to be transformed, are all types of 35 cereal, rape, turnip rape, potatoes, soybean, cotton, corn, sugarbeet or sunflowers. The transformed cells are - 7 - 23 5 7 selected for with the aid of a selection medium, are cultured to a callus and regenerated to the plant on an appropriate medium (Shain et al., Theor. appl. Genet. 72, 770-770 (1986); Masson, J. et al., Plant Science 53., 167-5 176 (1987), Zhan et al.. Plant Mol. Biol. JL1, 551-559 (1988); McGranaham et al., Bio/Technology 6, 800-804 (1988) Novrate et al., Bio/Technology 2/ 154-159 (1989). The resulting plant is changed by the transformation in such a way that, with the aid of the constructed oligo-10 nucleotides, the corresponding RNA is expressed in the cells, it being possible that ribozyme RNA together with "antisense" RNA becomes active against virus RNA. The examples which follow are intended to illustrate the invention further. 15 Examples Percentages relate to the weight if not stated otherwise. 1. Synthesis of the DNA for the expression of RNA The synthesis of the nucleotide for the ribozyme was carried out on the basis of the CMV RNA1 sequence, 20 position 3248 to 3264, (Rezaian M. et al., Eur. J. Biochem 150, 331-339 (1985)) provided with an Xbal linker on the 5' end and a PstI linker on the 3' end. The constant regions are evident from the attached diagram for the ribozyme: 25 DNA for the expression of a ribozyme with an Sail site in the variable part of the loop: 5'-CTAGAGGTAGCTCCTGATGAGTCGTCGACGACGAAACAACCTTCTGCA-3' TCCATCGAGGACTACTCAGCAGCTGCTGCTTTGTTGGAAG or: - 8 - 235789 5' - CTAGATTTCAAGGGTAGCTCCTGATGAGTCGTC 3' TAAAGTTCCCATGGAGGACTACTCAGGAG GACGACGAAACAACCTTGTAGGATGTCTGCA-3' CTGCTGCTTTGTTGGAACATCCTACAG - 5' The synthesis of the nucleotide for the antisense RNA was carried out on the basis of the CMV RNA4 sequence (Gould 5 I. et al., Eur. J. Biochem. 126, 217-26 (1982)) from position 2179 to 2193 with an Xbal linker on the 5' end and with a PstI linker on the 3' end, which were filled in order to create a Sail site for cloning. DNA for the production of an antisense RNA: 10 5'_CTAGATGGTCTCCTTATGGAGAACCTGTGGAAAACCACAGCTGCA- 3 ' TACCAGAGGAATACCTCTTGGACACCTTTTGGTGTCG or: 5'-TCGACATGGTCTCCTTATGGAGAACCTGTGGAAAACCACAGCG- 3 ' fiG C7 GTACC AGAGGAATACCTCTTGGACACCTTTTGGTGTCGCAGCT- 5' 2. Cloning in pBluescript SK+ and sequencing The plasmid pBluescript SK+ (Stratagene, Product Informa-15 tion) was cut open with the particular enzymes and, after treatment with calf intestinal phosphatase (CIP), was ligated with a five-fold excess of the double-stranded, phosphorylated oligonucleotides. After induction with isopropylgalactoside (IPTG) it was possible to identify 20 positive clones in the strain XL Blue (Stratagene) as white colonies on plates containing 5-bromo-4-chloro-3-indolyl ^s-D-galactoside (X-gal). 5 of the colonies were isolated in each case and sequenced by the dideoxy method (Boehringer, Sequencing 25 kit), in order to determine the orientation of the inserted oligonucleotide. - 9 - ? 3 5 7 8 9 3. Cloning in pDH51 5 The plasmid pDH51 is reproducibly described in the publication Pietrzak, M. et al., NAR 14, 5857-5868, 1986. The plasmid pBluescript SK+ containing the oligonucleotide was digested with Xbal and PstI in order to be able to isolate the oligonucleotide DNA after the fragment 10 fractionation in a 1% low melting agarose gel. The isolated oligonucleotide was incorporated into the Xba/Pst site of pDH51 in a five-fold excess. It was possible to detect positive clones, after the transformation of E. coli MC 1061 cells and transfer of the :5 colonies onto nitrocellulose filters, by hybridization with 32P-labeled oligonucleotide DNA and subsequent washing of the filters in SSC (1. 1 x SSC; 2. 0.1 x SSC? 3. 0.1 x SSC for 30 min each time) at 65°C. J A DNA sequence for the synthesis of the antisense oligo-20 nucleotide DNA was via the newly created Sail cleavage site cloned into a vector generated in this way. * \ V - 10 - r ^ After the transformation of 2. coli MC 1061 cells, the colonies were streaked onto nitrocellulose filters and hybridized overnight with 32?-labeled oligonucleotide DNA which was isolated from an appropriate pBluescript SX-r. The filters were washed as mentioned above. Positive clones were identified by autoradiography. 4. Cloning in pOCA18 The plasmid pCCAi8 is reproducibly described in publication Olszewski, N. et al., NAR 16, 10765-10782, 1988. The about 1.0 kb long EcoRI fragment from pDHSl with the oligonucleotide after the 35S promoter was isolated on a CsCl gradient, and the 0.8 kb fragment resulting from EcoRI digestion was incorporated into the EcoRI cleavage site of pOCAl8. The positive clones were identified by means of a DNA preparation and a subsequent EcoRI step. 07C7 r - 11 - 5- Transformation of agxobacteria The vector pOCAlS containing the 35S prcmoter/oligo-nucleotide insert was transferred into the agrobacterial strain A282 (Pharmacia, Freiburg, FR Germany or ATCC 37349 USA) - This was carried out by a triparental mating with the aid of the E. coli strain SMIO (Simon, R. et al., Bio/Technology 1/ 784-791, 1983). For this purpose equal amounts of the bacteria were placed together on a filter overnight, incubated at 28 °C, and the filters were rinsed with 2 ml of 10 mH MgSO,, and aliguots thereof were placed on yeast extract containing tetracycline and rifampicin (TEE: 1% yeast extract, 1% peptone, 0.5% NaCl) in order to select for positive clones. The subsequent hybridization of the colonies, which had been transferred onto nitrocellulose membranes, with radiolabeled oligonucleotide DNA again demonstrated the presence of positive clones. ■ s ' r Transformed agrobacteria were streaked onto filters, incubated at 28"C overnight ana hybridized with radiolabeled oligonucleotide DNA. 6- Transformation of tobacco The agrcbacteria were grown in YBB medium containing tetracycline and rifampicin. 20 ml of the bacteria were spun down, washed once in YEB medium and, suspended in 20 ml of 10 mM MgSO,., placed in a Petri dish. The plant material used was Nicotiana tabacum Wisconsin 38. The plants had been cultivated for 4 weeks under sterile conditions on 2MS medium (Murashige, T. et al., Physiol. Plant 15, 473-497 (1962)) at 25°C with 16 h of light per day. A 1 cm2 leaf piece was cut off these plants, damaged with sterile emery paper and immersed in the overnight ?3 - 13 - bacterial culture for 30 sec. The leaf pieces were, as described above for 2 MS, maintained on MS medium for 2 days at 258 C and then washed with liquid 2MS medium. Then these leaf pieces were placed on MSC 10 plates (MS medium containing 1.5% agar) containing kanamycin. After 5-o weeks, it was possible to replant regenerated plants into larger vessels where they formed roots after 2-3 weeks. The expression of the desired RNA in the transgenic plants was detected by transferring the total RNA (10 nq) , which had been fractionated in a gel (1% agarose gel containing 2.2 M formaldehyde), onto nitrocellulose filters ana subsequent hybridization with radioactive oligonucleotide DNA. - 14 - 71 7. Detection of the transformation DNA was isolated from about 8-week old transformed tobacco plants by standard methods (Maniatis et al-, Lab. Journal) and cut with EcoRI, ana 10 of DNA were transferred onto nitrocellulose membranes in each case and hybridized with 2^?-labeled oligonucleotide DNA. The incorporation of the desired sequence in the DNA of the transgenic plant was detectable by hybridization with the characteristic EcoRI DNA. .— - 15 - 23 5 7 8. Detection of the expression of the RNA RNA was isolated from a second leaf sample from the abovementioned tobacco plants, transferred onto nitrocellulose from a formaldehyde gel and hybridized as 5 above. It was possible to detect bands which showed the expected sizes. 9. Detection of the in vitro activity of the multifunctional RNA RNA was produced from the pBluescript SK+ clones contain-10 ing the inserted entire oligo by addition of T3 or T7 polymerase in a reaction mixture (Stratagene, Product Information for SK+) and then isolated. Hybridization of this RNA with 32P-labeled CMV RNA showed a cleavage of the virus RNA. 15 10. Infection with CMV strain Q About 8-week old tobacco plants were infected, with the aid of carborundum, with the CMV strain Q (Rezaian, M. et al., Eur. J. Biochem. 150, 331 (1985); 143, 277 (1984); Gould, J. et al., Eur. J. Biochem. 126. 217 (1982)). 20 Control plants showed distinct symptoms after 12-15 days. It was possible to detect virus particles in these plants. The transgenic plants proved to be resistant to the virus to varying degrees. </div>

Claims

<div class="application article clearfix printTableText" id="claims"> ° t C -K ^ . - / 0 A - ^ ^ y O y - 16 - Table: Percentage of infected plants with distinct symptoms after the time stated in each case (10 plants of a clone were infected together and evaluated, in each case) 12 d 20 d Wild type W38 80 80 Transgenic plants 40 50 60 60 40 60 30 50 60 60 30 40 30 30 20 10 50 50 235789 WHAT ME CLAIM IS: A gene coding for a ribozyme RNA sequence which is coupled in the loop of the ribozyme to an antisense RNA sequence. The gene as claimed in claim 1, with the encoded RNA being complementary to a virus RNA. An RNA encoded by a gene as claimed in claim 1 or 2. A host cell containing a gene as claimed in one of claims 1 or 2. A host cell containing an RNA as claimed in claim 3. Plants, plant cells and parts or seeds of the plants, containing the gene as claimed in claim 1 or 2. Plants, plant cells and parts or seeds of the plants, containing the RNA as claimed in claim 3. An agent directed against substrate RNA in host cells, comprising the RNA encoded by the gene as claimed in claim l. An antiviral agent comprising the RNA encoded by the gene as claimed in claim 2. A gene coding according to claim 1 substantially as herein described or exemplified. An RNA according to claim 3 substantially as herein described or exemplified. A host cell according to claim 5 substantially as herein described or exemplified. * t": r. A. ' S M - 18 - 0 7 E 7 Q w' ^ 13. a plant, plant cell ana part or seed of a plant according to claim 6 or 7 substantially as herein described or exeniDiified- HOECHST AXTIENGESELLSCHAFT By Their Attorneys HENRY HUGHES LIMITED </div>