CN114525215B

CN114525215B - Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain

Info

Publication number: CN114525215B
Application number: CN202210424155.2A
Authority: CN
Inventors: 黄和; 郭琪; 李珂; 施天穹
Original assignee: Nanjing Normal University
Current assignee: Nanjing Normal University
Priority date: 2022-04-22
Filing date: 2022-04-22
Publication date: 2022-08-02
Anticipated expiration: 2042-04-22
Also published as: CN114525215A

Abstract

The invention relates to the field of genetic engineering and the field of microbial fermentation, and discloses a recombinant strain for producing terpenoid, a construction method thereof, a method for producing terpenoid by fermentation and application thereof. The recombinant strain is obtained by the genetic engineering modification of an original strain, and compared with the original strain, the activity of alpha-humulene synthase and the flux of a mevalonate pathway and acetyl coenzyme A are respectively enhanced in a plurality of organelles of the recombinant strain, or the activity of squalene synthase and the flux of the mevalonate pathway and acetyl coenzyme A are respectively enhanced; wherein the plurality of organelles of the recombinant strain include cytoplasm and peroxisomes, each of which contains a gene encoding α -humulene synthase or a gene encoding squalene synthase. The recombinant strain provided by the invention can effectively improve the yield of alpha-humulene or squalene, and has the advantages of raw material regeneration, mild conditions, green production, no time and place constraints and the like.

Description

Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain

Technical Field

The invention relates to the fields of genetic engineering and microbial fermentation, in particular to a recombinant strain for producing terpenoid, a construction method thereof, a method for producing terpenoid by fermentation and application thereof.

Background

Terpenoids are the largest class of natural secondary metabolites, comprising 80000 many known molecules, with a high degree of structural diversity and a wide range of applications. Despite this remarkable diversity, all terpenoids are composed of isoprene units (C5). Terpenoids can be generally classified into monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), triterpenes (C30) and carotenoids (C40) according to the number of C5 units, with sesquiterpenes being the most abundant. Alpha-humulene is a kind of molecular formula C ₁₅ H ₂₄ The monocyclic sesquiterpenes of (A) have great application potential due to their anti-inflammatory, anti-allergic and anti-cancer activities.

At present, the alpha-humulene is mainly produced industrially by a chemical synthesis method or a plant extraction method, however, the plant extraction method is mainly limited by factors such as low content and easy limitation of seasons, geographical positions and the like, which leads to higher production cost of processes such as purification and the like, and the chemical synthesis has the defects of complicated steps, low yield, expensive catalyst, environmental pollution and the like, so that the development of the process is limited. Therefore, the heterologous microbial synthesis is receiving more and more attention as an alternative method for producing alpha-humulene, and in recent years, the alpha-humulene has been successfully produced in various hosts in a heterologous way, but the obtained yield is still low, so that the production efficiency is low and the requirement of industrial application is not met.

With the rapid development of metabolic engineering and synthetic biology, microorganisms are developing into an effective platform for green industrial production of high value-added natural compounds. Yarrowia lipolytica is a non-conventional oleaginous yeast considered as safe (GRAS), and more attention has been paid to yarrowia lipolytica because of the recent successful development of various highly efficient synthetic biological tools in yarrowia lipolytica to facilitate genetic manipulation of yarrowia lipolytica. However, researches on terpene synthesis by using yarrowia lipolytica as a host are mainly focused on cytoplasm, which is not favorable for exploring the potential of yarrowia lipolytica for producing terpenes and prevents the yarrowia lipolytica from being applied to industrialization.

Disclosure of Invention

The invention aims to overcome the problems in the prior art and provides a recombinant strain for producing terpenoid, a construction method thereof, a method for producing terpenoid by fermentation and application thereof.

In order to achieve the above objects, the present invention provides, in a first aspect, a recombinant strain for producing a terpenoid, which is α -humulene or squalene, the recombinant strain being obtained by genetic engineering of an original strain, the recombinant strain having enhanced activity of α -humulene synthase and flux of mevalonate pathway and acetyl-coa, respectively, or enhanced activity of squalene synthase and flux of mevalonate pathway and acetyl-coa, respectively, in a plurality of organelles as compared with the original strain; wherein the plurality of organelles of the recombinant strain comprise a cytoplasm and a peroxisome, and the cytoplasm and the peroxisome respectively comprise a nucleotide sequence encoding an amino acid sequence shown in SEQ ID NO: 1 or a gene encoding an amino acid sequence shown in SEQ ID NO: 2, and a gene of squalene synthase.

In a second aspect, the present invention provides a method for constructing a recombinant strain, the method comprising: genetically engineering a starting strain such that the activity of alpha-humulene synthase and the flux of the mevalonate pathway and acetyl-coa, respectively, or the activity of squalene synthase and the flux of the mevalonate pathway and acetyl-coa, respectively, are enhanced in the cytoplasm and peroxisomes of the starting strain; wherein the mode for enhancing the activity of the alpha-humulene synthase is that a coding amino acid sequence shown in SEQ ID NO: 1 in a manner that the squalene synthase activity is exogenously introduced into cytoplasm and peroxisomes of the starting strain into a gene encoding an amino acid sequence shown as SEQ ID NO: 2, and a gene of squalene synthase.

In a third aspect, the present invention provides a method for producing terpenoids by fermentation, wherein the terpenoids are alpha-humulene or squalene, the method comprising: inoculating the recombinant strain into a fermentation culture medium for fermentation; alternatively, a recombinant strain is constructed according to the above-described method, and the resulting recombinant strain is inoculated into a fermentation medium for fermentation.

In a fourth aspect, the invention provides the use of the recombinant strain or the method in preparing terpenoids, wherein the terpenoids are alpha-humulene or squalene.

Through the technical scheme, the recombinant strain provided by the invention can effectively improve the yield of alpha-humulene or squalene, and has the advantages of raw material regeneration, mild conditions, green production, no time and place constraints and the like.

In the most preferred embodiment of the invention, the recombinant strain obtained by taking yarrowia lipolytica as a host strain is added with 50 mu M copper sulfate solution when the fermentation is carried out for 0h, and the content of the alpha-humulene obtained after the fermentation is 96mg/g DCW, so that the fermentation effect and the yield of the alpha-humulene are more remarkably improved.

Biological preservation

Yarrowia lipolytica of the invention (A)Yarrowia lipolytica) GQ3007 was deposited at 14 days 3/2022 in the common microorganism center of the china committee for culture collection (address: beijing, west way No. 1 hospital on chaoyang district, No. 3, institute for microbiology, chinese academy of sciences, zip code: 100101) (CGMCC for preservation), and the preservation number is CGMCC No. 2425.

Drawings

FIG. 1 is a scheme showing the transfer of each coding gene into the starting strain in example 2.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

The terms "increase", "enhancing", "enhancement" or "activation" as used herein generally mean an increase in a statistically significant amount. However, for the avoidance of doubt, the terms "increase", "enhancement" or "activation" mean an increase of at least 10% compared to a reference level (e.g. a level in the starting strain), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or an increase of any amount between 10% and 100% compared to the reference level; or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any amount between 2-fold and 10-fold increase, or a greater amount of increase, as compared to a reference level.

In a first aspect, the present invention provides a recombinant strain for producing terpenoids, said terpenoids being alpha-humulene or squalene, the recombinant strain being obtained by genetic engineering of an original strain, said recombinant strain having enhanced activity of alpha-humulene synthase and flux of mevalonate pathway and acetyl-coa, respectively, or enhanced activity of squalene synthase and flux of mevalonate pathway and acetyl-coa, respectively, in a plurality of organelles compared to the original strain; wherein the plurality of organelles of the recombinant strain comprise a cytoplasm and a peroxisome, and the cytoplasm and the peroxisome enhance an activity of alpha-humulene synthase in a manner of: the cytoplasm and the peroxisome respectively contain a nucleotide sequence of a coding amino acid sequence shown as SEQ ID NO: 1, a gene of α -humulene synthase represented by the formula (I); the manner in which the activity of alpha-humulene synthase is enhanced in the cytoplasm and peroxisomes is: the cytoplasm and the peroxisome respectively contain a nucleotide sequence of a coding amino acid sequence shown as SEQ ID NO: 2, and a gene of squalene synthase.

In the present invention, preferably, the starting strain is yarrowia lipolytica (yarrowia lipolytica) ((R))Yarrowia lipolytica) More preferably yarrowia lipolytica knockout of non-homologous recombination encoding gene ku70, the nucleotide sequence of said encoding gene ku70 being as set forth in SEQ ID NO: as shown at 27. Illustratively, a coding gene ku70 responsible for non-homologous recombination was knocked out using yarrowia lipolytica strain MYA2613, purchased from American Type Culture Collection (ATCC), as the original strain, and the nucleotide sequence of coding gene ku70 is shown in SEQ ID NO: 27 to obtainYarrowia lipolytica Po1f delta ku70 (MatA, ura3-302, leu2-270, XPR2-322, axp2-delta, NU49, XPR2: SUC2 MYA2613 delta ku70: hisG) can be used as the starting strain of the invention.

In the present invention, in order to increase the α -humulene production of the recombinant strain, it is preferable that the recombinant strain contains a nucleic acid sequence encoding an amino acid sequence shown in SEQ ID NO: 1, and further preferably, the nucleotide sequence of the alpha-humulene synthase coding gene ACHS2 is shown in SEQ ID NO: 3 is shown in the specification; in order to increase the squalene production of the recombinant strain, it is preferred that the recombinant strain comprises a nucleic acid sequence encoding an amino acid sequence as set forth in SEQ ID NO: 2, and further preferably, the nucleotide sequence of the squalene synthase encoding gene ERG9 is shown in SEQ ID NO: 4, respectively. The inventor finds that by taking yarrowia lipolytica with a coding gene ku70 knocked out by non-homologous recombination as an initial strain, and exogenously introducing alpha-humulene synthase (ACHS 2) gene expression cassettes into cytoplasm and peroxisome of the recombinant strain respectively, the yield of a fermentation product alpha-humulene can be improved more remarkably; the exogenous introduction of the squalene synthase (ERG 9) gene expression cassettes can improve the yield of squalene.

In the present invention, when the recombinant strain is used for producing alpha-humulene, based on the enhancement of the activity of alpha-humulene synthase and the flux of mevalonate pathway and acetyl-coa in cytoplasm and peroxisome, respectively, the gene ERG9 encoding the squalene synthase can be further replaced by copper ion-inhibited promoter CTR 2; wherein the nucleotide sequence of the copper ion repression promoter CTR2 is shown as SEQ ID NO: 5, respectively. The inventor of the invention finds that the yield of alpha-humulene produced by the recombinant strain can be further improved by replacing a squalene synthase coding gene ERG9 with a copper ion-inhibited promoter CTR 2.

In the invention, the enhancement of the mevalonate pathway in the cytoplasm of the recombinant strain can be realized by over-expressing a coding gene of any key enzyme of the mevalonate pathway in the cytoplasm of the original strain, and the enhancement of the mevalonate pathway in the peroxisome of the recombinant strain can be realized by effectively expressing the coding gene of any key enzyme of the mevalonate pathway in the peroxisome. Preferably, the mevalonate pathway in the cytoplasm of said recombinant strain is enhanced by overexpressing in the cytoplasm of said starting strain at least one of gene tmgb 1 encoding a truncated hydroxymethylglutaryl-CoA reductase, gene ERG8 encoding phosphomevalonate kinase, gene ERG20 encoding geranyl/farnesyl diphosphate synthase, gene ERG12 encoding mevalonate kinase, gene ERG13 encoding hydroxymethylglutaryl-CoA synthase, gene ERG19 encoding mevalonate diphosphate decarboxylase, gene ERG10 encoding acetoacetyl-CoA thiolase and gene IDI encoding isopentenyl diphosphate isomerase; the means for enhancing mevalonate pathway in peroxisomes of the recombinant strain employs efficient expression of at least one of the coding genes tmg 1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI in the peroxisomes of the starting strain; wherein the nucleotide sequences of the coding genes tHMG1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI are respectively shown in SEQ ID NO: 6-13.

In order to better localize the above-mentioned coding genes tmg 1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI to peroxisomes of the starting strain and achieve effective expression of each in peroxisomes, the coding genes tmg 1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI are each linked with a short peptide as a peroxisome localization signal when introduced into peroxisomes, and include a sequence consisting of 7 amino acids, specifically gggsl, and the corresponding nucleotide sequence may be GGTGGTGGTTCTTCTAAACTA.

In the present invention, preferably, the flux of acetyl-CoA in the cytoplasm of the recombinant strain is enhanced by introducing at least one of a gene encoding CoA-acetylaldehyde dehydrogenase AAD, a gene encoding aldehyde dehydrogenase ALDH, a gene encoding carnitine acetyltransferase Cat2, a gene encoding AMP deaminase AMPD, a gene encoding ATP citrate lyase ACL1, ACL2, a gene encoding phosphoketolase PK and a gene encoding phosphotransacetylase PTA into the cytoplasm of the starting strain; wherein, the nucleotide sequences of the coding genes AAD, ALDH, Cat2, AMPD, ACL1, PK and PTA are respectively shown in SEQ ID NO: 14-20, and the nucleotide sequences of the coding gene ACL2 are respectively shown in SEQ ID NO: as shown at 29.

In the present invention, preferably, the flux of acetyl-CoA in peroxisomes of the recombinant strain is enhanced by overexpressing at least one of a gene POT1 encoding 3-ketoacyl-CoA thiolase, a gene MEF1 encoding peroxisome multifunctional enzyme type I, a gene PEX10 encoding peroxisome biogenesis factor 10, and/or at least one of a gene MIS1 encoding peroxisome malate synthase and a gene CIT2 encoding peroxisome citrate synthase in peroxisome of the starting strain; wherein the nucleotide sequences of the encoding genes POT1, MEF1, PEX10, MIS1 and CIT2 are respectively shown as SEQ ID NO: 21-25.

It should be noted that, in the present invention, while the flux of acetyl-coa is enhanced, the gene ANT encoding a carrier protein for ATP is further overexpressed to provide sufficient energy to peroxisomes, and the nucleotide sequence of the encoding gene ANT is as shown in SEQ ID NO: shown at 28.

In the present invention, preferably, the cytoplasm and peroxisome of the recombinant strain are further introduced by exogenous introduction of a gene encoding a key rate-limiting enzyme, NADH-tmg 1, and the nucleotide sequence of the encoding gene, NADH-tmg 1, is as shown in SEQ ID NO: shown at 26.

In the present invention, preferably, the coding gene ACHS2 of the alpha-humulene synthase is further overexpressed in the cytoplasm and peroxisomes of the recombinant strain for producing alpha-humulene, on the basis of the introduction of the coding gene NADH-tHMG 1; the gene encoding squalene synthase ERG9 was further overexpressed in the cytoplasm and peroxisomes of the recombinant strain used for producing squalene, on the basis of the introduction of the gene encoding NADH-tHMG 1.

In order to better localize the encoding gene NADH-tHMG1 to the peroxisome of the starting strain and achieve overexpression in the peroxisome, the encoding gene NADH-tHMG1 is linked to a short peptide as a peroxisome localization signal when introduced into the peroxisome, and comprises a sequence consisting of 7 amino acids, specifically GGGSSKL, and the corresponding nucleotide sequence can be GGTGGTGGTTCTTCTAAACTA.

According to a preferred embodiment of the invention, the recombinant strain has a accession number of CGMCC No. 242525.

In a second aspect, the present invention provides a method for constructing a recombinant strain, the method comprising: genetically engineering a starting strain such that the activity of alpha-humulene synthase and the flux of the mevalonate pathway and acetyl-coa, respectively, are enhanced in the cytoplasm and peroxisome of the starting strain, or the activity of squalene synthase and the flux of the mevalonate pathway and acetyl-coa, respectively, are enhanced; wherein the mode for enhancing the activity of the alpha-humulene synthase is that a coding amino acid sequence shown in SEQ ID NO: 1 in a manner that the squalene synthase activity is exogenously introduced into cytoplasm and peroxisomes of the starting strain into a gene encoding an amino acid sequence shown as SEQ ID NO: 2, and a gene of squalene synthase.

In the present invention, preferably, the nucleotide sequence of the alpha-humulene synthase coding gene ACHS2 is as shown in SEQ ID NO: 3, the nucleotide sequence of the squalene synthase coding gene ERG9 is shown as SEQ ID NO: 4, respectively. In the present invention, the enhancement of the activity of α -humulene synthase is achieved by exogenously introducing the expression cassette ACHS2 in the cytoplasm and peroxisome of the starting strain, respectively, and the enhancement of the activity of squalene synthase is achieved by exogenously introducing the expression cassette ERG9 in the cytoplasm and peroxisome of the starting strain, respectively.

In the present invention, preferably, when the activity of α -humulene synthase in cytoplasm and peroxisome of the recombinant strain is enhanced, the gene ERG9 encoding squalene synthase is replaced with copper ion repressible promoter CTR 2; wherein the nucleotide sequence of the copper ion repression promoter CTR2 is shown as SEQ ID NO: 5, respectively. The process of replacing ERG9 with CTR2 is based on the principle of homologous recombination, homologous arms are respectively obtained at the upstream and downstream of an endogenous promoter, CTR2 is expressed in the middle, and homologous recombination is carried out when the cells are transferred into a genome, namely the replacement is completed.

In the present invention, preferably, the starting strain is yarrowia lipolytica, preferably yarrowia lipolytica with coding gene ku70 knocked out for non-homologous recombination, and the nucleotide sequence of the coding gene ku70 is shown in SEQ ID NO: as shown at 27.

In the present invention, preferably, the mevalonate pathway in the cytoplasm of the recombinant strain is enhanced by overexpressing at least one of gene tmgb 1 encoding truncated hydroxymethylglutaryl-CoA reductase, gene ERG8 encoding phosphomevalonate kinase, gene ERG20 encoding geranyl/farnesyl diphosphate synthase, gene ERG12 encoding mevalonate kinase, gene ERG13 encoding hydroxymethylglutaryl-CoA synthase, gene ERG19 encoding mevalonate diphosphate decarboxylase, gene ERG10 encoding acetoacetyl-CoA thiolase, and gene IDI encoding isopentenyl diphosphate isomerase in the cytoplasm of the starting strain; the means for enhancing mevalonate pathway in peroxisomes of the recombinant strain employs efficient expression of at least one of the coding genes tmg 1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI in the peroxisomes of the starting strain; wherein the nucleotide sequences of the coding genes tHMG1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI are respectively shown in SEQ ID NO: 6-13.

In the present invention, preferably, the flux of acetyl-CoA in peroxisomes of the recombinant strain is enhanced by overexpressing at least one of gene for coding 3-ketoacyl-CoA thiolase POT1, gene for coding peroxisome multifunctional enzyme type I MEF1, gene for coding peroxisome biogenesis factor 10 PEX10, and/or gene for coding peroxisome malate synthase MIS1 and gene for coding peroxisome citrate synthase CIT2 in peroxisomes of the starting strain; wherein the nucleotide sequences of the encoding genes POT1, MEF1, PEX10, MIS1 and CIT2 are respectively shown as SEQ ID NO: 21-25.

In the present invention, preferably, the cytoplasm and peroxisome of the recombinant strain are further introduced by exogenous introduction of a gene encoding a key rate-limiting enzyme, NADH-tmg 1, and the nucleotide sequence of the encoding gene, NADH-tmg 1, is as shown in SEQ ID NO: as shown at 26.

In the present invention, overexpression refers to insertion of a gene existing in a cell itself into a strain so that the gene is up-regulated to express a final gene expression product at a level higher than a normal level; knock-out refers to the inactivation or non-expression of a gene present in the cell of the strain; exogenous introduction refers to the introduction of a functional gene (a gene that is not present in the genome of the target cell or has been inactivated) into the genome of the cell, and expression is achieved in the cell. In the invention, the overexpression, the knockout and the exogenous introduction all utilize a gene homologous recombination method, an upper homologous arm and a lower homologous arm are arranged at a specified position, and a gene expression frame to be expressed is placed between the two homologous arms or no gene is placed (mainly used for knockout).

In the present invention, the overexpression, knockout or exogenous introduction of the above-mentioned coding gene can be achieved by a method conventional in the art. For example, the coding gene for overexpression can be constructed into a corresponding recombinant vector, replicated in E.coli, and then introduced into a competent starting strain in a certain order. Various methods of constructing recombinant vectors are known in the art for ligating a gene fragment of interest (e.g., encoding gene ERG 8) to an expression vector to prepare a recombinant vector, such as, but not limited to, the classical "enzyme-ligation" method, the Gateway Cloning system developed by Invitrogen, and the Clon express Cloning system developed by Novow, such as the Clon express Multi One Step Cloning Kit.

Illustratively, the gene ERG8 can be constructed by a recombinase method to obtain the recombinant vector of the invention: based on the genome of an original strain (such as yarrowia lipolytica strain MYA2613 for knocking out non-homologous recombination coding gene ku 70), amplifying by adopting a PCR method to obtain an upstream and downstream homologous arm sequence of a target insertion part; the recombinant vector is obtained by connecting in series the expression cassette of the target gene to be inserted, the upstream and downstream homology arm sequences, the resistance gene expression cassette, etc., but the present invention is not limited thereto.

Subsequently, the recombinant vector can be introduced into the starting strain (e.g., yarrowia lipolytica strain MYA2613 encoding gene ku70, knock-out for non-homologous recombination) using methods conventional in the art, such as, but not limited to, microinjection, gene gun, transformation (e.g., electrotransformation). The microinjection, gene gun or transformation described above are all routine procedures in the art. For example, transformation refers to the entry of foreign DNA into a cell that is competent by treating the cell using some known method in molecular biology and genetic engineering, to make the treated cell competent, and thereby contacting the foreign DNA. Commonly used transformation methods include protoplast transformation, chemical transformation, and electroporation.

In the invention, when yarrowia lipolytica strain MYA2613 with coding gene ku70 knocked out by non-homologous recombination is used as a starting strain, after a recombinant vector is introduced into the starting strain, positive clones can be screened out through a screening marker (such as a resistance gene), and the verification is carried out through genome PCR or genome DNA sequencing, so that the recombinant strain for producing terpenoid compounds is obtained. For example, the procedure for competent cell preparation and Transformation can be carried out using the Yeast Transformation Kit of Frozen-EZ Yeast Transformation II Kit manufactured by Zymo Research.

In a third aspect, the present invention provides a method for producing terpenoids by fermentation, wherein the terpenoids are alpha-humulene or squalene, the method comprises: inoculating the recombinant strain into a fermentation medium for fermentation;

alternatively, a recombinant strain is constructed as described above, and the resulting recombinant strain is inoculated into a fermentation medium for fermentation.

In the present invention, preferably, the recombinant strain is prepared into a seed solution, and then the seed solution is inoculated into a fermentation medium for fermentation to obtain a fermentation broth.

In the present invention, preferably, the preparation method of the seed liquid comprises: and selecting a single colony of the recombinant strain to inoculate in a seed culture medium for seed culture to obtain the seed solution.

In the present invention, the seed medium is not particularly limited, and may be a seed medium conventionally used in the art for preparing a yarrowia lipolytica seed solution, and preferably, the seed medium is a YPD liquid medium.

In the present invention, preferably, the conditions for seed culture include: the rotation speed is 200 and 250rpm, the temperature is 25-35 ℃, and the time is 16-24 h. In the present invention, preferably, the single colony of the recombinant strain may be selected from colonies streaked on a solid plate. Illustratively, the recombinant strain is inoculated onto a YPD solid plate and streaked, and a single colony of the recombinant strain is obtained by culturing at 25-35 ℃ for 2-3 days.

In the present invention, the fermentation method is not particularly limited, and may be a method for producing terpenoid through fermentation, which is conventionally used in the art, such as inoculating the seed solution into a fermentation medium (such as a shake flask or a fermentation tank containing the fermentation medium) to perform fermentation culture to obtain a fermentation broth.

In the present invention, in order to increase the yield of α -humulene or squalene, it is preferable that the inoculation amount of the seed liquid is 0.5 to 2 parts by volume with respect to 100 parts by volume of the fermentation medium.

In the present invention, the conditions for the fermentation include; the temperature is 25-35 ℃, the rotation speed is 200-. Illustratively, to increase the yield of alpha-humulene, the fermentation conditions may be: firstly, fermenting for 20-30h under the conditions that the rotation speed is 200-250rpm and the temperature is 25-35 ℃; then adding n-dodecane, and continuing to ferment for 60-84h under the conditions of the rotation speed of 200-250rpm and the temperature of 25-35 ℃ to obtain fermentation liquor. Further preferably, the n-dodecane is added in an amount of 20 to 30 parts by volume with respect to 100 parts by volume of the fermentation medium. The addition of the n-dodecane can extract and collect the alpha-humulene secreted outside the cells in real time, and the dodecane layer is centrifuged after the fermentation is finished, so that the alpha-humulene can be obtained. In the present invention, preferably, the fermentation medium comprises a carbon source, an organic nitrogen source (e.g., yeast powder, peptone). More preferably, the fermentation medium comprises the following components in percentage by weight: 15-25g/L of peptone, 8-12g/L of yeast powder and 50-70g/L of glucose. In the present invention, preferably, when the squalene synthase encoding gene ERG9 is replaced with a copper ion-repressible promoter CTR2 in the cytoplasm and peroxisome of the recombinant strain, the fermentation medium further contains copper salt to further increase the yield of α -humulene during fermentation of the recombinant strain. Specifically, the content of copper salt in the fermentation medium is 5-500. mu.M.

In the present invention, α -humulene or squalene in the obtained fermentation broth can be isolated by a known method. For example, α -humulene can be secreted extracellularly by the strain, and isolated by removing cells from the fermentation broth, and then concentrating the cell-removed fermentation broth to crystallize the product, or by ion exchange chromatography or the like; and (2) collecting the thalli in the fermentation liquor when the squalene exists in the thalli, then carrying out freeze drying, weighing a certain amount of thalli, mixing with a sodium hydroxide-methanol solution, carrying out oscillation reaction, then mixing with concentrated sulfuric acid, finally mixing with dodecane, carrying out oscillation and then centrifuging, and extracting the squalene into a dodecane layer.

In the present invention, α -humulene or squalene in the fermentation solution can also be detected by a known method, or α -humulene or squalene separated from the fermentation solution. For example, α -humulene or squalene can be detected by gas chromatography and the like.

The present invention will be described in detail below by way of examples. These examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. In the following examples, unless otherwise indicated, all experimental procedures used are conventional procedures well known to those skilled in the art or as recommended by the manufacturer.

In the following examples, unless otherwise specified, reagents and media used are commercially available, and the methods used are conventional methods; the room temperature was 25. + -. 5 ℃ unless otherwise specified.

In the following examples, the starting strain isYarrowia lipolyticaPo1f Δ ku70 (MatA, ura3-302, leu2-270, XPR2-322, axp2-delta, NU49, XPR2:: SUC2 MYA2613 Δ ku70:: hisG), which was originally obtained from yarrowia lipolytica strain MYA2613 available from the American Type Culture Collection (ATCC), reference "Gao S, Tong Y, Zhu L, et alYarrowialipolytica for heterologousβ-carotene production[J]The method described in Metabolic Engineering,2017:192 ", knock-out the coding gene ku70 responsible for non-homologous recombination, the nucleotide sequence of the coding gene ku70 being as set forth in SEQ ID NO: 27 to obtainYarrowia lipolytica Po1fΔku70。

1. Culture medium and reagent

YPD liquid medium: peptone 20g/L, yeast powder 10g/L, glucose 20 g/L;

YPD solid Medium: peptone 20g/L, yeast powder 10g/L, glucose 20g/L, agar powder 20 g/L;

YPD ₆₀ fermentation medium: peptone 20g/L, yeast powder 10g/L, glucose 60g/L, copper sulfate 8 mg/L.

2. The content of alpha-humulene or squalene is detected by Gas Chromatography (GC):

the model of the gas chromatograph: shimadzu, Japan QP2020NX, HP-5MS column (30 m. times.320. mu. m. times.0.5. mu.m).

Detection conditions of alpha-humulene: the injection port temperature is 250 ℃, the injection volume is1 mu L, and the split ratio is 20: 1; a chromatographic column: HP-5ms (30 m.times.0.25 mM); chromatographic conditions are as follows: the initial temperature is 60 ℃, the temperature rises to 150 ℃ according to the speed of 10 ℃/min, then the temperature rises to 280 ℃ at 20 ℃/min, and the temperature is kept for 2 min; qualitative and quantitative determination was carried out using a standard of alpha-humulene.

Detection conditions of squalene: the injection port temperature is 250 ℃, the injection volume is1 mu L, and the split ratio is 20: 1; a chromatographic column: HP-5 (30 m.times.320. mu.m.times.0.25 μm); chromatographic conditions are as follows: heating to 175 deg.C for 3min, heating to 200 deg.C at 20 deg.C/min and maintaining for 3min, and heating to 260 deg.C at 20 deg.C/min and maintaining for 4 min; and carrying out qualitative and quantitative determination by using a standard substance of squalene.

3. Amplification of Gene fragment (PCR amplification method)

The PCR enzyme used in PCR amplification is PrimeSTAR MaxDNA polymerase of TAKARA; the PCR amplification system is shown in Table 1 below:

TABLE 1 PCR amplification System

Reagent	Amount of the use	Final concentration
			PrimeSTAR Max（2×）	25μL	1×
Primer 1	10-15 pmol	0.2-0.3 μmol
			Primer
2	10-15 pmol	0.2-0.3 μmol
			Template	＜200 ng
Sterilized distilled water	Up to 50μL

Wherein, the PCR amplification process comprises the following steps: denaturing at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extending at 72 ℃ for 35 cycles, and purifying and recovering each fragment with AxyPrepTM DNA Gel Extraction Kit (available from Corning Life sciences, Wujiang Ltd.); where, extension time = target fragment length/1 kb, unit min.

4. Construction of recombinant vector (one-step cloning method):

One-Step Cloning is realized by using Clonexpress Multi S One Step Cloning Kit of Nanjing Novozam Biotechnology Co., Ltd, a reaction system is shown in Table 2, and a circular recombinant vector is obtained after the reaction system is incubated for 15min at 50 ℃;

TABLE 2 one-step cloning System

Components	Recombination reactions
		Linearized vector	XμL
N inserts	Y1+Y2+…YnμL
		2×ClonExpress Mix	5μL
ddH2O	To 10μL

The circular recombinant vector is transformed into escherichia coli DH5a competent cells, and positive recombinant plasmids are obtained through ampicillin resistance plate screening and colony PCR and sequencing verification.

Example 1

Construction of original plasmid

Yarrowia lipolytica according to NCBI (r) ((r))Y.lipolytica) In (3), the nucleotide sequence of orotic acid nucleic acid pro-5 '-phosphate dredgerase encoding gene ura (genebank accession AJ 306421.1) and hisG tag (genebank accession AF 324729.1) are entrusted to the synthesis of Ongchikungunya Biotech Co., Ltd, two hisG tag encoding gene sequences are inserted into plasmid pUC, pUC57 is specifically used as a skeleton, ECORI and HindIII are used for enzyme digestion to recover the skeleton, the hisG tag encoding gene is subjected to One-Step Cloning by using Clon express MultiS One Cloning Kit to construct plasmid pUC-hisG-hisG, then the plasmid pUC-hisG-hisG is used as a skeleton, HindIII is used for enzyme digestion to recover the skeleton, the ura encoding gene is subjected to One-Step Cloning by using Clon MultiS One Cloning Kit to construct two hisG tag encoding gene sequences, and whey 5' -phosphate dredgese encoding gene is inserted into the two hisG tag encoding gene sequences to recover the whey marker, obtaining a plasmid pUC-HUH;

and replacing the HisG fragment in the construction process with Bilk (XM _ 023576916.1) to obtain a skeleton plasmid pUC-BUB.

Cloning of endogenous genes and expression elements of yarrowia lipolytica

(1) Extraction of yarrowia lipolytica genome: the whole genomic DNA of yarrowia lipolytica po1f was extracted (see the instructions for DNA extraction kit for DNA extraction from yeast, from Shanghai, Biotechnology engineering Co., Ltd.).

(2) Taking the yarrowia lipolytica genome obtained in the step (1) as a template, respectively designing corresponding primer pairs, cloning the following 12 endogenous coding genes, 6 promoters and 14 terminators by a PCR amplification method, and describing the construction process of the following integration plasmids in detail;

NADH-HMG1 (from roseobacter)Ruegeria pomeroyi) ACHS2 (isolated from plant Aquilaria sinensis), GFP (artificially synthesized), homology arm of CIT2 (endogenous), homology arm of MIS1 (endogenous), AMPD, ACL2, ACL1, PK (from Leuconostoc mesenteroides)Leuconostoc mesenteroides) Cat2 (from Saccharomyces cerevisiae)Saccharomycescerevisiae) AAD (from E. coli), ALDH (from E. coli)Escherichiacoli) All are entrusted to the Optimus department Biotechnology Limited company for synthesis after codon optimization.

Construction of integration plasmid

(1) Construction of integration plasmid pUC-IntC-HUH-tHMG1-ERG13-IDI

Firstly, using original plasmid pUC-HUH as a framework, carrying out PCR amplification (shown in a table 1) by using IntC-UP-F and IntC-UP-R to obtain IntC upper homology arm IntC-UP, carrying out enzyme digestion on the pUC-HUH framework by using ECORI, and then carrying out one-step cloning (shown in a table 2) and connection with IntC-UP to obtain pUC-HUH-intC-UP;

secondly, carrying out PCR amplification by using IntC-DN-F and IntC-DN-R to obtain IntC-DN of the lower homologous arm, carrying out enzyme digestion on pUC-HUH-intC-UP by using HindIII, and carrying out one-step cloning and connection with IntC-DN to obtain pUC-HUH-intC;

③ using T _tHMG1t -F and T _tHMG1t PCR amplification of-R to obtain T _tHMG1t PCR amplification with tHMG1-F and tHMG1-R to obtain tHMG1, and PCR amplification with P _TEFin -F and P _TEFin PCR amplification of-R to obtain P _TEFin The pUC-HUH-intC was digested with HindIII and then digested with T _tHMG1t tHMG1 and P _TEFin Carrying out one-step cloning and connection to obtain pUC-HUH-IntC-tHMG 1;

fourthly, using T _ERG13t -F and T _ERG13t PCR amplification of-R to obtain T _ERG13t ERG13 was obtained by PCR amplification using ERG13-F and ERG13-R, and P was used _GPD -F and P _GPD PCR amplification of-R to obtain P _GPD pUC-HUH-IntC-tHMG1 was digested with XbaI and then ligated with T _ERG13t ERG13 and P _GPD Performing one-step cloning and connection to obtain pUC-IntC-HUH-tHMG1-ERG13；

Use T _IDIt -F and T _IDIt PCR amplification of-R to obtain T _IDIt PCR amplification of IDI-F and IDI-R to obtain IDI, and PCR amplification of IDI-F and IDI-R with P _EXP -F and P _EXP PCR amplification of-R to obtain P _EXP pUC-IntC-HUH-tHMG1-ERG13 was digested with XbaI and then ligated with T _IDIt IDI and P _EXP And (3) carrying out one-step cloning and connection to obtain pUC-IntC-HUH-tHMG1-ERG13-IDI, wherein the nucleotide sequence of the related primer is shown in a table 3, and the nucleotide sequence of tHMG1 is shown in SEQ ID NO: 6, the nucleotide sequence of ERG13 is shown as SEQ ID NO: 10, and the nucleotide sequence of IDI is shown as SEQ ID NO: shown at 13.

The further integration plasmids were obtained by following the specific construction procedure of pUC-IntC-HUH-tHMG1-ERG 13-IDI.

TABLE 3

IntC-UP-F	gttgtaaaacgacggccagtgaattcAGGTTGTCGATGATATGCTG
		IntC-UP-R	ATGCACCACTGGAAGATCCGGGAATTAGGACAACTCCTGAGACATA
IntC-DN-F	AACAGCTTAATTAAGGTACCAAGCTTCGTGGTTCATGTCCTTCATCT
		IntC-DN-R	TGACCATGATTACGCCAAGCTGTCGAGTTGCGGCTCGAGAGCC
TtHMG1t-F	TGGAACAGCTTAATTAAGGTACCAAGCTcaggtcGTCTCGATCAAATCCTTG
		TtHMG1t-R	ATATTTGCATACGGTCATAGGTGTACAATAGTGAAGGAAA
tHMG1-F	TTTCCTTCACTATTGTACACCTATGACCGTATGCAAATAT
		tHMG1-R	CTTTTTGCAGTACtaaccgcagACCCAGTCTGTGAAGGTGGTTGA
PTEFin-F	ACCACCTTCACAGACTGGGTctgcggttaGTACTGCAAAA
		PTEFin-R	GATGAAGGACATGAACCACGAAGCTCTAGAAGAGACCGGGTTGGCGGCGTAT
TERG13t-F	ATACGCCGCCAACCCGGTCTCTTCTAGGGAGTAACAGCACGTATCGCACGT
		TERG13t-R	AGTACGAGATCAAGCAGTAGATTGTTAAGATGCAACTAGG
ERG13-F	CCTAGTTGCATCTTAACAATCTACTGCTTGATCTCGTACT
		ERG13-R	GAATTAAACACACATCAACAatgtcGCAACCCCAGAACGTTGGAA
PGPD-F	ACGTTCTGGGGTTGCgacatTGTTGATGTGTGTTTAATTCAAGAAT
		PGPD-R	AGATGAAGGACATGAACCACGAAGCTCTAGACGCAGTAGGATGTCCTGCAC
TIDIt-F	GTGCAGGACATCCTACTGCGTCTAGGACTCGATACTACTCCAGTCA
		TIDIt-R	TTCGGCGGTGGATCAAGTAGGGATTGGCGAAGTAATTAAT
IDI-F	ATTAATTACTTCGCCAATCCCTACTTGATCCACCGCCGAA
		IDI-R	CACAAGACATATCTACAGCAATGACGACGTCTTACAGCGA
PEXP-F	TCGCTGTAAGACGTCGTCATTGCTGTAGATATGTCTTGTG
		PEXP-R	CAGATGAAGGACATGAACCACGAAGCTCTAGACACACGTTTCGGTGAGTATGAG

(2) Integration plasmid pUC-ku70-HUH-ERG20-ERG12

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe upstream 1542bp and the downstream 1489bp of the ku70 site of the chromosome of Polf; after digestion with the restriction enzyme HindIII from Takara between ku70-dn and hisG, the resultant was linearized by agarose gel electrophoresis; the linearized pUC-HUH-KU70 plasmid is inserted into ERG20 and ERG12 expression frames in sequence to obtain an integration plasmid pUC-KU70-HUH-ERG20-ERG12, wherein the related primer nucleotide sequence is shown in Table 4, and the nucleotide sequence of ERG20 is shown in SEQ ID NO: 8, the nucleotide sequence of ERG12 is shown as SEQ ID NO: shown at 9.

TABLE 4

Ku70-UP-F	GCTATGACCATGATTACGATATTTAAATCCCAAAGACGAGGAGACTTTCT
		Ku70-UP-R	ATGCACCACTGGAAGATCCGGAATTCACGCGAAGTTGGGTGCCATGTT
Ku70-DN-F	CCTGATTGACTGGAACAGCCCCAAGCTTGGTGATGCCATCGAGGAATGGA
		Ku70-DN-R	TAAAACGACGGCCAGTGCCGATATTTAAATGCAAGCACAAGAAGGAGCCTCGCTTCAG
TERG20t-F	TTTACAAGCGACAGAAGTAGACACTTGAAAAAAACGCAAT
		TERG20t-R	CATTCCTCGATGGCATCACCAAGCTTCTAGAAGGACTCGGGTCAGAAGTTCTT
ERG20-F	GAATTAAACACACATCAACAATGTCCAAGGCGAAATTCGA
		ERG20-R	ATTGCGTTTTTTTCAAGTGTCTACTTCTGTCGCTTGTAAA
PGPD-F	CTGATTGACTGGAACAGCCCCAAGCTCGCAGTAGGATGTCCTGCACG
		PGPD-R	TCGAATTTCGCCTTGGACATTGTTGATGTGTGTTTAATTC
TERG12t-F	TCGGTCCCTGGACCCATTAGTATTTAATTTTAATGAGTGA
		TERG12t-R	CATTCCTCGATGGCATCACCAAGCTTCTAGACGAGGTATTGCTGTCTATAA
ERG12-F	CACAAGACATATCTACAGCATCTAGCATGGACTACATCATTTCGGCGC
		ERG12-R	TCACTCATTAAAATTAAATACTAATGGGTCCAGGGACCGA
PEXP-F	AGAACTTCTGACCCGAGTCCTTCTAGCACACGTTTCGGTGAGTATGAG
		PEXP-R	GCGCCGAAATGATGTAGTCCATGCTAGATGCTGTAGATATGTCTTGTG

(3) Integration plasmid pUC-SCP2-HUH-ERG10-ERG8-ERG19

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe upstream 1523bp and the downstream 1524bp of a chromosome SCP2 locus in the Polf-SCP 2; the resultant mixture was digested with restriction enzyme HindIII from Takara, SCP2-dn and hisG, and recovered from the gel by agarose gel electrophoresisLinearization is carried out; the linearized pUC-HUH-SCP2 plasmid is sequentially inserted into expression frames ERG10, ERG8 and ERG19 to finally obtain an integrated plasmid pUC-SCP2-HUH-ERG10-ERG8-ERG19, wherein the nucleotide sequence of the related primer is shown in Table 5, and the nucleotide sequence of ERG10 is shown in SEQ ID NO: 12, the nucleotide sequence of ERG8 is shown as SEQ ID NO: 7, the nucleotide sequence of ERG19 is shown as SEQ ID NO: shown at 11.

TABLE 5 primer nucleotide sequences of the integration plasmid pUC-SCP2-HUH-ERG10-ERG8-ERG19

SCP2-UP-F	gttgtaaaacgacggccagtgaattcCCGACAGTCGTCTGCACCCC
		SCP2-UP-R	ATGCACCACTGGAAGATCCGGGAATTTTTGTGTAATGAATAAGAGA
SCP2-DN-F	AACAGCTTAATTAAGGTACCAAGCTTCAAGTCCCCCAAGGGTGATG
		SCP2-DN-R	GACCATGATTACGCCAAGCTGCGGCCGCAACCGATAGTGAGACTCAAT
TERG10t-F	AGGTCTCTTCTGTCGAGTAGTTAGTATATAGATGATTTAT
		TERG10t-R	CATCACCCTTGGGGGACTTGAAGCTTGGACAATTAATTTGTCGCGT
ERG10-F	ACAAACTAACCCAGCTCTTCCGACTCACTCTGCCCCGACT
		ERG10-R	ATAAATCATCTATATACTAACTACTCGACAGAAGAGACCT
PFBAin-F	GAACAGCTTAATTAAGGTACCAAGCTGTACGTAGCAACAACAGTGT
		PFBAin-R	AGTCGGGGCAGAGTGAGTCGGAAGAGCTGGGTTAGTTTGT
TERG8t-F	TCGAGAAGGGGTTCAAGTAGCACTGTGACAATGAGAAGGA
		TERG8t-R	CATCACCCTTGGGGGACTTGAAGCTTGAAACATAATGCATAACTGT
ERG8-F	GAGTATAAGAATCATTCAAAATGACCACCTATTCGGCTCC
		ERG8-R	TCCTTCTCATTGTCACAGTGCTACTTGAACCCCTTCTCGA
PTEF-F	AACGCGACAAATTAATTGTCCAAGCTAGAGACCGGGTTGGCGGCGT
		PTEF-R	GGAGCCGAATAGGTGGTCATTTTGAATGATTCTTATACTC
TERG19t-F	GACAGTTATGCATTATGTTTCAAGCTTGGAGCCCGTTGAGGGAGAT
		TERG19t-R	CTCTGAAGAACAGCAAGTAGGCAGGGGGCAGAAACAAGAA
ERG19-F	TTCTTGTTTCTGCCCCCTGCCTACTTGCTGTTCTTCAGAG
		ERG19-R	ACAAACTAACCCAGCTCTTCATGATCCACCAGGCCTCCAC
PFBAin-F	GTGGAGGCCTGGTGGATCATGAAGAGCTGGGTTAGTTTGT
		PFBAin-R	GCATCACCCTTGGGGGACTTGAAGCTGTACGTAGCAACAACAGTGT

(4) Integration plasmid pUC-intD-HUH-2tHMG1

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe sequences of 1442bp upstream and 1189bp downstream of the intD locus of the chromosome of the Polf; after digestion with the restriction enzyme HindIII from Takara, the resultant was linearized by agarose gel electrophoresis; the linearized pUC-HUH-intD plasmid was inserted into two tHMG1 expression cassettes in sequence to obtain the integrated plasmid pUC-intD-HUH-2tHMG1, wherein the nucleotide sequence of the primer is shown in Table 6, and the nucleotide sequence of tHMG1 is shown in SEQ ID NO: and 6.

TABLE 6

intD-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATAACCTCATTTCATCTGAATTGA
		intD-UP-R	GGTATAGTACAATGATTACGAATTCCGGATCTTCCAGTGGTGCATG
intD-DN-F	TGATTGACTGGAACAGCCCCAAGCTTAGAGAACAGAACAAGTCGGAAG
		intD-DN-R	TGTTTATGTTACTCGATTTCATTTAAATagcttggcgtaatcatggtcatagct
TtHMG1t-F	AGGTATAGTACAATGATTACGAATTCcaggtcGTCTCGATCAAATCC
		TtHMG1t-R	ATATTTGCATACGGTCATAGGTGTACAATAGTGAAGGAAA
tHMG1-F1	TTTCCTTCACTATTGTACACCTATGACCGTATGCAAATAT
		tHMG1-R1	TTTTGCAGTACtaaccgcagACCCAGTCTGTGAAGGTGGT
PTEFin-F	ACCACCTTCACAGACTGGGTctgcggttaGTACTGCAAAA
		PTEFin-R	CATGCACCACTGGAAGATCCGGAATTAGAGACCGGGTTGGCGGCGT
TXPR2t-F	ATATTTGCATACGGTCATAGATTAAgatccaactacggaacttgtg
		TXPR2t-R	CTTCCGACTTGTTCTGTTCTCTAAGCTTGACACGGGCATCTCACTTGC
tHMG1-F2	CACAAGACATATCTACAGCATTAATATGACCCAGTCTGTGAAGGTGGTTGA
		tHMG1-R2	cacaagttccgtagttggatcTTAATCTATGACCGTATGCAAATAT
PEXP-F	CCCTGATTGACTGGAACAGCCCCAAGCTGgagtttggcgcccgttttt
		PEXP-R	TCAACCACCTTCACAGACTGGGTCATATTAATGCTGTAGATATGTCTTGTG

(5) Integration plasmid pUC-intF-HUH-2ACHS2

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe sequences of 1610bp upstream and 1852bp downstream of the intF locus of the chromosome of the Polf; after digestion with the restriction enzyme HindIII from Takara, the DNA fragment was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intF plasmid is sequentially inserted into two ACHS2 expression frames to finally obtain an integration plasmid pUC-intF-HUH-2ACHS2, wherein the related primer nucleotide sequence is shown in Table 7, and the nucleotide sequence of ACHS2 is shown in SEQ ID NO: 3, respectively.

TABLE 7

intF-UP-F	gttgtaaaacgacggccagtgaattcAGTGGTAATTCAGCAAGACC
		intF-UP-R	TGCACCACTGGAAGATCCGGGAATTCGCCCTCCAAGCTACATCTAC
intF-DN-F	GATTGACTGGAACAGCTTAATTAAGGTACCAAGCTTGCACAAGCCTCTCTATAATC
		intF-DN-R	GACCATGATTACGCCAAGCTGCGGCCGCAGGACGACAACGGCTGGTGA
TCYC1t-F	AACAGCTTAATTAAGGTACCAAGCTTGCAAATTAAAGCCTTCGAGC
		TCYC1t-R	TTCATCCCTTCACCATCTAATCATGTAATTAGTTATGTCA
ACHS2-F1	TGACATAACTAATTACATGATTAGATGGTGAAGGGATGAA
		ACHS2-R1	ACCAGCACTTTTTGCAGTACtaaccgcagTCTCCTGCACAGGCGCCCCA
PTEFin-F	TGGGGCGCCTGTGCAGGAGActgcggttaGTACTGCAAAAAGTGCTGGT
		PTEFin-R	TAGAGAGGCTTGTGCAAGCTGCTAGCAGAGACCGGGTTGGCGGCGT
Tmig1t-F	TTCATCCCTTCACCATCTAACACTGGCCGGTCGATAATTT
		Tmig1t-R	AAAAGATTATAGAGAGGCTTGTGCAAGCTGCTAGAAACCCAAAAGGGCCGAAGG
ACHS2-F2	CACAAGACATATCTACAGCACTAGCatgTCTCCTGCACAGGCGCCCCA
		ACHS2-R2	AAATTATCGACCGGCCAGTGTTAGATGGTGAAGGGATGAA
PEXP-F	ATACGCCGCCAACCCGGTCTCTGCTAGCccgtcgcttccacaggctct
		PEXP-R	TGGGGCGCCTGTGCAGGAGAcatGCTAGTGCTGTAGATATGTCTTGTG

(6) Integration plasmid pUC-HUH-intE1-PK-PTA

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe upstream 1352bp and the downstream 1852bp of the intE1 locus of the chromosome of the Polf; after digestion with the restriction enzyme HindIII from Takara, the DNA fragment was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intE1 plasmid is sequentially inserted into PK and PTA expression frames to finally obtain an integrated plasmid pUC-HUH-intE1-PK-PTA, wherein the related primer nucleotide sequence is shown in Table 8, and the PK nucleotide sequence is shown in SEQ ID NO: 19, the nucleotide sequence of PTA is shown as SEQ ID NO: shown at 20.

TABLE 8

IntE1-UP-F	cgttgtaaaacgacggccagtgaattGGCAGGCTGGTTACCGAATC
		IntE1-UP-R	TGCACCACTGGAAGATCCGGGAATTCAAGTGAACAGCGCACGATCT
IntE1-DN-F	CACTGCACTACCACTACACCGGTACCAAGCTTGGCTAACGAGAGAAACTGGGCCAA
		IntE1-DN-R	aaacagcTATGACCATGATTACGCCAAGCTTACGCGTATGTCACGTGATGGATTTC
TCYC1t-F	AGATCGTGCGCTGTTCACTTGAATTCGCAAATTAAAGCCTTCGAGC
		TCYC1t-R	CATGGTCTCCATTAAAATAATCATGTAATTAGTTATGTCA
PK-F	TGACATAACTAATTACATGATTATTTTAATGGAGACCATG
		PK-R	CACAAGACATATCTACAGCAGCCACCATGGCTGATTTCGATTCTAA
PEXP-F	TTAGAATCGAAATCAGCCATGGTGGCTGCTGTAGATATGTCTTGTG
		PEXP-R	ATGCACCACTGGAAGATCCGGGAATTGGTAGGTAGACAATTTACTT
TPEX10t-F	AAGCACAAGCTCAAGGTTAATGACGAGGTCTGGATGGAAG
		TPEX10t-R	TTCTCTCGTTAGCCAAGCTTGGTACCAGACAAGTACAAGCTGACCT
PTA-F	TTTTGCAGTACTAACCGCAGAAGTTGATGGAAAACATCTT
		PTA-R	CTTCCATCCAGACCTCGTCATTAACCTTGAGCTTGTGCTT
PTEFin-F	ATTGACTGGAACAGCTTAATTAAGGTACAGAGACCGGGTTGGCGGCGT
		PTEFin-R	AAGATGTTTTCCATCAACTTCTGCGGTTAGTACTGCAAAA

(7) Integration plasmid pUC-HUH-intE2-ACL1-ACL2-AMPD

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe sequences of 1533bp upstream and 1521bp downstream of the intE2 locus of the chromosome in the Polf-intE 2; after digestion with the restriction enzyme HindIII from Takara, the DNA fragment was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intE2 plasmid is sequentially inserted into an ACL1 expression frame, an ACL2 expression frame and an AMPD expression frame to finally obtain an integration plasmid pUC-HUH-intE2-ACL1-ACL2-AMPD, wherein the nucleotide sequence of the related primer is shown in Table 9, and the nucleotide sequence of AMPD is shown in SEQ ID NO: 17, the nucleotide sequence of ACL1 is shown in SEQ ID NO: 18, and the nucleotide sequence of ACL2 is shown in SEQ ID NO: as shown at 29.

TABLE 9

IntE2-UP-F	cgttgtaaaacgacggccagtgaattCACCTGTGGCTAATTTGGGA
		IntE2-UP-R	CATGCACCACTGGAAGATCCGGGAATTCGTCTTAGTGCAGCAAAATCG
IntE2-DN-F	ATACCCTGATTGACTGGAACAGCTTAATGTGTGGATTGCGATATTGAA
		IntE2-DN-R	acagcTATGACCATGATTACGCCAAGCTTCACCCTTTCTCTATCTCTG
TAMPDt-F	ATACCCTGATTGACTGGAACAGCTTAATGTGTGTTTACTGCACAGCCT
		TAMPDt-R	TTGAGCGGCTGCATGGTTAATTATAAGCATGTACTTGTAT
AMPD-F	ATACAAGTACATGCTTATAATTAACCATGCAGCCGCTCAA
		AMPD-R	CACAAGACATATCTACAGCAATGCCGCAGCAAGCAATGGA
PEXP-F	TCCATTGCTTGCTGCGGCATTGCTGTAGATATGTCTTGTG
		PEXP-R	TTCAATATCGCAATCCACACAAGCTTTTAATTAAGGTAGGTAGACAATTTACTT
TACL2t-F	CCACTCCTCTCGGAGTTTAACTTGCCCATGAGCGAGCGAA
		TACL2t-R	ACTTCAATATCGCAATCCACACAAGCTTCACCCTTTAAACCCTCCCTT
ACL2-F	ACTCCCCGACAATGTACTAACACAGGTCTCAGCGAAATCCATTCACGA
		ACL2-R	TTCGCTCGCTCATGGGCAAGTTAAACTCCGAGAGGAGTGG
PGPDin-F	AGTAAATTGTCTACCTACCTTAATTAAGACGCAGTAGGATGTCCTGCA
		PGPDin-R	TCGTGAATGGATTTCGCTGAGACCTGTGTTAGTACATTGTCGGGGAGT
TACL1t-F	AGGCCAAGACTCGATCATAGATCTAGGGTGATAGAATATA
		TACL1t-R	ATATCGCAATCCACACAAGCTTGGTACCAGCCATTAAGGAGTTCATTT
ACL1-F	CTCTCTACACAAACTAACCCAGCTCTTCATGTCTGCCAACGAGAACAT
		ACL1-R	TATATTCTATCACCCTAGATCTATGATCGAGTCTTGGCCT
PFBAin-F	GGGAGGGTTTAAAGGGTGATTAAGGTACGTACGTAGCAACAACAGTGT
		PFBAin-R	ATGTTCTCGTTGGCAGACATGAAGAGCTGGGTTAGTTTGTGTAGAGAG

(8) Integration plasmid pUC-intE5-HUH-perCat2

Using original plasmid pUC-HUH as skeleton, insertingY. lipolyticaThe sequence of 2138bp upstream and 2035bp downstream of the intE5 locus of the chromosome of Polf; after digestion with the restriction enzyme HindIII from Takara between intE5-dn and hisG, the resultant was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intE5 plasmid is sequentially inserted into the expression frame of perCat2, and finally the integrated plasmid pUC-intE5-HUH-perCat2 is obtained, wherein the related primer nucleotide sequences are shown in Table 10, and the nucleotide sequences of Cat2 are respectively shown in SEQ ID NO: shown at 16.

Watch 10

IntE5-UP-F	gacgttgtaaaacgacggccagtgaattATTTAAATAGCTGGACTCTGGCAAGCTC
		IntE5-UP-R	ACCACTGGAAGATCCGGgaattGCGGCCGCTGCAATTCCCGAACCATT
IntE5-DN-F	TGGAACAGCTTAATTAAGGTACCAAGCTTCACCTTCAGTCCGCATATT
		IntE5-DN-R	acagcTATGACCATGATTACGCCAAGCTATTTAAATATCCCTTTCAAGTTGCTACT
TPEX10t-F	AACGAAAAGCAAAGTTATGATGACGAGGTCTGGATGGAAG
		TPEX10t-R	AAATATGCGGACTGAAGGTGAAGCTTAGACAAGTACAAGCTGACCT
percat2-F	GAGTATAAGAATCATTCAAAATGAGGATCTGTCATTCGAG
		percat2-R	CTTCCATCCAGACCTCGTCATCATAACTTTGCTTTTCGTT
PTEF-F	TGGAACAGCTTAATTAAGGTACCAAGCTAGAGACCGGGTTGGCGGCGT
		PTEF-R	CTCGAATGACAGATCCTCATTTTGAATGATTCTTATACTC

(9) Integration plasmid pUC-IntC1-HUH-AAD

Inserting into pUC-HUH as skeletonY. lipolyticapUC-IntC1-HUH is obtained by the upstream 1698bp and the downstream 1642bp of the chromosome IntC1 locus of Polf; after digestion with the restriction enzyme HindIII from Takara between IntC1-UP and hisG, the cells were linearized by agarose gel electrophoresis. The linearized pUC-HUH-IntC1 plasmid is inserted into AAD expression frame in sequence to obtain integrated plasmid pUC-IntC1-HUH-AAD, wherein the related primer nucleotide sequence is shown in Table 11, and the nucleotide sequence of AAD is shown in SEQ ID NO: as shown at 14.

TABLE 11

IntC1-UP-F	aaaacgacggccagtgaattATTTAAATCTGCTGCCTTACTGTCGACT
		IntC1-UP-R	CCACTGGAAGATCCGGgaattGCGGCCcGCGTAGCAGAACCGTAGATG
IntC1-DN-F	TTGACTGGAACAGCTTAATTAAGGTACCAGTCGTGGGAGCAACAGGGC
		IntC1-DN-R	ATTACGCCAAGCTTGGTACCATTTAAATGGAGCGACAGTTGCTCAATC
TylCYC1t-F	ATCATCTACGGTTCTGCTACGCGGCCGCCgaggtggttggagatggac
		TylCYC1t-R	ATGCGTTTCGCATTGTTTAAgatccTAAGCGTCTACAACTGGACCCTT
AAD-F	AAGGGTCCAGTTGTAGACGCTTAggatcTTAAACAATGCGAAACGCAT
		AAD-R	CACACAAGACATATCTACAGCAggatccATGAATCAACAGGATATTGA
PEXP-F	TCAATATCCTGTTGATTCATggatccTGCTGTAGATATGTCTTGTGTG
		PEXP-R	GGAAGATCCGGgaattGCGGCCcacgtgccgtcgcttccacaggctct

(10) Integration plasmid pUC-IntC1-HUH-ALDH

Using pUC-IntC1-HUH as a backbone, restriction enzyme HindIII from Takara was used between IntC1-UP and hisG, and then the resultant was linearized by agarose gel electrophoresis. Inserting the linearized pUC-HUH-IntC1 plasmid into an ALDH expression frame to finally obtain an integration plasmid pUC-IntC1-HUH-ALDH, wherein the nucleotide sequences of the related primers are shown in Table 12, and the nucleotide sequences of the ALDH are respectively shown in SEQ ID NO: 15, respectively.

TABLE 12

TylCYC1t-F	ATCATCTACGGTTCTGCTACGCGGCCGCCgaggtggttggagatggac
		TylCYC1t-R	TCTGGATAAGCCTGGAGGCCTGAgatccTAAGCGTCTACAACTGGACC
ALDH-F	GGTCCAGTTGTAGACGCTTAggatcTCAGGCCTCCAGGCTTATCCAGA
		ALDH-R	CACACAAGACATATCTACAGCAggatccATGAATTTTCATCATCTGGC
PEXP-F	GCCAGATGATGAAAATTCATggatccTGCTGTAGATATGTCTTGTGTG
		PEXP-R	GGAAGATCCGGgaattGCGGCCcacgtgccgtcgcttccacaggctct

(11) Integration plasmid pUC-intF3-HUH-IDI-PTS-ERG19-PTS-ACHS2-PTS

Inserting into pUC-HUH as skeletonY. lipolyticaThe sequences of the upstream 2113bp and the downstream 2006bp of the intF3 locus of the Polf chromosome; the fragment was digested between intF3-up and hisG with the restriction enzyme NotI from Takara, and then linearized by agarose gel electrophoresis. Inserting the linearized pUC-HUH-intF3 plasmid into IDI-PTS, ERG19-PTS and ACHS2-PTS expression frames in sequence to finally obtain an integrated plasmid pUC-intF3-HUH-IDI-PTS-ERG19-PTS-ACHS2-PTS, wherein the related primer nucleotide sequence is shown in Table 13, PTS is signal peptide of peroxisome and is respectively connected with the C ends of IDI, ERG19 and ACHS genes, and is specifically GGTGGTGGTTCTTCTAAACTA; nucleotide sequences of IDI, ERG19 and ACHS2 are respectively shown in SEQ ID NO: 13. 11 and 3.

Watch 13

IntF3-UP-F	gttgtaaaacgacggccagtgaattATTTAAATGTGCTGTTCAGAAGCCGGC
		IntF3-UP-R	ACTGGAAGATCCGGgaattGCGGCCGCATACGCGAGTTCCCAAAGCAG
IntF3-DN-F	CTGGAACAGCTTAATTAAGGTACCAAGCTTCTGGGGACCGAGAATTAG
		IntF3-DN-R	cagcTATGACCATGATTACGCCAAGCTATTTAAATGGGGCGCTCCCTGTGGGCC
TIDIt-F	TCTGCTTTGGGAACTCGCGTATGCGGCCGACTCGATACTACTCCAGTC
		TIDIt-R	GGTGGTGGTTCTTCTAAACTATAAGGATTGGCGAAGTAATTAAT
IDI-F	TTATAGTTTAGAAGAACCACCACCCTTGATCCACCGCCGAATCT
		IDI-R	CACAAGACATATCTACAGCAATGACGACGTCTTACAGCGA
PEXP-F	TCGCTGTAAGACGTCGTCATTGCTGTAGATATGTCTTGTG
		PEXP-R	CACTGGAAGATCCGGgaattGCGGCCGCCACACGTTTCGGTGAGTATG
TERG19t-F	CATACTCACCGAAACGTGTGGCGGCCTGGAGCCCGTTGAGGGAGAT
		TERG19t-R	GGTGGTGGTTCTTCTAAACTATAGGCAGGGGGCAGAAACAAGAA
ERG19-F	CTATAGTTTAGAAGAACCACCACCCTTGCTGTTCTTCAGAGAAC
		ERG19-R	ACAAACTAACCCAGCTCTTCATGATCCACCAGGCCTCCAC
PFBAin-F	GTGGAGGCCTGGTGGATCATGAAGAGCTGGGTTAGTTTGT
		PFBAin-R	CACTGGAAGATCCGGgaattGCGGCCGCGTACGTAGCAACAACAGTGT
Txpr2t-F	ACACTGTTGTTGCTACGTACGCGGCCGCGACACGGGCATCTCACTTGC
		Txpr2t-R	GGTGGTGGTTCTTCTAAACTATAAGTAGGATCCAACTACGGAAC
ACHS2-F	TTATAGTTTAGAAGAACCACCACCGATGGTGAAGGGATGAACCA
		ACHS2-R	TTTTGCAGTACtaaccgcagTCTCCTGCACAGGCGCCCCA
PTEFin-F	TGGGGCGCCTGTGCAGGAGActgcggttaGTACTGCAAAA
		PTEFin-R	ACCACTGGAAGATCCGGgaattGCGGCCAGAGACCGGGTTGGCGGCGT

(12) Integration plasmid pUC-7h-HUH-ERG10-PTS-ERG13-PTS-tHMG1-PTS

Inserting into pUC-HUH as skeletonY. lipolyticaThe sequence of 1698bp at the upstream and 1642bp at the downstream of the 7h site of the chromosome of Polf; after digestion between 7h-up and hisG with the restriction enzyme EcoRI from Takara, the cells were linearized by agarose gel electrophoresis. The linearized pUC-HUH-7h plasmid is inserted into expression boxes of ERG10-PTS, ERG13-PTS and tHMG1-PTS in sequence to finally obtain an integrated plasmid pUC-7h-HUH-ERG10-PTS-ERG13-PTS-tHMG1-PTS, wherein the related primer nucleotide sequence is shown in Table 14, PTS is signal peptide of peroxisome and is respectively connected to the C ends of ERG10, ERG13 and tHMG1 genes, particularly GGTGGTGGTTCTTCTAAACTA; the nucleotide sequences of ERG10, ERG13 and tHMG1 are respectively shown as SEQ ID NO: 12. 10 and 6.

TABLE 14

7h-UP-F	gacgttgtaaaacgacggccagtgaattATTTAAATcagtacgagtatctTCACTC
		7h-UP-R	TGCACCACTGGAAGATCCGGgaattcAACACCGTCCCCGGCTGGGA
7h-DN-F	CCCTGATTGACTGGAACAGCTTAATTAATTCTGGACGTTCTTGTTAAG
		7h-DN-R	TTACGCCAAGCTTGGTACCTTATTTAAATCCGTGAAAATCCCGTGATC
Txpr2t-F	GGTGGTGGTTCTTCTAAACTATGAGTAGGATCCAACTACGGAACTTGT
		Txpr2t-R	TGCACCACTGGAAGATCCGGGAATTGACACGGGCATCTCACTTGC
NADH-HMGR-F	CAGCACTTTTTGCAGTACtaaccgcagACCGGCAAGACAGGACACA
		NADH-HMGR-R	TCATAGTTTAGAAGAACCACCACCGGTGTTTTCCAAAACCTGCT
PTEFin-F	TCCCAGCCGGGGACGGTGTTgaattcAGAGACCGGGTTGGCGGCGT
		PTEFin-R	TGTGTCCTGTCTTGCCGGTctgcggttaGTACTGCAAAAAGTGCTG
TERG13t-F	CGCAAGTGAGATGCCCGTGTCAATTCGGAGTAACAGCACGTATCGC
		TERG13t-R	GGTGGTGGTTCTTCTAAACTATAAATTGTTAAGATGCAACTAGG
ERG13-F	TTATAGTTTAGAAGAACCACCACCCTGCTTGATCTCGTACTTTC
		ERG13-R	GAATTAAACACACATCAACAatgtcGCAACCCCAGAACGT
PGPD-F	ACGTTCTGGGGTTGCgacatTGTTGATGTGTGTTTAATTC
		PGPD-R	TGCACCACTGGAAGATCCGGGAATTgCGCAGTAGGATGTCCTGCAC
TERG10t-F	GGTGGTGGTTCTTCTAAACTATAATTAGTATATAGATGATTTAT
		TERG10t-R	ATGCACCACTGGAAGATCCGGgaattGGACAATTAATTTGTCGCGT
ERG10-F	ACAAACTAACCCAGCTCTTCCGACTCACTCTGCCCCGACT
		ERG10-R	TTATAGTTTAGAAGAACCACCACCCTCGACAGAAGAGACCTTCT
PFBAin-F	CCGTGCAGGACATCCTACTGCGcAATTCGTACGTAGCAACAACAGTGT
		PFBAin-R	AGTCGGGGCAGAGTGAGTCGGAAGAGCTGGGTTAGTTTGT

(13) Integration plasmid pUC-intF2n-HUH-ERG12-PTS-ERG8-PTS-ERG20-PTS

Inserting into pUC-HUH as skeletonY. lipolyticaThe sequence of 1698bp upstream and 1642bp downstream of the intF2n locus of the chromosome of Polf; the DNA fragment was digested between intF2n-up and hisG with restriction enzyme EcoRI from Takara, and then linearized by agarose gel electrophoresis. Inserting the linearized pUC-HUH-intF2n plasmid into ERG12-PTS, ERG8-PTS and ERG20-PTS expression frames to finally obtain an integrated plasmid pUC-intF2n-HUH-ERG12-PTS-ERG8-PTS-ERG20-PTS, wherein the related primer nucleotide sequence is shown in Table 15, the PTS is a signal peptide of peroxisome and is respectively connected to the C ends of ERG12, ERG8 and ERG20 genes, and is specifically GGTGGTGGTTCTTCTAAACTA; the nucleotide sequences of ERG12, ERG8 and ERG20 are respectively shown as SEQ ID NO: 9. 7 and 8.

Watch 15

intF2n-UP-F	acgttgtaaaacgacggccagtgaattATTTAAATGAAATAGTCATGGTGGATA
		intF2n-UP-R	TGCACCACTGGAAGATCCGGgaattcTAAAACCCCAGATCCAAGTC
intF2n-DN-F	GGAACAGCTTAATTAAGGTACCAAGCTTCATCCCATAGTGTTGAAGGT
		intF2n-DN-R	acagcTATGACCATGATTACGCCAAGCTATTTAAATACCAAATCACACTATCAA
TERG20t-F	GGTGGTGGTTCTTCTAAACTATAGACACTTGAAAAAAACGCAAT
		TERG20t-R	TACGCCGCCAACCCGGTCTCTGAATTAGGACTCGGGTCAGAAGTTC
ERG20-F	GAATTAAACACACATCAACAATGTCCAAGGCGAAATTCGA
		ERG20-R	CTATAGTTTAGAAGAACCACCACCCTTCTGTCGCTTGTAAATCT
PGPD-F	GACTTGGATCTGGGGTTTTAGAATTCCGCAGTAGGATGTCCTGCAC
		PGPD-R	TCGAATTTCGCCTTGGACATTGTTGATGTGTGTTTAATTC
TERG12t-F	GGTGGTGGTTCTTCTAAACTATAATATTTAATTTTAATGAGTGA
		TERG12t-R	ATGCACCACTGGAAGATCCGGGAATTGAGGTATTGCTGTCTATAAC
ERG12-F	CACACAAGACATATCTACAGCATCTAGCATGGACTACATCATTTCGGC
		ERG12-R	TTATAGTTTAGAAGAACCACCACCATGGGTCCAGGGACCGATGT
PEXP-F	TGGACTTGGATCTGGGGTTTTAGAATTCCACACGTTTCGGTGAGTATG
		PEXP-R	GCCGAAATGATGTAGTCCATGCTAGATGCTGTAGATATGTCTTGTGTG
TERG8t-F	GGTGGTGGTTCTTCTAAACTATAGCACTGTGACAATGAGAAGGA
		TERG8t-R	TCATACTCACCGAAACGTGTGGAATTGAAACATAATGCATAACTGT
ERG8-F	GAGTATAAGAATCATTCAAAATGACCACCTATTCGGCTCC
		ERG8-R	CTATAGTTTAGAAGAACCACCACCCTTGAACCCCTTCTCGAGCC
PTEF-F	TGGACTTGGATCTGGGGTTTTAGAATTCAGAGACCGGGTTGGCGGCGT
		PTEF-R	GGAGCCGAATAGGTGGTCATTTTGAATGATTCTTATACTC

(14) Integration plasmid pUC-intE4-BUB-2NADH-tHMG1-PTS-ANT

Inserting into pUC-BUB as skeletonY. lipolyticaThe upstream 2078bp and the downstream 2023bp of the intE4 locus of the chromosome of the Polf; after digestion with the restriction enzyme HindIII from Takara, the mixture between intE4-up and Bilk was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intE4 plasmid was inserted into two NADH-THMG1-PTS expression cassettes in sequence, digested between intE4-dn and Bilk with restriction enzyme NotI from Takara, and then charged with agarose gelAnd (5) carrying out electrophoretic glue recovery linearization. Inserting the linearized pUC-BUB-intE4-2NADH-tHMG1-PTS plasmid into an ANT expression frame to finally obtain an integration plasmid pUC-intE4-BUB-2NADH-tHMG1-PTS-ANT, wherein the related primer nucleotide sequence is shown in Table 16, PTS is signal peptide of peroxisome and is respectively connected to the C end of an NADH-tHMG1 gene, and is GGTGGTGGTTCTTCTAAACTA; the nucleotide sequence of NADH-tHMG1 is shown as SEQ ID NO: 26, the nucleotide sequence of ANT is shown as SEQ ID NO: shown at 28.

TABLE 16

IntE4-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATGCCGCTACAATTCCGACCCTA
		IntE4-UP-R	AATGAAGTGTTCCACCCTAGaattcGTTTAAACTCCCCTCCCCACGGTGATGG
IntE4-DN-F	AGCGGCATGGAGTCGAGACCGCGGCCGCCACCGAGGGATAGGGAACAC
		IntE4-DN-R	cgaggtaccgagctcgaattGCGGCCATTTAAATAGGCTGTCAGGTGTCGTTTGATG
Txpr2t-F	ACCGTGGGGAGGGGAGTTTAAACgaattGACACGGGCATCTCACTTGC
		Txpr2t-R	GGTGGTGGTTCTTCTAAACTATGAGTAGGATCCAACTACGGAACTTGT
NADH-HMGR-F1	TCATAGTTTAGAAGAACCACCACCGGTGTTTTCCAAAACCTGCT
		NADH-HMGR-R1	ACCAGCACTTTTTGCAGTACtaaccgcagACCGGCAAGACAGGACACA
PTEFin-F	TGTGTCCTGTCTTGCCGGTctgcggttaGTACTGCAAAAAGTGCTGGT
		PTEFin-R	AAGTGTTCCACCCTAGGGAGACCgaattAGAGACCGGGTTGGCGGCGT
Tlip1t-F	GGTGGTGGTTCTTCTAAACTATGAaattcGGTTCATGAGAAGAT
		Tlip1t-R	AAGTGTTCCACCCTAGGGAGACCgaattAGTTGGAAGATATGATGGCC
NADH-HMGR-F2	CCCAACACAACACCACAGTAgaattATGACCGGCAAGACAGGACACAT
		NADH-HMGR-R2	TCATAGTTTAGAAGAACCACCACCGGTGTTTTCCAAAACCTGCT
PILV5-F	AATACGCCGCCAACCCGGTCTCTgaattAGGAGCGGGAGCGGAGTTGA
		PILV5-R	ATGTGTCCTGTCTTGCCGGTCATaattcTACTGTGGTGTTGTGTTGGG
TANTt-F	CCACCTTGATCAAGGGATAAGAATAGACAAGACATTGTAG
		TANTt-R	GTGTTCCCTATCCCTCGGTGGCGGCCCTCTGGCCACAACATGCCCT
ANT-F	CACAAGACATATCTACAGCAATGGCAGCTATTTCCAAAGA
		ANT-R	CTACAATGTCTTGTCTATTCTTATCCCTTGATCAAGGTGG
PEXP-F	AGCGGCATGGAGTCGAGACCGCGGCCGCccgtcgcttccacaggctct
		PEXP-R	AGTCTTTGGAAATAGCTGCCATTGCTGTAGATATGTCTTGTGT

(15) Integration plasmid pUC-intA-BUB-2ACHS2-PTS-POT1

Inserting into pUC-BUB as skeletonY. lipolyticaThe sequence of 1641bp upstream and 1608bp downstream of the intA locus of the chromosome of Polf; after digestion with restriction enzyme EcoRI from Takara, the mixture was linearized by agarose gel electrophoresis. The linearized pUC-HUH-intA plasmid was inserted into the ACHS2-PTS expression cassette, digested between intA-dn and Bilk with the restriction enzyme NotI from Takara, and then linearized by agarose gel electrophoresis gel recovery. Inserting the linearized pUC-BUB-intA-ACHS2-PTS plasmid into ACHS2-PTS and POT1 expression frames to obtain the integrated plasmid pUC-intA-BUB-2ACHS2-PTS-POT1, wherein the related primer nucleotide sequence is shown in Table 17, PTS is signal peptide of peroxisome, and is respectively connected to C end of ACHS2 gene and has the function of promoting cell growthThe body is GGTGGTGGTTCTTCTAAACTA; the nucleotide sequence of ACHS2 is shown as SEQ ID NO: 3, the nucleotide sequence of POT1 is shown as SEQ ID NO: shown at 21.

TABLE 17

intA-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATGGCCTGTGATTGGGAGCTGGGATG
		intA-UP-R	AATGAAGTGTTCCACCCTAGaattcGTTTAAACCGTCGCACTCGGCCGATATGG
intA-DN-F	CGAAGCGGCATGGAGTCGAGACCGCGGCCGCTGGGGCTGGCGTGTGAAGGA
		intA-DN-R	cgaggtaccgagctcgaattGCGGCCATTTAAATTATCCTCACTTGGGTACAGTTG
TXPR2t-F	CGGCCGAGTGCGACGGTTTAAACgaattGACACGGGCATCTCACTTGC
		TXPR2t-R	GGTGGTGGTTCTTCTAAACTATAAGTAGGATCCAACTACGGAAC
ACHS2-F1	TTATAGTTTAGAAGAACCACCACCGATGGTGAAGGGATGAACCA
		ACHS2-R1	AGCACTTTTTGCAGTACtaaccgcagTCTCCTGCACAGGCGCCCCA
PTEFin-F	TGGGGCGCCTGTGCAGGAGActgcggttaGTACTGCAAAAAGTGCT
		PTEFin-R	TGTTCCACCCTAGGGAGACCgaattcAGAGACCGGGTTGGCGGCGT
Tpex20t-F	GGTGGTGGTTCTTCTAAACTATAAGGAAGTGTGGATGGGGAAGT
		Tpex20t-R	TCCTTCACACGCCAGCCCCAGCGGCCAAGCTTTCAAGAGCTGGGAT
ACHS2-F2	CACAAGACATATCTACAGCAatgTCTCCTGCACAGGCGCCCCAGGT
		ACHS2-R2	TTATAGTTTAGAAGAACCACCACCGATGGTGAAGGGATGAACCA
PEXP-F	GGACCGAAGCGGCATGGAGTGGCCGCccgtcgcttccacaggctcttcG
		PEXP-R	ACCTGGGGCGCCTGTGCAGGAGAcatTGCTGTAGATATGTCTTGTG
Tlip1t-F	CTCTGGTTGTTGCCGAGTaaCTAGCGGTTCATGAGAAGATAAATATAt
		Tlip1t-R	gaagagcctgtggaagcgacggGCGGCCAGTTGGAAGATATGATGGCC
POT1-F	GAATTAAACACACATCAACAATGGACCGACTTAACAACCT
		POT1-R	aTATATTTATCTTCTCATGAACCGCTAGttACTCGGCAACAACCAGAG
PGPD-F	GGCATGGAGTCGAGACCGCGGCCGCGACGCAGTAGGATGTCCTGCACG
		PGPD-R	AGGTTGTTAAGTCGGTCCATTGTTGATGTGTGTTTAATTC

(16) Integration plasmid Puc-ERG9-HUH-CTR2

Inserting into pUC-HUH as skeletonY. lipolyticaThe upstream 2100bp sequence and the downstream 1700bp sequence of the ERG9 locus of the chromosome of Polf; after digestion with the restriction enzyme EcoRI from Takara, the DNA was linearized by agarose gel electrophoresis. The linearized pUC-HUH-ERG9 plasmid was inserted into P _CTR2 And finally obtaining an integration plasmid pUC-ERG9-HUH-CTR2, wherein the nucleotide sequence of the related primer is shown in a table 18, and the nucleotide sequence of CTR2 is shown in SEQ ID NO: 5, the nucleotide sequence of ERG9 is shown as SEQ ID NO: 4, respectively.

Watch 18

UP-F	cgttgtaaaacgacggccagtgaattATTTAAATggctGGGTGCTGCTGACCTT
		UP-R	TGCACCACTGGAAGATCCGGgaattcTCGACGTGGGGATAATTGAA
DN-F	AACAGCTTAATTAAGGTACCAAGCTATGGGAAAACTCATCGAACT
		DN-R	gcTATGACCATGATTACGCCAAGCTTATTTAAATcagaaagagattctagatca
PCTR2-F	ATTAAGGTACCAAGCTTGCGGCCGCACCAATGACCATCCAGTAAA
		PCTR2-R	CGATGAGTTTTCCCATGCGGCCATCCATGCTTCCGTGGTCGT

(17) Integration plasmid pUC-intE3-HUH-PEX10

Inserting into pUC-HUH as skeletonY. lipolyticaThe sequences of 1900bp upstream and 1800bp downstream of the intE3 locus of the chromosome of the Polf; after digestion between intE3-up and HisG with restriction enzyme EcoRI from Takara, the cells were linearized by agarose gel electrophoresis. The linearized pUC-HUH-intE3 plasmid was inserted into the PEX10 expression cassette to obtain the final integrated plasmid pUC-intE3-HUH-PEX10, wherein the nucleotide sequence of the primer is shown in Table 19, and the nucleotide sequence of PEX10 is shown in SEQ ID NO: shown at 23.

Watch 19

IntE3-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATctacttgtagctgatCTCCT
		IntE3-UP-R	TGCACCACTGGAAGATCCGGgaattcGTTTAAACTGTTTGATGTCTTGAGTTTG
IntE3-DN-F	TTAATTAAGGTACCAAGCTTGCGGCCGCGTATACccaatgtacttgta
		IntE3-DN-R	agcTATGACCATGATTACGCCAAGCTATTTAAATtacaagtacttgcagTCGAT
Tlip1t-F	ACTTGTTGCCTATCAGATAActagcGGTTCATGAGAAGATAAATATAt
		Tlip1t-R	ATGCACCACTGGAAGATCCGGgaattAGTTGGAAGATATGATGGCC
PEX10-F	TGAGTATAAGAATCATTCAAAgctagATGTGGGGAAGTTCACATGC
		PEX10-R	aTATATTTATCTTCTCATGAACCgctagTTATCTGATAGGCAACAAGT
PTEF-F	AAACAGTTTAAACgaattcAGAGACCGGGTTGGCGGCGTA
		PTEF-R	GCATGTGAACTTCCCCACATctagcTTTGAATGATTCTTATACTCA

(18) Integration plasmid pUC-intE3-HUH-POT1

Using pUC-intE3-HUH as a backbone, the region between intE3-up and HisG was digested with restriction enzyme EcoRI from Takara, and then linearized by agarose gel electrophoresis. Inserting the linearized pUC-HUH-intE3 plasmid into POT1 expression frame to obtain the integrated plasmid pUC-intE3-HUH-POT1, wherein the related primer nucleotide sequence is shown in Table 20, and the nucleotide sequence of POT1 is shown in SEQ ID NO: shown at 21.

Watch 20

Tlip1t-F	CTCTGGTTGTTGCCGAGTaaCTAGCGGTTCATGAGAAGATAAATAT
		Tlip1t-R	ATGCACCACTGGAAGATCCGGgaattAGTTGGAAGATATGATGGCC
POT1-F	TCTGAGTATAAGAATCATTCAAAGCTAGATGGACCGACTTAACAACCT
		POT1-R	ATATTTATCTTCTCATGAACCGCTAGttACTCGGCAACAACCAGAG
PTEF-F	AAACAGTTTAAACgaattcAGAGACCGGGTTGGCGGCGTA
		PTEF-R	AGGTTGTTAAGTCGGTCCATCTAGCTTTGAATGATTCTTATACTCAGA

(19) Integration plasmid pUC-intE3-HUH-MFE

Using pUC-intE3-HUH as a backbone, the region between intE3-up and HisG was digested with restriction enzyme EcoRI from Takara, and then linearized by agarose gel electrophoresis. Inserting the linearized pUC-HUH-intE3 plasmid into an MFE expression frame to finally obtain an integrated plasmid pUC-intE3-HUH-MFE, wherein the nucleotide sequence of the related primer is shown in a table 21, and the nucleotide sequence of MFE is shown in SEQ ID NO: 22, respectively.

TABLE 21

Tlip1t-F	CCAAGGATGCTAAGCTCTAActagcGGTTCATGAGAAGATAAATAT
		Tlip1t-R	ATGCACCACTGGAAGATCCGGgaattAGTTGGAAGATATGATGGCC
MFE-F	TGAGTATAAGAATCATTCAAAgctagatgtctgGAGAACTAAGATA
		MFE-R	ATATTTATCTTCTCATGAACCgctagTTAGAGCTTAGCATCCTTGG
PTEF-F	AAACAGTTTAAACgaattcAGAGACCGGGTTGGCGGCGTA
		PTEF-R	TATCTTAGTTCTCcagacatctagcTTTGAATGATTCTTATACTCA

(20) Integration plasmid pUC-MIS1-HUH

Inserting into pUC-HUH as skeletonY. lipolyticaSequences of upstream 2004bp and downstream 2012bp of MIS gene of Polf to obtain an integration plasmid pUC-MIS1-HUH, wherein the related primer nucleotide sequence is shown in Table 22, and the nucleotide sequence of MIS1 is shown in SEQ ID NO: as shown at 24.

TABLE 22

MIS-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATGTAGGTGGAATCGACAACCG
		MIS-UP-R	CATGCACCACTGGAAGATCCGGgaattcAGCGACGTTTGAGGTTTGTG
MIS-DN-F	GGAACAGCTTAATTAAGGTACCtctagaGTGGGATGACGAAGAGTATT
		MIS-DN-R	TGACCATGATTACGCCAAGCTTGGTACCATTTAAATATGCTCCCAGTGAGTTCTCA

(21) Integration plasmid pUC-CIT2-HUH

Inserting into pUC-HUH as skeletonY. lipolyticaThe sequence of upstream 2045bp and downstream 2266bp of CIT2 gene of Polf is integrated with plasmid pUC-CIT2-HUH to obtain integrated plasmid pUC-CIT2-HUH, wherein the related primer nucleotide sequence is shown in Table 23, and the nucleotide sequence of CIT2 is shown in SEQ ID NO: shown at 25.

TABLE 23

CIT2-UP-F	cgttgtaaaacgacggccagtgaattATTTAAATagCTAACACAGTGCGTTCCA
		CIT2-UP-R	CATGCACCACTGGAAGATCCGGgaattcGCAAATAATGACTTACGAAT
CIT2-DN-F	GGAACAGCTTAATTAAGGTACCtctagaGATTGATATTTCAGATTTGT
		CIT2-DN-R	TATGACCATGATTACGCCAAGCTTGGTACCATTTAAATTCTCTGAGAACATGCCCATC

(22) Integration plasmid pUC-IntC3-HUH-2ACHS2

Inserting into pUC-HUH as skeletonY. lipolyticaA sequence of 2142bp upstream and 2135bp downstream of the chromosome IntC3 site of Polf; after digestion with the restriction enzyme HindIII from Takara between IntC3-UP and hisG, linearization was recovered by agarose gel electrophoresis, an expression cassette of ACHS2 was inserted, and digestion with the restriction enzyme HindIII from Takara between IntC3-dn and hisG was followed by linearization recovery by agarose gel electrophoresis, and further insertion of an expression cassette of ACHS2 resulted in the integrated plasmid pUC-IntC3-HUH-2ACHS2, in which the nucleotide sequences of the primers involved are shown in Table 24, and the nucleotide sequence of ACHS2 is shown in SEQ ID NO: 3, respectively.

Watch 24

IntC3-UP-F	acGTTGTAAAACGACGGCCAGTGAATTATTTAAATACTAGCTAATAGTTCTTGT
		IntC3-UP-R	TGCACCACTGGAAGATCCGGGAATTCTACAGTGTCTATCAACGGGG
IntC3-DN-F	CTGATTGACTGGAACAGCTTAATTAAAAGCTTGCCATAGCACTATTGTAGAG
		IntC3-DN-R	acaGCTATGACCATGATTACGCCAAGCTATTTAAATAGGACCGCATTCTCATTTG
TCYC1t-F	TTCATCCCTTCACCATCTAATCATGTAATTAGTTATGTCA
		TCYC1t-R	GCCACTCTACAATAGTGCTATGGCAAGCTTGGTACGCAAATTAAAGCCTTCGAGC
ACHS2-F1	CCAGCACTTTTTGCAGTACtaaccgcagTCTCCTGCACAGGCGCCCCA
		ACHS2-R1	TGACATAACTAATTACATGATTAGATGGTGAAGGGATGAA
PTEFin-F	TTGACTGGAACAGCTTAATTAAGGTACCAGAGACCGGGTTGGCGGCGT
		PTEFin-R	TGGGGCGCCTGTGCAGGAGActgcggttaGTACTGCAAAAAGTGCTGG
Txpr2t-F	CCCCGTTGATAGACACTGTAGAATTCGACACGGGCATCTCACTTGC
		Txpr2t-R	TTCATCCCTTCACCATCTAAGTAGGATCCAACTACGGAACTTGTGT
ACHS2-F2	ACACAAGTTCCGTAGTTGGATCCTACTTAGATGGTGAAGGGATGAA
		ACHS2-R2	CACAAGACATATCTACAGCAatgTCTCCTGCACAGGCGCCCCA
PEXP-F	TGGGGCGCCTGTGCAGGAGAcatTGCTGTAGATATGTCTTGTG
		PEXP-R	CACTGGAAGATCCGGGAATTGCGGCCGCccgtcgcttccacaggctct

Note that the primers in each of tables 3-24 are specific, and only for the construction of the integrative plasmid plasmids corresponding to the tables, for example, the primers P are contained in tables 3, 4, 14 and 15 _GPD F, but for a different integrative plasmid, primer P _GPD The nucleotide sequence of-F is not identical.

Example 2

Construction of recombinant strains

Starting strainYarrowia lipolyticaPo1 f. delta. ku70 was cultured in YPD liquid medium for 12 hours to an OD600 of 0.8, and the cells were cultured using the Zymogen Frozen EZ Yeast Transformation Kit II Kit manufactured by Zymo Research CorporationThe 22 integration plasmids obtained in example 1 were transferred to the original strain, homologous recombination was performed, competent cells were prepared, and after each integration plasmid was transferred, screening was performed using a screening medium, and correct positive clones were identified by PCR.

It should be noted that the integration plasmids pUC-HUH-intE1-PK-PTA, pUC-HUH-intE2-ACL1-ACL2-AMPD, pUC-intE5-HUH-perCat2, pUC-intC1-HUH-AAD and pUC-intC1-HUH-ALDH obtained in example 1 belong to recombinant vectors associated with the enhancement of the flux of acetyl-CoA in the cytoplasm of the recombinant strain, which can be transferred one or more; similarly, the integration plasmids pUC-intE3-HUH-PEX10, pUC-intE3-HUH-POT1, pUC-intE3-HUH-MFE, pUC-MIS1-HUH and pUC-CIT2-HUH belong to recombinant vectors associated with the enhancement of the flux of acetyl-CoA in the peroxisome of the recombinant strains, which can also be transferred in one way or in multiple ways.

In this example, each encoding gene was transferred into the starting strainYarrowia lipolyticaThe scheme of Po1 f. delta. ku70 is shown in FIG. 1, and specifically, the sequence of transferring the integrative plasmid obtained in example 1 into the starting strain is as follows: pUC-intF-HUH-2ACHS2, pUC-intC-HUH-tHMG1-ERG13-IDI, pUC-ku70-HUH-ERG20-ERG12, pUC-SCP2-HUH-ERG10-ERG8-ERG19, pUC-intD-HUH-2tHMG1, pUC-intC3-HUH-2ACHS2, pUC-intC3-HUH-2ACHS2, pUC-intC1-HUH-AAD, pUC-intF 3-NADH-IDI-PTS-ERG 19-PTS-ACHS-pUC-7 h-HUH-ERG 4-pUC-PTS 10-HMG-10-685PTS, HMG-intF 2 10-685-10-ERG 685-10-685-10-HMG 10-685-10-685, pUC-intA-BUB-2ACHS2-PTS-POT1 and Puc-ERG9-HUH-CTR2 to finally obtain the recombinant strainYarrowia lipolyticaGQ3007, deposited at 14 days 3 and 2022 in China general microbiological culture Collection center (CGMCC) with the collection number of CGMCC No. 242560.

Example 3

(1) Fermentation production of alpha-humulene

Streaking recombinant strain GQ3007 on YPD solid culture medium, culturing for 2-3 days, picking single colony to YPD liquid culture medium, culturing at 30 deg.C and 220rpm to obtain recombinant strain seed solution, and mixing the recombinant strain seed solution at 1 vol%The inoculated amount was inoculated in 50mL of YPD ₆₀ Shaking culturing in fermentation culture medium at 30 deg.C and 220rpm for 24 hr, adding YPD ₆₀ And (3) continuously performing shake culture on n-dodecane with the volume of 25% of the fermentation medium for 72h to obtain GQ3007 fermentation liquor.

Starting strainYarrowia lipolyticaPo1f delta ku70, yarrowia lipolytica strain MYA2613, recombinant strain GQ1001 and recombinant strain GQ1014 are fermented according to the methods to obtain corresponding fermentation liquids.

(2) Fermentation culture product analysis

The recombinant strain GQ3007 and the original strain areYarrowia lipolyticaFermentation liquor corresponding to Po1f delta ku70, yarrowia lipolytica strain MYA2613, recombinant strain GQ1001 and recombinant strain GQ1014 is respectively transferred into a 50mL centrifuge tube, centrifuged for 5min at 8000rpm, an upper organic phase is collected and subjected to membrane filtration, and the yield of alpha-humulene is detected, and the result is shown in Table 25;

collecting thallus, freeze-drying, weighing the mass of the dried thallus, and calculating the dry cell weight DCW, wherein the results are shown in Table 25;

the powder of 10mg of dried cells was quantitatively weighed, resuspended in 500. mu.L of 0.5M sodium methoxide (sodium hydroxide in pure methanol), shaken at 1200rpm for 2h at room temperature, neutralized with 40. mu.L of concentrated sulfuric acid, extracted with 400. mu.L of dodecane, shaken at room temperature for 10min, centrifuged, and the dodecane layer collected, and then filmed, and analyzed by GC-MS for squalene in the recombinant strain, the results are shown in Table 25.

TABLE 25

Bacterial strains	DCW（g/L）	Yield of alpha-humulene (mg/g DCW)	Squalene content (mg/g DCW)
				Recombinant strain GQ3007	25	96	68.3
The starting strain Yarrowia lipolytica Po1 f. delta. ku70	28	0	13
				Yarrowia lipolytica strain MYA2613	27.5	0	16
Recombinant strain GQ1001	27.5	0.73	7
				Recombinant strain GQ1014	30	46.7	69.5

The results in table 25 show that the recombinant strain GQ3007 provided by the present invention has significantly increased α -humulene yield, and has the advantages of raw material regeneration, mild conditions, green production, no time and place constraints, etc.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

Sequence listing

<110> university of Nanjing university

<120> terpenoid-producing recombinant strain, construction method thereof, method for producing terpenoid through fermentation and application thereof

<130> 2022.4.13

<160> 29

<170> SIPOSequenceListing 1.0

<210> 1

<211> 555

<212> PRT

<213> Artificial Synthesis ()

<400> 1

Met Ser Pro Ala Gln Ala Pro Gln Val Ser Ala Pro Thr Gln Lys Ala

1 5 10 15

Ala Asp Glu Glu Ala Asn Arg Arg Ser Ala Gly Tyr His Pro Ser Phe

20 25 30

Trp Gly Glu Phe Phe Leu Thr His Ser Ser Gly Tyr Thr Lys Ser Asp

35 40 45

Thr Lys Ile Gln Gln Lys His Glu Glu Leu Lys Gln Gln Val Arg Gly

50 55 60

Met Ile Leu Asp Ala Ala Ala Asp Thr Ser Gln Lys Leu Glu Leu Ile

65 70 75 80

Asp Ala Ala Leu Arg Leu Gly Val Gly Tyr His Phe Glu Ala Glu Ile

85 90 95

Gln Ser Gln Leu Gln Lys Ile His Gly Gln Gly Ser Phe His Ser Asp

100 105 110

Leu Tyr Thr Ala Cys Ile Trp Phe Arg Val Leu Arg Gly Gln Gly Phe

115 120 125

Thr Val Ser Ala Asp Val Phe Asn Ile Met Lys Asn Lys Asp Gly Gly

130 135 140

Phe Glu Ala Arg Asp Ala Arg Thr Leu Leu Cys Leu Tyr Glu Thr Thr

145 150 155 160

His Leu Arg Ile Gln Gly Glu Gln Val Leu Glu Glu Ala Leu Glu Phe

165 170 175

Ser Arg Lys Gln Leu Gly Asp Leu Leu Ala Glu Leu Ser Ser Pro Leu

180 185 190

Ala Glu Tyr Val Asn Asn Ser Leu Glu Leu Pro Tyr His Lys Gly Met

195 200 205

Gln Arg Leu Glu Ala Arg Gln Tyr Ile Pro Ile Tyr Glu Ser Tyr Ala

210 215 220

Asn Lys Asn Asp Thr Leu Leu Gln Phe Ala Lys Leu Asp Phe Asn Leu

225 230 235 240

Leu Gln Ala Leu His Gln Ser Glu Ile Arg Glu Ile Thr Arg Trp Trp

245 250 255

Lys Asp Leu Asp Phe Lys Ala Arg Leu Pro Tyr Ala Arg Asp Arg Leu

260 265 270

Val Glu Cys Tyr Phe Trp Ile Leu Gly Val Gln Tyr Glu Pro Gln Tyr

275 280 285

Ser Ile Ser Arg Val Phe Leu Thr Lys Val Ile Ser Leu Ala Ser Val

290 295 300

Phe Asp Asp Thr Tyr Asp Ile Tyr Gly Thr Phe Asp Glu Leu Lys Leu

305 310 315 320

Leu Thr Asp Ala Val Glu Arg Trp Glu Pro Glu Ala Thr Asp Ser Leu

325 330 335

Pro Gly Tyr Met Gln Ile Leu Tyr Gly Ala Leu Leu Lys Val Phe Glu

340 345 350

Glu Tyr Lys Asp Glu Leu Ile Asn Ala Gly Gly Arg Asp Tyr Cys Leu

355 360 365

Tyr Tyr Ala Lys Glu Ala Met Lys Gly Leu Val Arg Ser Tyr His Thr

370 375 380

Glu Ala Val Ser Phe His Thr Gly Tyr Val Gln Asn Phe Glu Glu Tyr

385 390 395 400

Leu Asp Asn Ser Ala Val Ser Ser Gly Tyr Pro Met Leu Thr Val Glu

405 410 415

Ala Leu Ile Gly Met Gly Ala Pro Tyr Ala Thr Arg Glu Ser Leu Asp

420 425 430

Trp Ala Leu Lys Val Pro Lys Ile Ile Lys Ala Ser Ser Asp Ile Cys

435 440 445

Arg Leu Val Asp Asp Leu Arg Thr Tyr Lys Val Glu Glu Glu Arg Gly

450 455 460

Asp Ala Pro Ser Gly Val His Cys Tyr Met Arg Asp Tyr Asn Val Ser

465 470 475 480

Glu Glu Glu Ala Cys Thr Lys Ile Glu Glu Met Ile Asp Leu Ala Trp

485 490 495

Lys Ala Ile Asn Glu Glu Ile Gln Lys Pro Asn His Leu Pro Leu Pro

500 505 510

Ile Leu Leu Pro Ala Leu Asn Phe Ala Arg Met Met Glu Val Leu Tyr

515 520 525

Gln Asn Ile Asp Gly Tyr Thr Asn Ser Gly Gly Arg Thr Lys Glu Arg

530 535 540

Ile Ser Ser Leu Leu Val His Pro Phe Thr Ile

545 550 555

<210> 2

<211> 445

<212> PRT

<213> Artificial Synthesis ()

<400> 2

Met Gly Lys Leu Ile Glu Leu Leu Leu His Pro Ser Glu Leu Ser Ala

1 5 10 15

Ala Ile His Tyr Lys Leu Trp Arg Gln Pro Leu His Pro Arg Asp Leu

20 25 30

Ser Lys Glu Ser Thr Glu Leu Arg Arg Cys Tyr Glu Leu Leu Asp Val

35 40 45

Cys Ser Arg Ser Phe Ala Ala Val Ile Arg Glu Leu His Pro Glu Val

50 55 60

Arg Asp Ala Val Met Leu Phe Tyr Leu Ile Leu Arg Ala Leu Asp Thr

65 70 75 80

Ile Glu Asp Asp Met Thr Leu Ser Arg Asp Ile Lys Ile Pro Ile Leu

85 90 95

Arg Asp Phe Thr Lys Cys Met Lys Thr Pro Gly Trp Lys Phe Thr Asp

100 105 110

Ser Asp Pro Asn Glu Arg Asp Arg Val Val Leu Gln Glu Phe Pro Val

115 120 125

Val Met Thr Glu Phe Asn Lys Leu Lys Pro Lys Tyr Gln Glu Val Ile

130 135 140

Tyr Asp Ile Thr Asp Arg Met Gly Asn Gly Met Ala Asp Tyr Val Ile

145 150 155 160

Asp Asp Asp Phe Asn Asn Asn Gly Val Asp Thr Ile Ala Ala Tyr Asp

165 170 175

Leu Tyr Cys His His Val Ala Gly Ile Val Gly Glu Gly Leu Thr Arg

180 185 190

Ile Thr Ile Leu Ala Gly Phe Gly Thr Asp Val Leu His Glu Asn Pro

195 200 205

Arg Leu Gln Glu Ser Met Gly Leu Phe Leu Gln Lys Val Asn Ile Ile

210 215 220

Arg Asp Tyr Arg Glu Asp Ile Asp Val Asn Arg Ala Phe Trp Pro Arg

225 230 235 240

Glu Ile Trp His Lys Tyr Ala Glu Glu Met Arg Asp Phe Lys Asp Pro

245 250 255

Lys Tyr Ser Lys Lys Ala Leu His Cys Thr Ser Asp Leu Val Ala Asn

260 265 270

Ala Leu Gly His Ala Thr Asp Cys Leu Asp Tyr Leu Asp Asn Val Thr

275 280 285

Asp Pro Ser Thr Phe Thr Phe Cys Ala Ile Pro Gln Val Met Ala Ile

290 295 300

Ala Thr Leu Asp Leu Val Tyr Arg Asn Pro Asp Val Phe Gln Lys Asn

305 310 315 320

Val Lys Leu Arg Lys Gly Thr Thr Val Ser Leu Ile Leu Glu Ala Ser

325 330 335

Asn Val Ser Gly Val Cys Asp Ile Phe Thr Arg Tyr Ala Arg Lys Val

340 345 350

Tyr Lys Lys Ser Asp Pro Asn Asp Pro Asn Tyr Phe Arg Val Ser Val

355 360 365

Leu Cys Gly Lys Ile Glu Gln His Ala Ala Leu Ile Lys Arg Gln Arg

370 375 380

Gly Pro Pro Ala Lys Thr Ile Ala Gln Leu Glu Gly Glu Arg Lys Glu

385 390 395 400

Met Ala Leu Ser Leu Ile Val Cys Leu Ala Val Ile Phe Ser Met Ser

405 410 415

Gly Leu Met Ala Tyr Ile Ala Tyr Val Ser Gly Phe Arg Trp Ser Pro

420 425 430

Arg Glu Ile Phe Asp Ser Lys Met Phe Pro Leu Arg Asp

435 440 445

<210> 3

<211> 1665

<212> DNA

<213> Artificial Synthesis ()

<400> 3

atgtctcctg cacaggcgcc ccaggtgtct gccccaaccc agaaggctgc agacgaagag 60

gccaaccgac gatctgccgg ttaccatcct agtttctggg gcgagttctt cctcactcac 120

tccagcgggt acaccaagag cgacacgaag atccagcaga agcacgagga gctcaagcaa 180

caggtgcgag gaatgatcct tgatgctgcc gccgacactt cccagaagct ggaactcatc 240

gacgccgctc tccggcttgg tgttggttat cactttgagg ctgaaattca gagccaactg 300

caaaagattc atggccaagg atcgttccac agtgatcttt atactgcctg catatggttc 360

cgagtgctta gaggccaggg cttcacggtt tcagcagatg tcttcaacat catgaaaaac 420

aaggacggag gattcgaggc tcgtgatgcg agaaccctcc tgtgtctcta tgagactacc 480

catctgcgaa tccagggtga acaggtcctt gaagaggcgc tggagttttc cagaaaacag 540

ctgggagact tattagccga actgtctagc cctctggccg agtacgtcaa caactccttg 600

gagctcccgt accacaaggg catgcagagg ctcgaggcac gacagtacat tcccatctac 660

gagtcgtacg caaacaagaa cgacacacta ctgcagtttg ctaaactcga ttttaatctg 720

ctccaggccc tacaccagtc ggagattcga gaaatcaccc gatggtggaa ggacttggac 780

ttcaaggcac gtctcccgta tgctcgcgac cggttggtcg agtgctactt ttggatcctg 840

ggtgtccagt atgagcctca atactccata tcgagagtct ttctgacaaa ggtcatttca 900

cttgcatccg tatttgacga tacatacgac atttacggca ccttcgacga gctcaaactg 960

ttgactgatg ccgttgaaag atgggagccc gaggccactg atagtcttcc cggatacatg 1020

cagattctat atggagctct tctcaaggtg tttgaagagt acaaggatga gcttatcaat 1080

gctggaggcc gggattactg cctctattac gccaaggagg ccatgaaggg tctagtacgg 1140

tcctaccaca ccgaggccgt gagtttccat acaggctacg tgcagaattt tgaggaatat 1200

ctggacaact ctgctgtgtc ttcgggatac cccatgctga cggtggaagc attgattggt 1260

atgggggctc cttacgccac tcgagagtca ctggactggg ccctgaaggt tcccaagatc 1320

atcaaggctt cttctgacat ttgtcggctg gtcgacgacc ttaggacgta caaggtggag 1380

gaggagcgag gcgacgctcc gtccggcgtg cactgttaca tgcgagacta caacgtctcg 1440

gaggaagaag cttgcaccaa aattgaggag atgatcgatc tcgcctggaa ggccatcaac 1500

gaggagatcc aaaaacccaa ccaccttcca ctgcccattc tcctgcctgc gctcaacttc 1560

gctcgaatga tggaggttct gtaccagaac attgacggct acaccaattc gggtggacgt 1620

accaaggaac gcatttcatc cttactggtt catcccttca ccatc 1665

<210> 4

<211> 1338

<212> DNA

<213> Artificial Synthesis ()

<400> 4

atgggaaaac tcatcgaact gctcttgcac cctagcgaac tgtctgctgc tatccactac 60

aagctgtggc gtcagcctct gcatccccgc gatctttcca aggagtccac tgagctgcga 120

cgatgctatg agcttctaga cgtgtgctca cgatcatttg cagccgttat tcgagaactg 180

catcctgagg tgcgagacgc tgtaatgctg ttctatctga ttcttcgtgc tctcgacacg 240

attgaagacg atatgactct gtcgcgtgac atcaagatcc caattcttcg agacttcacg 300

aagtgcatga agacacctgg ctggaagttc accgactctg atcccaacga gcgagatcgt 360

gtggtgctac aggagtttcc tgtggttatg actgagttca acaagctcaa gcccaagtac 420

caggaagtaa tctacgacat taccgacaga atgggaaacg gaatggccga ttacgtcatt 480

gatgacgact tcaacaacaa cggcgtggac accattgccg cttatgatct gtactgtcat 540

catgttgccg gcatcgtggg tgagggcctt acccgaatta cgattctcgc tggttttgga 600

accgacgtgt tgcacgaaaa cccccgactt caggagtcta tgggcttgtt cttgcaaaag 660

gtcaacatca tccgagacta cagagaagac attgacgtga acagagcttt ctggcctcga 720

gaaatctggc acaagtacgc cgaagaaatg cgagatttca aggacccgaa gtattccaag 780

aaggccttgc attgcacctc cgatctggtt gcaaatgccc tcggacatgc cacagactgc 840

ctcgattacc tcgacaacgt caccgatcct tcaaccttca ctttctgcgc cattccccag 900

gtcatggcca ttgctaccct ggacttggtc taccgaaacc ccgacgtttt ccagaagaac 960

gtcaagttgc gcaagggaac tactgtcagc ctgattcttg aggccagcaa cgtttctgga 1020

gtatgtgaca ttttcactcg atacgcccgg aaggtgtaca agaagtccga ccccaatgac 1080

cccaactact tccgagtgtc tgtgctctgc ggtaagatcg agcagcatgc ggctctgatc 1140

aagagacagc gaggaccccc cgctaaaacc attgcacaac tggaaggtga acgaaaagag 1200

atggccctgt cgctaattgt ctgtttagca gttatcttct cgatgtctgg actgatggct 1260

tatatcgcct acgtgtctgg attcagatgg tcaccccgag agattttcga ctctaagatg 1320

tttcctctga gagattag 1338

<210> 5

<211> 408

<212> DNA

<213> Artificial Synthesis ()

<400> 5

accaatgacc atccagtaaa ctcttcccag aaaccctggt cttggagatc cgtccgagtt 60

gtatgagccc tgtccctggt ttttggcggt ggccagaatg tcgtagacca tgttgtgagt 120

gacttcgagg gagtttgctg agaataggaa cctcctggag ctggtcgtaa ggactccgat 180

accacacact ctttacagtt tgctcaaaga tgcatagtgt tccgctagct agtaatagta 240

taaatctatt cgcacataga ctcagatttt ccagctgaaa cgagcaaata tcaaactcaa 300

aaaagagaca tcagcagctc ataattccag tatttccatc tcttttttat tcaactccaa 360

caccatttct cacacacaaa aatgagccac gaccacggaa gcatggat 408

<210> 6

<211> 1503

<212> DNA

<213> Artificial Synthesis ()

<400> 6

atgacccagt ctgtgaaggt ggttgagaag cacgttccta tcgtcattga gaagcccagc 60

gagaaggagg aggacacctc ttctgaagac tccattgagc tgactgtcgg aaagcagccc 120

aagcccgtga ccgagacccg ttctctggac gacctagagg ctatcatgaa ggcaggtaag 180

accaagcttc tggaggacca cgaggttgtc aagctctctc tcgagggcaa gcttcctttg 240

tatgctcttg agaagcagct tggtgacaac acccgagctg ttggcatccg acgatctatc 300

atctcccagc agtctaatac caagacttta gagacctcaa agcttcctta cctgcactac 360

gactacgacc gtgtttttgg agcctgttgc gagaacgtta ttggttacat gcctctcccc 420

gttggtgttg ctggccccat gaacattgat ggcaagaact accacattcc tatggccacc 480

actgagggtt gtcttgttgc ctcaaccatg cgaggttgca aggccatcaa cgccggtggc 540

ggtgttacca ctgtgcttac tcaggacggt atgacacgag gtccttgtgt ttccttcccc 600

tctctcaagc gggctggagc cgctaagatc tggcttgatt ccgaggaggg tctcaagtcc 660

atgcgaaagg ccttcaactc cacctctcga tttgctcgtc tccagtctct tcactctacc 720

cttgctggta acctgctgtt tattcgattc cgaaccacca ctggtgatgc catgggcatg 780

aacatgatct ccaagggcgt cgaacactct ctggccgtca tggtcaagga gtacggcttc 840

cctgatatgg acattgtgtc tgtctcgggt aactactgca ctgacaagaa gcccgcagcg 900

atcaactgga tcgaaggccg aggcaagagt gttgttgccg aagccaccat ccctgctcac 960

attgtcaagt ctgttctcaa aagtgaggtt gacgctcttg ttgagctcaa catcagcaag 1020

aatctgatcg gtagtgccat ggctggctct gtgggaggtt tcaatgcaca cgccgcaaac 1080

ctggtgaccg ccatctacct tgccactggc caggatcctg ctcagaatgt cgagtcttcc 1140

aactgcatca cgctgatgag caacgtcgac ggtaacctgc tcatctccgt ttccatgcct 1200

tctatcgagg tcggtaccat tggtggaggt actattttgg agccccaggg ggctatgctg 1260

gagatgcttg gcgtgcgagg tcctcacatc gagacccccg gtgccaacgc ccaacagctt 1320

gctcgcatca ttgcttctgg agttcttgca gcggagcttt cgctgtgttc tgctcttgct 1380

gccggccatc ttgtgcaaag tcatatgacc cacaaccggt cccaggctcc tactccggcc 1440

aagcagtctc aggccgatct gcagcgtcta caaaacggtt cgaatatttg catacggtca 1500

tag 1503

<210> 7

<211> 1257

<212> DNA

<213> Artificial Synthesis ()

<400> 7

atgaccacct attcggctcc gggaaaggcc ctcctttgcg gcggttattt ggttattgat 60

ccggcgtatt cagcatacgt cgtgggcctc tcggcgcgta tttacgcgac agtttcggct 120

tccgaggcct ccaccacctc tgtccatgtc gtctctccgc agtttgacaa gggtgaatgg 180

acctacaact acacgaacgg ccagctgacg gccatcggac acaacccatt tgctcacgcg 240

gccgtcaaca ccgttctgca ttacgttcct cctcgaaacc tccacatcaa catcagcatc 300

aaaagtgaca acgcgtacca ctcgcaaatt gacagcacgc agagaggcca gtttgcatac 360

cacaaaaagg cgatccacga ggtgcctaaa acgggcctcg gtagctccgc tgctcttacc 420

accgttcttg tggcagcttt gctcaagtca tacggcattg atcccttgca taacacccac 480

ctcgttcaca acctgtccca ggttgcacac tgctcggcac agaagaagat tgggtctgga 540

tttgacgtgg cttcggccgt ttgtggctct ctagtctata gacgtttccc ggcggagtcc 600

gtgaacatgg tcattgcagc tgaagggacc tccgaatacg gggctctgtt gagaactacc 660

gttaatcaaa agtggaaggt gactctggaa ccatccttct tgccgccggg aatcagcctg 720

cttatgggag acgtccaggg aggatctgag actccaggta tggtggccaa ggtgatggca 780

tggcgaaaag caaagccccg agaagccgag atggtgtgga gagatctcaa cgctgccaac 840

atgctcatgg tcaagttgtt caacgacctg cgcaagctct ctctcactaa caacgaggcc 900

tacgaacaac ttttggccga ggctgctcct ctcaacgctc taaagatgat aatgttgcag 960

aaccctctcg gagaactagc acgatgcatt atcactattc gaaagcatct caagaagatg 1020

acacgggaga ctggtgctgc tattgagccg gatgagcagt ctgcattgct caacaagtgc 1080

aacacttata gtggagtcat tggaggtgtt gtgcctggag caggaggcta cgatgctatt 1140

tctcttctgg tgatcagctc tacggtgaac aatgtcaagc gagagagcca gggagtccaa 1200

tggatggagc tcaaggagga gaacgagggt ctgcggctcg agaaggggtt caagtag 1257

<210> 8

<211> 1035

<212> DNA

<213> Artificial Synthesis ()

<400> 8

atgtccaagg cgaaattcga aagcgtgttc ccccgaatct ccgaggagct ggtgcagctg 60

ctgcgagacg agggtctgcc ccaggatgcc gtgcagtggt tttccgactc acttcagtac 120

aactgtgtgg gtggaaagct caaccgaggc ctgtctgtgg tcgacaccta ccagctactg 180

accggcaaga aggagctcga tgacgaggag tactaccgac tcgcgctgct cggctggctg 240

attgagctgc tgcaggcgtt tttcctcgtg tcggacgaca ttatggatga gtccaagacc 300

cgacgaggcc agccctgctg gtacctcaag cccaaggtcg gcatgattgc catcaacgat 360

gctttcatgc tagagagtgg catctacatt ctgcttaaga agcatttccg acaggagaag 420

tactacattg accttgtcga gctgttccac gacatttcgt tcaagaccga gctgggccag 480

ctggtggatc ttctgactgc ccccgaggat gaggttgatc tcaaccggtt ctctctggac 540

aagcactcct ttattgtgcg atacaagact gcttactact ccttctacct gcccgttgtt 600

ctagccatgt acgtggccgg cattaccaac cccaaggacc tgcagcaggc catggatgtg 660

ctgatccctc tcggagagta cttccaggtc caggacgact accttgacaa ctttggagac 720

cccgagttca ttggtaagat cggcaccgac atccaggaca acaagtgctc ctggctcgtt 780

aacaaagccc ttcagaaggc cacccccgag cagcgacaga tcctcgagga caactacggc 840

gtcaaggaca agtccaagga gctcgtcatc aagaaactgt atgatgacat gaagattgag 900

caggactacc ttgactacga ggaggaggtt gttggcgaca tcaagaagaa gatcgagcag 960

gttgacgaga gccgaggctt caagaaggag gtgctcaacg ctttcctcgc caagatttac 1020

aagcgacaga agtag 1035

<210> 9

<211> 1350

<212> DNA

<213> Artificial Synthesis ()

<400> 9

atggactaca tcatttcggc gccaggcaaa gtgattctat ttggtgaaca tgccgctgtg 60

tttggtaagc ctgcgattgc agcagccatc gacttgcgaa catacctgct tgtcgaaacc 120

acaacatccg acaccccgac agtcacgttg gagtttccag acatccactt gaacttcaag 180

gtccaggtgg acaagctggc atctctcaca gcccagacca aggccgacca tctcaattgg 240

tcgactccca aaactctgga taagcacatt ttcgacagct tgtctagctt ggcgcttctg 300

gaagaacctg ggctcactaa ggtccagcag gccgctgttg tgtcgttctt gtacctctac 360

atccacctat gtcccccttc tgtgtgcgaa gattcatcaa actgggtagt tcgatcaacg 420

ctgcctatcg gcgcgggcct gggctcttcc gcatccattt gtgtctgttt ggctgcaggt 480

cttctggttc tcaacggcca gctgagcatt gaccaggcaa gagatttcaa gtccctgacc 540

gagaagcagc tgtctctggt ggacgactgg tccttcgtcg gtgaaatgtg cattcacggc 600

aacccgtcgg gcatcgacaa tgctgtggct actcagggag gtgctctgtt gttccagcga 660

cctaacaacc gagtccctct tgttgacatt cccgagatga agctgctgct taccaatacg 720

aagcatcctc gatctaccgc agacctggtt ggtggagtcg gagttctcac taaagagttt 780

ggctccatca tggatcccat catgacttca gtaggcgaga tttccaacca ggccatggag 840

atcatttcta gaggcaagaa gatggtggac cagtctaacc ttgagattga gcagggtatc 900

ttgcctcaac ccacctctga ggatgcctgc aacgtgatgg aagatggagc tactcttcaa 960

aagttgagag atatcggttc ggaaatgcag catctagtga gaatcaatca cggcctgctt 1020

atcgctatgg gtgtttccca cccgaagctc gaaatcattc gaactgcctc cattgtccac 1080

aacctgggtg agaccaagct cactggtgct ggaggaggag gttgcgccat cactctagtc 1140

acttctaaag acaagactgc gacccagctg gaggaaaatg tcattgcttt cacagaggag 1200

atggctaccc atggcttcga ggtgcacgag actactattg gtgccagagg agttggtatg 1260

tgcattgacc atccctctct caagactgtt gaagccttca agaaggtgga gcgggcggat 1320

ctcaaaaaca tcggtccctg gacccattag 1350

<210> 10

<211> 1341

<212> DNA

<213> Artificial Synthesis ()

<400> 10

atgtcgcaac cccagaacgt tggaatcaaa gccctcgaga tctacgtgcc ttctcgaatt 60

gtcaaccagg ctgagctcga gaagcacgac ggtgtcgctg ctggcaagta caccattggt 120

cttggtcaga ccaacatggc ctttgtcgac gacagagagg acatctattc ctttgccctg 180

accgccgtct ctcgactgct caagaacaac aacatcgacc ctgcatctat tggtcgaatc 240

gaggttggta ctgaaaccct tctggacaag tccaagtccg tcaagtctgt gctcatgcag 300

ctctttggcg agaacagcaa cattgagggt gtggacaacg tcaacgcctg ctacggagga 360

accaacgccc tgttcaacgc tatcaactgg gttgagggtc gatcttggga cggccgaaac 420

gccatcgtcg ttgccggtga cattgccctc tacgcaaagg gcgctgcccg acccaccgga 480

ggtgccggct gtgttgccat gctcattggc cccgacgctc ccctggttct tgacaacgtc 540

cacggatctt acttcgagca tgcctacgat ttctacaagc ctgatctgac ctccgagtac 600

ccctatgttg atggccacta ctccctgacc tgttacacaa aggccctcga caaggcctac 660

gctgcctaca acgcccgagc cgagaaggtc ggtctgttca aggactccga caagaagggt 720

gctgaccgat ttgactactc tgccttccac gtgcccacct gcaagcttgt caccaagtct 780

tacgctcgac ttctctacaa cgactacctc aacgacaaga gcctgtacga gggccaggtc 840

cccgaggagg ttgctgccgt ctcctacgat gcctctctca ccgacaagac cgtcgagaag 900

accttccttg gtattgccaa ggctcagtcc gccgagcgaa tggctccttc tctccaggga 960

cccaccaaca ccggtaacat gtacaccgcc tctgtgtacg cttctctcat ctctctgctg 1020

acttttgtcc ccgctgagca gctgcagggc aagcgaatct ctctcttctc ttacggatct 1080

ggtcttgctt ccactctttt ctctctgacc gtcaagggag acatttctcc catcgtcaag 1140

gcctgcgact tcaaggctaa gctcgatgac cgatccaccg agactcccgt cgactacgag 1200

gctgccaccg atctccgaga gaaggcccac ctcaagaaga actttgagcc ccagggagac 1260

atcaagcaca tcaagtctgg cgtctactac ctcaccaaca tcgatgacat gttccgacga 1320

aagtacgaga tcaagcagta g 1341

<210> 11

<211> 1164

<212> DNA

<213> Artificial Synthesis ()

<400> 11

atgatccacc aggcctccac caccgctccg gtgaacattg cgacactcaa gtactggggc 60

aagcgagacc ctgctctcaa tctgcccact aacaactcca tctccgtgac tttgtcgcag 120

gatgatctgc ggaccctcac cacagcctcg tgttcccctg atttcaccca ggacgagctg 180

tggctcaatg gcaagcagga ggacgtgagc ggcaaacgtc tggttgcgtg tttccgagag 240

ctgcgggctc tgcgacacaa aatggaggac tccgactctt ctctgcctaa gctggccgat 300

cagaagctca agatcgtgtc cgagaacaac ttccccaccg ccgctggtct cgcctcatcg 360

gctgctggct ttgccgccct gatccgagcc gttgcaaatc tctacgagct ccaggagacc 420

cccgagcagc tgtccattgt ggctcgacag ggctctggat ccgcctgtcg atctctctac 480

ggaggctacg tggcatggga aatgggcacc gagtctgacg gaagcgactc gcgagcggtc 540

cagatcgcca ccgccgacca ctggcccgag atgcgagccg ccatcctcgt tgtctctgcc 600

gacaagaagg acacgtcgtc cactaccggt atgcaggtga ctgtgcacac ttctcccctc 660

ttcaaggagc gagtcaccac tgtggttccc gagcggtttg cccagatgaa gaagtcgatt 720

ctggaccgag acttccccac ctttgccgag ctcaccatgc gagactcaaa ccagttccac 780

gccacctgtc tggactcgta tcctcccatt ttctacctca acgacgtgtc gcgagcctcc 840

attcgggtag ttgaggccat caacaaggct gccggagcca ccattgccgc ctacaccttt 900

gatgctggac ccaactgtgt catctactac gaggacaaga acgaggagct ggttctgggt 960

gctctcaagg ccattctggg ccgtgtggag ggatgggaga agcaccagtc tgtggacgcc 1020

aagaagattg atgttgacga gcggtgggag tccgagctgg ccaacggaat tcagcgggtg 1080

atccttacca aggttggagg agatcccgtg aagaccgctg agtcgcttat caacgaggat 1140

ggttctctga agaacagcaa gtag 1164

<210> 12

<211> 1194

<212> DNA

<213> Artificial Synthesis ()

<400> 12

atgcgactca ctctgccccg acttaacgcc gcctacattg taggagccgc ccgaactcct 60

gtcggcaagt tcaacggagc cctcaagtcc gtgtctgcca ttgacctcgg tatcaccgct 120

gccaaggccg ctgtccagcg atccaaggtc cccgccgacc agattgacga gtttctgttt 180

ggccaggtgc tgaccgccaa ctccggccag gcccccgccc gacaggtggt tatcaagggt 240

ggtttccccg agtccgtcga ggccaccacc atcaacaagg tgtgctcttc cggcctcaag 300

accgtggctc tggctgccca ggccatcaag gccggcgacc gaaacgttat cgtggccggt 360

ggaatggagt ccatgtccaa caccccctac tactccggtc gaggtcttgt tttcggcaac 420

cagaagctcg aggactccat cgtcaaggac ggtctctggg acccctacaa caacatccac 480

atgggcaact gctgcgagaa caccaacaag cgagacggca tcacccgaga gcagcaggac 540

gagtacgcca tcgagtccta ccgacgggcc aacgagtcca tcaagaacgg cgccttcaag 600

gacgagattg tccccgttga gatcaagacc cgaaagggca ccgtgactgt ctccgaggac 660

gaggagccca agggagccaa cgccgagaag ctcaagggcc tcaagcctgt ctttgacaag 720

cagggctccg tcactgccgg taacgcctcc cccatcaacg atggtgcttc tgccgttgtc 780

gttgcctctg gcaccaaggc caaggagctc ggtacccccg tgctcgccaa gattgtctct 840

tacgcagacg ccgccaccgc ccccattgac tttaccattg ctccctctct ggccattccc 900

gccgccctca agaaggctgg ccttaccaag gacgacattg ccctctggga gatcaacgag 960

gccttctccg gtgtcgctct cgccaacctc atgcgactcg gaattgacaa gtccaaggtc 1020

aacgtcaagg gtggagctgt tgctctcggc caccccattg gtgcctccgg taaccgaatc 1080

tttgtgactt tggtcaacgc cctcaaggag ggcgagtacg gagttgccgc catctgcaac 1140

ggtggaggag cttccaccgc catcgtcatc aagaaggtct cttctgtcga gtag 1194

<210> 13

<211> 813

<212> DNA

<213> Artificial Synthesis ()

<400> 13

atgacgacgt cttacagcga caaaatcaag agtatcagcg tgagctctgt ggctcagcag 60

tttcctgagg tggcgccgat tgcggacgtg tccaaggcta gccggcccag cacggagtcg 120

tcggactcgt cggccaagct atttgatggc cacgacgagg agcagatcaa gctgatggac 180

gagatctgtg tggtgctgga ctgggacgac aagccgattg gcggcgcgtc caaaaagtgc 240

tgtcatctga tggacaacat caacgacgga ctggtgcatc gggccttttc cgtgttcatg 300

ttcaacgacc gcggtgagct gcttctgcag cagcgggcgg cggaaaaaat cacctttgcc 360

aacatgtgga ccaacacgtg ctgctcgcat cctctggcgg tgcccagcga gatgggcggg 420

ctggatctgg agtcccggat ccagggcgcc aaaaacgccg cggtccggaa gcttgagcac 480

gagctgggaa tcgaccccaa ggccgttccg gcagacaagt tccatttcct cacccggatc 540

cactacgccg cgccctcctc gggcccctgg ggcgagcacg agattgacta cattctgttt 600

gtccggggcg accccgagct caaggtggtg gccaacgagg tccgcgatac cgtgtgggtg 660

tcgcagcagg gactcaagga catgatggcc gatcccaagc tggttttcac cccttggttc 720

cggctcattt gtgagcaggc gctgtttccc tggtgggacc agttggacaa tctgcccgcg 780

ggcgatgacg agattcggcg gtggatcaag tag 813

<210> 14

<211> 1404

<212> DNA

<213> Artificial Synthesis ()

<400> 14

atgaatcaac aggatattga acaggtggtg aaagcggtac tgctgaaaat gcaaagcagt 60

gacacgccgt ccgccgccgt tcatgagatg ggcgttttcg cgtccctgga tgacgccgtt 120

gcggcagcca aagtcgccca gcaagggtta aaaagcgtgg caatgcgcca gttagccatt 180

gctgccattc gtgaagcagg cgaaaaacac gccagagatt tagcggaact tgccgtcagt 240

gaaaccggca tggggcgcgt tgaagataaa tttgcaaaaa acgtcgctca ggcgcgcggc 300

acaccaggcg ttgagtgcct ctctccgcaa gtgctgactg gcgacaacgg cctgacccta 360

attgaaaacg caccctgggg cgtggtggct tcggtgacgc cttccactaa cccggcggca 420

accgtaatta acaacgccat cagcctgatt gccgcgggca acagcgtcat ttttgccccg 480

catccggcgg cgaaaaaagt ctcccagcgg gcgattacgc tgctcaacca ggcgattgtt 540

gccgcaggtg ggccggaaaa cttactggtt actgtggcaa atccggatat cgaaaccgcg 600

caacgcttgt tcaagtttcc gggtatcggc ctgctggtgg taaccggcgg cgaagcggta 660

gtagaagcgg cgcgtaaaca caccaataaa cgtctgattg ccgcaggcgc tggcaacccg 720

ccggtagtgg tggatgaaac cgccgacctc gcccgtgccg ctcagtccat cgtcaaaggc 780

gcttctttcg ataacaacat catttgtgcc gacgaaaagg tactgattgt tgttgatagc 840

gtagccgatg aactgatgcg tctgatggaa ggccagcacg cggtgaaact gaccgcagaa 900

caggcgcagc agctgcaacc ggtgttgctg aaaaatatcg acgagcgcgg aaaaggcacc 960

gtcagccgtg actgggttgg tcgcgatgcg gcgaaaatcg cggcggcaat cggcctgaac 1020

gtgccgcaag aaacgcgttt gctgtttgtg gaaaccactg cagaacatcc gtttgccgtg 1080

accgaactga tgatgccggt gctgcccgtc gtgcgcgtcg ccaacgtggc ggatgccatt 1140

gcgctggcgg tgaaactgga gggcggttgc caccacacgg cggcaatgca ctcgcgcaat 1200

atcgaaaaca tgaaccagat ggcgaacgcc attgatacca gcattttcgt taagaacgga 1260

ccgtgcattg ccgggctggg gctgggcggg gaaggctgga ccaccatgac catcaccacg 1320

ccaaccggtg aaggggtaac cagcgcgcgg acgtttgtcc gtctgcgtcg ctgtgtatta 1380

gtcgatgcgt ttcgcattgt ttaa 1404

<210> 15

<211> 1488

<212> DNA

<213> Artificial Synthesis ()

<400> 15

atgaattttc atcatctggc ttactggcag gataaagcgt taagtctcgc cattgaaaac 60

cgcttattta ttaacggtga atatactgct gcggcggaaa atgaaacctt tgaaaccgtt 120

gatccggtca cccaggcacc gctggcgaaa attgcccgcg gcaagagcgt cgatatcgac 180

cgtgcgatga gcgcagcacg cggcgtattt gaacgcggcg actggtcact ctcttctccg 240

gctaaacgta aagcggtact gaataaactc gccgatttaa tggaagccca cgccgaagag 300

ctggcactgc tggaaactct cgacaccggc aaaccgattc gtcacagtct gcgtgatgat 360

attcccggcg cggcgcgcgc cattcgctgg tacgccgaag cgatcgacaa agtgtatggc 420

gaagtggcga ccaccagtag ccatgagctg gcgatgatcg tgcgtgaacc ggtcggcgtg 480

attgccgcca tcgtgccgtg gaacttcccg ctgttgctga cttgctggaa actcggcccg 540

gcgctggcgg cgggaaacag cgtgattcta aaaccgtctg aaaaatcacc gctcagtgcg 600

attcgtctcg cggggctggc gaaagaagca ggcttgccgg atggtgtgtt gaacgtggtg 660

acgggttttg gtcatgaagc cgggcaggcg ctgtcgcgtc ataacgatat cgacgccatt 720

gcctttaccg gttcaacccg taccgggaaa cagctgctga aagatgcggg cgacagcaac 780

atgaaacgcg tctggctgga agcgggcggc aaaagcgcca acatcgtttt cgctgactgc 840

ccggatttgc aacaggcggc aagcgccacc gcagcaggca ttttctacaa ccagggacag 900

gtgtgcatcg ccggaacgcg cctgttgctg gaagagagca tcgccgatga attcttagcc 960

ctgttaaaac agcaggcgca aaactggcag ccgggccatc cacttgatcc cgcaaccacc 1020

atgggcacct taatcgactg cgcccacgcc gactcggtcc atagctttat tcgggaaggc 1080

gaaagcaaag ggcaactgtt gttggatggc cgtaacgccg ggctggctgc cgccatcggc 1140

ccgaccatct ttgtggatgt ggacccgaat gcgtccttaa gtcgcgaaga gattttcggt 1200

ccggtgctgg tggtcacgcg tttcacatca gaagaacagg cgctacagct tgccaacgac 1260

agccagtacg gccttggcgc ggcggtatgg acgcgcgacc tctcccgcgc gcaccgcatg 1320

agccgacgcc tgaaagccgg ttccgtcttc gtcaataact acaacgacgg cgatatgacc 1380

gtgccgtttg gcggctataa gcagagcggc aacggtcgcg acaaatccct gcatgccctt 1440

gaaaaattca ctgaactgaa aaccatctgg ataagcctgg aggcctga 1488

<210> 16

<211> 2013

<212> DNA

<213> Artificial Synthesis ()

<400> 16

atgaggatct gtcattcgag aactctctca aacttaaagg atcttccgat aacgtcaagg 60

agagcaatgc attcggccat tgtcaattac tccacccaaa aggcccaatt tcccgtagag 120

acaaataatg gggaacacta ttgggcggaa aagccgaaca aattctacca gaacaaaagg 180

cccaattttc aaggcattac ctttgctaaa caacaagact taccatcatt acccgtgccc 240

gaattgaagt ctacacttga caagtatttg caaaccatcc gcccattttg caatgatgta 300

gaaacttttg aaagacagca gctgttatgt aaggacttct cggagcacat ggggcctatc 360

ttacaagacc gattgaaaga gtatgccaac gataaaagaa actggatggc caagttttgg 420

gatgaacaat cctatttaca atacaacgat cctattgttc catacgtctc ttatttttat 480

tctcatatgc cattaccgaa tcatttatcg aagatcgata atgatccttt gattaaggct 540

actgcgatta tctcaaccgt ggttaaattc atcgaagcta ttaaagatga atctttaccc 600

gtagaaatta tcaaaggtat gccattttgt atgaatagtt tttcattgat gtttaacact 660

tcgagattgc ctggtaagcc agaggataac caagatacaa atatttttta ttcagtttat 720

gagaacaact ttgtaactat cgcttataaa gggaagtttt acaaactgat gacccatgac 780

gggaatgaca aaccgctttc cgaaaacgaa atctggaggc aactgtactc tgtggtattc 840

caaggatcgc agtccgatcc caaactaggt ggcattggtt ctctcacctc tttacctcgt 900

gatcaatggc gtgaagtaca tatggagctt atgaaggatc ctatttctca ggattcacta 960

gaaacaatcc ataagtcttc ctttatgcta tgtttggatc ttgaccaatc ccctgtcact 1020

ttggaagaaa agtcaagaaa ttgctggcac ggtgatggta ttaacagatt ctacgataag 1080

tctttacagt tcctagtcac cggtaatggt tcatcaggtt tcttagctga acactcgaag 1140

atggatggta cgccaacatt gtttttaaat aactacgttt gtcagcagtt gaataaacta 1200

gatgtggatg acttcatgag aaaagtaatt acgccatcat ctacggtggc aatgaaacct 1260

atggaactgc ccttcattat cacaccgaag attcataaag caatcgaatc tgcccaacta 1320

caatttaagg aaacaattgg tgagcatgac ctacgtgttt ggcactacaa caaatatgga 1380

aaaacgttta taaaacgcca tggcatgtca cctgatgcat ttattcaaca agttatccaa 1440

ctggcggttt tcaaatatct gaaacgacaa ctaccaactt acgaggctgc ttccacgaga 1500

aaatacttca aaggccgtac tgaaactggt agatctgtgt ccaccgcctc cttagaattt 1560

gtttctaaat ggcaaaatgg cgatgttcct attgcagaaa agattcaggc tttgaaacat 1620

tctgcaaaag agcattcgac gtacctgaaa aatgctgcaa atggtaatgg tgtcgatcgt 1680

catttcttcg gtctaaagaa tatgctaaaa tctaatgatg accaaattcc gccccttttc 1740

aaagatccct tatttaatta ttcttcaact tggttgatct ccacatctca actatcttcg 1800

gaatattttg acggttatgg ttggtcccaa gtaaatgaca acgggtttgg actggcatac 1860

atgttgaata acgagtggct gcatatcaat attgtcaaca aaccagccaa gagtggagcc 1920

agtgttaaca gattacacta ttatttatct caagctgctg atgaaatttt tgacgccttg 1980

gaaaatgaga ataaacgaaa agcaaagtta tga 2013

<210> 17

<211> 2610

<212> DNA

<213> Artificial Synthesis ()

<400> 17

atgccgcagc aagcaatgga tatcaagggc aaggccaagt ctgtgcccat gcccgaagaa 60

gacgacctgg actcgcattt tgtgggtccc atctctcctc gacctcacgg agcagacgag 120

attgctggct acgtgggctg cgaagacgac gaagacgagc ttgaagaact gggaatgctg 180

ggccgatctg cgtccaccca cttctcttac gcggaagaac gccacctcat cgaggttgat 240

gccaagtaca gagctcttca tggccatctg cctcatcagc actctcagag tcccgtgtcc 300

agatcttcgt catttgtgcg ggccgaaatg aaccaccccc ctcccccacc ctccagccac 360

acccaccaac agccagagga cgatgacgca tcttccactc gatctcgatc gtcgtctcga 420

gcttctggac gcaagttcaa cagaaacaga accaagtctg gatcttcgct gagcaagggt 480

ctccagcagc tcaacatgac cggatcgctc gaagaagagc cctacgagag cgatgacgat 540

gcccgactat ctgcggaaga cgacattgtc tatgatgcta cccagaaaga cacctgcaag 600

cccatatctc ctactctcaa acgcacccgc accaaggacg acatgaagaa catgtccatc 660

aacgacgtca aaatcaccac caccacagaa gatcctcttg tggcccagga gctgtccatg 720

atgttcgaaa aggtgcagta ctgccgagac ctccgagaca agtaccaaac cgtgtcgcta 780

cagaaggacg gagacaaccc caaggatgac aagacgcact ggaaaattta ccccgagcct 840

ccaccaccct cctggcacga gaccgaaaag cgattccgag gctcgtccaa aaaggagcac 900

caaaagaaag acccgacaat ggatgaattc aaattcgagg actgcgaaat ccccggaccc 960

aacgacatgg tcttcaagcg agatcctacc tgtgtctatc aggtctatga ggatgaaagc 1020

tctctcaacg aaaataagcc gtttgttgcc atcccctcaa tccgagatta ctacatggat 1080

ctggaggatc tcattgtggc ttcgtctgac ggacctgcca agtcttttgc tttccgacga 1140

ctgcaatatc tagaagccaa gtggaacctc tactacctgc tcaacgagta cacggagaca 1200

accgagtcca agaccaaccc ccatcgagac ttttacaacg tacgaaaggt cgacacccac 1260

gttcaccact ctgcctgcat gaaccagaag catctgctgc gattcatcaa atacaagatg 1320

aagaactgcc ctgatgaagt tgtcatccac cgagacggtc gggagctgac actctcccag 1380

gtgtttgagt cacttaactt gactgcctac gacctgtcta tcgataccct tgatatgcat 1440

gctcacaagg actcgttcca tcgatttgac aagttcaacc tcaagtacaa ccctgtcggt 1500

gagtctcgac tgcgagaaat cttcctaaag accgacaact acatccaggg tcgataccta 1560

gctgagatca caaaggaggt gttccaggat ctcgagaact cgaagtacca gatggcggag 1620

taccgtattt ccatctacgg tcggtccaag gacgagtggg acaagctggc tgcctgggtg 1680

ctggacaaca aactgttttc gcccaatgtt cggtggttga tccaggtgcc tcgactgtac 1740

gacatttaca agaaggctgg tctggttaac acctttgccg acattgtgca gaacgtcttt 1800

gagcctcttt tcgaggtcac caaggatccc agtacccatc ccaagctgca cgtgttcctg 1860

cagcgagttg tgggctttga ctctgtcgat gacgagtcga agctggaccg acgtttccac 1920

cgaaagttcc caactgcagc atactgggac agcgcacaga accctcccta ctcgtactgg 1980

cagtactatc tatacgccaa catggcctcc atcaacacct ggagacagcg tttgggctat 2040

aatacttttg agttgcgacc ccatgctgga gaggctggtg acccagagca tcttctgtgc 2100

acttatctgg ttgctcaggg tatcaaccac ggtattctgt tgcgaaaggt gcccttcatt 2160

cagtaccttt actacctgga ccagatcccc attgccatgt ctcccgtgtc caacaatgcg 2220

ctgttcctca cgttcgacaa gaaccccttc tactcatact tcaagcgggg tctcaacgtg 2280

tccttgtcat cggatgatcc tctgcagttt gcttacacta aggaggctct gattgaggag 2340

tactctgtgg ctgcgctcat ttacaagctt tccaacgtgg atatgtgtga gcttgctcga 2400

aactcggtac tgcaatctgg ctttgagcga atcatcaagg agcattggat cggcgaaaac 2460

tacgagatcc atggccccga gggcaacacc atccagaaga caaacgtgcc caatgtgcgt 2520

ctggccttcc gagacgagac tttgacccac gagcttgctc tggtggacaa gtacaccaat 2580

cttgaggagt ttgagcggct gcatggttaa 2610

<210> 18

<211> 1953

<212> DNA

<213> Artificial Synthesis ()

<400> 18

atgtctgcca acgagaacat ctcccgattc gacgcccctg tgggcaagga gcaccccgcc 60

tacgagctct tccataacca cacacgatct ttcgtctatg gtctccagcc tcgagcctgc 120

cagggtatgc tggacttcga cttcatctgt aagcgagaga acccctccgt ggccggtgtc 180

atctatccct tcggcggcca gttcgtcacc aagatgtact ggggcaccaa ggagactctt 240

ctccctgtct accagcaggt cgagaaggcc gctgccaagc accccgaggt cgatgtcgtg 300

gtcaactttg cctcctctcg atccgtctac tcctctacca tggagctgct cgagtacccc 360

cagttccgaa ccatcgccat tattgccgag ggtgtccccg agcgacgagc ccgagagatc 420

ctccacaagg cccagaagaa gggtgtgacc atcattggtc ccgctaccgt cggaggtatc 480

aagcccggtt gcttcaaggt tggaaacacc ggaggtatga tggacaacat tgtcgcctcc 540

aagctctacc gacccggctc cgttgcctac gtctccaagt ccggaggaat gtccaacgag 600

ctgaacaaca ttatctctca caccaccgac ggtgtctacg agggtattgc tattggtggt 660

gaccgatacc ctggtactac cttcattgac catatcctgc gatacgaggc cgaccccaag 720

tgtaagatca tcgtcctcct tggtgaggtt ggtggtgttg aggagtaccg agtcatcgag 780

gctgttaaga acggccagat caagaagccc atcgtcgctt gggccattgg tacttgtgcc 840

tccatgttca agactgaggt tcagttcggc cacgccggct ccatggccaa ctccgacctg 900

gagactgcca aggctaagaa cgccgccatg aagtctgctg gcttctacgt ccccgatacc 960

ttcgaggaca tgcccgaggt ccttgccgag ctctacgaga agatggtcgc caagggcgag 1020

ctgtctcgaa tctctgagcc tgaggtcccc aagatcccca ttgactactc ttgggcccag 1080

gagcttggtc ttatccgaaa gcccgctgct ttcatctcca ctatttccga tgaccgaggc 1140

caggagcttc tgtacgctgg catgcccatt tccgaggttt tcaaggagga cattggtatc 1200

ggcggtgtca tgtctctgct gtggttccga cgacgactcc ccgactacgc ctccaagttt 1260

cttgagatgg ttctcatgct tactgctgac cacggtcccg ccgtatccgg tgccatgaac 1320

accattatca ccacccgagc tggtaaggat ctcatttctt ccctggttgc tggtctcctg 1380

accattggta cccgattcgg aggtgctctt gacggtgctg ccaccgagtt caccactgcc 1440

tacgacaagg gtctgtcccc ccgacagttc gttgatacca tgcgaaagca gaacaagctg 1500

attcctggta ttggccatcg agtcaagtct cgaaacaacc ccgatttccg agtcgagctt 1560

gtcaaggact ttgttaagaa gaacttcccc tccacccagc tgctcgacta cgcccttgct 1620

gtcgaggagg tcaccacctc caagaaggac aacctgattc tgaacgttga cggtgctatt 1680

gctgtttctt ttgtcgatct catgcgatct tgcggtgcct ttactgtgga ggagactgag 1740

gactacctca agaacggtgt tctcaacggt ctgttcgttc tcggtcgatc cattggtctc 1800

attgcccacc atctcgatca gaagcgactc aagaccggtc tgtaccgaca tccttgggac 1860

gatatcacct acctggttgg ccaggaggct atccagaaga agcgagtcga gatcagcgcc 1920

ggcgacgttt ccaaggccaa gactcgatca tag 1953

<210> 19

<211> 2442

<212> DNA

<213> Artificial Synthesis ()

<400> 19

atggctgatt tcgattctaa ggaatatttg gaattggttg ataagtggtg gagagcaaca 60

aattacttgt cagctggtat gattttcttg aagtcaaacc cattattttc tgttacaaac 120

actccaatta aagctgaaga tgttaaggtt aagccaatcg gtcattgggg tactatctct 180

ggtcaaacat ttttatacgc acatgctaac agattgatta ataagtacgg tttgaatatg 240

ttttacgttg gtggtccagg tcatggtggt caagttatgg ttactaatgc atacttggat 300

ggtgcttata ctgaagatta cccagaaatt acacaagata ttgaaggcat gtcacatttg 360

tttaaaagat tttctttccc aggtggtatc ggttcacata tgacagctca aactccaggt 420

tcattgcatg aaggtggtga attgggttat tctttatcac atgcatttgg tgctgtttta 480

gataatccag atcaagttgc atttgctgtt gttggtgacg gtgaagcaga aacaggtcca 540

tctatggctt catggcattc tattaaattc ttgaacgcta aaaatgatgg tgctgtttta 600

ccagttttgg atttgaacgg ttttaaaatc tctaatccaa caattttctc tagaatgtct 660

gatgaagaaa tcactaagtt tttcgaaggt ttgggttact ctccaagatt cattgaaaac 720

gatgatatcc atgattacgc aacttaccat caattggctg caaacatctt ggatcaagct 780

atcgaagata tccaagcaat ccaaaacgat gctagagaaa acggtaaata ccaagatggt 840

gaaattccag catggccagt tattattgct agattgccaa aaggttgggg tggtccaaca 900

catgatgcat ctaacaaccc aatcgaaaac tcttttagag ctcatcaagt tccattgcca 960

ttagaacaac atgatttggc tactttacca gaattcgaag attggatgaa ctcttacaag 1020

ccagaagaat tgtttaatgc tgatggttca ttgaaggatg aattgaaggc aatcgctcca 1080

aagggtgaca agagaatgtc tgcaaaccca atcactaacg gtggtgctga tagatcagat 1140

ttgaagttgc caaactggag agaattcgca aacgatatca acgatgatac acgtggtaaa 1200

gaattcgctg attctaagag aaacatggat atggcaactt tgtctaacta cttaggtgct 1260

gtttcacaat tgaacccaac aagattcaga tttttcggtc cagatgaaac tatgtctaat 1320

agattgtggg gtttgtttaa tgttacacca agacaatgga tggaagaaat taaagaacca 1380

caagatcaat tgttgtcacc aactggtaga atcatcgatt cacaattgtc tgaacatcaa 1440

gcagaaggtt ggttggaagg ttacacattg actggtagag ttggtatctt cgcttcatac 1500

gaatcatttt tgagagttgt tgatacaatg gttactcaac atttcaagtg gttgagacat 1560

gcatctgaac aagcttggag aaacgattac ccatctttga atttgatcgc aacatcaact 1620

gcttttcaac aagatcataa tggttacact catcaagatc caggcatgtt gacacatttg 1680

gcagaaaaga aatctaactt catcagagaa tatttgccag ctgatggtaa ttctttgtta 1740

gcagttcaag aaagagcttt ttcagaaaga cataaggtta atttgttaat tgcttcaaaa 1800

caaccaagac aacaatggtt tactgttgaa gaagcagaag ttttggctaa cgaaggtttg 1860

aagatcatcg attgggcatc tacagctcca tcttcagatg ttgatattac ttttgcatca 1920

gctggtacag aaccaactat tgaaacattg gctgcattgt ggttgattaa tcaagctttc 1980

ccagatgtta agtttagata cgttaacgtt gttgaattgt tgagattgca aaagaaatct 2040

gaaccaaaca tgaacgatga aagagaattg tcagcagaag aattcaataa gtacttccaa 2100

gctgatacac cagttatttt cggtttccat gcttacgaaa atttgatcga atcatttttc 2160

tttgaaagaa agtttactgg tgacgtttat gttcatggtt acagagaaga tggtgacatc 2220

actacaactt acgatatgag agtttactct catttggata gatttcatca agcaaaagaa 2280

gctgcagaaa tcttgtcagc taacggtaaa atcgatcaag ctgcagctga tacttttatt 2340

gcaaagatgg atgatacatt ggctaagcat ttccaagtta ctagaaacga aggtagagat 2400

atcgaagaat tcactgattg gacatggtct ccattaaaat aa 2442

<210> 20

<211> 1002

<212> DNA

<213> Artificial Synthesis ()

<400> 20

atgaagttga tggaaaacat cttcggtttg gctaaggcag ataaaaagaa aattgttttg 60

gcagaaggtg aagaagaaag aaacatcaga gcttctgaag aaatcatcag agatggtatc 120

gcagatatca tcttggttgg ttctgaatca gttattaaag aaaacgctgc aaagtttggt 180

gttaatttgg ctggtgttga aatcgttgat ccagaaactt cttcaaagac agcaggttat 240

gctaacgcat tctacgaaat cagaaagaat aagggtgtta ctttggaaaa ggctgataag 300

atcgttagag atccaatcta tttcgcaaca atgatggtta agttgggtga cgcagatggt 360

ttagtttctg gtgctattca tactactggt gacttgttaa gaccaggttt gcaaattgtt 420

aaaactgttc caggtgcttc tgttgtttct tcagttttct tgatgtcagt tccagattgt 480

gaatacggtg aagatggttt cttgttattt gcagattgtg ctgttaatgt ttgtccaact 540

gcagaagaat tgtcttcaat tgctatcact acagcagaaa cagctaaaaa tttgtgtaag 600

atcgaaccaa gagttgctat gttgtctttt tcaacaatgg gttctgcatc acatgaattg 660

gttgataagg ttactaaggc tacaaagttg gcaaaagaag ctagaccaga tttggatatt 720

gatggtgaat tgcaattaga tgcttctttg gttaagaaag ttgcagattt gaaagctcca 780

ggttcaaaag ttgctggtaa agctaacgtt ttgatcttcc cagatatcca agctggtaac 840

atcggttaca agttggttca aagatttgct aaagcagaag ctattggtcc aatctgtcaa 900

ggtttcgcta agccaattaa tgatttgtct agaggttgtt cagttgatga tatcgttaag 960

gttgttgcag ttactgctgt tcaagcacaa gctcaaggtt aa 1002

<210> 21

<211> 1245

<212> DNA

<213> Artificial Synthesis ()

<400> 21

atggaccgac ttaacaacct cgccacccag ctcgagcaga accccgccaa gggcctcgac 60

gctatcacct ccaagaaccc cgatgacgtt gtcatcaccg ccgcctaccg aactgcccac 120

accaagggag gcaagggtct gttcaaggac acctcttctt ccgagctgct cgcctctctg 180

ctggagggcc tcgtcaagga gtccaagatc gaccccaagc tcatcggtga tgtcgtctgc 240

ggaaacgttc tcgctgccgg tgccggtgcc actgagcacc gagctgcctg ccttgttgcc 300

ggcatccccg agaccgttcc cttcgtcgct ctcaaccgac agtgctcctc tggtctgatg 360

gccgtcaacg acgttgccaa caagatccga gccggccaga ttgacattgg tatcggctgt 420

ggtgtcgagt ccatgtccaa ccagtacggt cccaactccg tcaccccctt ctccaacaag 480

ttccagaaca acgaggaggc taagaagtgc ctgatcccca tgggtatcac ttccgagaac 540

gttgccgcca agtacaacgt gtcccgaaag gcccaggacg cctttgctgc caagtcctac 600

gagaaggccg ccgctgccca ggccgccggc aagttcgacc aggagatcct ccccatcaag 660

accactgttc tcgatgatga tgacaacgag aaggaggtta ccgtcaacaa ggacgacggt 720

atccgacctg gtgtcaccgc cgagaagctc ggcaagctca agcctgcttt ctccgccgag 780

ggaaccaccc acgctggtaa cgcctctcag atctccgacg gtgccggagc cgttctcctc 840

atgcgacgat ctgttgccga gaagcttggc cagcccatcc ttgccaagtt tgtccactgc 900

aagaccgtcg gtgttccccc cgagctcatg ggaattggcc ccgcttacgc cattcctgct 960

gtccttgagg accttggtct gaccgtcaac gacgttgacg ttttcgagat caacgaggct 1020

ttcgcttccc aggctctgtt ctccatccag cattgtggaa tcgacgagtc caaggtcaac 1080

ccccgaggtg gtgccattgc tattggccac cctctgggag ccaccggtgc tcgacagttt 1140

gccactctgc tctccgagct taaggagtct ggcaagaagg tcggtgtcac ctccatgtgc 1200

attggtaccg gtatgggtgc cgcttctctg gttgttgccg agtaa 1245

<210> 22

<211> 2780

<212> DNA

<213> Artificial Synthesis ()

<400> 22

atgtctggag aactaagata cgacggaaag gtcgtcattg ttaccggtgc cggtggcggt 60

ctcggtaagg catacgccct tttctacggc tctcgaggag cctctgttgt tgtcaacgat 120

cttggtggcg acttcaaggg cgacggtgcc caggctggca gtggcaagcg agtgagtatc 180

attacaagcg cagcgaagcg aaacgaccca aaacgacacc acacagaagg ataaactaac 240

accaggttgc cgatgttgtc gtcgacgaga ttgtttccaa gggaggcaag gctgttgcta 300

actacgactc tgtcgagaac ggtgacaaga ttgtcgagac tgccgtcaag gcttttggct 360

ccgtccacat tgtcatcaac aacgccggta ttctccgaga tatttccttc aagaagatga 420

ccgacaagga ctgggatctt gtctacaagg tccacgtttt cggtgcctac aaggttaccc 480

gagctgcctg gccttacttc cgaaagcaga agtacggtcg agttatctct acctcttccg 540

ctgctggtct ttacggaaac ttcggccaga ccaactactc cgctgccaag ctcgccctgg 600

ttggtttcgg tgagactctc gccaaggagg gtgccaagta caacattact tccaacgtca 660

tcgctcctct tgctgcttcc cgaatgaccg agacagtcat gcccgaggat atcctcaagc 720

tcctcaagcc tgagtacgtt gttcctctgg tcggctacct cacccacgac tctgtcaccg 780

agtcttatgg tatttacgag gtcggtgctg gttacatggc taaaatccga tgggagcgag 840

gcaacggtgc tgttttcaag ggcgacgaca ctttcacccc gtctgctatt ctgaagcgat 900

gggatgaggt cacctctttt gagagcccca cctaccctaa cggccctgct gacttcttca 960

aatacgctga ggagtctgtt aagcgacccg agaaccccca gggacctacc gtctccttca 1020

aggaccaggt tgtcattgtc actggagccg gtgctggcat tggccgagct tactctcacc 1080

tccttgctaa gcttggtgcc aaggtcgttg ttaacgattt cggtaaccct cagaaggttg 1140

tcgatgaaat taaggccctc ggtggtatcg ccgtcgctga caagaacaac gtcatccacg 1200

gtgagaaggt tgttcagacc gctatcgacg ccttcggtgc tgtccacgcc gttgtcaaca 1260

acgctggtat tctccgagac aagtctttcg ccaacatgga tgatgagatg tggcagctga 1320

tctttgatgt ccacctcaac ggtacttact ccgttaccaa ggccgcgtgg ccccacttcc 1380

ttaagcagaa gtacggccgt gtcatcaaca ccacctcaac ttctggtatc tacggtaact 1440

tcggccaggc caactactct gccgccaagg ctggtatcct cggtttctcc cgagctcttg 1500

ctcgagaggg tgagaagtac aacattcttg tcaacaccat tgcccctaac gctggtactg 1560

ccatgactgc ttctgtcttc actgaggaga tgctcgagct cttcaagccc gatttcatcg 1620

cacccatcac cgtcctgctt gcttccgatc aggctcccgt caccggtgat ctgtttgaga 1680

ctggttctgc ttggatcgga cagactcgat ggcagcgagc tggtggtaag gccttcaaca 1740

ccaagaaggg tgtcaccccc gaaatggttc gagacagctg ggctaagatc gtcgacttcg 1800

atgatggtaa ctccacccat cccaccactc cctccgagtc tactactcag attcttgaga 1860

acatcttcaa cgtgcctgat gaggaggttg aggagactgc tctcgttgct ggtcccggtg 1920

gtcccggtat cctcaacaag gagggcgaac ctttcgacta cacttacact taccgagacc 1980

tcattcttta caaccttggt ctcggtgcca aggctaatga gctcaagtat gtcttcgagg 2040

gtgatgatga cttccagacc gtgcccactt tcggtgttat cccttacatg ggtggcctca 2100

tcactaccaa ctatggcgac ttcgttccta acttcaaccc tatgatgctt ctccacggtg 2160

agcagtacct tgaaatccga cagtggccta ttcctaccaa tgctacattg gagaacaagg 2220

ctaaggtcat cgatgtcgtt gacaagggca aggctgccct ccttgtcact gctaccacca 2280

ccacgaacaa ggagactggt gaggaggttt tctacaacga gtcttctctc ttcatccgag 2340

gctctggtgg tttcggtggt aagtctaccg gtactgaccg tggcgctgcc actgctgcca 2400

acaagccccc tgctcgagct cctgacttcg ttaaggagat caagatccag gaggaccagg 2460

ctgccattta ccgactttct ggtgattaca accctcttca catcgaccct gcttttgctg 2520

ctgttggtaa ctttgaccga cctattctcc acggtctctg ctcttttggt gtctccggta 2580

aggctcttta cgatcagttt ggtcctttca agaacgctaa ggtccgattt gctggtcacg 2640

tcttccctgg tgagaccctg aaggttgagg gctggaagga gggcaacaag gtcattttcc 2700

agaccaaggt tgttgagcga ggtactaccg ccatcagcaa tgccgccatt gagctcttcc 2760

ccaaggatgc taagctctaa 2780

<210> 23

<211> 1134

<212> DNA

<213> Artificial Synthesis ()

<400> 23

atgtggggaa gttcacatgc attcgctggt gaatctgatc tgacactaca actacacacc 60

aggtccaaca tgagcgacaa tacgacaatc aaaaagccga tccgacccaa accgatccgg 120

acggaacgcc tgccttacgc tggggccgca gaaatcatcc gagccaacca gaaagaccac 180

tactttgagt ccgtgcttga acagcatctc gtcacgtttc tgcagaaatg gaagggagta 240

cgatttatcc accagtacaa ggaggagctg gagacggcgt ccaagtttgc atatctcggt 300

ttgtgtacgc ttgtgggctc caagactctc ggagaagagt acaccaatct catgtacact 360

atcagagacc gaacagctct accgggggtg gtgagacggt ttggctacgt gctttccaac 420

actctgtttc catacctgtt tgtgcgctac atgggcaagt tgcgcgccaa actgatgcgc 480

gagtatcccc atctggtgga gtacgacgaa gatgagcctg tgcccagccc ggaaacatgg 540

aaggagcggg tcatcaagac gtttgtgaac aagtttgaca agttcacggc gctggagggg 600

tttaccgcga tccacttggc gattttctac gtctacggct cgtactacca gctcagtaag 660

cggatctggg gcatgcgtta tgtatttgga caccgactgg acaagaatga gcctcgaatc 720

ggttacgaga tgctcggtct gctgattttc gcccggtttg ccacgtcatt tgtgcagacg 780

ggaagagagt acctcggagc gctgctggaa aagagcgtgg agaaagaggc aggggagaag 840

gaagatgaaa aggaagcggt tgtgccgaaa aagaagtcgt caattccgtt cattgaggat 900

acagaagggg agacggaaga caagatcgat ctggaggacc ctcgacagct caagttcatt 960

cctgaggcgt ccagagcgtg cactctgtgt ctgtcataca ttagtgcgcc ggcatgtacg 1020

ccatgtggac actttttctg ttgggactgt atttccgaat gggtgagaga gaagcccgag 1080

tgtcccttgt gtcggcaggg tgtgagagag cagaacttgt tgcctatcag ataa 1134

<210> 24

<211> 1596

<212> DNA

<213> Artificial Synthesis ()

<400> 24

atgacagtca actccacttt tagatcggca tcaacttccc caaaactggg caaaaccagc 60

caggcagaca tcctgagccc cgaggcccaa aagttcctgg ttgaactcca cagcaacttc 120

aaccagcgac gtctggagct ccttgatctg cgtcagaaga accagctcaa gctcgatgca 180

ggcgaaatcc ccacgtatcc cacggaaaca gcagacatcc gagcagacaa gtcgtggaca 240

ggtccatctc tggctcccgg tctccatgac cgacgggtcg aaatcactgg ccccccagac 300

cgaaagatga tcatcaacgc cctcaacaca aacgtcgcca cctacatgtc cgatttcgag 360

gactcccaag cccccacctg ggacaactgt ctcgatgggc aagtcaacct gtacgatgcc 420

atccgaaacc aggttgattt cgacacagag aagaaaccct acaagctgac tacaaagaag 480

tggaccgagg ggacctactc tagaggctcc acggacactc gacccactct tttggtgcgc 540

cctagaggct ggcacatgct cgaaagccat gttcagatcg atggacagag catgtctggg 600

tctctgttcg actttggact cttcttcttc aacaacgcca aggctctgat tgaggctggc 660

cgaggccctt acttttacct ccccaagatg gagcattatc tcgaggctcg actctggaat 720

gatgtctttg ttttctctca aaactactgc ggaatccccc agggcaccat tcgagctact 780

tgtctgattg agactcttcc tgcagctctg cacatggagg agatcatcta cgagctgcga 840

gatcactcta ccggcctcaa ctgtggtcga tgggactaca tgttctcagt tatcaagcgg 900

ttccgaaacc agcccgagaa gctgcttcct gaccgaaaga tgatcaccat gaccgttccc 960

ttcatgaacg cttacgtgac tcgtctggtt cacgtgtgtc acaaacgaaa ggtgcatgcc 1020

atgggaggta tggctgccat cattcctctc aaggatgctg cggagaacgc ccttgccatg 1080

gagaaggtca aggctgacaa acacagagag gcctctgcag gctgtgacgg tacctggatc 1140

gctcatccag gtttggctga gactgccacc aaggagtttg acgagttgat gccaggggaa 1200

aaccaatttg atttcgtcgg agaggacgtt ccctccgaga agctgttgga tactaccatt 1260

gaaggctttg ccatcaccaa ggagggtctt caggagaatg tctacattgg tctgcgctac 1320

atggaggcat ggctgcgagg tttgggatgt gtgcccatca acaacctcat ggaggatgct 1380

gctactgccg aggtttctcg tgcccagctg tggcagtgga ccaagcacgg caagttcacc 1440

aaggaggagg tattggagat gatttcccag gaggccgaga agctgggaaa caccgactct 1500

gtcaagcgag caggcgagtt gctgggatct gagattggcg gcgattttgc agagttcctc 1560

accgatctgc tgtatcctga tctggttgaa cagtag 1596

<210> 25

<211> 1709

<212> DNA

<213> Artificial Synthesis ()

<400> 25

atgatttctg ctattcgtcc cgccgttcga tcttccgttc gtgttgcccc tatggccaac 60

accgccttcc gggcctactc tacccaggat gtgagtattt cttttctttc atcaattggt 120

tgctgtgcga cggatttcgt tgcgtcagcc tgattgcaac agccttaggc cccattttcg 180

acctgttctt gcctcggcaa aagtttttcc gaatgcatgt gacacgtcga atgtggtgct 240

ttcaagcagc agcagcagca taaaatatgg aatgtgttgt gtgcagaagt cgacattaca 300

taaccccgcg gcaaccatac gagatggcag tcataacaat tgcaattgag caatacaaac 360

cacactgcaa cccactaaaa agaaacacga ctaacaaata gggtcttaag gagcgattcg 420

ccgagctcat ccccgagaac gtcgagaaga tcaagaagct ccgaaaggag aagggtaaca 480

ccgtcatcgg cgaggtcatc ctcgaccagg cttacggtgg tatgcgaggt attaagggtc 540

tcgtctggga gggatccgtc ctcgaccccg aggagggtat ccgattccga ggtctgacta 600

tccccgacct ccagaagcag ctcccccacg cccctggcgg aaaggagcct ctccccgagg 660

gtcttttctg gctcctgctc accggcgaga tccccactga tgctcaggtc aagggtctgt 720

ccgctgactg ggcctctcga gccgagatcc ccaagcatgt tgaggagctc atcgaccgat 780

gcccccccac cctccacccc atggctcagc tcggtattgc cgtcaacgct ctggagtccg 840

agtctcagtt caccaaggct tacgagaagg gtgttaacaa gaaggagtac tggcagtaca 900

cctacgagga ttccatgaac ctcattgcca agctccccgt cattgcttct cgaatctacc 960

gaaacctttt caaggacgga aagattgttg gctccattga caactctctt gactactctg 1020

ctaacttcgc ctctctgctc ggctttggcg acaacaagga gttcattgag cttctgcgac 1080

tctacctcac catccacgct gaccacgagg gaggtaacgt ctctgcccac accaccaagc 1140

ttgttggttc tgctctctcc tctcccttcc tctctctgtc cgctggtctc aacggtcttg 1200

ccggtcctct ccacggccga gctaaccagg aggtccttga gtggattctc gagatgaagt 1260

ccaagattgg ctctgatgtc accaaggagg acattgagaa gtacctctgg gataccctta 1320

aggccggtcg agtcgtcccc ggttacggac acgccgttct ccgaaagacc gatcctcgat 1380

acaccgccca gcgagagttc gccctcgagc acatgcccga ctacgacctc ttccacctcg 1440

tttccaccat ctacgaggtt gcccccaagg ttctcaccga gcacggcaag accaagaacc 1500

cctggcccaa tgtggactcc cactccggtg tcctcctcca gtactacggt ctcactgagc 1560

agtcttacta cactgttctc ttcggtgttt cccgagctat cggtgtcctg ccccagctca 1620

tcatggaccg agcttacggt gctcccatcg agcgacccaa gtccttctct accgagaagt 1680

acgctgagct cgttggcctc aagctctaa 1709

<210> 26

<211> 1302

<212> DNA

<213> Artificial Synthesis ()

<400> 26

atgaccggca agacaggaca cattgatggc ctgaactcgc ggatcgagaa gatgcgagat 60

cttgatcctg cccaacgatt ggtcagggta gccgaggctg ccggactcga gcctgaggct 120

atctctgccc tggcgggcaa cggtgctctg ccgttgtctc tggccaatgg catgatcgag 180

aacgtcattg gtaaatttga gctgccccta ggggtcgcaa ccaacttcac cgtcaacgga 240

agagactacc taatccccat ggccgtggag gagccctcag tagttgcagc cgccagttac 300

atggcccgaa ttgccagaga gaatggcggc tttacggctc atggaaccgc ccctctgatg 360

cgggcccaga ttcaggttgt tggtctgggc gaccccgagg gtgctcgaca gagactcttg 420

gcccacaagg ctgccttcat ggaggccgcg gacgctgtcg atccagtgct agtggggtta 480

ggaggaggat gcagagacat cgaggtgcac gtgttccgag acactcctgt tggcgccatg 540

gtcgttctgc atctcatcgt cgacgtccgt gatgctatgg gcgctaacac tgtgaataca 600

atggctgaac gtttggcgcc cgaagtggag cgaatcgccg gcggaactgt gcgcctccgg 660

attctctcca acctggccga tctgcggctt gtaagggctc gagtcgaact ggcacctgag 720

actctgacca cccagggcta tgatggagct gacgttgctc gcggaatggt ggaagcctgt 780

gccctggcta tagtggatcc ctaccgagca gcaacgcaca acaagggcat catgaacggg 840

atcgaccccg ttgtggtggc cacaggtaat gactggcgag ccattgaggc tggagcccat 900

gcctacgcgg cccgtacggg tcactacaca agccttactc gatgggagct tgccaacgac 960

ggacgtctgg tcggcaccat tgaactgcca cttgccctcg gacttgtggg tggtgctacc 1020

aagacccatc cgaccgcacg agctgctctc gctctcatgc aggtcgagac tgccaccgaa 1080

ctcgcgcaag tcactgcagc tgttggtctt gctcagaaca tggcagcaat ccgagccctg 1140

gccactgagg gcatccagcg aggccacatg actctccacg cgcggaacat tgccatcatg 1200

gctggcgcaa cgggagccga cattgaccgc gtgacccgag ttattgtcga ggcgggtgac 1260

gtgtccgtgg caagagcgaa gcaggttttg gaaaacacct ga 1302

<210> 27

<211> 1758

<212> DNA

<213> Artificial Synthesis ()

<400> 27

atggaatgga tttcacatct ggagaacgat gacgatgtgc tggaaatcga ggactacaag 60

gtgcgcaagg acgcgctgct gatcgccatt caagtaaccc agaacgccat taacaacgga 120

actcttcata aggccttgga ggcagccttc gatgctgtga ctgacagaat cgtcatatcg 180

ccgcaagatt acaccggcgt tatgctgttc ggtgcctcca tgcagtctga ggacgacggt 240

gacgagttcg atgatgagtc agatacacat ttcattctca agctgggcct tcctaccgct 300

gctcagatca aacgactcaa acgactggca gaggaccctg atctgggtga gaggttcaag 360

gtgcaggaag agcctcacct gatggacgtg tttttcgaca tgaaccgcca ttttatcaac 420

atggcaccca acttcgcgtc cagacgaatc atctatatca cagacgacga tacccccacg 480

acgaatgagg acgatatcaa caagacacga gttcgaattg aggatctaag ccatctcaag 540

gtgaaggtcg agcctctttt gatcaaccct tcggaagaca agacgttcga ctcctccaaa 600

ttctacgctc ttgtgttcaa cgaagacaca tctgtggagc cggttgaggc gatcgatttg 660

aagcagttta tcaacaaaag aaacgtgctc aatcgatcac tgttcaatgt caaaatggaa 720

atcggagaag gtcttgttgt cggagtaaga ggataccttc tttatgcgga acaaaaggct 780

acttcaacaa cccgaaaggc ctgggtttac actggaggtg agaaacccga gattgccaaa 840

ttagaatcgc aggccgtcac tattgaaagt ggcagaagcg tggacaaggc agatctgaga 900

aagactttca agtttggaaa tgactatgtt cctttcacag aagaacagct gacgcaaatc 960

cggtactttg gagagccaat tattcgaatt ctcggcttcc acaattcctc ggacttctcc 1020

gagctcttca tccacagtgt ccgatcgtca atgttcctat atcccactga tgagaagctt 1080

gtgggttcga ttcgagcctt ttcagcactc tatcagagtc tcaagaacaa ggataagatg 1140

gctctggcct gggttattgt ccgcaagggc gccaaaccta ttctggctct tcttattcct 1200

tcaactaagg agatcgaagg tcttcatatg gtcttcttgc cttttacaga tgatattcga 1260

caagaaccaa agactgaact tgtgtctgcc gcccctgagc tcgtggacgc aaccaagaat 1320

attttcactc gtctacgcat gcctggcgga tttgagtcgc aaagataccc caacccccgt 1380

ctacagtggc attaccgagt tgtacgagcc atggcccttc aggaggaggt tcccaaggta 1440

cccgaagaca agacgacacc aaagtatcgg tctattgata ctcgagttgg tgatgccatc 1500

gaggaatgga acaaggtgtt gcagagcagc tccaagcgac ctgcggagga tatctgtaag 1560

gctgagaaga aagtcaagag ttctgacgcg ggccctccgt ccaacgagca aatgcaaaat 1620

atggttgaga atgacattgt cggcaagctg accgtcgcag aactcagggc ttggggtgct 1680

gctaacaatg ttgagcccaa tggtagcaag ttgaagaagg actgggttga ggtggtcaaa 1740

aagtactatg ggaagtga 1758

<210> 28

<211> 948

<212> DNA

<213> Artificial Synthesis ()

<400> 28

atggcagcta tttccaaaga ctatgttctg tcgccctggg gcaaagccgt ggctggtgcc 60

gctggagccg tgctcgcaaa cacactggtc taccccctag acattgtgaa aacgcggctt 120

caggtgcagg tcaagcgcaa ggagggcgga ccccttcctg ccttcgagga gggccatttc 180

gagcactacg agggcactgt cgacgctctg aaaaagatct atgccgccaa cggcctggcc 240

ggcctgtacc agggtcttcc ctcttgtctt ctaggtgtgg cctctaccaa ctttgcctac 300

ttctactggt atggcttcat ccgagactct tacattaagc gaaaccccgg taaagctctc 360

tcgactccca tcgagctgct cctcggagct gtggcaggag ccctggcaca ggttttcacc 420

atccccgtgg ccgtgatcac cacacgacag cagacttcag acgccaagtc gcggcaggga 480

ttcctggcta ctgccaagag cgtggtggat gacgacggaa tcagtggtct ctggcgaggt 540

ctcaaggcct ctctggtgct ggtgatcaac ccctccatca cttacggctc gtttgagcgt 600

ctcagaacca tcctgttcaa gggtaagctg cacctgtctc ccggagagaa cttcctgctg 660

ggagccttgt ccaaggctat ggccaccatt gccactcagc ccatgattgt ggccaaggtc 720

atgcagcagt ccaagaccaa gggtggcaag cagttcaaca gctttgtgca ggcattggtg 780

ttcctgttca aggaggaggg tattttggga atgtggaagg gagttggccc ccagatctcc 840

aagggcatca ttgtgcaggg gctcctcttc atgattaagg accaagtcga gctcttcatc 900

gtgctacttt ttagactcat gaaggccccc accttgatca agggataa 948

<210> 29

<211> 1494

<212> DNA

<213> Artificial Synthesis ()

<400> 29

atgtcagcga aatccattca cgaggccgac ggcaaggccc tgctcgcaca ctttctgtcc 60

aaggcgcccg tgtgggccga gcagcagccc atcaacacgt ttgaaatggg cacacccaag 120

ctggcgtctc tgacgttcga ggacggcgtg gcccccgagc agatcttcgc cgccgctgaa 180

aagacctacc cctggctgct ggagtccggc gccaagtttg tggccaagcc cgaccagctc 240

atcaagcgac gaggcaaggc cggcctgctg gtactcaaca agtcgtggga ggagtgcaag 300

ccctggatcg ccgagcgggc cgccaagccc atcaacgtgg agggcattga cggagtgctg 360

cgaacgttcc tggtcgagcc ctttgtgccc cacgaccaga agcacgagta ctacatcaac 420

atccactccg tgcgagaggg cgactggatc ctcttctacc acgagggagg agtcgacgtc 480

ggcgacgtgg acgccaaggc cgccaagatc ctcatccccg ttgacattga gaacgagtac 540

ccctccaacg ccacgctcac caaggagctg ctggcacacg tgcccgagga ccagcaccag 600

accctgctcg acttcatcaa ccggctctac gccgtctacg tcgatctgca gtttacgtat 660

ctggagatca accccctggt cgtgatcccc accgcccagg gcgtcgaggt ccactacctg 720

gatcttgccg gcaagctcga ccagaccgca gagtttgagt gcggccccaa gtgggctgct 780

gcgcggtccc ccgccgctct gggccaggtc gtcaccattg acgccggctc caccaaggtg 840

tccatcgacg ccggccccgc catggtcttc cccgctcctt tcggtcgaga gctgtccaag 900

gaggaggcgt acattgcgga gctcgattcc aagaccggag cttctctgaa gctgactgtt 960

ctcaatgcca agggccgaat ctggaccctt gtggctggtg gaggagcctc cgtcgtctac 1020

gccgacgcca ttgcgtctgc cggctttgct gacgagctcg ccaactacgg cgagtactct 1080

ggcgctccca acgagaccca gacctacgag tacgccaaaa ccgtactgga tctcatgacc 1140

cggggcgacg ctcaccccga gggcaaggta ctgttcattg gcggaggaat cgccaacttc 1200

acccaggttg gatccacctt caagggcatc atccgggcct tccgggacta ccagtcttct 1260

ctgcacaacc acaaggtgaa gatttacgtg cgacgaggcg gtcccaactg gcaggagggt 1320

ctgcggttga tcaagtcggc tggcgacgag ctgaatctgc ccatggagat ttacggcccc 1380

gacatgcacg tgtcgggtat tgttcctttg gctctgcttg gaaagcggcc caagaatgtc 1440

aagccttttg gcaccggacc ttctactgag gcttccactc ctctcggagt ttaa 1494

Claims

1. A recombinant strain for producing terpenoid, wherein the terpenoid is alpha-humulene, and the recombinant strain is obtained by genetic engineering of an original strain, and compared with the original strain, the activity of alpha-humulene synthase and the mevalonate pathway and the flux of acetyl-CoA are respectively enhanced in a plurality of organelles of the recombinant strain;

wherein the starting strain isYarrowia lipolytica Po1f Δ ku70, a plurality of organelles of the recombinant strain comprising a cytoplasm and a peroxisome, each of which comprises a nucleotide sequence encoding an amino acid sequence set forth in SEQ ID NO: 1, a gene of α -humulene synthase represented by the formula (I);

overexpression of a coding gene tHMG1 of truncated hydroxymethylglutaryl coenzyme A reductase, a coding gene ERG8 of phosphomevalonate kinase, a coding gene ERG20 of geranyl/farnesyl diphosphate synthase, a coding gene ERG12 of mevalonate kinase, a coding gene ERG13 of hydroxymethylglutaryl-CoA synthase, a coding gene ERG19 of mevalonate diphosphate decarboxylase, a coding gene ERG10 of acetoacetyl coenzyme A thiolase and a coding gene IDI of isopentenyl diphosphate isomerase in cytoplasm of the recombinant strain, and exogenous introduction of a coding gene ACHS2 of alpha-humulene synthase, a coding gene-tHMG 1 of key rate-limiting enzyme and a coding gene AAD of NADH-CoA acetylaldehyde dehydrogenase;

the recombinant strain effectively expresses tHMG1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI in peroxisomes, ACHS2, NADH-tHMG1, an encoding gene ANT of a carrier protein for over-expressing ATP and an encoding gene POT1 of 3-ketoacyl-CoA thiolase are introduced by exogenous introduction, and an encoding gene ERG9 of squalene synthase is replaced by a copper ion inhibition type promoter CTR 2;

the nucleotide sequence of the coding gene ACHS2 of the alpha-humulene synthase is shown as SEQ ID NO: 3, the nucleotide sequence of the copper ion repression type promoter CTR2 is shown as SEQ ID NO: 5 is shown in the specification; the nucleotide sequences of the coding genes tHMG1, ERG8, ERG20, ERG12, ERG13, ERG19, ERG10 and IDI are respectively shown as SEQ ID NO: 6-13, and the nucleotide sequence of the encoding gene AAD is shown as SEQ ID NO: 14, the nucleotide sequence of the coding gene POT1 is shown as SEQ ID NO: 21, and the nucleotide sequence of the coding gene NADH-tHMG1 is shown as SEQ ID NO: 26, and the nucleotide sequence of the coding gene ANT is shown as SEQ ID NO: shown at 28.

2. The recombinant strain producing terpenoids according to claim 1, wherein the nucleotide sequence of the gene encoding squalene synthase ERG9 is as set forth in SEQ ID NO: 4, respectively.

3. The terpenoid-producing recombinant strain of claim 1 or 2, wherein the nucleotide sequence encoding gene ku70 in the starting strain is as set forth in SEQ ID NO: 27 is shown; and/or the presence of a gas in the gas,

the preservation number of the recombinant strain is CGMCC No. 2425.

4. A method of constructing a recombinant strain, the method comprising: genetically engineering a starting strain to enhance alpha-humulene synthase activity and mevalonate pathway and acetyl-coa flux, respectively, in cytoplasm and peroxisomes of the starting strain;

wherein the starting strain isYarrowia lipolytica Po1f Δ ku70, in a manner that enhances the activity of α -humulene synthase by exogenously introducing into the cytoplasm and peroxisomes of the starting strain a nucleic acid encoding an amino acid sequence as set forth in SEQ ID NO: 1, a gene of α -humulene synthase represented by the formula (I);

5. The method according to claim 4, wherein the squalene synthase gene ERG9 has a nucleotide sequence as set forth in SEQ ID NO: 4 is shown in the specification; and/or the presence of a gas in the gas,

the nucleotide sequence of the coding gene ku70 in the starting strain is shown as SEQ ID NO: as shown at 27.

6. A method for producing terpenoids through fermentation, wherein the terpenoids are alpha-humulene, and the method comprises the following steps: inoculating the recombinant strain of any one of claims 1 to 3 into a fermentation medium for fermentation;

alternatively, a recombinant strain is constructed according to the method of claim 4 or 5, and the resulting recombinant strain is inoculated into a fermentation medium for fermentation.

7. Use of the recombinant strain of any one of claims 1 to 3 or the method of claim 4 or 5 for the preparation of a terpenoid, wherein the terpenoid is alpha-humulene.