CN112538451B

CN112538451B - Clostridium beijerinckii for producing butyl acetate by over-expressing ATF gene

Info

Publication number: CN112538451B
Application number: CN201910898097.5A
Authority: CN
Inventors: 金明杰; 方大徽; 闻志强; 翟睿; 许召贤
Original assignee: Nanjing University of Science and Technology
Current assignee: Nanjing University of Science and Technology
Priority date: 2019-09-23
Filing date: 2019-09-23
Publication date: 2022-06-21
Anticipated expiration: 2039-09-23
Also published as: CN112538451A

Abstract

The invention discloses a clostridium beijerinckii for producing butyl acetate by over-expressing ATF gene. The invention takes clostridium beijerinckii for efficiently producing butanol and acetyl-CoA as a host, introduces an alcohol acyltransferase gene and obtains clostridium beijerinckii genetic engineering bacteria for over-expressing ATF genes. The genetic engineering strain can produce 1.5g/L butyl acetate within 72h, the yield of the butyl acetate can be further improved to 5.5g/L by adding 10% of dodecane and 1% of calcium carbonate into a fermentation culture medium, and the clostridium beijerinckii is suitable for industrial fermentation production of the butyl acetate.

Description

Clostridium beijerinckii for producing butyl acetate by over-expressing ATF gene

Technical Field

The invention relates to clostridium beijerinckii for producing butyl acetate by over-expressing ATF gene, belonging to the technical field of genetic engineering bacteria.

Background

Butyl acetate is a commonly used chemical raw material, is commonly used as a solvent and diluent for coating materials in processes of printing, curing agents and the like, and is also widely used as a solvent and an extractant in the production of artificial leather, textiles and plastics, and is also an important drug intermediate [ Matsuyama A, Yamamoto H, Kobayashi Y.practical Application of communicating needle-Cell biochemicals for the Manufacturing of Pharmaceutical Intermediates of ceramic Alcohols [ J ]. Organic Process Research & Development,2002,6(4):558-561 ]. The traditional production mode of butyl acetate is synthesized by esterification reaction of acetic acid and n-butanol at a high temperature of more than 110 ℃, the method has the problems of long process time, large reaction energy consumption, side reaction and the like, and the subsequent separation of the final product is difficult. In addition, the synthesis process of butyl acetate is continuously carried out under a high-temperature condition, so that the energy consumption is high and potential safety hazards exist [ Wuming, research progress of butyl acetate synthesis technology in China [ J ]. fine and special chemicals, 2018, v.26(08):55-57 ].

Clostridia are generally gram-positive anaerobic bacteria, the cells of which are ciliated so that they move and are capable of forming endospores, which are commonly found in nature, the main habitat of which is soil, river sludge, activated sludge, animal excrement, etc. Among them, Clostridium beijerinckii (Clostridium beijerinckii) is known for its ability to have significant substrate tolerance and its diversity of potential metabolites, and is an excellent solventogenic Clostridium species, which is excellent in both solvent yield and productivity [ Lee S Y, Park J H, Jang S H, et al. nutritional butanol production by Y clinical science [ J ]. Biotechnology and Biotechnology, 2008,101(2):209-228 ].

The ATF1 gene encoding alcohol acetyltransferase (AATase) [ Fujii T, Nagasawa N, Iwamath A, et al. molecular cloning, sequence analysis, and expression of the yeast alcohol acetyltransferase gene [ J ]. Applied and Environmental Microbiology,1994,60(8): 2786-. The nucleotide sequence of the ATF1 gene from Saccharomyces cerevisiae consists of 1575bp open reading frame, which encodes 525 amino acids. Although the yeast AAT enzyme is considered a membrane bound enzyme, the results of the hydrophobicity analysis indicate that the gene product does not have a significantly hydrophobic transmembrane region. Southern analysis of the yeast genome using the ATF1 gene as a probe revealed that s.cerevisiae had one ATF1 gene, while s.cerevisiae had one ATF1 gene and another homologous gene (Lg-ATF 1).

Disclosure of Invention

The invention aims to provide a clostridium beijerinckii strain for producing butyl acetate by over-expressing an ATF gene. The invention introduces ATF1 gene into Clostridium beijerinckii to construct new engineering strain. The engineering strain expresses alcohol acyltransferase of ATF1 gene, and under the action of the alcohol acyltransferase, the engineering strain is fermented in a glucose culture medium to successfully obtain a target product butyl acetate.

The technical scheme for realizing the purpose of the invention is as follows:

a butyl acetate-producing Clostridium beijerinckii overexpressing the ATF gene was constructed by inserting an alcohol acyltransferase gene (ATF1 gene) into the Clostridium beijerinckii genome.

The invention provides a construction method of clostridium beijerinckii for producing butyl acetate by over-expressing ATF genes, which comprises the following steps:

step 1, using pXY1 as a plasmid vector, loading an ATF1 gene fragment into a plasmid framework pXY1 linearized by BamHI and SmaI double enzyme digestion in an enzyme digestion connection manner, and constructing an overexpression plasmid pYX1-ATF 1;

and 2, pre-methylating the over-expression plasmid pYX1-ATF1, introducing the over-expression plasmid pYX1-ATF1 into clostridium beijerinckii in an electroporation mode, screening, and obtaining the clostridium beijerinckii-ATF1 which can over-express the ATF gene and can produce butyl acetate after sequencing and verification are correct.

Further, the invention provides an application of the clostridium beijerinckii in fermentation production of butyl acetate.

Specifically, the application method of the clostridium beijerinckii in the fermentation production of butyl acetate comprises the following steps: inoculating clostridium beijerinckii for producing butyl acetate of over-expression ATF gene into a fermentation culture medium, and carrying out anaerobic fermentation to produce butyl acetate.

In a specific embodiment of the present invention, the formulation of the fermentation medium (XPH2 medium) is as follows (g/L): yeast extract 1g, glucose 60g, K₂HPO₄·3H₂O 0.655g，KH₂PO₄ 0.5g，NH₄AC 2.2g, cysteine hydrochloride 1 g; adding 10mL/L of fermentation medium of the second component and 1mL/L of fermentation medium of the third component; component two component (g/100 mL): MgSO (MgSO)₄·7H₂O 2.0g，MnSO₄·H₂O 0.1g，NaCl 0.1g，FeSO₄·7H₂0.1g of O; componentsThree components (mg/100 mL): 100mg of aminobenzoic acid (rho-aminobenzoic acid), 100mg of vitamin B1(thiamine), and 1mg of biotin (biotin).

Preferably, the fermentation medium is further supplemented with 10% dodecane and 1% calcium carbonate.

In a specific embodiment of the invention, the Clostridium beijerinckii is Clostridium beijerinckii NCIMB8052 (Clostridium beijerinckii NCIMB 8052).

Compared with the prior art, the invention has the following advantages:

the invention takes Clostridium beijerinckii NCIMB8052 for efficiently producing butanol and acetyl-CoA as a host, and introduces an alcohol acyltransferase gene (ATF1) to obtain a genetic engineering strain. The alcohol acyltransferase expressed from ATF1 gene can combine acyl-CoA with alcohol to remove ester corresponding to CoA synthesis. The genetic engineering strain can produce 1.5g/L butyl acetate within 72 hours. In addition, the invention further improves the yield of the butyl acetate to 5.5g/L by optimizing the fermentation medium and adding 10% of dodecane and 1% of calcium carbonate into the culture medium.

Drawings

FIG. 1 is a diagram of the metabolic pathway of Clostridium beijerinckii.

FIG. 2 is a diagram of the metabolic pathway of Clostridium beijerinckii overexpressing the ATF1 gene.

FIG. 3 is a design schematic diagram of a plasmid (pXY1-ATF1) for overexpressing ATF1 gene.

FIG. 4 is a diagram showing the results of introducing a plasmid (pXY1-ATF1) overexpressing ATF1 gene into E.coli DH5 α.

FIG. 5 is a plate diagram of C.beijerinckii-ATF1 strain obtained by introducing a plasmid (pXY1-ATF1) which is sequencing-verified and overexpresses ATF1 gene into C.beijerinckii and selecting mutants by erythromycin resistance at 25 mg/mL.

FIG. 6 shows the results of fermentation with glucose as substrate by C.beijerinckii-ATF1, compared with the wild type strain, A: glucose consumption, growth of cells and production of butyl acetate of beijerinckii-ATF1 strain; b: production of byproducts (acetone, acetic acid, butyric acid, ethanol, butanol) of beijerinckii-ATF1 strain; c: glucose consumption, thallus growth and pH change of wild clostridium beijerinckii; d: production of by-products of wild clostridium beijerinckii (acetone, acetic acid, butyric acid, ethanol, butanol).

Fig. 7 is a graph of the fermentation results of c.beijerinckii-ATF1 strain with glucose substrate after optimizing the fermentation conditions, a: glucose consumption, growth of cells and production of butyl acetate of beijerinckii-ATF1 strain; b: production of byproducts (acetone, acetic acid, butyric acid, ethanol, butanol) of beijerinckii-ATF1 strain.

Detailed Description

The present invention will be described in more detail with reference to the following examples and the accompanying drawings.

In the following examples, Clostridium beijerinckii NCIMB8052 (Clostridium beijerinckii NCIMB8052) was used.

YTG medium formula is as follows (g/L): peptone 6, yeast extract 10g, glucose 5g, NaCl 5g, cysteine hydrochloride 1g, resazurin 0.003g, solid medium need to be added with 12g/L agarose. Performing anaerobic preparation and subpackage, and sterilizing at 121 ℃ for 20 min.

The formula of the fermentation medium (XPH2) is as follows (g/L): yeast extract 1g, glucose 60g, K₂HPO₄·3H₂O0.655g，KH₂PO₄ 0.5g，NH₄AC 2.2g and cysteine hydrochloride 1 g. Performing anaerobic preparation and subpackage, and sterilizing at 121 ℃ for 20 min. After the sterilization is finished, 10mL/L of the component two solution and 1mL/L of the component three solution are added.

Component two solution ingredients (g/100 mL): MgSO (MgSO) in vitro₄·7H₂O 2.0g，MnSO₄·H₂O 0.1g，NaCl 0.1g，FeSO₄·7H₂O 0.1g。

Component three solution ingredients (mg/100 mL): aminobenzoic acid (p-aminobenzoic acid)100mg, vitamin B1(thiamine)100mg, biotin (biotin)1mL (1mg/mL of mother liquor).

Example 1

The construction of Clostridium beijerinckii-ATF1 for over-expressing ATF1 gene comprises the following steps:

step 1, as shown in FIG. 3, an overexpression plasmid (pXY1-ATF1) was designed and obtained. The design principle is that ATF1 gene for expressing alcohol acyltransferase is constructed on pXY1 skeleton, expression is started under THL promoter, ATF1 gene (SEQ No.3) is transcribed and translated into alcohol acyltransferase. The design scheme is that pXY1 is used as a plasmid vector, and an ATF1 gene fragment is loaded into a plasmid framework pXY1 linearized by BamHI and SmaI double enzyme digestion in an enzyme digestion connection mode to obtain an overexpression plasmid pYX1-ATF 1.

ATF1 primer F (SEQ No. 1): cgggatccatgaatgaaatagatgagaaaaatc

ATF1 primer R (SEQ No. 2): tcccccgggttatggtcctaataataaagcttta

And 2, introducing the overexpression plasmid pYX1-ATF1 obtained in the step 1 into DH5 alpha in escherichia coli for amplification, screening the escherichia coli carrying the plasmid with 100mg/mL ampicillin resistance, selecting a single colony for PCR verification, checking whether the size of a PCR gene fragment is consistent with a target through electrophoresis, culturing the escherichia coli overnight and extracting the plasmid if the size is consistent with the target, performing double enzyme digestion verification on the extracted plasmid by using BamHI and SmaI, and finally sending the plasmid to a gene sequencing mechanism for sequencing.

Sequencing primer F (SEQ No. 4): ctaaaatcaaagtcaagtatgaaatc

Sequencing primer R (SEQ No. 5): gtgctgcaaggcgattaagttg

And 3, extracting a plasmid which is verified to be correct after sequencing, and introducing an initial clostridium beijerinckii OD600 of 1.5, the using amount of the plasmid of 4 mu g, the electrotransfer voltage of 1.8kv and an electrotransfer parameter for reviving for 9h into the clostridium beijerinckii in an electroporation mode. Clostridium beijerinckii carrying an overexpression plasmid (pYX1-ATF1) was then screened for erythromycin resistance at 25 mg/mL.

And 4, performing colony PCR on the single colony growing in the solid culture medium in the step 3 by using a sequencing primer designed according to a corresponding gene, recovering and sequencing the amplified gene fragment, comparing the sequencing result with an ATF1 gene sequence, selecting a strain with a sequence consistent with that of an ATF1 gene, and obtaining the clostridium beijerinckii-ATF1 over-expressing the ATF1 gene.

Example 2

A method for producing butyl acetate by using glucose glycerol by using clostridium beijerinckii-ATF1 which overexpresses ATF1 gene, comprising the following steps:

inoculating the C.beijerinckii-ATF1 strain into a 5mL YTG culture medium test tube containing erythromycin resistance of 25mg/mL for overnight growth, then inoculating the 5mL test tube bacterial liquid into a 100mL YTG culture medium serum bottle containing erythromycin resistance of 25mg/mL, and after the bacteria reach the vigorous growth period (6-12h), transferring the bacteria into a 500mL anaerobic fermentation tank, and carrying out anaerobic fermentation by using a fermentation medium (XPH 2).

Example 3

In order to improve the yield of fermented butyl acetate, the fermentation process is optimized, 10% of dodecane is added into fermentation liquor after the genetic engineering strain is inoculated into a fermentation culture medium, and the growth condition of the genetic engineering strain can be obviously improved. In addition, 1% calcium carbonate is added into the fermentation liquor to further improve the growth condition of the genetic engineering strain and increase the yield of butyl acetate, and the specific steps are as follows:

step 1: the genetically engineered strain C.beijerinckii-ATF1 was streaked on YTG solid plate containing erythromycin 25mg/L and cultured in an inverted state at 37 ℃ in an anaerobic chamber for 24 hours.

Step 2: single colonies on the YTG plates were picked, inoculated into 5ml of YTG liquid medium containing erythromycin at 25mg/L, and cultured overnight in an anaerobic chamber at 37 ℃.

And 3, step 3: the overnight growth in the test tube of 5mL test tube bacterial liquid all inoculated into 100mL containing 25mg/mL erythromycin resistance YTG medium serum bottle, at 37 degrees C anaerobic box static culture.

And 4, step 4: when the thallus in a 100mL serum bottle reaches a growth vigorous period (6-12h, a large amount of fine foam is generated during shaking), the thallus is transferred into a 500mL anaerobic fermentation tank according to the inoculation amount of 10 percent, and the culture medium of the anaerobic fermentation tank is XPH 2.

And 5: 10% dodecane and 1% calcium carbonate were added to the anaerobic fermentor and then fermented in the anaerobic fermentor for 72 h.

After fermentation, the growth condition of thalli, the consumption condition of glucose, the production condition of butyl acetate and the production condition of other products (acetone, butanol, ethanol, butyric acid and acetic acid) in the fermentation process are analyzed by instruments such as a high performance liquid chromatograph, a gas chromatograph, an ultraviolet-visible spectrophotometer and the like.

The fermentation result of the over-expression engineering strain C.beijerinckii-ATF1 is shown in FIGS. 6A and 6B, and the over-expression engineering strain rapidly grows in the first 24h and accumulates biomass. 21.7g/L of glucose was consumed during 72h of the fermentation period, yielding 1.5g/L of butyl acetate, which was not present in the wild strain. In addition, the engineered strain also produced 1.69g/L butanol, 0.635g/L acetone, 0.345g/L ethanol, 0.37g/L acetic acid and 0.103g/L butyric acid in the meantime. Compared with the wild strain, the modified over-expression strain C.beijerinckii-ATF1 can obviously produce butyl acetate, and the yield of the butyl acetate is equivalent to that of butanol.

The wild strain fermentation results are shown in FIGS. 6C and 6D, and the strains of the wild type strain of Clostridium beijerinckii grow rapidly within the first 24 hours after 72 hours of fermentation. 51g/L glucose was consumed during 72h of fermentation, yielding 10.59g/L butanol, 6.592g/L acetone, 0.812g/L ethanol, and 1.37g/L acetic acid and 0.467g/L butyric acid. Compared with the transformed over-expression strain C.beijerinckii-ATF1, it can be seen that the wild strain has no production of butyl acetate.

The fermentation result of the over-expression engineering strain C.beijerinckii-ATF1 after process optimization is shown in FIGS. 7A and 7B, the biomass is accumulated at the early stage of the strain, 37g/L of glucose is consumed within 72h, and 5.5g/L of butyl acetate is produced. In addition, the engineered strain also produced 3.87g/L butanol, 2.65g/L acetone, 0.405g/L ethanol, 2.81g/L acetic acid and 0.445g/L butyric acid during the optimized fermentation medium fermentation. Compared with the strain fermentation before the fermentation process is optimized, the over-expression strain C.beijerinckii-ATF1 after the fermentation process is optimized can obviously generate 5.5g/L of butyl acetate, the yield is 367 percent before the fermentation process is optimized, and the improvement effect is obvious.

Sequence listing

<110> Nanjing university of science and technology

<120> Clostridium beijerinckii for production of butyl acetate overexpressing ATF gene

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgggatccat gaatgaaata gatgagaaaa atc 33

<210> 2

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcccccgggt tatggtccta ataataaagc ttta 34

<210> 3

<211> 1578

<212> DNA

<213> Saccharomyces cerevisiae

<400> 3

atgaatgaaa tagatgagaa aaatcaagca ccagttcaac aagaatgttt aaaagaaatg 60

attcaaaatg gacatgctag aagaatgggt tcagttgaag atctttatgt agcattaaat 120

agacaaaatt tatatagaaa tttttgtact tatggtgaac ttagtgatta ttgtactaga 180

gatcaattaa ctttagcttt aagagaaatt tgtttaaaaa atccaacatt attacatata 240

gttttaccaa ctagatggcc taatcatgaa aattattata gatcaagtga atattatagt 300

agacctcatc cagttcatga ttatatatca gttttacaag aattaaaatt aagtggagtt 360

gttttaaatg aacaaccaga atattctgca gtaatgaaac aaattttaga agaatttaaa 420

aatagtaaag gatcatatac tgcaaaaata tttaaattaa caactacttt aacaatacca 480

tattttggac caacaggacc atcatggaga ttaatatgtt tacctgaaga acatactgaa 540

aaatggaaaa aatttatttt tgtatctaat cattgtatga gtgatggtag atcatctata 600

catttctttc atgatctaag agatgaatta aataatatta aaacaccacc taaaaaatta 660

gattatattt ttaaatatga agaagattat caattattaa gaaaattacc tgaaccaata 720

gaaaaagtta tagattttag accaccttat ttatttatac ctaaaagttt attaagtgga 780

tttatatata atcatttaag atttagttct aaaggagtat gtatgagaat ggatgatgta 840

gaaaaaactg atgatgtagt aacagaaata attaatataa gtcctacaga atttcaagct 900

ataaaagcta atattaaatc taatattcaa ggaaaatgca caataactcc atttttacat 960

gtatgttggt ttgtatcatt acataaatgg ggtaaattct ttaaaccatt aaattttgaa 1020

tggttaactg atatttttat tccagctgat tgtagatcac aactacctga tgatgatgaa 1080

atgagacaaa tgtatagata tggagctaat gtaggattta ttgatttcac tccatggata 1140

agtgaatttg atatgaatga taacaaagaa aatttttggc cattaattga acattatcat 1200

gaagtaatat ctgaagcatt aagaaataag aaacatttac atggattagg atttaatata 1260

caaggatttg ttcaaaaata tgttaatatt gataaagtaa tgtgtgatag agcaatagga 1320

aaaagaagag gtggtacatt acttagtaat gtaggattat ttaatcaatt agaagaacct 1380

gatgctaaat attcaatatg tgatttagca tttggacaat ttcaaggttc ttggcatcaa 1440

gctttttcat taggagtatg ttcaactaat gttaaaggta tgaatatagt tgtagctagt 1500

actaaaaatg tagttggtag ccaagaatca ttagaagaat tatgtagtat atataaagct 1560

ttattattag gaccataa 1578

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctaaaatcaa agtcaagtat gaaatc 26

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgctgcaag gcgattaagt tg 22

Claims

1. Clostridium beijerinckii (C.beijerinckii) for producing butyl acetate over-expressing ATF1 geneClostridium beijerinckii) The gene is characterized by being constructed by inserting an alcohol acyltransferase gene into a Clostridium beijerinckii NCIMB8052 genome, wherein the nucleotide sequence of the alcohol acyltransferase gene is shown as SEQ No. 3.

2. The method for constructing clostridium beijerinckii according to claim 1, characterized by comprising the following specific steps:

step 1, pXY1 is used as a plasmid vector, an ATF1 gene fragment is loaded into a plasmid framework pXY1 which is linearized by BamHI and SmaI double enzyme digestion in an enzyme digestion connection mode, and an overexpression plasmid pYX1-ATF1 is constructed;

and 2, pre-methylating the over-expression plasmid pYX1-ATF1, introducing the over-expression plasmid pYX1-ATF1 into clostridium beijerinckii in an electroporation mode, screening, and obtaining the clostridium beijerinckii for producing the butyl acetate of the over-expression ATF1 gene after sequencing verification is correct.

3. Use of clostridium beijerinckii according to claim 1 for the fermentative production of butyl acetate.

4. The application of claim 3, wherein the specific method is as follows: inoculating clostridium beijerinckii for producing butyl acetate which overexpresses ATF1 gene into a fermentation culture medium, and carrying out anaerobic fermentation to produce butyl acetate.

5. The use according to claim 4, wherein the fermentation medium is formulated as: yeast extract 1g/L, glucose 60 g/L, K₂HPO₄•3H₂O 0.655 g/L，KH₂PO₄ 0.5 g/L，NH₄AC 2.2 g/L, cysteine hydrochloride 1 g/L; adding 10mL/L of fermentation medium of the second component and 1mL/L of fermentation medium of the third component; the component two comprises: mg (magnesium)SO₄•7H₂O 20.0 g/L， MnSO₄•H₂O 1 g/L，NaCl 1 g/L，FeSO₄•7H₂O1 g/L; the components are three: 1g/L of aminobenzoic acid, 11 g/L of vitamin B and 0.01 g/L of biotin.

6. The use according to claim 5, wherein the fermentation medium is supplemented with 10% dodecane and 1% calcium carbonate.