Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6424—Serine endopeptidases (3.4.21)
  • C12N9/6464—Protein C (3.4.21.69)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
  • C12Y304/21—Serine endopeptidases (3.4.21)
  • C12Y304/21069—Protein C activated (3.4.21.69)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
  • C12N2710/00011—Details
  • C12N2710/20011—Papillomaviridae
  • C12N2710/20041—Use of virus, viral particle or viral elements as a vector
  • C12N2710/20043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• This invention relates to Protein C and the use of recombinant DNA techniques to produce Protein C.
• the coagulation cascade is a series of reactions, involving a number of plasma proteins, which occur in response to an injury.
• One of these plasma proteins, Protein C helps ensure that the two important mechanisms in the blood system, clot formation and clot lysis, are properly balanced so that the body neither bleeds for undue periods nor clots in places other than the specific site of the injury.
• Protein C in its activated form, inactivates two cofactors in the blood clotting pathway, factors Va and Villa. Protein C has considerable amino acid sequence homology to other vitamin K-dependent coagulation factors, including prothrombin and factors VII, IX, and X (Foster et al . , 1985 Proc. Nat! . Acad. Sci . 82:4673). Protein C, factor VII, factor IX, factor X, and Prothrombin, are also similar in that each is modified post-translationally by having the glutamic acid residues in the gamma-carboxyglutamic acid domain of the protein gamma-carboxylated by specific enzymes, normally present in the liver. These proteins are inactive without such modification. For example, regarding the transforming of mouse fibroblast Ltk-cells with the gene encoding human factor IX (Anson et al . (1985) Nature 311:683), the authors state:
• the gene encoding human Protein C has been isolated, cloned, and sequenced (Foster et al . , 1984 Proc. Nat. Acad. Sci . 81:4766; Foster et al., 1985 Proc. Nat. Acad. Sci. 82:4673; Beckmann et al . , 1985 Nac. Acad. Res. 13:5233).
• the active protein has been expressed in a human hepatoma (HEPG-2) cell line (Little et al . , 1985 Xth Intl. Congress on Thrombosis and Hae ostasis, Abstract 0989), and a Chinese hamster ovary (CHO) cell line (Little et al .
• transient expression levels were reported to be approximately 1.2 ⁇ g/2x!0 5 cells/24h, with 43% of the protein being active.
• the invention features a method of producing recombinant human Protein C by providing a vector comprising a DNA sequence encoding human Protein C under the transcriptional control of a eukaryotic (preferably mammalian) metallothionein promoter, the vector further comprising at least the 69% transforming region of the bovine papillo a virus, transfecting host eukaryotic cells with the vector, adhering the transfected cells to carrier particles, culturing the carrier particle-bound cells in culture medium to produce recombinant Protein C, and isolating the recombinant Protein C from the culture medium or the cells.
• a eukaryotic preferably mammalian
• metallothionein promoter the vector further comprising at least the 69% transforming region of the bovine papillo a virus
• transfecting host eukaryotic cells with the vector adhering the transfected cells to carrier particles, culturing the carrier particle-bound cells in culture medium to produce recombinant Protein
• the above aspect of the invention is based on our discovery that the expression system employed, in combination with microcarrier culturing, produces Protein C of substantially greater biological activity than that produced by the same expression system in tissue culture. Coupled with this are improved methods for activating the zymogen Protein C to the activated form of Protein C.
• Preferred mammalian cells are rodent, e.g., rat or mouse cells, e.g., mouse C127 cells, mouse myeloma cells, and rat hepatoma cells.
• C127 cells are particularly advantageous in that they are easily transfected and cultured, and can maintain Protein
• Preferred vectors of the invention contain DNA (genomic or cDNA) and at least the 69% transforming region, and more preferably all, of the bovine papilloma virus "BPV") genome (described in Howley et al . , U.S. Patent No. 4,419,446, hereby incorporated by reference).
• BBV bovine papilloma virus
• the Protein C made by the recombinant cells in one embodiment of the invention differs from the naturally occurring molecule in that it has an arginine residue at position -4, a modification which has shown some improvement in processing and increase expression in mammalian cells.
• Another preferred embodiment of the present invention coupled this modification with the substitution of glutamine for arginine at -5 position.
• recombinant Protein C refers to inactive Protein C precursors as well as activated forms of the enzyme. Protein C is synthesized intracellularly in a single chain form and is subsequently cleaved in vivo at four sites. The first cleavage, between a glycine and a threonine residue, results in the removal of the signal peptide necessary for transport into intracellular compartments. The second cleavage, between an arginine and alanine residue, results in the removal of the "pro-peptide" piece necessary for protein recognition by the gamma-carboxylase system.
• Fig. 3 is drawn to indicate the presence of amino acids 156 and 157.
• the invention provides biologically active, gamma-carboxylated Protein C useful in medical applications, as will be described in greater detail below.
• the recombinant Protein C of the invention is greater than 95%, more preferably greater than 98%, by weight, pure.
• Figure 1 is a diagrammatic representation of two human Protein C cDNA clones
• Figure 2 is the 5' terminal sequence of one of said the clones
• FIG. 3 is a diagram illustrating the processing of recombinant Protein C
• Figures 4 and 5 are diagrammatic representations of the construction of the intermediate vector ProC-5 and BPV expression vectors; and Figure 6 is a graphical representation of the relationship between Protein C concentration and clotting time; and
• Figure 7 compares snake venom with thrombin-Sepharose bead activation.
• a cDNA sequence encoding a portion of human Protein C was first isolated from a clone which hybridized to an oligonucleotide prepared to a portion of mature Protein C. A fragment derived from this clone was then used as a second probe to identify a clone containing a cDNA sequence encoding the complete protein.
• the complete cDNA was modified by i_n vitro mutagenesis to remove an unspl ced intron at the 5' end.
• pA123 is the plasmid which was processed for insertion into an expression vector for expression of Protein C in mammalian cells.
• Plasmid pA123 contains the entire Protein C coding region (the .thickened line, Fig. 1) and also contains an N-terminal intron (which was removed as will be described below).
• pA46 a plasmid containing a cDNA which supplied a 350 base pair (bp) probe which was used, as will be described below, to obtain pA123.
• the sequence between the translational start point (ATG(-42)) and the first amino acid residue (Ala(D) of the mature protein represents the "pre-pro" sequence.
• a second processing cleavage then occurs, by an unknown mechanism, between residues -1 and 1 resulting in a single chain Protein C that starts with the Ala of the mature light chain. Further processing results in Protein C being cleaved so as to produce a non-naturally occurring active species, designated "new" Protein C.
• Fig. 1 Two polyadenylation and processing sites are shown in Fig. 1 at the 3' end as Poly(A). There is a unique StuI site near the 5' end of the gene (shown in Fig. 2) upstream from a second ATG start site. This second start site may represent the start of a 38 amino acid polypeptide, and is encoded by a portion of an unspliced intron in the cDNA for the Protein C gene.
• pA46 is a plasmid clone, derived from a human liver cDNA library, using an oligonucleotide probe made to amino acids 64-77 of the Protein C sequence. Since the 5' end of the Protein C gene was lacking in pA46, its 5' 350 base pair Pst-I fragment was used to reprobe the cDNA library to obtain the complete cDNA clone pA123.
• Derivatives of pA123 were constructed, as described below, to facilitate the insertion of the cDNA for Protein C (ProC) into expression vectors, e.g., ProC-5 (Fig. 6), similar to a precursor ProC-3 (Fig. 4) except that the sequence near the ATG start codon of the cDNA has been modified to provide an Xhol site, and the DNA upstream from the modified sequence has been deleted, removing the intron of the cDNA clone.
• ProC Protein C
• a cDNA library may be constructed by any conventional method, such as for example as described by Michelson et al . (1983, Proc. Nat. Acad. Sci. 80:472).
• the method used herein involved homogenizing human liver in the presence of guanidine hydrochloride, and then isolating poly(A) + RNA by two passages through oligo(dT)- cellulose.
• cDNA was then synthesized from the liver mRNA in the presence of placenta! RNase inhibitor (RNasin, Biotec, Madison, WI).
• cDNA greater than 400 nucleotides long was isolated by alkaline sucrose gradient centrifugation and second-strand synthesis carried out in the presence of the Klenow fragment of Escherichia coli DNA polymerase I (Boehringer Mannheim).
• the resulting double-stranded cDNA was treated with SI nuclease (Sigma) and a size fraction of duplex DNA greater than 400 base pairs (bp) in length obtained by sedimentation through a neutral surcrose gradient.
• Homopolymer tracts of dC were added to the 3' ends of this cDNA and the dC-tailed cDNA then hybridized to Ps ⁇ I cleaved and dG-tailed plasmid vector pKT218 (Talmadge et al . , 1980, Gene 12: 235), and tetracycline-res stant colonies selected after transformation of E. coli strain MCI061 (Michelson et al . , 1983, Proc. Natl . Acad. Sci. USA 80: 472). Approximately 120,000 independent recombinant clones were obtained from the original plates, pooled, and stored at -70°C as glycerol stock without further amplification.
• oligonucleotide probe was made complementary to the sequence encoding amino acids 64-77 of Protein C using a Standard solid-phase phosphotriester method.
• the probe had the sequence: 5' TGAAGCTGCCGATGCCGTCGATGCACGTGCACGTGCCCTTG 3'.
• pA123 was digested with Stui/Ayal; the Stui site is unique in the Protein C cDNA sequence and is located 164 bp upstream of the ATG in the 5' untranslated sequence.
• the Aval site is located in the coding region of the cDNA, about 250 bp upstream from the TAG termination codon (Fig. 1). This Stul/Aval fragment was purified by electroelution from an agarose gel slice.
• pA123 was also digested with PstI and the 880 bp fragment isolated.
• This 800 bp fragment contains the P_stl site within the coding region, 516 bp downstream from the ATG start codon, and the PstI site 10 bp downstream of the TAG termination codon in the 3' untranslated region.
• the Pstl-PstI fragment was cloned into the PstI site of the plasmid vector pUC 9.
• the random clones of the chimeric pUC9 were isolated and tested for the orientation of the insert. In one isolated clone, ProC-1 , the 5' PstI site of the PstI fragment was located near the EcoRI site in the plasmid vector.
• This clone was digested with Smal and then Aval, mixed with the Stul-Aval fragment, and ligated. The blunt Aval ends ligated together, as did the blunt Stul-Smal ends.
• the resulting chimeric plasmid, ProC-2 contains the reconstituted coding sequence for Protein C bounded by unique EcoRI and Hindlll restriction enzyme sites.
• the Protein C coding region in ProC-2 was excised with Hindlll/EcoRI restriction enzymes and cloned into the M13 vector, mpl ⁇ . This clone is referred to as mProC-2. Digestion of this plasmid with HindiII/EcoRI, filling in the ends with E.
• the strategy for constructing ProC-5 is diagrammed in Figs. 4 and 5.
• the 5' end of the Protein C cDNA was altered utilizing a synthetic oligonucleotide (oligo B) (this is underscored in the sequence shown in Figure.2).
• oligo B synthetic oligonucleotide
• the sequence of this ol gonucleotide contains two base pair mismatches to the native Protein C cDNA sequence (noted by asterisks) which provide an Xhol restriction enzyme s te immediately 5' of the initiator methionine of the Protein C cDNA.
• This site in conjunction with a Xhol site constructed at the 3' end of the cDNA clone, ProC-3, provided the entire Protein C coding region on a single Xhol fragment suitable for cloning into BPV expression vectors.
• the EcoRI-Hindlll insert fragment of ProC-2 was first subcloned into the M13 phage vector rnpl ⁇ (the resulting clone is termed mProC-2 to distinguish it from the pUC9 ProC-2 clone; see Fig. 4).
• the single-stranded form of mProC-2 was then isolated and the base pairs changed by site directed mutagenesis using Oligo B, as described below.
• the mutation was identified by hybridization analysis and a clone (termed m5'XhoProc-2) isolated in bulk quantities.
• the second strand of the phage DNA was synthesized by adding 50 ⁇ l of 30mM Tris.pH 7.5, lOmM MgCl 2 , 2mM beta-mercapto ethanol, lO ⁇ l of lOmM ATP, 3 ⁇ l of E . coli polymerase (klenow fragment) 5 ⁇ l of T4 DNA Ligase (2 u/ ⁇ l), 2 ⁇ l of [alpha- 32 P]dATP, and l ⁇ l each of lOOmM dATP, dGTP, dCTP, dTTP. After incubation for 15 minutes at room temperature the mixture was left at 16°C overnight.
• 70 ⁇ l of the above extension reaction was mixed with 70 ⁇ l of 0.3M NaCl, 50mM ZnCl 2 , lOOmM Tris, pH 7.5, 7 ⁇ l SI nuclease (0.5 u/ ⁇ l), and 553 ⁇ l of double distilled water, incubated at 37°C for one minute, and then at 65°C for ten minutes. 35 ml of this SI treated extension was then transformed into 300 ml of competent OM101 (£. coli cells). As a control, 2 ml of the extension reaction, untreated by SI, was also transformed into JM101.
• the m5'XhoProC-2 construct was ligated to the constructed 3'-Xho end of ProC-3 by splicing the two fragments together at a unique Nael site.
• the resulting pUC9 plasmid, ProC-4 was isolated and characterized.
• a routine part of the analysis of new vectors normally performed is to determine whether all restriction enzyme sites used in constructions are properly regenerated. In this case, the Nael site used in the construction of ProC-4 was not regenerated.
• a Bqlll-Hindlll fragment of ProC-4 was replaced by the same fragment from ProC-3, as shown in Fig. 5a.
• the Nael site is contained on the fragment from ProC-3.
• the final clone, ProC-5 was checked by both restriction map analysis and DNA sequencing to confirm its integrity. Construction of ProC-GIn-Arq
• oligo C The strategy used to construct ProC-Gln-Arg is diagrammed in Fig. 5c.
• the propeptide end of Protein C cDNA was altered using a synthetic oligonucleotide (oligo C) based on the original DNA sequence.
• the sequence of oligo C is 3'GG GTG GTT GAC GTC GCG GCG TTT GCA CGG 5'. This sequence contains 3 base pair mismatches to native Protein C cDNA, the sequence of which is shown in Fig. 2 and numbered 341-372.
• This sequence codes for two amino acid changes in Protein C, one from isoleucine to arginine at position -4, and the other from arginine to glutamine at position -5.
• the 1.4kb EcoRI-Hindlll fragment of ProC-5 was isolated and ligated to EcoRI-Hindlll treated mpl ⁇ , to produce mProC-5.
• the single stranded form of mProC-5 was solated and the base pairs changed by site directed mutagenesis using oligo C and the method described above for the construction of ProC-5, i.e. treatment with Klenow and T4 DNA ligase.
• the mutation was identified by hybridization analysis and a clone (termed ProC-GIn-Arg) isolated in bulk quantities.
• the modified cDNAs can be inserted into any suitable mammalian expression vector.
• Preferred expression vectors are the BPV vectors described in Wei et al . U.S.S.N. 782,686, filed October 1, 1985, assigned to the same assignee, and hereby incorporated by reference; and Hsuing et al . 1984, J. Molec and App. Genet. 2 : 497.
• the vectors include a mouse metallothionein promoter from which inserted genes can be transcribed, and bovine papilloma virus DNA to effect transfection of mammalian cells. CLH3axBPV (Fig.
• the illustrated expression plasmids also include a portion of the E. coli plasmid pML, which permits shuttling between procaryotic and eukaryotic systems. No selection is required for the maintenance of these plasmids in host cells, and they are maintained in high (on the order of 100 copies/cell) copy number.
• the Xhol-linkered Protein C sequence in ProC-5 was isolated by digestion with Xhol and excision of the insert band from an agarose gel. This fragment was them cloned into the Xhol site of each of the two BPV vectors, as shown in Fig. 5b. These vectors were then transformed into E. coli strain HB101 and grown in bulk culture. The DNA was purified by CsCl banding before transfection into mammalian cells. The 5' to 3' orientation of the Protein C insert within the expression vectors was checked by six sets of restriction enzyme digestions. The final vector constructs are shown in Fig. 4b.
• PC is an abbreviation for Protein C
• a refers to Protein C cDNA which has had the 5'-intron removed as described herein while “b” represents the unspliced intron.
• An additional letter, prefacing these vector designations, indicates the cell line into which the DNA's were transfected (i.e., "C” for C127).
• the Xhol fragment of ProC-GIn-Arg may also be inserted into these expression vectors, using similar techniques.
• Mouse C127 epithelial cells (commercially available) were maintained in Dulbecco's modified Eagle's medium (DME) supplemented with 10% fetal calf serum (containing small amounts of vitamin K, approximately 1 ⁇ g/ml ) , penicillin/streptomycin, and 10 mM glutamine as described in Hsuing et al . , id- These cells have epoxide reductase activity and thus are able to recycle and efficiently use vitamin K for ⁇ -carboxylation of the Protein C produced.
• DME Dulbecco's modified Eagle's medium
• fetal calf serum containing small amounts of vitamin K, approximately 1 ⁇ g/ml
• penicillin/streptomycin penicillin/streptomycin
• 10 mM glutamine as described in Hsuing et al .
• the rate hepatoma cell line FAO-1 HPRT-,OUA r
• Faza 967 Korean et al .
• C127 cells were transfected with PCMb in three separate transfections of 10, 15 and 20 ⁇ g, using salmon sperm DNA as carrier by the method described in Wilger et al . 1977, Cell 11:223, as modified by Hsuing et al . , id.
• the day following transfection the cells were split into culture plates, some of which contained glass coverslips. On days three and four after transfection, the coverslips were removed and stained with Protein C antibodies. Two sets of controls were performed. The first control was a culture of C127 cells transfected with a non-Protein C vector, split onto coverslips.
• the second control was Protein C transfected cells which, unlike test cells (below), were not permeabi ⁇ zed with NP-40 after formaldehyde fixation.
• the control cells gave minimal or no i munofluorescence.
• permeabilized Protein C transfected cultures gave clearly visible staining, which probably results from transient expression of the Protein C vector (the day 4 cells stained less intensely than the day 3 cells).
• transfected cell foci were screened with the filter lift assay. Numerous positive foci were identified by this technique. Control cells treated similarly were negative fay this assay. Seventy-nine foci, positive by the filter assay, were picked and transferred to T-25 flasks and cultured in medium containing 10 ⁇ g/ml vitamin K. Of these clones, 72 were screened by ELISA analysis of the culture supernatants. The best 31 clones were then passed to T-75 flasks. Twenty-four hour cell counts and production levels were measured on one set of flasks, while duplicate T-75 flasks were maintained and the production levels assayed every 48 hours.
• the T-75 flasks contained approximately 4 X 10 cells in 10 mis of culture media. These cells were assayed for a period of 10 days. Table 1, below, shows the four best producing cells lines, expressed as grams of Protein C antigen secreted per cell per 24 hours. Table 2, below, gives the production of 6 cell lines based on nanograms Protein C antigen per milliliter of culture fluid. As shown, two cell lines, PCM-4e and PCM-6b, produced levels consistently greater than l ⁇ g/ml/24 hours (1 mg per liter of culture medium per day).
• PCM-4e 1.62 x 10 ⁇ 12
• PCM-4b 9.40 x 10 "12
• a typical purification regime is as follows. Twenty-three liters of serum-free culture medium containing recombinant Protein C is made 0.01% with respect to Tween 80. This media is then clarified to remove particles and debris by filtration through a Sartorius Sartobran 0.5 ⁇ M Filtration Cartridge. After filtration, the pH of the media is adjusted to 5.0 by the addition of 1.0M HC1. The media is then applied to a 100 ml (bed volume) by 5.0 cm diameter Q-Sepharose Fast Flow (Pharmacia) column previously equilibrated with buffer containing: 50mM sodium acetate (NaOAc), pH 6.0/50mM NaCl/0.01% Tween 80.
• the flow rate through the column is not critical but is routinely 20 ml/minute.
• the column is washed with 8-10 bed volumes of buffer containing: 50 mM sodium acetate (NaOAc), pH 7.0/50mM NaCl/0.01%
• Tween 80 A step elution buffer of 500mM NaCl 0.01% Tween 50mM NaOAc pH 7.0 is applied to the column and 20 ml fractions collected. The peak Protein C fractions are identified by assaying the column fractions with a commercial Protein C ELISA kit (Diagnostica Stago). Peak fractions are pooled. Recovery of recombinant Protein C from this column are generally 95-100%.
• the pooled fraction from the Q-Sepharose column is diluted 1:1 with buffer containing 10 mM Tris, pH8.0/10mM CaCl 2 /0.01% Tween 80. This material is applied to an lmmunoaffinity column previously equilibrated with buffer containing: 50mM Tris, pH 7.5/150mM NaCl/5mM CaCl 2 /0.05% Tween 80.
• the immunoaffinity column is prepared by binding a human Protein C specific monoclonal antibody to CNBr activated Sepharose 4B (Pharmacia) by standard protocol at a ratio of 5mg antibody per mi Hi liter of bead.
• the monoclonal antibody is calcium-dependent, i.e., it binds Protein C only in the presence of calcium ion, the antibody is made by conventional methods.
• the column diameter is 5cm and the bed volume is determined at a ratio of 1 mi Hi liter of bed volume per milligram of Protein C in the pooled Q-Sepharose fraction.
• the column is washed with 8-10 bed volumes of buffer containing 50mM Tris, pH 7.5/150mM NaCl/5mM CaCl 2 /0.01% Tween 80.
• the column is then washed with 8-10 bed volumes of buffer containing 50mM Tris, pH 7.5/2.0M NaCl/2mM CaClp/0.01% Tween 80.
• the recombinant Protein C is eluted from the column with buffer containing lOOmM Glycine/0.01% Tween 80 pH 4.0. Column eluate is collected in fractions and neutralized by the addition of one-tenth volume of buffer containing: 1.0M Tris, pH 8.0/0.01% Tween 80. Recovery of recombinant Protein C from this column is typically 80%.
• the resultant purified Protein C may be further purified by applying the following procedure.
• the recombinant Protein C from the immunoaffinity column is diluted 1:1 with buffer containing: lOOmM NaOAc, pH 6.0/30mM
• the resulting recombinant Protein C is 99% pure or greater as judged by the following protocol: 2.0-2.5 ⁇ grams of the purified Protein C is applied to an 8x10x0.08 cm reduced SDS polyacrylamide gel and electrophoresed by standard Laemmli technique. The gel is then stained by standard Coomassie-blue technology. The washed gel is then scanned by laser densitometry and recombinant Protein C and contaminant bands quantified.
• the recombinant material contains major proteins that comigrate with the natural light chain and two heavy chain bands of Protein C. In addition to these bands, there is a higher molecular weight band that potentially corresponds to single-chain Protein C. The amount of material in this band corresponds more closely to the level of Protein C being expressed in the culture medium than to the volume of culture medium passed over the antibody column. A densito eter tracing of a sim lar gel indicated that approximately 70% of the staining material is in this high molecular weight band.
• the purified recombinant Protein C is measured for biological activity by a coagulation assay. This assay was chosen because of its depedence on the gamma-carboxyglutamic acid residues of Protein C. Protein C clot assay protocol is provided in detail later. The standard used is ideally highly purified human Protein C available from Dr. Johan Stenflo (University of Lund, Maimo, Sweden).
• Figure 6 shows a typical standard curve and Table 3 give the average clotting times of the standards and the recombinant Protein C samples.
• Sample #3 was measured both in the presence and absence of Protac C. Without Protac C, the clotting time was indistinguishable from buffer alone, indicating that the sample was activatable by a Protein C activator and that no activated Protein C was present in the preparation.
• #3 and #4 were approximately 50% biologically active, whereas #5 was approximately 75% biologically active. The reason for the difference in biological activity of these fractions is not known.
• Protein C was produced from CPM-4e cells grown on microcarriers as fol lows:
• Microcarrier spinners (Bellco Glass Co.) were washed, air dried, siliconized (Sig acote, Sigma Chemical Co.), and dried. The spinners were then extensively rinsed with glass-distilled water.
• Cytodex 3 (Pharmacia) inert polymeric microcarrier beads were added to each spinner and the spinners were then filled to one-half of final working volume with phosphate buffered saline (PBS).
• PBS phosphate buffered saline
• the beads were allowed to swell at room temperature for three hours, after which they were rinsed twice with PBS by decanting and the spinner volume returned to one-half of final working volume.
• the spinners were then loosely capped, prepared for autoclaving, and steam sterilized at 121°C for one to two hours. After cooling to room temperature, the PBS was withdrawn to 20% of final working volume and DME medium added to final volume. The resulting culture was stirred for five minutes at 37°C, and the beads then allowed to settle, after which 80% of the supernatant was replaced with fresh DME medium containing 10% fetal bovine serum.
• Recombinant Protein C of the invention can be used in the treatment of patients with congenital and acquired Protein C deficiencies.
• Congenital Protein C deficiency for which there is currently no effective treatment, afflicts one of 16,000 persons, with 75% experiencing recurrent thrombolytic problems starting at age 25 to 35.
• Protein C deficiency occurs in persons with vitamin K deficiency, liver disease, disseminated intravascular coagulation (a condition wherein blood clots form all over the body), and may also occur during post-operative periods. Hip surgery patients, numbering 167,000 per year in the United States, often have reduced
• Protein C levels for approximately five days following surgery. During this post-operative stage, these patients are at high risk for deep vein thrombosis, and it is expected that restoring Protein C to normal levels will help minimize this risk.
• Protein C is as an adjunct therapy to fibrinolytic agents, particularly tissue plasminogen activator (TPA).
• TPA tissue plasminogen activator
• Protein C of the invention will be admixed with a pharmaceutically acceptable carrier substance, e.g., saline, and administered orally, intravenously, or by injection into affected tissues.
• a pharmaceutically acceptable carrier substance e.g., saline
• sufficient Protein C is administered to bring blood levels up to at least 1.5 mi11 equivalents/ml (3 milliequivalents/ml is normal).
• this will require administration of about 10-100 mg, most preferably about 60 mg, of Protein C to an average human adult.
• protein C Another potential use of protein C is as an anti-coagulate for blood in vitro.
• a second, similar use is in interoperative "recycled" blood.
• Blood normally lost in abdominal and chest spaces during surgery is suctioned into a machine where it is washed and readministered to the patient.
• This blood is anti-coagulated with sodium citrate and EDTA, and during extended surgery the patient is susceptible to toxic effects.
• Protein C in the activated form instead of sodium citrate and EDTA, to anti-coagulate this blood could prevent such toxic effects in the patient.
• the vector CL28XhoBPVPR0C was deposited, on July 24, 1986, in E. coli strains with the American Type Culture Collection (ATCC), Rockville, Maryland, and assigned ATCC accession number 67164.
• Protein C produced in C127 host cells transformed with the vector CL28 XhoBPVROC contains the ⁇ -1-3 galactose linkage within the carbohydrate moiety, which linkage is similar to the human blood group B determinant as demonstrated by its reactivity with human immunoglobulin.
• This linkage lends additional biological characteristics to the Protein C molecule such as increased in vivo half-life in primates possibly in turn due to an apparently increased immunological reactivity with ' normally present immunoglobulins.
• CHO cells transformed with a suitable vector incorporating the same Protein C cDNA sequence do not produce Protein C with the ⁇ -1-3 galactose linkage and the accompanying biological advantages.
• Anticlot C Activator (American Diagnostica, Inc.) - This reagent contains PROTAC C, a Protein C activator derived from viper venom, which is co-lyophilized with APTT reagent.
• Protein C deficient plasma (American Diagnostica, Inc.) - lyophilized.
• Bovine serum albumin (Sigma #A-7638).
• a stock solution containing 600 ng/ml Protein C is prepared by diluting 300 ⁇ l of normal human plasma in 1.2 ml imidazole-BSA buffer. - The remaining standards are prepared from the stock solution:
• Standard/samples are assayed (in duplicate) for clotting time by pipetting the following reagents into appropriate wells of the assay tray:
• Each assay tray holds twelve sample wells.
• the concentration of Protein C in the samples is determined from the standards using a curve fitting computer program that calculates the data based on a second order quadratic equation
• the performance of the assay is monitored with a purified Protein C preparation which serves as an internal control and is included in every assay.
• the assay bias is unknown due to the lack of a standard Protein C preparation with a known specific activity.
• Solution A 3.03 grams Tris; 1.7 grams imidazole; 50 ml IN HC1 in 100 mis distilled water.
• Solution B 4.04 grams Tris; 2.27 grams imidazole; 1.95 grams NaCl in 100 mis distilled water.
• Working Buffer 1-0.3: 1/10 dilution in water of 1OX concentrate.
• ThromStop (American Diagnostica). Take up one bottle (l.O ⁇ moles) in one milliliters water, store at 4°C for up to three weeks.
• Spectrozyme PCa (American Diagnostica). Take up one bottle (l.O ⁇ moles) in 2.5 milliliters water. Store refrigerated for up to three weeks or aliquoted and frozen (no more than once) for several months.
• Immobilized thrombin was prepared by coupling purified bovine thrombin (Sigma T7513, 2196 U/mg) to CNBr-activated Sepharose 4B (Pharmacia) according to the manufacturer's directions; ethanolamine was used to block unreacted sites. Quantitative coupling of protein was obtained. Yield of active thrombin averaged 33-40% as determined by the thrombin assay described below. Activity of the coupled beads was in the range of 80-120 U/ml of packed beads.
• Thrombin (Sigma T7513) is diluted to 0.1 U/ml in 50mM Citrate, pH 6.5; 150mM NaCl; 0.01% Tween 80. Bead slurry (1 ml of buffer per 1 ml of packed beads) are generally diluted 1/400. Spectrozyme TH
• Thrombin-Sepharose beads were prepared by coupling 250 units of thrombin (Sigma) per milliliter of wet packed cyanogen bromide activated Sepharose 4B (Pharmacia) as described in the "Handbook of Affinity Chromatography" obtained from the manufacturer (Pharmacia). Thrombin-Sepharose beads were stored in buffer containing 50 M Na citrate (pH 6.5); 150 mM NaCl and 0.01% Tween 80 at a ratio of 1 ml buffer per ml packed wet beads at 4°C (for long storage periods 0.05% sodium azide is added to the-buffer).
• Units of thrombin activity coupled to the beads were determined using a synthetic chro ogenic substrate, Spectrozyme TH (American Diagnostica) as described by the manufacturer of the synthetic substrates. Generally, recovery of thrombin activity on the beads was 30-60%.
• Activation of Protein C zymogen was advantageously performed at Protein C concentrations of between about 10 and 1000 ⁇ g and at thrombin concentrations of between about 1 and 20 units per ml.
• the tube was capped tightly and incubated at 37°C for four hours with continuous agitation. After incubation, thrombin beads were removed by centrifugat on for five minutes in a clinical centrifuge. The activated Protein C supernatant was decanted and assayed for protein concentration by assay in ELISA (Diagnostica Stago) and Bradford protein assay (Bradford, M.; Anal. Biochem 72:248 (1976)) and activity in an amidolytic and clot assay as previously described. The following results were obtained:
• Run 1 Run 2 Run 3 Run 4 Run 5
• the World Health Organization Standard for Protein C 86/622, has, by definition, 0.81IU/ml which, taking an average of 3 ⁇ g Protein C/ml plasma, is equivalent to 273 IU/mg, in all cases significantly less than the recombinant Protein C of the present invention.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Medicinal Chemistry (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (2)

Publications (2)

Family

ID=22208746

Family Applications (1)

Country Status (4)

Families Citing this family (14)

Citations (3)

Family Cites Families (5)

• 1988
  • 1988-06-17 WO PCT/US1988/002083 patent/WO1989012685A1/en not_active Application Discontinuation
  • 1988-06-17 JP JP63506813A patent/JPH03501921A/ja active Pending
  • 1988-06-17 EP EP19880907471 patent/EP0380508A4/en not_active Withdrawn
• 1990
  • 1990-02-16 DK DK041590A patent/DK41590A/da not_active Application Discontinuation

Patent Citations (3)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events