CN113493758A

CN113493758A - Tyrosol-producing recombinant escherichia coli capable of shortening fermentation period and application thereof

Info

Publication number: CN113493758A
Application number: CN202110598376.7A
Authority: CN
Inventors: 梁一晨; 张锦雯; 沈微; 陈献忠; 杨海泉; 夏媛媛; 陈磊
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-05-31
Filing date: 2021-05-31
Publication date: 2021-10-12
Anticipated expiration: 2041-05-31
Also published as: CN113493758B

Abstract

The invention relates to tyrosol-producing recombinant escherichia coli capable of shortening a fermentation period and application thereof, and belongs to the technical field of fermentation engineering. The tyrosol-producing recombinant Escherichia coli YC166 with the shortened fermentation period is preserved in China center for type culture Collection, is classified and named as Escherichia coli YC166(Escherichia coli YC166), and has a preservation date of 2021, 4 and 12 months and a preservation number of CCTCC NO: m2021358. The strain is applied to shake flask fermentation or fermentation tank fermentation of tyrosol to obtain the tyrosol. The fermentation level of the strain provided by the invention is equivalent to that of the tyrosol-producing strain disclosed by the prior art, but the fermentation speed is obviously higher than that of the same type of strain disclosed by the prior art.

Description

Tyrosol-producing recombinant escherichia coli capable of shortening fermentation period and application thereof

Technical Field

The invention relates to tyrosol-producing recombinant escherichia coli capable of shortening a fermentation period and application thereof, and belongs to the technical field of fermentation engineering.

Background

Tyrosol is a phenolic organic compound with specific pharmacological actions. The tyrosol is produced by plant extraction, chemical synthesis, and microbial fermentation. Because of its low cost, the chemical synthesis method is the main production method of tyrosol.

The method for producing the tyrosol by adopting the microbial fermentation method mainly takes the glucose as the raw material, has low cost and can be regenerated, and toxic substances are not easily formed in the production process, so the method is a tyrosol preparation method with development prospect. The major disadvantages of the prior art microbial fermentation of tyrosol are the low yield and long fermentation period of tyrosol, with reported tyrosol fermentation processes having a yield of up to 3.9g/L and a fermentation time of 48hr (Xu W, Yang C, Xia Y, et al. High-level production of tyrosol with a non-fermented recombinant Escherichia coli by metabolic engineering. agricultural and Food Chemistry,2020,68: 4616-.

Because the use of proper host bacteria is an effective method for improving the fermentation speed, screening escherichia coli from nature, further constructing tyrosol-producing recombinant escherichia coli, and finally obtaining the recombinant escherichia coli with the fermentation time remarkably shorter than that of the reported homologous strains is a very effective means.

Disclosure of Invention

The invention aims to overcome the defects and provide the tyrosol-producing recombinant escherichia coli capable of shortening the fermentation period and the application thereof.

The technical scheme of the invention is that a tyrosol-producing recombinant Escherichia coli YC166 with a shortened fermentation period is deposited in China center for type culture Collection, Wuhan university, China, and is classified and named as enterobacter coli YC166(Escherichia coli YC166), the preservation date is 2021, 4 and 12 days, and the preservation number is CCTCC NO: m2021358.

The construction method of the tyrosol-producing recombinant Escherichia coli YC166 is as follows:

(1) screening nature: firstly, taking an escherichia coli standard strain K12 as a reference, selecting a bacterial colony similar to a K12 bacterial strain, sequencing, and comparing with a MG1655 gene sequence to obtain 197 bacterial strains with high homology;

(2) high biomass host bacterium screening: culturing 197 strains of Escherichia coli obtained in the step (1) to prepare an electrotransformation competent cell, transferring a recombinant plasmid pKK223-3-ARO10 into the Escherichia coli competent cell, and screening host bacteria YEC039, YEC104 and YEC166 which can obtain transformants and have the characteristics of tyrosol production and high thallus concentration;

(3) host bacterium transformation: knocking out tyrosol-producing competitive pathway genes feaB, pheA, tyrB and an aromatic global regulation repressor gene tyrR from the high-thallus-concentration host bacteria YEC039, YEC104 and YEC166 obtained in the step (2), so as to obtain host bacteria YEC166 capable of completing knocking out, and knocking out genes to obtain recombinant bacteria YEC166 delta feaB delta pheA delta tyrB delta tyrR;

(4) the method for obtaining the tyrosol-producing recombinant bacteria with shortened fermentation period comprises the following steps: and (3) taking the Escherichia coli YEC166 delta feaB delta pheA delta tyrB delta tyrR obtained in the step (3), and further transferring the Escherichia coli 89166 delta feaB delta pheA delta tyrB delta tyrR into a recombinant plasmid pKK223-3-ARO10 expressed by a key enzyme gene ARO10 for controlling tyrosol synthesis through electrotransformation, namely obtaining tyrosol-producing recombinant Escherichia coli YEC166 delta feaB delta pheA delta tyrB delta tyrR/pKK223-3-ARO10 which is abbreviated as YC166 and shortens the fermentation period.

Further, in the step (1), the standard Escherichia coli strain K12 is used as a reference, colonies close to the K12 strain are selected to obtain 800 strains, all the strains are subjected to 16s rDNA sequencing, the sequencing result is compared with a 16s rDNA gene sequence (GeneID:944897) in a genome sequence of Escherichia coli MG1655, and the standard Escherichia coli standard strain K12 is used for the next experiment; and finally obtaining 197 strains with the serial numbers of YEC001-YEC197, wherein the escherichia coli are respectively preserved in an industrial microbial resource information platform (http:// www.cicim-cu. jiangnan. edu. cn) of colleges and universities in south Jiang and a limited bioscience of Xianqin for subsequent experiments.

The genome sequence of the Escherichia coli MG1655 is published in the national center of biotechnology information (USA) websitewww.ncbi.nlm.nih.gov) And the login number is NC-000913.

The method for analyzing the sequence of the 16s rDNA gene comprises the steps of firstly obtaining a PCR product of the 16s rDNA gene of a strain according to a document [ Suihua, prokaryote evolution and taxonomy experimental course, Beijing, scientific publishing agency, 2011, pages 62-69 ], sending the PCR product to Shanghai Biotechnology service company for sequencing, and then analyzing the sequence homology according to the method of the document.

Further, in the step (2), transferring the recombinant plasmid pKK223-3-ARO10 for controlling the expression of the tyrosol synthesis key enzyme phenylpyruvate decarboxylase gene in the escherichia coli into YEC001-YEC197 strain, culturing to prepare the obtained electrotransformation competent cells, and electrotransforming the screened competent cells of the escherichia coli by using the plasmid pKK223-3-ARO10 to obtain 81 strains of the transformant; and respectively inoculating the 81 transformants to an M9Y culture medium, performing shake flask fermentation, detecting the thallus concentration at intervals of 12 hours, detecting the yield of tyrosol when the fermentation time is 48 hours, and screening three host bacteria with host bacteria numbers of YEC039, YEC104 and YEC 166.

The recombinant plasmid pKK223-3-ARO10 is a recombinant plasmid for controlling expression of tyrosol synthesis key enzyme, namely, pyruvate decarboxylase gene in Escherichia coli, and is disclosed in CuiYang, Xiaozhong Chen, Junzhuang Chang, Lihua Zhuang, Wei Xu, Wei Shen, You Fan.Reconstruction of tyrosyn pathetic pathways in Escherichia coli, Chinese chemical engineering report, English edition 2018,26(12): 2615-2621. The plasmid can control escherichia coli to synthesize tyrosol after being transferred into escherichia coli, normal operation of strain amino acid metabolism is probably influenced by high expression of ARO10 gene, and the growth of escherichia coli transformant transferred into the plasmid is generally slower and is obviously slower than that of a control strain transferred into an empty plasmid.

Further, in the step (3), in order to knock out the feaB gene, primers PfeAB01 and PfeAB02 for the feaB gene knock-out were designed with reference to the feaB gene sequence (GeneID:8115427) in the genomic sequence (accession number: NC-000913) of E.coli MG1655 published by the national center for Biotechnology information (www.ncbi.nlm.nih.gov) and the sequences of about 500 nucleotides upstream and downstream of the gene. The primer sequences are as follows:

primer PfeAB01 sequence (SEQ ID NO: 1): 5'-CAGCGAAAAA AGTGACTTTT CTTGTCGCTG CGTACACTGA AATCACACTG GGGGCTGGAG CTGCTTC-3', respectively;

primer PfeAB02 sequence (SEQ ID NO: 2): 5'-TTAATACCGT ACACACACCG ACTTAGTTTC ACACCAACCG TCCAGCCAGT ATTCCGGGGA TCCGTCGACC-3', respectively;

primers PfeOB (SEQ ID NO:3), PfeBD (SEQ ID NO:4) and Pkan02(SEQ ID NO:5) for identifying the gene knockout recombinant bacteria are simultaneously designed, and the sequences are as follows:

PfeaBU sequence: 5'-GACTATAGGA AATAAGTC-3', respectively;

PfeaBD sequence: 5'-CTCTGCTGAA ACCATGG-3', respectively;

sequence of Pkan 02: 5'-TGAACAAGAT GGATTGCACG-3' are provided.

Further, in the pheA gene knock-out in step (3), pheA gene knock-out primers PpheA01(SEQ ID NO: 6) and PpheA02(SEQ ID NO:7) were designed with reference to the pheA gene sequence (GeneID:8114416) in the genomic sequence (accession number: NC-000913) of E.coli MG1655 and the sequences of about 500 nucleotides upstream and downstream of the gene. The primer sequences are as follows:

primer PpheA01 sequence: 5'-AGGCAACACT ATGACATCGG AAAACCCGTT ACTGGCGCTG CGAGAGAAAA GGCTGGAGCT GCTTC-3', respectively;

primer PpheA02 sequence: 5'-CAGACGGGTC ATAATCAGAT TGTGGTTGCG CAGTACCAGC AACGCTTCAA CCAATTCCGG GGATCCGTCG ACC-3', respectively;

simultaneously designing primers PpheAU (SEQ ID NO:8) and PpheAD (SEQ ID NO:9) for identifying the pheA gene knockout recombinant bacteria, wherein the sequences are as follows:

primer PpheAU sequence: 5'-TCCTTTATAT TGAGTGTATC G-3', respectively;

primer PpheAD sequence: 5'-TGGCCTGAAT ATCCAGATAG-3' are provided.

Further, in the deletion of tyrB gene in step (3), tyrB gene deletion primers PtyrB01(SEQ ID NO: 10) and PtyrB02(SEQ ID NO:11) were designed with reference to the tyrB gene sequence (GeneID:8115375) in the genomic sequence (accession number: NC-000913) of Escherichia coli MG1655 and the sequences of about 500 bases upstream and downstream of the gene. The primer sequences are as follows:

PtyrB01 primer sequence: 5'-GCTTATGGAG CGTTTTAAAG AAGACCCTCG CAGCGACAAA GTGAATTTAA GTATGGCTGG AGCTGCTTC-3', respectively;

PtyrB02 primer sequence: 5'-TTACATCACC GCAGCAAACG CCTTTGCCAC ACGTTGTACA TTTGCCGATT CCGGGGATCC GTCGACC-3', respectively;

primers PtyrBU (SEQ ID NO:12) and PtyrBD (SEQ ID NO:13) for identifying tyrB gene knockout recombinant bacteria are designed at the same time, and the sequences are as follows:

primer PtyrBU sequence: 5'-TGACGCCTAC GCTGG-3'

Primer PtyrBD sequence: 5'-TTTCACTGCA GGCTGGGTAG-3'

Further, in the deletion of tyrR gene in step (3), tyrR gene deletion primers PtyrR01(SEQ ID NO:14) and PtyrR02(SEQ ID NO:15) were designed with reference to the tyrR gene sequence (GeneID:945879) in the genomic sequence (accession number: NC-000913) of Escherichia coli MG1655 and the sequences of about 500 bases each upstream and downstream of the gene. The primer sequences are as follows:

PtyrR01 primer sequence: 5'-TTTTCAGGTG AAGGTTCCCA TGCGTCTGGA AGTCTTTTGT GAAGAGGCTG GAGCTGCTTC-3', respectively;

PtyrR02 primer sequence: 5'-TTACTCTTCG TTCTTCTTCT GACTCAGACC ATATTCCCGC AACTTATTGG CATTCCGGGG ATCCGTCGAC C-3', respectively;

simultaneously designing primers PtyrRU (SEQ ID NO:16) and PtyrRD (SEQ ID NO:17) for identifying tyrR gene knockout recombinant bacteria, wherein the sequences are as follows:

primer PtyrRU sequence: 5'-GTGCCCGTTT TTCCGTC-3', respectively;

primer PtyrRD sequence: 5'-GATTACGAAG CAGCTCTGGC-3' are provided.

The recombinant escherichia coli YC166 for producing the tyrosol is applied to shake flask fermentation or fermenter fermentation of the tyrosol to obtain the tyrosol.

Further, fermenting by adopting recombinant escherichia coli YC166 for producing tyrosol, wherein the inoculation amount is 1%, and the culture medium is M9Yb fermentation culture medium; fermenting at 30 deg.C for 24h at 200 r/min.

The invention has the beneficial effects that: compared with the existing microbial fermentation method for preparing tyrosol, the recombinant escherichia coli YC166 for producing tyrosol provided by the invention has the advantages that the fermentation level is equivalent, the fermentation time is obviously shortened, the industrial application prospect is good, and the industrial value is high.

Biological material sample preservation: the tyrosol-producing recombinant Escherichia coli YC166 with the shortened fermentation period is deposited in China center for type culture Collection, Wuhan university, China, and is classified and named as enterobacter coli YC166(Escherichia coli YC166), the preservation date is 2021 years, 4 months and 12 days, and the preservation number is CCTCC NO: m2021358.

Drawings

FIG. 1 is a PCR-verified electrophoretogram of deletion of feaB gene;

m is molecular weight standard DL 2000; 1, PCR identification of a starting bacterium YEC 166; 2: YEC166 PCR identification of Δ feaB.

FIG. 2 is a PCR validation of pheA, tyrB, tyrR gene deletion;

m is molecular weight standard DL 2000; YEC166 Δ feaB at 3: 166; YEC166 Δ feaB Δ pheA; YEC166 Δ feaB Δ pheA; YEC166 Δ feaB Δ pheA Δ tyrB; YEC166 Δ feaB Δ pheA Δ tyrB; 8 YEC166 Δ feaB Δ pheA Δ tyrB Δ tyrR

FIG. 3 is a graph showing the time-cell density/yield of tyrosol in fermentor fermentation of recombinant E.coli YC 166.

Detailed Description

The tyrosol standards used for liquid phase detection in the examples below are available from Sigma. Other reagents were purchased from the national pharmaceutical group chemical agents corporation. The molecular biological operation reagents are all products of Dalianbao bioengineering limited company. Plasmid extraction kit, PCR product purification and gel recovery kit, etc. are products of Aisijin biotechnology (Hangzhou) Co.

EXAMPLE 1 preparation of tyrosol-producing recombinant E.coli YC166

(1) Screening of E.coli from nature: feces of various wild animals are collected in nature. After dilution, the mixture is streaked on LB solid culture medium, and colonies similar to K12 are selected with colibacillus standard strain K12 as reference, and further microscopic examination is carried out to obtain about 800 bacillus colonies. The 16s rDNA gene sequence analysis was performed in its entirety, and the sequencing results were compared with the 16s rDNA gene sequence (GeneID:944897) in the genomic sequence (accession No: NC-000913) of Escherichia coli MG1655 published by the national center for Biotechnology information (www.ncbi.nlm.nih.gov), and used in the next experiment, with the sequence homology of more than 98.5%. The method for analyzing the sequence of the 16s rDNA gene comprises the steps of firstly obtaining a PCR product of the 16s rDNA gene of a strain according to a document (Suihua, prokaryote evolution and taxonomy experiment course, Beijing, scientific publishing agency, 2011, pages 62-69), sending the PCR product to a Shanghai Biotechnology service company for sequencing, obtaining a sequence, and then carrying out sequence homology analysis according to the method of the document. Coli 197 strain, numbered YEC001-YEC197, was identified in total according to the above criteria.

The Escherichia coli is preserved in China university Industrial microbial resource information platform (http:// www.cicim-cu. jiangnan. edu. cn) and Xianqin-free McJO, respectively, and then used for subsequent experiments.

(2) Screening of high biomass host bacteria: according to the preparation and transformation methods of the electrotransformation competent cells in the literature (Zhoushan, L-phenylalanine producing strain construction, metabolic regulation and fermentation condition optimization [ D ]. doctor academic thesis, Wuxi, university of Jiangnan, 2011), the 197 strains of Escherichia coli are respectively cultured and then prepared into the electrotransformation competent cells.

Escherichia coli JM109/pKK223-3-ARO10 was cultured to extract a large amount of plasmid pKK223-3-ARO 10. Escherichia coli JM109/pKK223-ARO10 is disclosed in [ Yang C, Chen X Z, Chang J Z, et al.Reconstruction of systemic synthesis pathways in Escherichia coli [ J ]. report on chemical engineering in China: English edition, 2018(7):23-27 ].

The 197 E.coli competent cells obtained by the above screening were transformed electrically with the plasmid pKK223-3-ARO 10. After multiple times of transformation, 81 strains obtain transformants. And (3) partial strains of the other strains have ampicillin resistance, and the other strains can not obtain transformants after multiple times of transformation, and the strains are abandoned. Inoculating the 81 transformants into M9Y culture medium respectively, fermenting in a shaking flask, detecting the thallus concentration at intervals of 12 hours, and detecting the tyrosol yield after fermenting for 48 hours. And after eliminating strains which do not produce tyrosol completely, screening the strains with the highest final thallus concentration as materials for subsequent research.

The M9Y culture medium specifically comprises the following components: 3g/L of monopotassium phosphate, 17.1g/L of disodium hydrogen phosphate dodecahydrate, 1g/L of ammonium chloride, 0.5g/L of sodium chloride, 20g/L of glucose and 0.25g/L of yeast powder, and sterilizing at 115 ℃ for 15 min. Separately, a 1.25mol/L magnesium sulfate solution mother liquor was prepared and sterilized separately, and 4mL of the magnesium sulfate mother liquor was added to each L of the above medium at the time of use.

Through screening, no tyrosol is detected in the fermentation liquor of 14 strains in 81 strains of transformants, and tyrosol can be detected in the fermentation liquor of the other 67 strains, wherein the concentration is 0.1-0.5. All strains reached the highest concentration at 24hr of culture, with the concentrations of transformants of the three host strains, host strain numbers YEC039, YEC104 and YEC166, being significantly higher than the other strains, reaching 12.9, 11.2 and 11.6, respectively, calculated as OD 600.

Among them, the YEC039 strain failed to achieve gene knockout in subsequent work and was eventually abandoned. YEC166 and its transformants were used in subsequent experiments. Escherichia coli YEC166 has been deposited respectively at the industrial microbial resource information platform of colleges and universities in the university of China in south China (http:// www.cicim-cu. jiangnan. edu. cn) and Xixingxi Biotech limited, the cooperative enterprises of this project, the strains having the deposit numbers CICICIM B6943 and XQ05159B at two units.

(3) Transformation of host bacteria: according to the research, the knockout of the tyrosol-producing competitive pathway genes feaB, pheA and tyrB and the aromatic global regulatory repressor gene tyrR can greatly improve the yield of tyrosol. The above-mentioned 4 genes of the host bacterium YEC166 were knocked out according to the method reported in the literature (CuiYang, Xiaonzhong Chen, Junzhuang, Lihua Zhuang, Wei Xu, Wei Shen, You Fan. Reconstruction of tyrosylvtic pathwalls in Escherichia coli, proceedings of chemical engineering, English edition 2018,26(12): 2615-2621). The specific operation method comprises the following steps:

a. knockout of feaB Gene: primers PfeAB01 and PfeAB02 for the deletion of the feaB gene were designed by referring to the feaB gene sequence (GeneID:8115427) in the genomic sequence (accession number: NC-000913) of Escherichia coli MG1655 published by the national center for Biotechnology information (www.ncbi.nlm.nih.gov) and the sequences of approximately 500 bases upstream and downstream of the gene. The primer sequences are as follows:

primer PfeaB01 sequence:

5’-CAGCGAAAAA AGTGACTTTT CTTGTCGCTG CGTACACTGA AATCACACTG GGGGCTGGAG CTGCTTC-3’(SEQ ID NO:1)；

primer PfeaB02 sequence:

5’-TTAATACCGT ACACACACCG ACTTAGTTTC ACACCAACCG TCCAGCCAGT ATTCCGGGGA TCCGTCGACC-3’(SEQ ID NO:2)；

primers PfeOB, PfeBD and Pkan02 for identifying the gene knockout recombinant bacteria are designed simultaneously, and the sequences are as follows:

PfeaBU sequence: 5'-GACTATAGGA AATAAGTC-3' (SEQ ID NO: 3);

PfeaBD sequence: 5'-CTCTGCTGAAACCATGG-3' (SEQ ID NO: 4);

sequence of Pkan 02: 5'-TGAACAAGAT GGATTGCACG-3' (SEQ ID NO: 5).

The feaB gene knockout cassette was obtained by PCR amplification using pKD13 as a template and PfeAB01 and PfeAB02 as primers. Escherichia coli YEC166 strain was used to prepare electroporation competent cells. The YEC166 competent cells were transformed by electroporation with plasmid pKD 46. The feaB gene knockout, marker gene pop-up and helper plasmid elimination were further performed according to the method described in [ Yang C, Chen X Z, Chang J Z, et al.Reconstruction of tyrosol synthetic pathways in Escherichia coli [ J ]. Chinese chemical engineering report, English edition, 2018(7):23-27 ]. Coli YEC166 Δ feaB which had the feaB gene deleted and did not contain any marker genes and recombinant plasmids was finally obtained.

FIG. 1 is an electrophoretic identification chart of the recombinant bacterium. Identification primers PfeOB and PfeOB respectively correspond to the upstream and downstream sequences of the knocked-out part of the feaB gene, the length of a gene fragment between the primers before gene deletion is about 1789bp, and the length of the primers PfeOB and PfeOBD after gene deletion and marker gene ejection is about 407 bp. As can be seen from FIG. 1, the size of the PCR product was consistent with that expected, and it was found that the recombinant bacterium YEC166 Δ feaB was successfully constructed.

b. Deletion of pheA gene: primers PpheA01 and PpheA02 for the pheA gene knockout were designed with reference to the pheA gene sequence (GeneID:8114416) in the genomic sequence of E.coli MG1655 (accession number: NC-000913) and the sequences of approximately 500 bases upstream and downstream of the gene. The primer sequences are as follows:

primer PpheA01 sequence:

5’-AGGCAACACT ATGACATCGG AAAACCCGTT ACTGGCGCTG CGAGAGAAAAGGCTGGAGCT GCTTC-3’(SEQ ID NO:6)；

primer PpheA02 sequence:

5’-CAGACGGGTC ATAATCAGAT TGTGGTTGCG CAGTACCAGC AACGCTTCAA CCAATTCCGG GGATCCGTCG ACC-3’(SEQ ID NO:7)；

simultaneously designing primers PpheAU and PpheAD for identifying pheA gene knockout recombinant bacteria, wherein the sequences are as follows:

primer PpheAU sequence: 5'-TCCTTTATAT TGAGTGTATC G-3' (SEQ ID NO: 8);

primer PpheD sequence: 5'-TGGCCTGAAT ATCCAGATAG-3' (SEQ ID NO: 9);

the pheA gene knockout cassette was obtained by PCR using pKD13 as a template and PpheA01 and PpheA02 as primers. The recombinant Escherichia coli YEC166 Δ feaB strain obtained in the above step was taken to prepare cells in an electrotransformation-sensitive state. Plasmid pKD46 was used to transform the YEC 166. delta. feaB competent cells. Further, pheA gene knockout, marker gene ejection and helper plasmid elimination were performed using the above pheA gene knockout cassette according to the method of method 6 in the materials method. Finally, the Escherichia coli YEC166 delta feaB delta pheA without any marker gene and recombinant plasmid is obtained. FIG. 2a is an electrophoretic identification chart of the recombinant bacterium. The identifying primers PpheAU and PpheAD correspond to the upstream and downstream sequences of the knocked-out part of the pheA gene respectively, the length of the gene fragment between the PpheAU and PpheAD primers before gene deletion is about 1294bp, and the length of the gene fragment after gene deletion and marker gene ejection is about 493 bp. As can be seen from FIG. 2a, the size of the PCR product was consistent with that predicted, and it was found that the recombinant bacterium YEC166 Δ feaB Δ pheA was successfully constructed.

c. Knockout of tyrB Gene

Primers PtyrB01 and PtyrB02 for tyrB gene knock-out were designed with reference to the tyrB gene sequence (GeneID:8115375) in the genomic sequence of Escherichia coli MG1655 (accession number: NC-000913) and the sequences of about 500 bases each upstream and downstream of the gene. The primer sequences are as follows:

PtyrB01 primer sequence:

5’-GCTTATGGAG CGTTTTAAAG AAGACCCTCG CAGCGACAAA GTGAATTTAA GTATGGCTGG AGCTGCTTC-3’(SEQ ID NO:10)；

PtyrB02 primer sequence:

5’-TTACATCACC GCAGCAAACG CCTTTGCCAC ACGTTGTACA TTTGCCGATT CCGGGGATCC GTCGACC-3’(SEQ ID NO:11)；

primers PtyrBU and PtyrBD for identifying tyrB gene knockout recombinant bacteria are designed simultaneously, and the sequences are as follows:

primer PtyrBU sequence: 5'-TGACGCCTAC GCTGG-3' (SEQ ID NO: 12);

primer PtyrBD sequence: 5'-TTTCACTGCA GGCTGGGTAG-3' (SEQ ID NO: 13);

and carrying out PCR amplification by using PtyrB01 and PtyrB02 as primers and pKD13 as a template to obtain a tyrB gene knockout cassette. Knocking out tyrB gene of the recombinant bacterium escherichia coli YEC166 delta feaB delta pheA obtained in the last step according to the method for knocking out feaB gene, eliminating the auxiliary plasmid and simultaneously popping out gene knock-out marker gene to obtain recombinant bacterium escherichia coli YEC166 delta feaB delta pheA delta tyrB. The identification primers PtyrBU and PtyrBD correspond to the upstream and downstream sequences of the knocked-out part of tyrB gene, respectively, the length of the gene fragment between primers before gene deletion is about 1220bp, and the length of the gene fragment between primers after gene deletion and marker gene ejection is about 261 bp. As can be seen from FIG. 2b, the size of the PCR product was consistent with that predicted, and the successful construction of the recombinant bacterium YEC166 Δ feaB Δ pheA Δ tyrB was observed.

d. Knock-out of tyrR Gene: primers PtyrR01 and PtyrR02 for tyrR gene knockout were designed with reference to the tyrR gene sequence (GeneID:945879) in the genomic sequence (accession number: NC-000913) of Escherichia coli MG1655 and the sequences of about 500 bases each upstream and downstream of the gene. The primer sequences are as follows:

PtyrR01 primer sequence: 5'-TTTTCAGGTG AAGGTTCCCA TGCGTCTGGA AGTCTTTTGT GAAGAGGCTG GAGCTGCTTC-3' (SEQ ID NO: 14);

PtyrR02 primer sequence: 5'-TTACTCTTCG TTCTTCTTCT GACTCAGACC ATATTCCCGC AACTTATTGG CATTCCGGGG ATCCGTCGAC C-3' (SEQ ID NO: 15);

simultaneously, primers PtyrRU and PtyrRD for identifying tyrR gene knockout recombinant bacteria are designed, and the sequences are as follows:

primer PtyrRU sequence: 5'-GTGCCCGTTT TTCCGTC-3' (SEQ ID NO: 16);

primer PtyrRD sequence: 5'-GATTACGAAG CAGCTCTGGC-3' (SEQ ID NO: 17);

a tyrR gene knockout cassette was obtained by PCR using pKD13 as a template and PtyrR01 and PtyrR02 as primers. Knocking out tyrR gene of the recombinant Escherichia coli YEC166 delta feaB delta pheA delta tyrB obtained in the previous step according to the method for knocking out the feaB gene, eliminating the auxiliary plasmid and simultaneously popping out gene knock-out marker gene to obtain recombinant Escherichia coli YEC166 delta feaB delta pheA delta tyrB delta tyrR. The identification primers PtyrRU and PtyrRD correspond to the upstream and downstream sequences of the knocked-out part of tyrR gene respectively, the length of the gene fragment between the primers PtyrRU and PtyrRD before gene deletion is about 1730bp, and the length of the gene fragment after gene deletion and marker gene ejection is about 355 bp. As can be seen from FIG. 2c, the size of the PCR product was consistent with that predicted, and the successful construction of the recombinant bacterium YEC166 Δ feaB Δ pheA Δ tyrB Δ tyrR was observed.

Finally, the recombinant plasmid pKK223-ARO10 is transformed into competent cells of the recombinant bacterium YEC166 delta feaB delta pheA delta tyrB delta tyrR to obtain a recombinant bacterium YEC166 delta feaB delta phe delta tyrB delta tyrR/pKK223-3-ARO10, and the recombinant bacterium is named as Escherichia coli YC166 for the research of subsequent tyrosol fermentation.

The PCR template plasmid pKD13 (containing kanamycin resistance gene exclusively used for gene knockout), the Red recombinant helper plasmids pKD46 and pCP20 are deposited after the publication of the above documents.

The strain is named as tyrosol-producing recombinant Escherichia coli YC166 with shortened fermentation period, is deposited in China center for type culture Collection, Wuhan university, and is classified and named as Escherichia coli YC166(Escherichia coli YC166), the preservation date is 2021, 4, 12 days, the preservation number is CCTCC NO: m2021358.

The following examples were carried out for the measurement of cell concentration as follows:

detecting the cell density OD600 at 600nm by using an ultraviolet spectrophotometer; the detection of the dry weight of the cells is carried out according to the following method: taking 1mL of bacterial liquid to be detected, centrifuging at 12000r/min for 10min, discarding the supernatant, repeatedly washing with deionized water for 3 times, and drying in a drying oven to constant weight; weighing, according to the previous study result, the ratio of YC166 cell dry weight DCW (y) to OD600(x) is: 0.382:1.

HPLC method for detecting tyrosol content in fermentation liquor

Sample treatment: heating the fermentation liquid at 100 deg.C for 10min, removing protein, centrifuging, collecting supernatant, and filtering with water system microporous membrane.

Liquid phase conditions: using 1mL/min 80% of 0.1% formic acid and 20% pure methanol as mobile phases; the chromatographic column is a Bora Aijier C18 chromatographic column (4.6 × 250mm, aperture of 5 μm); the column temperature is 30 ℃; the detection wavelength is 276nm, and the sample injection amount is 10 mu L.

And (3) standard curve determination: diluting the standard sample by multiple times, detecting under the above conditions, and measuring with tyrosol concentration as abscissa and HPLC peak area of tyrosol standard as ordinate to obtain tyrosol concentration (g.L)^-1) The standard curve is: y 7054x 564.5(R2 0.9998).

The detection instrument of HPLC is as follows: high performance liquid chromatography Agilent, model 1260 HPLC.

EXAMPLE 2 Shake flask fermentation of recombinant E.coli YC166 for tyrosol production

The recombinant strain YEC166/pKK-223-3-ARO10 and YC166 are subjected to shake flask fermentation according to the following steps:

(1) carrying out streaking separation culture on an LB plate containing 100 mu g/mL ampicillin to obtain a single colony;

(2) selecting a single colony, inoculating 20mL LB liquid culture medium, and culturing overnight at 37 ℃;

(3) the bacterial solution was inoculated (1% inoculum size inoculated) into 50mL of M9Yb fermentation medium, and fermented at 30 ℃ at 200r/min for 48 h. Sampling was performed every 24h for tyrosol production and cell concentration.

M9Yb medium (a modified M9Y medium for primary screening of tyrosol-producing recombinant bacteria): 3g/L of potassium dihydrogen phosphate, 17.1g/L of disodium hydrogen phosphate dodecahydrate, 1.3g/L of ammonium chloride, 0.5g/L of sodium chloride, 2.5g/L of glucose and 0.25g/L of yeast powder, and sterilizing at 115 ℃ for 15 min. Separately, a 1.25mol/L magnesium sulfate solution mother liquor was prepared and sterilized separately, and when used, 5mL of magnesium sulfate mother liquor was added per L of the above medium.

The results show that the two strains reach the highest thallus concentration and tyrosol yield when fermented for 24 hours. Wherein the cell concentration calculated by OD600 is 12.3 and 11.3, and the tyrosol yield is 0.16g/L and 1.9g/L, respectively. The experiment shows that the knockout of four genes such as feaB in the host bacterium YC166 can greatly improve the yield of tyrosol.

Xu et al reported that YMG5A was found to have a maximum level of tyrosol fermentation of 10.92mM (approximately 1.84g/L) under shake flask fermentation conditions (Xu W, Yang C, Xia Y, et al, high-level production of tyrosol with purified recombinant Escherichia coli by metabolic engineering, Agricultural and Food Chemistry,2020,68: 4616-membered 4623), and YC166 shake flask fermentation final levels were not significantly increased over YMG5A, but the fermentation time of YC166 was only 24 hours and YMG5A required 48 hours. YMG5A calcium carbonate had to be added to neutralize the by-product organic acids produced by the strain when shake flask fermentation was performed, with acetic acid being the major by-product, estimated to be up to 0.5mM, whereas YC166 produced little acid during shake flask fermentation, with by-product mainly also acetic acid, in total amounts below 0.1 mM. The influence of adding calcium carbonate into the fermentation liquor of YC166 during shake flask fermentation is not obvious, and the shake flask fermentation method of adding calcium carbonate reported by Xu et al is adopted to carry out the fermentation of YC166, so that the yield of tyrosol is still about 1.9g/L, the fermentation time is 24h, which is probably because YC166 is rarely produced, and the effect of calcium carbonate as a neutralizing agent in the fermentation process is not obvious.

The YC166 fermentation medium in this example is M9Yb, with slightly higher amounts of glucose and ammonium chloride in its composition than M9Y used in Xu et al, a difference that may have an effect on the final yield of tyrosol and is generally unlikely to have a significant effect on shortening the fermentation cycle. The same experiment was carried out with caution in our YMG5A, and the results showed that the final fermentation level of YMG5A in M9Yb medium was still around 1.8 g/L and the fermentation period was rather prolonged, exceeding 48 h.

EXAMPLE 3 fermenter fermentation of recombinant E.coli YC166

Carrying out fermentation tank fermentation on the recombinant Escherichia coli YC166 according to the following steps:

(1) culturing the strain to be fermented on a solid LB culture medium to obtain a single colony;

(2) selecting a single colony, inoculating 20mL LB culture medium, and culturing overnight at 37 ℃;

(3) inoculating the above bacterial solution into 500mL triangular flask (generally 6 flasks need to be inoculated simultaneously) containing 50mL LB medium, controlling initial bacterial concentration at OD600 of 0.05, performing shake flask culture at 37 deg.C at 200r/min for 2-3 hr to reach OD₆₀₀Performing enlarged culture of thallus about 0.25;

(4) the cultured cell suspension was inoculated into a 5L fermentor containing 2L M9Y medium at an inoculum size of 10%. Ammonia water is used as a neutralizer in the fermentation process, and the constant pH value is 7 +/-0.5;

(5) samples were taken every 4h during fermentation and glucose concentration was determined at sampling. According to the results of glucose assay, if the sugar content is below 5g/L, the feed medium is added to a glucose concentration of 5 g/L. The samples taken were used to measure both tyrosol production and cell concentration.

The results are shown in FIG. 3. The results of fermenter fermentations using the tyrosol fermenter fermentation method reported by Xu et al (same as method 2 in the treatment method of the present invention) are shown in FIG. 3. As can be seen in FIG. 3, YC166 reached a maximum level of tyrosol at 3.3g/L when fermented for 24 h. The highest level of tyrosol obtained by fermenting tyrosol-producing recombinant bacteria YMG5A obtained at the earlier stage of the subject group under the same condition is 3.9g/L, but the fermentation time is 48 h. From Xu et al, it is clear that YMG5A has tyrosol content in the fermentation liquid of about 1.9g/L when fermented for 24h, and that the fermentation rate of YC166 is significantly higher than YMG 5A.

The fermentation method adopted in the present example is completely consistent with that reported by Xu et al, and from the fermentation results, the fermentation level of YC166 is close to YMG5A, and the fermentation period is greatly shortened.

Sequence listing

<110> university of south of the Yangtze river

<120> tyrosol-producing recombinant escherichia coli capable of shortening fermentation period and application thereof

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 67

<212> DNA

<213> PfeaB01(PfeaB01)

<400> 1

cagcgaaaaa agtgactttt cttgtcgctg cgtacactga aatcacactg ggggctggag 60

ctgcttc 67

<210> 2

<211> 70

<212> DNA

<213> PfeaB02(PfeaB02)

<400> 2

ttaataccgt acacacaccg acttagtttc acaccaaccg tccagccagt attccgggga 60

tccgtcgacc 70

<210> 3

<211> 18

<212> DNA

<213> PfeaBU(PfeaBU)

<400> 3

gactatagga aataagtc 18

<210> 4

<211> 17

<212> DNA

<213> PfeaBD(PfeaBD)

<400> 4

ctctgctgaa accatgg 17

<210> 5

<211> 20

<212> DNA

<213> Pkan02(Pkan02)

<400> 5

tgaacaagat ggattgcacg 20

<210> 6

<211> 65

<212> DNA

<213> PpheA01(PpheA01)

<400> 6

aggcaacact atgacatcgg aaaacccgtt actggcgctg cgagagaaaa ggctggagct 60

gcttc 65

<210> 7

<211> 73

<212> DNA

<213> PpheA02(PpheA02)

<400> 7

cagacgggtc ataatcagat tgtggttgcg cagtaccagc aacgcttcaa ccaattccgg 60

ggatccgtcg acc 73

<210> 8

<211> 21

<212> DNA

<213> PpheAU(PpheAU)

<400> 8

tcctttatat tgagtgtatc g 21

<210> 9

<211> 20

<212> DNA

<213> PpheD(PpheD)

<400> 9

tggcctgaat atccagatag 20

<210> 10

<211> 69

<212> DNA

<213> PtyrB01(PtyrB01)

<400> 10

gcttatggag cgttttaaag aagaccctcg cagcgacaaa gtgaatttaa gtatggctgg 60

agctgcttc 69

<210> 11

<211> 67

<212> DNA

<213> PtyrB02(PtyrB02)

<400> 11

ttacatcacc gcagcaaacg cctttgccac acgttgtaca tttgccgatt ccggggatcc 60

gtcgacc 67

<210> 12

<211> 15

<212> DNA

<213> PtyrBU(PtyrBU)

<400> 12

tgacgcctac gctgg 15

<210> 13

<211> 20

<212> DNA

<213> PtyrBD(PtyrBD)

<400> 13

tttcactgca ggctgggtag 20

<210> 14

<211> 60

<212> DNA

<213> PtyrR01(PtyrR01)

<400> 14

ttttcaggtg aaggttccca tgcgtctgga agtcttttgt gaagaggctg gagctgcttc 60

<210> 15

<211> 71

<212> DNA

<213> PtyrR02(PtyrR02)

<400> 15

ttactcttcg ttcttcttct gactcagacc atattcccgc aacttattgg cattccgggg 60

atccgtcgac c 71

<210> 16

<211> 17

<212> DNA

<213> PtyrRU(PtyrRU)

<400> 16

gtgcccgttt ttccgtc 17

<210> 17

<211> 20

<212> DNA

<213> PtyrRD(PtyrRD)

<400> 17

gattacgaag cagctctggc 20

Claims

1. The tyrosol-producing recombinant Escherichia coli YC166 with the shortened fermentation period is deposited in China center for type culture Collection, Wuhan university, China, and is classified and named as Escherichia coli YC166(Escherichia coli YC166), the preservation date is 2021 years, 4 months and 12 days, and the preservation number is CCTCC NO: m2021358.

2. The process of claim 1 for preparing tyrosol-producing recombinant E.coli YC166, which comprises the steps of:

(2) high biomass host bacterium screening: culturing 197 escherichia coli obtained in the step (1) to prepare an electrotransformation competent cell, transferring a recombinant plasmid pKK223-3-ARO10 into the escherichia coli competent cell, screening strains capable of obtaining a transformant, and finally obtaining host bacteria YEC039, YEC104 and YEC166 with the characteristics of tyrosol production and high thallus concentration of the transformant after the plasmid pKK223-3-ARO10 is transferred;

(3) host bacterium transformation: knocking out tyrosol-producing competitive pathway genes feaB, pheA, tyrB and an aromatic global regulation repressor gene tyrR from the high-concentration host bacteria YEC039, YEC104 and YEC166 obtained in the step (2), and finally obtaining host bacteria YEC166 capable of completing knocking-out work, wherein the strain obtained after the gene knocking-out is escherichia coli YEC166 delta feaB delta pheA delta tyrB delta tyrR;

(4) the method for obtaining the tyrosol-producing recombinant bacteria with shortened fermentation period comprises the following steps: and (3) further transferring the Escherichia coli YEC166 delta feaB delta pheA delta tyrB delta tyrR obtained in the step (3) into a recombinant plasmid pKK223-3-ARO10 expressed by a key enzyme gene ARO10 for controlling tyrosol synthesis, namely obtaining the tyrosol-producing recombinant Escherichia coli YC166 with shortened fermentation period.

3. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: in the step (1), the escherichia coli standard strain K12 is used as a reference, colonies similar to the K12 strain are selected to obtain 800 strains, 16s rDNA gene sequencing is carried out on all the strains, the sequencing result is compared with a 16s rDNA gene sequence in a genome sequence of escherichia coli MG1655, and the standard of sequence homology of 98.5% is used for the next experiment; and finally obtaining 197 strains, wherein the numbers of the strains are YEC001-YEC197, and the strains are all preserved in an industrial microbial resource information platform of colleges and universities in China, university in south of the Yangtze river.

4. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: transferring a recombinant plasmid pKK223-3-ARO10 for controlling the expression of a tyrosol synthesis key enzyme phenylpyruvate decarboxylase gene in escherichia coli into a strain YEC001-YEC197 to culture to prepare an electric transformation competent cell, and electrically transforming the screened competent cell of the escherichia coli by using the plasmid pKK223-3-ARO10 to obtain a transformant which is 81 strains; and respectively inoculating the 81 transformants into an M9Y culture medium, carrying out shake flask fermentation, detecting the thallus concentration at intervals of 12 hours, fermenting for 48 hours, detecting the yield of tyrosol, and screening three host bacteria with host bacteria numbers of YEC039, YEC104 and YEC 166.

5. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: in the knockout of the feaB gene in the step (3), adopted primers are PfeAB01 and PfeAB 02; the sequence of PfeAB01 is shown as SEQ ID NO. 1, and the sequence of PfeAB02 is shown as SEQ ID NO. 2;

the primers used for identifying the gene knockout recombinant bacteria are PfeOB, PfeOB and Pkan 02; the sequence of PfeOB is shown as SEQ ID NO. 3, the sequence of PfeOB is shown as SEQ ID NO. 4, and the sequence of Pkan02 is shown as SEQ ID NO. 5.

6. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: in the pheA gene knocking-out in the step (3), primers adopted are PpheA01 and PpheA 02; PpheA01 has a sequence shown in SEQ ID NO 6; the sequence of PpheA02 is shown as SEQ ID NO. 7;

the primers for identifying the pheA gene knockout recombinant bacteria are PpheAU and PpheAD specifically; the sequence of PpheAU is shown as SEQ ID NO. 8, and the sequence of PpheD is shown as SEQ ID NO. 9.

7. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: in the knockout of tyrB gene in the step (3), adopted primers are PtyrB01 and PtyrB 02; the sequence of PtyrB01 is shown as SEQ ID NO. 10, and the sequence of PtyrB02 is shown as SEQ ID NO. 11;

the primers for identifying tyrB gene knockout recombinant bacteria are PtyrBU and PtyrBD; the sequence of PtyrBU is shown as SEQ ID NO. 12, and the sequence of PtyrBD is shown as SEQ ID NO. 13.

8. The process of claim 2, wherein the recombinant E.coli YC166 for producing tyrosol is prepared by: in the knockout of tyrR gene in the step (3), adopted primers are PtyrR01 and PtyrR 02; the PtyrR01 primer sequence is shown as SEQ ID NO. 14; the sequence of the PtyrR02 primer is shown as SEQ ID NO. 15;

the primers used for identifying tyrR gene knockout recombinant bacteria are PtyrRU and PtyrRD; the PtyrRU sequence is shown as SEQ ID NO 16, and the PtyrRD sequence is shown as SEQ ID NO 17.

9. The use of recombinant E.coli YC166 for the production of tyrosol as claimed in claim 1, wherein: the method is applied to shake flask fermentation or fermentation tank fermentation of tyrosol.

10. The use of recombinant escherichia coli YC166 for producing tyrosol according to claim 9, wherein: fermenting with tyrosol-producing recombinant Escherichia coli YC166 with inoculum size of 1%, and culture medium M9Yb fermentation medium; fermenting at 30 deg.C for 24h at 200 r/min.