CN113249240B

CN113249240B - Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof

Info

Publication number: CN113249240B
Application number: CN202110546281.0A
Authority: CN
Inventors: 罗云孜; 刘化一
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2021-05-19
Filing date: 2021-05-19
Publication date: 2023-04-28
Anticipated expiration: 2041-05-19
Also published as: CN113249240A

Abstract

The invention relates to the technical field of microbial genetic engineering, and discloses a saccharomyces cerevisiae for high-yield hydroxytyrosol and a construction method thereof. The saccharomyces cerevisiae with high hydroxytyrosol yield expresses HpaB and HpaC with specific sources on the basis of the saccharomyces cerevisiae capable of synthesizing the tyrosol, thereby realizing the preparation and high yield of the hydroxytyrosol. The invention mainly selects 4-hydroxyphenylacetic acid-3-hydroxylase from pseudomonas aeruginosa, combines with other riboflavin oxidoreductase from specific sources, transfers the riboflavin oxidoreductase into a saccharomyces cerevisiae chassis cell capable of producing tyrosol, and realizes the improvement of hydroxytyrosol yield; on the basis, various modifications are further carried out, so that the yield of hydroxytyrosol of the saccharomyces cerevisiae reaches 1120mg/L, and a new way is provided for producing hydroxytyrosol by high-efficiency fermentation of microorganisms.

Description

Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof

Technical Field

The invention relates to the technical field of microbial genetic engineering, in particular to saccharomyces cerevisiae for high-yield hydroxytyrosol and a construction method thereof.

Background

The hydroxytyrosol (3, 4-dihydroxyphenethyl alcohol) has wide application in the aspects of food, health care products and cosmetics and has wide market value. At present, the yield of extracting hydroxytyrosol from plants is low, and the purification is complex. The chemical synthesis of hydroxytyrosol requires expensive catalysts. The method for producing the hydroxytyrosol by adopting the microbial fermentation has the advantages of low natural dependence, no need of expensive catalysts, relatively easy purification and the like, so that an engineering bacterium capable of producing the hydroxytyrosol at high yield has great development potential. There are prior art techniques for converting tyrosol to hydroxytyrosol using 4-hydroxyphenylacetic acid-3-hydroxylase HpaB/riboflavin oxidoreductase HpaC derived from Escherichia coli (Escherichia coil); however, according to the document Overproduction of hydroxytyrosol in Saccharomyces cerevisiae by heterologous overexpression of the Escherichia coli, 4-hydroxyphenylacrylate 3-monooxygenase, 1mM tyrosol can only be converted into 4.6mg/L hydroxytyrosol by expressing HpaB/HpaC derived from Ec in Saccharomyces cerevisiae, which is inefficient. At present, no saccharomyces cerevisiae engineering bacteria capable of efficiently converting tyrosol into hydroxytyrosol in saccharomyces cerevisiae are found yet.

Disclosure of Invention

In view of the above, the invention aims to provide a Saccharomyces cerevisiae for high yield of hydroxytyrosol and a construction method thereof, so that the Saccharomyces cerevisiae can remarkably improve the yield of hydroxytyrosol.

In order to achieve the above object, the present invention provides the following technical solutions:

a Saccharomyces cerevisiae with high hydroxytyrosol yield further expresses HpaB and HpaC of any combination on the basis of the Saccharomyces cerevisiae capable of synthesizing tyrosol:

(1) HpaB (PaHpaB) from Pseudomonas aeruginosa (Pseudomonas aeruginosa), and HpaC (SeHpaC, paHpaC and EcHpaC) from Salmonella enterica (Salmonella enterica), pseudomonas aeruginosa, or Escherichia coli; or (b)

(2) HpaB (EcHpaB) derived from Escherichia coli and HpaC derived from Pseudomonas aeruginosa.

The HpaB and HpaC of the source combination are expressed in the saccharomyces cerevisiae capable of synthesizing the tyrosol, the tyrosol in the saccharomyces cerevisiae can be efficiently converted into the hydroxytyrosol, and compared with other combinations, the yield of the hydroxytyrosol is obviously improved.

In a specific embodiment of the invention, the PaHpaB can be either wild-type or mutant with a Q212D mutation; the wild type amino acid sequence of PaHpaB is shown as SEQ ID No.1, and the corresponding nucleotide sequence comprises but is not limited to the one shown as SEQ ID No. 2; the Q212D mutant amino acid sequence of PaHpaB is changed into D from 212 th amino acid based on the sequence shown in SEQ ID No.1, and the corresponding nucleotide sequence is changed into GAC from 634 th to 636 th base based on the sequence shown in SEQ ID No.2, but the PaHpaB is not limited to the sequence; other sources of wild-type HpaB and HpaC sequences were as follows:

SeHpaC, paHpaC and EcHpaC amino acid sequences are shown in SEQ ID No.3-5, and corresponding nucleotide sequences are shown in SEQ ID No. 6-8; the amino acid sequence of EcHpaB is shown as SEQ ID No.9, and the corresponding nucleotide sequence is shown as SEQ ID No. 10.

The saccharomyces cerevisiae capable of synthesizing tyrosol can be constructed by referring to the prior art, and the invention provides a better construction mode:

(1) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L And ARO7 ^G141S Mutant and expression of knocked-out Saccharomyces cerevisiae PHA2 and PDC1；

(2) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutants and knockdown of expression of saccharomyces cerevisiae PHA2 and PDC 1; or (b)

(3) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutant, over-expression of TyrA from E.coli ^M53I ^A354V Double mutant and expression of knocked-out Saccharomyces cerevisiae PHA2 and PDC 1.

The overexpression can be realized in the form of an overexpression vector, or the expression quantity of a target gene is improved, and the expression of the knockdown saccharomyces cerevisiae PHA2 and PDC1 can be knocked down by a CRISPSR-Cas 9 method.

In a specific embodiment of the invention, the construction is carried out by using CEN.PK2-1C Saccharomyces cerevisiae commonly used in the art, wherein the first construction mode is used for obtaining the Saccharomyces cerevisiae capable of synthesizing tyrosol, the fermentation yield of tyrosol is 1040.2mg/L, the second construction mode is used for obtaining the Saccharomyces cerevisiae capable of synthesizing tyrosol, the fermentation yield of tyrosol can reach up to 1350mg/L, and the third construction mode is used for over-expressing TyrA from escherichia coli on the basis of the second construction mode ^{M53I A354V} Double mutant, and the fermentation yield of tyrosol is 1160mg/L;

wherein the amino acid sequence of ARO2 is shown as SEQ ID No.11, and the nucleotide sequence is shown as SEQ ID No. 12; the amino acid sequence of ARO10 is shown as SEQ ID No.13, and the nucleotide sequence is shown as SEQ ID No. 14; the amino acid sequence of TKL1 is shown as SEQ ID No.15, and the nucleotide sequence is shown as SEQ ID No. 16; the RKI1 amino acid sequence is shown as SEQ ID No.17, and the nucleotide sequence is shown as SEQ ID No. 18;

ARO4 ^K229L the amino acid sequence is shown as SEQ ID No.19, and the nucleotide sequence is shown as SEQ ID No. 20; ARO7 ^G141S The amino acid sequence is shown as SEQ ID No.21, and the nucleotide sequence is shown as SEQ ID No. 22; ARO3 ^D154N The amino acid sequence of the mutant is shown as SEQ ID No.23, and the nucleotide sequence is shown as SEQ ID No. 24;

derived from E.coliTyrA ^{M53I A354V} The amino acid sequence of the double mutant is shown as SEQ ID No.25, and the nucleotide sequence is shown as SEQ ID No. 26.

In addition, in order to further increase the yield of the high-yield hydroxytyrosol-producing Saccharomyces cerevisiae of the present invention, the endogenous TRP2 gene promoter thereof (also referred to as the endogenous TRP2 gene promoter of the tyrosol-synthesizing Saccharomyces cerevisiae) may be replaced with a weak promoter, which is a promoter having a weaker promoter capacity than the original promoter. In a specific embodiment of the present invention, the present invention replaces the original stronger promoter TRP2-promoter of TRP2 gene with the YEN1p weak promoter.

After the transformation of the different combination schemes, the yield of the saccharomyces cerevisiae with high yield of hydroxytyrosol can reach 1120mg/L at most. Based on the technical effects, the invention provides application of the saccharomyces cerevisiae with high yield of hydroxytyrosol in preparing hydroxytyrosol; the invention also provides an application of HpaB and HpaC or expression vectors thereof in constructing Saccharomyces cerevisiae with high hydroxytyrosol yield by taking Saccharomyces cerevisiae capable of synthesizing tyrosol as a chassis:

(1) HpaB derived from Pseudomonas aeruginosa, hpaC derived from Salmonella enterica, pseudomonas aeruginosa or Escherichia coli; or (b)

(2) HpaB from E.coli and HpaC from P.aeruginosa.

Meanwhile, the invention also provides a construction method of the saccharomyces cerevisiae with high yield of hydroxytyrosol, and the recombinant vector expressing HpaB and HpaC which are arbitrarily combined as follows is transferred into the saccharomyces cerevisiae capable of synthesizing tyrosol to obtain the saccharomyces cerevisiae with high yield of hydroxytyrosol;

or integrating the coding genes of HpaB and HpaC which are arbitrarily combined into a saccharomyces cerevisiae genome capable of synthesizing tyrosol for expression to obtain the saccharomyces cerevisiae with high hydroxytyrosol yield;

(2) HpaB from E.coli and HpaC from P.aeruginosa.

The recombinant vector may also be referred to as an expression cassette, which is a genetic element known in the art capable of expressing a gene of interest, including but not limited to a promoter, a gene of interest and a terminator, which are commercially available according to actual needs; in a specific embodiment of the invention, the recombinant vector is constructed on the basis of commercially available PRS-series plasmids (PRS 403, PRS404, PRS406, etc.); the coding genes for expressing HpaB and HpaC can be respectively integrated on the carrier plasmids to form different recombinant carriers, and can also be simultaneously integrated on the same carrier plasmid, so that the method is more convenient and efficient.

Because of the unique homologous recombination mechanism of Saccharomyces cerevisiae, the invention can construct homology arms at both ends of the coding genes of HpaB and HpaC and then integrate into the genome of Saccharomyces cerevisiae.

In order to be able to further increase the yield, it is preferable to obtain Saccharomyces cerevisiae capable of synthesizing tyrosol using the aforementioned construction method; the promoter of its endogenous TRP2 gene may also be replaced with a promoter having a weaker promoter capacity than the original promoter. In a specific embodiment of the invention, the replacement of the original promoter is performed by CRISPR-Cas9 technology.

According to the application provided by the invention, a method for preparing hydroxytyrosol is also provided, the Saccharomyces cerevisiae with high yield of hydroxytyrosol is adopted for fermentation culture, and the supernatant of fermentation liquor is collected to separate out hydroxytyrosol. Wherein the fermentation medium is preferably YPD medium.

In a specific embodiment of the present invention, the method for preparing hydroxytyrosol comprises:

1) Culturing a saccharomyces cerevisiae strain with high hydroxytyrosol yield on a YPD plate, and activating the saccharomyces cerevisiae strain;

2) Picking monoclonals in 5ml YPD liquid and culturing for 36 hours;

3) 5ml of YPD culture medium was transferred to 50ml of YPD at a ratio of 1:50, and cultured at 30℃for 84 hours at 220 rpm;

4) Collecting the supernatant of the fermentation liquor and separating to obtain the hydroxytyrosol.

According to the technical scheme, the invention mainly selects 4-hydroxyphenylacetic acid-3-hydroxylase from pseudomonas aeruginosa, combines with other riboflavin oxidoreductase from specific sources, and transfers the riboflavin oxidoreductase into saccharomyces cerevisiae chassis cells capable of producing tyrosol, thereby realizing the improvement of hydroxytyrosol yield; on the basis, various modifications are further carried out, so that the yield of hydroxytyrosol of the saccharomyces cerevisiae reaches 1120mg/L, and a new way is provided for producing hydroxytyrosol by high-efficiency fermentation of microorganisms.

Drawings

FIG. 1 shows the yield results of hydroxytyrosol producing Saccharomyces cerevisiae for different HpaB/C combinations;

FIG. 2 shows the use of PaHpaB ^Q212D Yield results of Saccharomyces cerevisiae hydroxytyrosol combined with mutant and EcHpaC;

FIG. 3 shows the use of PaHpaB ^Q212D Results of production of hydroxytyrosol before and after replacing the TRP2 gene original promoter with the YEN1p promoter by saccharomyces cerevisiae in combination of mutant + EcHpaC.

Detailed Description

The embodiment of the invention discloses a saccharomyces cerevisiae for high-yield hydroxytyrosol and a construction method thereof, and a person skilled in the art can properly improve process parameters by referring to the content of the invention. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included within the present invention. The Saccharomyces cerevisiae with high yield of hydroxytyrosol and the construction method thereof have been described by the preferred embodiments, and the related personnel can obviously modify or appropriately change and combine the Saccharomyces cerevisiae with high yield of hydroxytyrosol and the construction method thereof to realize and apply the technology without departing from the content, spirit and scope of the invention.

In the invention, in the specific embodiment, the experiment is compared, except for the due differences of each group, other experimental conditions, raw materials, strains, reagents and the like which are not explicitly mentioned are kept consistent, and the comparability of the comparison experiment is ensured.

The invention provides a Saccharomyces cerevisiae for high-yield hydroxytyrosol and a construction method thereof.

Example 1: construction of Chassis strains producing tyrosol

1) Amplifying ARO2, ARO10, TKL1, RKI1 gene fragment and ARO4, ARO7, ARO3 fragment by PCR using Saccharomyces cerevisiae CEN.PK2-1C genome as a template; using the escherichia coli BL21 genome as a template, and amplifying a TyrA fragment by using PCR;

2) ARO4 production by Point mutation ^K229L ，ARO7 ^G141S ，ARO3 ^D154N A mutant;

3) Expressing the genes by using a Saccharomyces cerevisiae constitutive promoter, and constructing a PRS406 and PRS404 integration plasmid;

4) The PDC1 and PHA2 genes are knocked out in the saccharomyces cerevisiae by using a CRISPR-Cas9 method;

PDC1-spacer：ATTGGATCTGACTCCTCACG；

PDC1 homology arm:

ACAGCAGCAAAATGACGATAGTTCCATAAATATGTATCCCGTGTATGCGTATTTGCCATCCATATCTAAAATTGGCACAATTGAACAACCCTGATAGAAAGGAATCATTTCTGTTGGAAA；

PHA2-spacer：GGGGGATAGAGGCTGCTGGG；

PHA2 homology arm:

AGGTACGTATTCCCATCAAGCTGCATTACAACAATTTCAATCAACATCTGATGTTGAGTAAATGTTTTAACCAATTGGAGAACGACACTAGTATAGATTATTCAGTGGTACCGTTGG；

5) Method for obtaining TyrA by utilizing point mutation ^{M53I A354V} Double mutant genes and constructs into PRS405 integration plasmids.

6) Integrating the integrated plasmid into Saccharomyces cerevisiae CEN.PK2-1C to obtain high-tyrosol-producing chassis Saccharomyces cerevisiae, and fermenting the chassis Saccharomyces cerevisiae with YPD culture medium to obtain 1160mg/L yield; at the same time, this example also tested for the overexpression of TyrA ^{M53I A354V} The tyrosol yield of the double mutant Saccharomyces cerevisiae chassis was 1350mg/L as determined by HPLC. In addition, the present invention also tested for over-expression of ARO3 ^D154N Mutant and TyrA ^{M53I A354V} Tyrosol yield of double mutant Saccharomyces cerevisiae chassis, HPLC detection result is 1040.2mg/L;

example 2: construction of HpaB and HpaC combinations

1) The coding genes of HpaB and HpaC with different sources are synthesized by a reagent company, and an upstream primer and a downstream primer (the sequences of a PDC1p promoter homologous arm and a GPM1t terminator homologous arm are added at two ends of an amplification primer, and the sequences of a TEF1p promoter homologous arm and a PGK1t terminator homologous arm are added) are designed by taking the coding genes as templates for PCR amplification. The PCR amplification conditions were as follows:

pre-denaturation at 95℃for 10min, followed by 25 cycles of 98℃30s,58℃30s,72℃1min 30 s; finally, the extension is carried out for 5min at 72 ℃.

And (3) recovering the PCR product by using a gel to obtain HpaB coding gene fragments with different sources and a homologous arm of a PDC1p promoter and a homologous arm of a GPM1t terminator, and HpaC coding gene fragments with a homologous arm of a TEF1p promoter and a homologous arm of a PGK1t terminator.

2) The HpaB gene with the PDC1p promoter homologous arm and the GPM1t terminator homologous arm is connected with a carrier PRS403-PDC1p-GPM1t with the PDC1p promoter and the GPM1t terminator by homologous recombination to construct an HpaB expression cassette capable of being expressed in a saccharomyces cerevisiae strain; the HpaC gene with the homologous arm of the TEF1p promoter and the homologous arm of the PGK1t terminator is connected to a vector PRS403-TEF1p-PGK1t with the TEF1p promoter and the PGK1t terminator by homologous recombination, and an HpaC expression cassette (recombinant expression vector) capable of expressing in a Saccharomyces cerevisiae strain is constructed.

3) Amplifying different HpaC expression cassettes (with promoters and terminators) by using PCR in vitro, connecting to the expression cassettes of HpaB, and constructing co-expression cassettes of different combinations of HpaB/C;

4) And introducing the co-expression cassettes of different HpaB/C combinations into a saccharomyces cerevisiae strain producing tyrosol, and successfully integrating into a saccharomyces cerevisiae genome through sequencing verification to obtain the saccharomyces cerevisiae producing hydroxytyrosol.

Example 3: construction of expression PaHpaB ^Q212D Mutant Saccharomyces cerevisiae

1) Mutant PaHpaB to PaHpaB Using CRISPR-Cas9 on Saccharomyces cerevisiae Strain constructed in example 2 ^Q212D . The spacer is designed to be 5'-TCAAGGTTCTGCTCAATTGT-3', and the homology arm sequence is as follows:

TTGTTTCTGGTGCTAAGGTTGTTGCTACTAACTCTGCTTTGACTCACTACAACTTCGTTGGTCAAGGTTCTGCTGACCTACTTGGTGACAACACTGACTTCGCTTTGATGTTCATCGCTCCAATGAACACTCCAGGTAT；

2) Transferring Cas9 plasmid with corresponding spacer and homologous arm into Saccharomyces cerevisiae strain expressing PaHpaB-HpaC combination, amplifying PaHpaB sequence by colony PCR and genome PCR, and sequencing to verify that PaHpaB is successfully mutated into PaHpaB ^Q212D 。

Example 4: construction of Saccharomyces cerevisiae Strain weakly expressing TRP2 Gene

On the basis of the strain constructed in example 2 or the strain constructed in example 3, the following steps were carried out:

1) Weak expression TRP2 gene is constructed by CRISPR-Cas9, and TRP2 original promoter is replaced with weak promoter, preferably YEN1p weak promoter. Designing a spacer as 5'-CTATGGTCCGTCGTAGCAGA-3', SEQ ID No.27, which shows a YEN1p weak promoter sequence with a homology arm, wherein 489bp-916bp are the YEN1p weak promoter sequences, and the rest are homology arm sequences, and the sequence can be adjusted according to actual situations;

2) The Cas9 plasmid with the corresponding spacer and the homology arm are transferred into a saccharomyces cerevisiae strain, and after colony PCR and genome PCR amplification, the TRP2 original promoter is correctly replaced through sequencing verification.

Example 5: test for preparing hydroxytyrosol

1. Fermentation process

2) Picking monoclonals in 5ml YPD liquid and culturing for 36 hours;

4) Collecting the supernatant of the fermentation broth to obtain a fermentation broth containing hydroxytyrosol; HPLC was used to detect the yield of hydroxytyrosol.

2. Test results

(1) The different HpaB/C combinations of hydroxytyrosol producing Saccharomyces cerevisiae were constructed as in example 1, wherein each group of tyrosol producing Saccharomyces cerevisiae was identical, and the technical method of example 1 was referenced as follows, while the experimental conditions remained identical:

overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L And ARO7 ^G141S Mutants and knockdown of expression of saccharomyces cerevisiae PHA2 and PDC 1;

then carrying out fermentation experiments on the constructed hydroxytyrosol-producing saccharomyces cerevisiae, and the results are shown in figure 1;

the results in FIG. 1 show that there is a significant yield improvement for both the PaHpaB+ PaHpaC, paHpaB + EcHpaC, paHpaB +SeHpaC and the EcHpaB+PaHpaC combinations compared to the EcHpaB+SeHpaC combinations, where the best results with PaHpaB+EcHpaC indicate that the introduction of different HpaB/C combinations directly affects the hydroxytyrosol yield of Saccharomyces cerevisiae, and that the yield levels are not predictable in advance.

(2) Construction of PaHpaB according to the procedure of example 2 ^Q212D The combination of mutant Saccharomyces cerevisiae and HpaB/C is the optimal PaHpaB+EcHpaC in (1), the tyrosol-producing Saccharomyces cerevisiae is the same as the chassis strain in (1), and the fermentation experiment result is shown in figure 2; FIG. 2 results show the use of PaHpaB ^Q212D The mutant can further improve the hydroxytyrosol yield of the strain.

(3) Constructing a strain of Saccharomyces cerevisiae with weak TRP2 expression gene according to the method of example 3 on the basis of the strain in (2), and fermenting the experimental result shown in figure 3; FIG. 3 shows that the weak expression of the TRP2 gene by YEN1p can again increase the hydroxytyrosol yield of the strain.

(4) The tyrosol-producing Saccharomyces cerevisiae was constructed as follows with reference to the technical method of example 1:

overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutant, over-expression of TyrA from E.coli ^{M53I A354V} Double mutant and knocking out expression of saccharomyces cerevisiae PHA2 and PDC 1;

then, according to the results of (1) and (3), paHpaB+EcHpaC was used in combination, and the weak promoter YEN1p was used to express TRP2 gene, and the strain obtained was fermented with a yield as high as 1120mg/L.

The foregoing is only for the understanding of the method of the present invention and the core idea thereof, and it should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications also fall within the protection scope of the claims of the invention.

Sequence listing

<110> university of Tianjin

<120> Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof

<130> MP21007301

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 520

<212> PRT

<213> Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 1

Met Lys Pro Glu Asp Phe Arg Ala Ser Ala Thr Arg Pro Phe Thr Gly

1 5 10 15

Glu Glu Tyr Leu Ala Ser Leu Arg Asp Asp Arg Glu Ile Tyr Ile Tyr

20 25 30

Gly Asp Arg Val Lys Asp Val Thr Ser His Pro Ala Phe Arg Asn Ala

35 40 45

Ala Ala Ser Met Ala Arg Leu Tyr Asp Ala Leu His Asp Pro Gln Ser

50 55 60

Lys Glu Lys Leu Cys Trp Glu Thr Asp Thr Gly Asn Gly Gly Tyr Thr

65 70 75 80

His Lys Phe Phe Arg Tyr Ala Arg Ser Ala Asp Glu Leu Arg Gln Gln

85 90 95

Arg Asp Ala Ile Ala Glu Trp Ser Arg Leu Thr Tyr Gly Trp Met Gly

100 105 110

Arg Thr Pro Asp Tyr Lys Ala Ala Phe Gly Ser Ala Leu Gly Ala Asn

115 120 125

Pro Gly Phe Tyr Gly Arg Phe Glu Asp Asn Ala Lys Thr Trp Tyr Lys

130 135 140

Arg Ile Gln Glu Ala Cys Leu Tyr Leu Asn His Ala Ile Val Asn Pro

145 150 155 160

Pro Ile Asp Arg Asp Lys Pro Val Asp Gln Val Lys Asp Val Phe Ile

165 170 175

Ser Val Asp Glu Glu Val Asp Gly Gly Ile Val Val Ser Gly Ala Lys

180 185 190

Val Val Ala Thr Asn Ser Ala Leu Thr His Tyr Asn Phe Val Gly Gln

195 200 205

Gly Ser Ala Gln Leu Leu Gly Asp Asn Thr Asp Phe Ala Leu Met Phe

210 215 220

Ile Ala Pro Met Asn Thr Pro Gly Met Lys Leu Ile Cys Arg Pro Ser

225 230 235 240

Tyr Glu Leu Val Ala Gly Ile Ala Gly Ser Pro Phe Asp Tyr Pro Leu

245 250 255

Ser Ser Arg Phe Asp Glu Asn Asp Ala Ile Leu Val Met Asp Lys Val

260 265 270

Phe Ile Pro Trp Glu Asn Val Leu Ile Tyr Arg Asp Phe Glu Arg Cys

275 280 285

Lys Gln Trp Phe Pro Gln Gly Gly Phe Gly Arg Leu Phe Pro Met Gln

290 295 300

Gly Cys Thr Arg Leu Ala Val Lys Leu Asp Phe Ile Thr Gly Ala Leu

305 310 315 320

Tyr Lys Ala Leu Gln Cys Thr Gly Ser Leu Glu Phe Arg Gly Val Gln

325 330 335

Ala Gln Val Gly Glu Val Val Ala Trp Arg Asn Leu Phe Trp Ser Leu

340 345 350

Thr Asp Ala Met Tyr Gly Asn Ala Ser Glu Trp His Gly Gly Ala Phe

355 360 365

Leu Pro Ser Ala Glu Ala Leu Gln Ala Tyr Arg Val Leu Ala Pro Gln

370 375 380

Ala Tyr Pro Glu Ile Lys Lys Thr Ile Glu Gln Val Val Ala Ser Gly

385 390 395 400

Leu Ile Tyr Leu Pro Ser Gly Val Arg Asp Leu His Asn Pro Gln Leu

405 410 415

Asp Lys Tyr Leu Ser Thr Tyr Cys Arg Gly Ser Gly Gly Met Gly His

420 425 430

Arg Glu Arg Ile Lys Ile Leu Lys Leu Leu Trp Asp Ala Ile Gly Ser

435 440 445

Glu Phe Gly Gly Arg His Glu Leu Tyr Glu Ile Asn Tyr Ala Gly Ser

450 455 460

Gln Asp Glu Ile Arg Met Gln Ala Leu Arg Gln Ala Ile Gly Ser Gly

465 470 475 480

Ala Met Lys Gly Met Leu Gly Met Val Glu Gln Cys Met Gly Asp Tyr

485 490 495

Asp Glu Asn Gly Trp Thr Val Pro His Leu His Asn Pro Asp Asp Ile

500 505 510

Asn Val Leu Asp Arg Ile Arg Gln

515 520

<210> 2

<211> 1563

<212> DNA

<213> Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 2

atgaagccag aagacttcag agcttctgct actagaccat tcactggtga agaatacttg 60

gcttctttga gagacgacag agaaatctac atctacggtg acagagttaa ggacgttact 120

tctcacccag ctttcagaaa cgctgctgct tctatggcta gattgtacga cgctttgcac 180

gacccacaat ctaaggaaaa gttgtgttgg gaaactgaca ctggtaacgg tggttacact 240

cacaagttct tcagatacgc tagatctgct gacgaattga gacaacaaag agacgctatc 300

gctgaatggt ctagattgac ttacggttgg atgggtagaa ctccagacta caaggctgct 360

ttcggttctg ctttgggtgc taacccaggt ttctacggta gattcgaaga caacgctaag 420

acttggtaca agagaatcca agaagcttgt ttgtacttga accacgctat cgttaaccca 480

ccaatcgaca gagacaagcc agttgaccaa gttaaggacg ttttcatctc tgttgacgaa 540

gaagttgacg gtggtatcgt tgtttctggt gctaaggttg ttgctactaa ctctgctttg 600

actcactaca acttcgttgg tcaaggttct gctcaattgt tgggtgacaa cactgacttc 660

gctttgatgt tcatcgctcc aatgaacact ccaggtatga agttgatctg tagaccatct 720

tacgaattgg ttgctggtat cgctggttct ccattcgact acccattgtc ttctagattc 780

gacgaaaacg acgctatctt ggttatggac aaggttttca tcccatggga aaacgttttg 840

atctacagag acttcgaaag atgtaagcaa tggttcccac aaggtggttt cggtagattg 900

ttcccaatgc aaggttgtac tagattggct gttaagttgg acttcatcac tggtgctttg 960

tacaaggctt tgcaatgtac tggttctttg gaattcagag gtgttcaagc tcaagttggt 1020

gaagttgttg cttggagaaa cttgttctgg tctttgactg acgctatgta cggtaacgct 1080

tctgaatggc acggtggtgc tttcttgcca tctgctgaag ctttgcaagc ttacagagtt 1140

ttggctccac aagcttaccc agaaatcaag aagactatcg aacaagttgt tgcttctggt 1200

ttgatctact tgccatctgg tgttagagac ttgcacaacc cacaattgga caagtacttg 1260

tctacttact gtagaggttc tggtggtatg ggtcacagag aaagaatcaa gatcttgaag 1320

ttgttgtggg acgctatcgg ttctgaattc ggtggtagac acgaattgta cgaaatcaac 1380

tacgctggtt ctcaagacga aatcagaatg caagctttga gacaagctat cggttctggt 1440

gctatgaagg gtatgttggg tatggttgaa caatgtatgg gtgactacga cgaaaacggt 1500

tggactgttc cacacttgca caacccagac gacatcaacg ttttggacag aatcagacaa 1560

taa 1563

<210> 3

<211> 170

<212> PRT

<213> Salmonella enterica (Salmonella enterica)

<400> 3

Met Gln Val Asp Glu Gln Arg Leu His Phe Arg Asp Ala Met Ala Ser

1 5 10 15

Leu Ala Ala Ala Val Asn Ile Val Thr Thr Ala Gly His Ala Gly Arg

20 25 30

Cys Gly Ile Thr Ala Thr Ala Val Cys Ser Val Thr Asp Thr Pro Pro

35 40 45

Ser Val Met Val Cys Ile Asn Ala Asn Ser Ala Met Asn Pro Val Phe

50 55 60

Gln Gly Asn Gly Arg Leu Cys Ile Asn Val Leu Asn His Glu Gln Glu

65 70 75 80

Leu Met Ala Arg His Phe Ala Gly Met Thr Gly Met Ala Met Glu Glu

85 90 95

Arg Phe His Gln Pro Cys Trp Gln Asn Gly Pro Leu Gly Gln Pro Val

100 105 110

Leu Asn Gly Ala Leu Ala Gly Leu Glu Gly Glu Ile Ser Glu Val Gln

115 120 125

Thr Ile Gly Thr His Leu Val Tyr Leu Val Ala Ile Lys Asn Ile Ile

130 135 140

Leu Ser Gln Asp Gly His Gly Leu Ile Tyr Phe Lys Arg Arg Phe His

145 150 155 160

Pro Val Arg Leu Glu Met Glu Ala Pro Val

165 170

<210> 4

<211> 170

<212> PRT

<213> Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 4

Met Ser Gln Leu Glu Pro Arg Gln Gln Ala Phe Arg Asn Ala Met Ala

1 5 10 15

His Leu Ser Ala Ala Val Asn Val Ile Thr Ser Asn Gly Pro Ala Gly

20 25 30

Arg Cys Gly Ile Thr Ala Thr Ala Val Cys Ser Val Thr Asp Ser Pro

35 40 45

Pro Thr Leu Met Leu Cys Ile Asn Arg Asn Ser Glu Met Asn Thr Val

50 55 60

Phe Lys Ala Asn Gly Arg Leu Cys Val Asn Val Leu Ser Gly Glu His

65 70 75 80

Glu Glu Val Ala Arg His Phe Ala Gly Met Thr Glu Val Pro Met Glu

85 90 95

Arg Arg Phe Ala Leu His Asp Trp Arg Glu Gly Leu Ala Gly Leu Pro

100 105 110

Val Leu His Gly Ala Leu Ala Asn Leu Gln Gly Arg Ile Ala Glu Val

115 120 125

Gln Glu Ile Gly Thr His Ser Val Leu Leu Leu Glu Leu Glu Asp Ile

130 135 140

Gln Val Leu Glu Gln Gly Asp Gly Leu Val Tyr Phe Ser Arg Ser Phe

145 150 155 160

His Arg Leu Gln Cys Pro Arg Arg Ala Ala

165 170

<210> 5

<211> 170

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 5

Met Gln Leu Asp Glu Gln Arg Leu Arg Phe Arg Asp Ala Met Ala Ser

1 5 10 15

Leu Ser Ala Ala Val Asn Ile Ile Thr Thr Glu Gly Asp Ala Gly Gln

20 25 30

Cys Gly Ile Thr Ala Thr Ala Val Cys Ser Val Thr Asp Thr Pro Pro

35 40 45

Ser Leu Met Val Cys Ile Asn Ala Asn Ser Ala Met Asn Pro Val Phe

50 55 60

Gln Gly Asn Gly Lys Leu Cys Val Asn Val Leu Asn His Glu Gln Glu

65 70 75 80

Leu Met Ala Arg His Phe Ala Gly Met Thr Gly Met Ala Met Glu Glu

85 90 95

Arg Phe Ser Leu Ser Cys Trp Gln Lys Gly Pro Leu Ala Gln Pro Val

100 105 110

Leu Lys Gly Ser Leu Ala Ser Leu Glu Gly Glu Ile Arg Asp Val Gln

115 120 125

Ala Ile Gly Thr His Leu Val Tyr Leu Val Glu Ile Lys Asn Ile Ile

130 135 140

Leu Ser Ala Glu Gly His Gly Leu Ile Tyr Phe Lys Arg Arg Phe His

145 150 155 160

Pro Val Met Leu Glu Met Glu Ala Ala Ile

165 170

<210> 6

<211> 513

<212> DNA

<213> Salmonella enterica (Salmonella enterica)

<400> 6

atgcaagttg acgaacaaag attgcacttc agagacgcta tggcttcttt ggctgctgct 60

gttaacatcg ttactactgc tggtcacgct ggtagatgtg gtatcactgc tactgctgtt 120

tgttctgtta ctgacactcc accatctgtt atggtttgta tcaacgctaa ctctgctatg 180

aacccagttt tccaaggtaa cggtagattg tgtatcaacg ttttgaacca cgaacaagaa 240

ttgatggcta gacacttcgc tggtatgact ggtatggcta tggaagaaag attccaccaa 300

ccatgttggc aaaacggtcc attgggtcaa ccagttttga acggtgcttt ggctggtttg 360

gaaggtgaaa tctctgaagt tcaaactatc ggtactcact tggtttactt ggttgctatc 420

aagaacatca tcttgtctca agacggtcac ggtttgatct acttcaagag aagattccac 480

ccagttagat tggaaatgga agctccagtt taa 513

<210> 7

<211> 513

<212> DNA

<213> Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 7

atgtctcaat tggaaccaag acaacaagct ttcagaaacg ctatggctca cttgtctgct 60

gctgttaacg ttatcacttc taacggtcca gctggtagat gtggtatcac tgctactgct 120

gtttgttctg ttactgactc tccaccaact ttgatgttgt gtatcaacag aaactctgaa 180

atgaacactg ttttcaaggc taacggtaga ttgtgtgtta acgttttgtc tggtgaacac 240

gaagaagttg ctagacactt cgctggtatg actgaagttc caatggaaag aagattcgct 300

ttgcacgact ggagagaagg tttggctggt ttgccagttt tgcacggtgc tttggctaac 360

ttgcaaggta gaatcgctga agttcaagaa atcggtactc actctgtttt gttgttggaa 420

ttggaagaca tccaagtttt ggaacaaggt gacggtttgg tttacttctc tagatctttc 480

cacagattgc aatgtccaag aagagctgct taa 513

<210> 8

<211> 513

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 8

atgcaattgg acgaacaaag attgagattc agagacgcta tggcttcttt gtctgctgct 60

gttaacatca tcactactga aggtgacgct ggtcaatgtg gtatcactgc tactgctgtt 120

tgttctgtta ctgacactcc accatctttg atggtttgta tcaacgctaa ctctgctatg 180

aacccagttt tccaaggtaa cggtaagttg tgtgttaacg ttttgaacca cgaacaagaa 240

ttgatggcta gacacttcgc tggtatgact ggtatggcta tggaagaaag attctctttg 300

tcttgttggc aaaagggtcc attggctcaa ccagttttga agggttcttt ggcttctttg 360

gaaggtgaaa tcagagacgt tcaagctatc ggtactcact tggtttactt ggttgaaatc 420

aagaacatca tcttgtctgc tgaaggtcac ggtttgatct acttcaagag aagattccac 480

ccagttatgt tggaaatgga agctgctatc taa 513

<210> 9

<211> 520

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 9

Met Lys Pro Glu Asp Phe Arg Ala Ser Thr Gln Arg Pro Phe Thr Gly

1 5 10 15

Glu Glu Tyr Leu Lys Ser Leu Gln Asp Gly Arg Glu Ile Tyr Ile Tyr

20 25 30

Gly Glu Arg Val Lys Asp Val Thr Thr His Pro Ala Phe Arg Asn Ala

35 40 45

Ala Ala Ser Val Ala Gln Leu Tyr Asp Ala Leu His Lys Pro Glu Met

50 55 60

Gln Asp Ser Leu Cys Trp Asn Thr Asp Thr Gly Ser Gly Gly Tyr Thr

65 70 75 80

His Lys Phe Phe Arg Val Ala Lys Ser Ala Asp Asp Leu Arg Gln Gln

85 90 95

Arg Asp Ala Ile Ala Glu Trp Ser Arg Leu Ser Tyr Gly Trp Met Gly

100 105 110

Arg Thr Pro Asp Tyr Lys Ala Ala Phe Gly Cys Ala Leu Gly Ala Asn

115 120 125

Pro Gly Phe Tyr Gly Gln Phe Glu Gln Asn Ala Arg Asn Trp Tyr Thr

130 135 140

Arg Ile Gln Glu Thr Gly Leu Tyr Phe Asn His Ala Ile Val Asn Pro

145 150 155 160

Pro Ile Asp Arg His Leu Pro Thr Asp Lys Val Lys Asp Val Tyr Ile

165 170 175

Lys Leu Glu Lys Glu Thr Asp Ala Gly Ile Ile Val Ser Gly Ala Lys

180 185 190

Val Val Ala Thr Asn Ser Ala Leu Thr His Tyr Asn Met Ile Gly Phe

195 200 205

Gly Ser Ala Gln Val Met Gly Glu Asn Pro Asp Phe Ala Leu Met Phe

210 215 220

Val Ala Pro Met Asp Ala Asp Gly Val Lys Leu Ile Ser Arg Ala Ser

225 230 235 240

Tyr Glu Met Val Ala Gly Ala Thr Gly Ser Pro Tyr Asp Tyr Pro Leu

245 250 255

Ser Ser Arg Phe Asp Glu Asn Asp Ala Ile Leu Val Met Asp Asn Val

260 265 270

Leu Ile Pro Trp Glu Asn Val Leu Ile Tyr Arg Asp Phe Asp Arg Cys

275 280 285

Arg Arg Trp Thr Met Glu Gly Gly Phe Ala Arg Met Tyr Pro Leu Gln

290 295 300

Ala Cys Val Arg Leu Ala Val Lys Leu Asp Phe Ile Thr Ala Leu Leu

305 310 315 320

Lys Lys Ser Leu Glu Cys Thr Gly Thr Leu Glu Phe Arg Gly Val Gln

325 330 335

Ala Asp Leu Gly Glu Val Val Ala Trp Arg Asn Thr Phe Trp Ala Leu

340 345 350

Ser Asp Ser Met Cys Ser Glu Ala Thr Pro Trp Val Asn Gly Ala Tyr

355 360 365

Leu Pro Asp His Ala Ala Leu Gln Thr Tyr Arg Val Leu Ala Pro Met

370 375 380

Ala Tyr Ala Lys Ile Lys Asn Ile Ile Glu Arg Asn Val Thr Ser Gly

385 390 395 400

Leu Ile Tyr Leu Pro Ser Ser Ala Arg Asp Leu Asn Asn Pro Gln Ile

405 410 415

Asp Gln Tyr Leu Ala Lys Tyr Val Arg Gly Ser Asn Gly Met Asp His

420 425 430

Val Gln Arg Ile Lys Ile Leu Lys Leu Met Trp Asp Ala Ile Gly Ser

435 440 445

Glu Phe Gly Gly Arg His Glu Leu Tyr Glu Ile Asn Tyr Ser Gly Ser

450 455 460

Gln Asp Glu Ile Arg Leu Gln Cys Leu Arg Gln Ala Gln Asn Ser Gly

465 470 475 480

Asn Met Asp Lys Met Met Ala Met Val Asp Arg Cys Leu Ser Glu Tyr

485 490 495

Asp Gln Asp Gly Trp Thr Val Pro His Leu His Asn Asn Asp Asp Ile

500 505 510

Asn Met Leu Asp Lys Leu Leu Lys

515 520

<210> 10

<211> 1563

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 10

atgaagccag aagacttcag agcttctact caaagaccat tcactggtga agaatacttg 60

aagtctttgc aagacggtag agaaatctac atctacggtg aaagagttaa ggacgttact 120

actcacccag ctttcagaaa cgctgctgct tctgttgctc aattgtacga cgctttgcac 180

aagccagaaa tgcaagactc tttgtgttgg aacactgaca ctggttctgg tggttacact 240

cacaagttct tcagagttgc taagtctgct gacgacttga gacaacaaag agacgctatc 300

gctgaatggt ctagattgtc ttacggttgg atgggtagaa ctccagacta caaggctgct 360

ttcggttgtg ctttgggtgc taacccaggt ttctacggtc aattcgaaca aaacgctaga 420

aactggtaca ctagaatcca agaaactggt ttgtacttca accacgctat cgttaaccca 480

ccaatcgaca gacacttgcc aactgacaag gttaaggacg tttacatcaa gttggaaaag 540

gaaactgacg ctggtatcat cgtttctggt gctaaggttg ttgctactaa ctctgctttg 600

actcactaca acatgatcgg ttttggctct gctcaagtca tgggtgaaaa cccagacttc 660

gctttgatgt tcgttgctcc aatggacgct gacggtgtta agttgatctc tagagcttct 720

tacgaaatgg ttgctggtgc tactggttct ccatacgact acccattgtc ttctagattc 780

gacgaaaacg acgctatctt ggttatggac aacgttttga tcccatggga aaacgttttg 840

atctacagag acttcgacag atgtagaaga tggactatgg aaggtggttt cgctagaatg 900

tacccattgc aagcttgtgt tagattggct gttaagttgg acttcatcac tgctttgttg 960

aagaagtctt tggaatgtac tggtactttg gaattcagag gtgttcaagc tgacttgggt 1020

gaagttgttg cttggagaaa cactttctgg gctttgtctg actctatgtg ttctgaagct 1080

actccatggg ttaacggtgc ttacttgcca gaccacgctg ctttgcaaac ttacagagtt 1140

ttggctccaa tggcttacgc taagatcaag aacatcatcg aaagaaacgt tacttctggt 1200

ttgatctact tgccatcttc tgctagagac ttgaacaacc cacaaatcga ccaatacttg 1260

gctaagtacg ttagaggttc taacggtatg gaccacgttc aaagaatcaa gatcttgaag 1320

ttgatgtggg acgctatcgg ttctgaattc ggtggtagac acgaattgta cgaaatcaac 1380

tactctggtt ctcaagacga aatcagattg caatgtttga gacaagctca aaactctggt 1440

aacatggaca agatgatggc tatggttgac agatgtttgt ctgaatacga ccaagacggt 1500

tggactgttc cacacttgca caacaacgac gacatcaaca tgttggacaa gttgttgaag 1560

taa 1563

<210> 11

<211> 376

<212> PRT

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 11

Met Ser Thr Phe Gly Lys Leu Phe Arg Val Thr Thr Tyr Gly Glu Ser

1 5 10 15

His Cys Lys Ser Val Gly Cys Ile Val Asp Gly Val Pro Pro Gly Met

20 25 30

Ser Leu Thr Glu Ala Asp Ile Gln Pro Gln Leu Thr Arg Arg Arg Pro

35 40 45

Gly Gln Ser Lys Leu Ser Thr Pro Arg Asp Glu Lys Asp Arg Val Glu

50 55 60

Ile Gln Ser Gly Thr Glu Phe Gly Lys Thr Leu Gly Thr Pro Ile Ala

65 70 75 80

Met Met Ile Lys Asn Glu Asp Gln Arg Pro His Asp Tyr Ser Asp Met

85 90 95

Asp Lys Phe Pro Arg Pro Ser His Ala Asp Phe Thr Tyr Ser Glu Lys

100 105 110

Tyr Gly Ile Lys Ala Ser Ser Gly Gly Gly Arg Ala Ser Ala Arg Glu

115 120 125

Thr Ile Gly Arg Val Ala Ser Gly Ala Ile Ala Glu Lys Phe Leu Ala

130 135 140

Gln Asn Ser Asn Val Glu Ile Val Ala Phe Val Thr Gln Ile Gly Glu

145 150 155 160

Ile Lys Met Asn Arg Asp Ser Phe Asp Pro Glu Phe Gln His Leu Leu

165 170 175

Asn Thr Ile Thr Arg Glu Lys Val Asp Ser Met Gly Pro Ile Arg Cys

180 185 190

Pro Asp Ala Ser Val Ala Gly Leu Met Val Lys Glu Ile Glu Lys Tyr

195 200 205

Arg Gly Asn Lys Asp Ser Ile Gly Gly Val Val Thr Cys Val Val Arg

210 215 220

Asn Leu Pro Thr Gly Leu Gly Glu Pro Cys Phe Asp Lys Leu Glu Ala

225 230 235 240

Met Leu Ala His Ala Met Leu Ser Ile Pro Ala Ser Lys Gly Phe Glu

245 250 255

Ile Gly Ser Gly Phe Gln Gly Val Ser Val Pro Gly Ser Lys His Asn

260 265 270

Asp Pro Phe Tyr Phe Glu Lys Glu Thr Asn Arg Leu Arg Thr Lys Thr

275 280 285

Asn Asn Ser Gly Gly Val Gln Gly Gly Ile Ser Asn Gly Glu Asn Ile

290 295 300

Tyr Phe Ser Val Pro Phe Lys Ser Val Ala Thr Ile Ser Gln Glu Gln

305 310 315 320

Lys Thr Ala Thr Tyr Asp Gly Glu Glu Gly Ile Leu Ala Ala Lys Gly

325 330 335

Arg His Asp Pro Ala Val Thr Pro Arg Ala Ile Pro Ile Val Glu Ala

340 345 350

Met Thr Ala Leu Val Leu Ala Asp Ala Leu Leu Ile Gln Lys Ala Arg

355 360 365

Asp Phe Ser Arg Ser Val Val His

370 375

<210> 12

<211> 1131

<212> DNA

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 12

atgtcaacgt ttgggaaact gttccgcgtc accacatatg gtgaatcgca ttgtaagtct 60

gtcggttgca ttgtcgacgg tgttcctcca ggaatgtcat taaccgaagc tgacattcag 120

ccacaattga ccagaagaag accgggtcaa tctaagctat cgacccctag agacgaaaag 180

gatagagtgg aaatccagtc cggtaccgag ttcggcaaga ctctaggtac acccatcgcc 240

atgatgatca aaaacgagga ccaaagacct cacgactact ccgacatgga caagttccct 300

agaccttccc atgcggactt cacgtactcg gaaaagtacg gtatcaaggc ctcctctggt 360

ggtggcagag cttctgctag agaaacgatt ggccgtgtcg cttcaggtgc cattgctgag 420

aagttcttag ctcagaactc taatgtcgag atcgtagcct ttgtgacaca aatcggggaa 480

atcaagatga acagagactc tttcgatcct gaatttcagc atctgttgaa caccatcacc 540

agggaaaaag tggactcaat gggtcctatc agatgtccag acgcctccgt tgctggtttg 600

atggtcaagg aaatcgaaaa gtacagaggc aacaaggact ctatcggtgg tgtcgtcact 660

tgtgtcgtga gaaacttgcc taccggtctc ggtgagccat gctttgacaa gttggaagcc 720

atgttggctc atgctatgtt gtccattcca gcatccaagg gtttcgaaat tggctcaggt 780

tttcagggtg tctctgttcc agggtccaag cacaatgacc cattttactt tgaaaaagaa 840

acaaacagat taagaacaaa gaccaacaat tcaggtggtg tacaaggtgg tatctctaat 900

ggtgagaaca tctatttctc tgtcccattc aagtcagtgg ccactatctc tcaagaacaa 960

aaaaccgcca cttacgatgg tgaagaaggt atcttagccg ctaagggtag acatgaccct 1020

gctgtcactc caagagctat tcctattgtg gaagccatga ccgctctggt gttggctgac 1080

gcgcttttga tccaaaaggc aagagatttc tccagatccg tggttcatta a 1131

<210> 13

<211> 635

<212> PRT

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 13

Met Ala Pro Val Thr Ile Glu Lys Phe Val Asn Gln Glu Glu Arg His

1 5 10 15

Leu Val Ser Asn Arg Ser Ala Thr Ile Pro Phe Gly Glu Tyr Ile Phe

20 25 30

Lys Arg Leu Leu Ser Ile Asp Thr Lys Ser Val Phe Gly Val Pro Gly

35 40 45

Asp Phe Asn Leu Ser Leu Leu Glu Tyr Leu Tyr Ser Pro Ser Val Glu

50 55 60

Ser Ala Gly Leu Arg Trp Val Gly Thr Cys Asn Glu Leu Asn Ala Ala

65 70 75 80

Tyr Ala Ala Asp Gly Tyr Ser Arg Tyr Ser Asn Lys Ile Gly Cys Leu

85 90 95

Ile Thr Thr Tyr Gly Val Gly Glu Leu Ser Ala Leu Asn Gly Ile Ala

100 105 110

Gly Ser Phe Ala Glu Asn Val Lys Val Leu His Ile Val Gly Val Ala

115 120 125

Lys Ser Ile Asp Ser Arg Ser Ser Asn Phe Ser Asp Arg Asn Leu His

130 135 140

His Leu Val Pro Gln Leu His Asp Ser Asn Phe Lys Gly Pro Asn His

145 150 155 160

Lys Val Tyr His Asp Met Val Lys Asp Arg Val Ala Cys Ser Val Ala

165 170 175

Tyr Leu Glu Asp Ile Glu Thr Ala Cys Asp Gln Val Asp Asn Val Ile

180 185 190

Arg Asp Ile Tyr Lys Tyr Ser Lys Pro Gly Tyr Ile Phe Val Pro Ala

195 200 205

Asp Phe Ala Asp Met Ser Val Thr Cys Asp Asn Leu Val Asn Val Pro

210 215 220

Arg Ile Ser Gln Gln Asp Cys Ile Val Tyr Pro Ser Glu Asn Gln Leu

225 230 235 240

Ser Asp Ile Ile Asn Lys Ile Thr Ser Trp Ile Tyr Ser Ser Lys Thr

245 250 255

Pro Ala Ile Leu Gly Asp Val Leu Thr Asp Arg Tyr Gly Val Ser Asn

260 265 270

Phe Leu Asn Lys Leu Ile Cys Lys Thr Gly Ile Trp Asn Phe Ser Thr

275 280 285

Val Met Gly Lys Ser Val Ile Asp Glu Ser Asn Pro Thr Tyr Met Gly

290 295 300

Gln Tyr Asn Gly Lys Glu Gly Leu Lys Gln Val Tyr Glu His Phe Glu

305 310 315 320

Leu Cys Asp Leu Val Leu His Phe Gly Val Asp Ile Asn Glu Ile Asn

325 330 335

Asn Gly His Tyr Thr Phe Thr Tyr Lys Pro Asn Ala Lys Ile Ile Gln

340 345 350

Phe His Pro Asn Tyr Ile Arg Leu Val Asp Thr Arg Gln Gly Asn Glu

355 360 365

Gln Met Phe Lys Gly Ile Asn Phe Ala Pro Ile Leu Lys Glu Leu Tyr

370 375 380

Lys Arg Ile Asp Val Ser Lys Leu Ser Leu Gln Tyr Asp Ser Asn Val

385 390 395 400

Thr Gln Tyr Thr Asn Glu Thr Met Arg Leu Glu Asp Pro Thr Asn Gly

405 410 415

Gln Ser Ser Ile Ile Thr Gln Val His Leu Gln Lys Thr Met Pro Lys

420 425 430

Phe Leu Asn Pro Gly Asp Val Val Val Cys Glu Thr Gly Ser Phe Gln

435 440 445

Phe Ser Val Arg Asp Phe Ala Phe Pro Ser Gln Leu Lys Tyr Ile Ser

450 455 460

Gln Gly Phe Phe Leu Ser Ile Gly Met Ala Leu Pro Ala Ala Leu Gly

465 470 475 480

Val Gly Ile Ala Met Gln Asp His Ser Asn Ala His Ile Asn Gly Gly

485 490 495

Asn Val Lys Glu Asp Tyr Lys Pro Arg Leu Ile Leu Phe Glu Gly Asp

500 505 510

Gly Ala Ala Gln Met Thr Ile Gln Glu Leu Ser Thr Ile Leu Lys Cys

515 520 525

Asn Ile Pro Leu Glu Val Ile Ile Trp Asn Asn Asn Gly Tyr Thr Ile

530 535 540

Glu Arg Ala Ile Met Gly Pro Thr Arg Ser Tyr Asn Asp Val Met Ser

545 550 555 560

Trp Lys Trp Thr Lys Leu Phe Glu Ala Phe Gly Asp Phe Asp Gly Lys

565 570 575

Tyr Thr Asn Ser Thr Leu Ile Gln Cys Pro Ser Lys Leu Ala Leu Lys

580 585 590

Leu Glu Glu Leu Lys Asn Ser Asn Lys Arg Ser Gly Ile Glu Leu Leu

595 600 605

Glu Val Lys Leu Gly Glu Leu Asp Phe Pro Glu Gln Leu Lys Cys Met

610 615 620

Val Glu Ala Ala Ala Leu Lys Arg Asn Lys Lys

625 630 635

<210> 14

<211> 1908

<212> DNA

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 14

atggcacctg ttacaattga aaagttcgta aatcaagaag aacgacacct tgtttccaac 60

cgatcagcaa caattccgtt tggtgaatac atatttaaaa gattgttgtc catcgatacg 120

aaatcagttt tcggtgttcc tggtgacttc aacttatctc tattagaata tctctattca 180

cctagtgttg aatcagctgg cctaagatgg gtcggcacgt gtaatgaact gaacgccgct 240

tatgcggccg acggatattc ccgttactct aataagattg gctgtttaat aaccacgtat 300

ggcgttggtg aattaagcgc cttgaacggt atagccggtt cgttcgctga aaatgtcaaa 360

gttttgcaca ttgttggtgt ggccaagtcc atagattcgc gttcaagtaa ctttagtgat 420

cggaacctac atcatttggt cccacagcta catgattcaa attttaaagg gccaaatcat 480

aaagtatatc atgatatggt aaaagataga gtcgcttgct cggtagccta cttggaggat 540

attgaaactg catgtgacca agtcgataat gttatccgcg atatttacaa gtattctaaa 600

cctggttata tttttgttcc tgcagatttt gcggatatgt ctgttacatg tgataatttg 660

gttaatgttc cacgtatatc tcaacaagat tgtatagtat acccttctga aaaccaattg 720

tctgacataa tcaacaagat tactagttgg atatattcca gtaaaacacc tgcgatcctt 780

ggagacgtac tgactgatag gtatggtgtg agtaactttt tgaacaagct tatctgcaaa 840

actgggattt ggaatttttc cactgttatg ggaaaatctg taattgatga gtcaaaccca 900

acttatatgg gtcaatataa tggtaaagaa ggtttaaaac aagtctatga acattttgaa 960

ctgtgcgact tggtcttgca ttttggagtc gacatcaatg aaattaataa tgggcattat 1020

acttttactt ataaaccaaa tgctaaaatc attcaatttc atccgaatta tattcgcctt 1080

gtggacacta ggcagggcaa tgagcaaatg ttcaaaggaa tcaattttgc ccctatttta 1140

aaagaactat acaagcgcat tgacgtttct aaactttctt tgcaatatga ttcaaatgta 1200

actcaatata cgaacgaaac aatgcggtta gaagatccta ccaatggaca atcaagcatt 1260

attacacaag ttcacttaca aaagacgatg cctaaatttt tgaaccctgg tgatgttgtc 1320

gtttgtgaaa caggctcttt tcaattctct gttcgtgatt tcgcgtttcc ttcgcaatta 1380

aaatatatat cgcaaggatt tttcctttcc attggcatgg cccttcctgc cgccctaggt 1440

gttggaattg ccatgcaaga ccactcaaac gctcacatca atggtggcaa cgtaaaagag 1500

gactataagc caagattaat tttgtttgaa ggtgacggtg cagcacagat gacaatccaa 1560

gaactgagca ccattctgaa gtgcaatatt ccactagaag ttatcatttg gaacaataac 1620

ggctacacta ttgaaagagc catcatgggc cctaccaggt cgtataacga cgttatgtct 1680

tggaaatgga ccaaactatt tgaagcattc ggagacttcg acggaaagta tactaatagc 1740

actctcattc aatgtccctc taaattagca ctgaaattgg aggagcttaa gaattcaaac 1800

aaaagaagcg ggatagaact tttagaagtc aaattaggcg aattggattt ccccgaacag 1860

ctaaagtgca tggttgaagc agcggcactt aaaagaaata aaaaatag 1908

<210> 15

<211> 680

<212> PRT

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 15

Met Thr Gln Phe Thr Asp Ile Asp Lys Leu Ala Val Ser Thr Ile Arg

1 5 10 15

Ile Leu Ala Val Asp Thr Val Ser Lys Ala Asn Ser Gly His Pro Gly

20 25 30

Ala Pro Leu Gly Met Ala Pro Ala Ala His Val Leu Trp Ser Gln Met

35 40 45

Arg Met Asn Pro Thr Asn Pro Asp Trp Ile Asn Arg Asp Arg Phe Val

50 55 60

Leu Ser Asn Gly His Ala Val Ala Leu Leu Tyr Ser Met Leu His Leu

65 70 75 80

Thr Gly Tyr Asp Leu Ser Ile Glu Asp Leu Lys Gln Phe Arg Gln Leu

85 90 95

Gly Ser Arg Thr Pro Gly His Pro Glu Phe Glu Leu Pro Gly Val Glu

100 105 110

Val Thr Thr Gly Pro Leu Gly Gln Gly Ile Ser Asn Ala Val Gly Met

115 120 125

Ala Met Ala Gln Ala Asn Leu Ala Ala Thr Tyr Asn Lys Pro Gly Phe

130 135 140

Thr Leu Ser Asp Asn Tyr Thr Tyr Val Phe Leu Gly Asp Gly Cys Leu

145 150 155 160

Gln Glu Gly Ile Ser Ser Glu Ala Ser Ser Leu Ala Gly His Leu Lys

165 170 175

Leu Gly Asn Leu Ile Ala Ile Tyr Asp Asp Asn Lys Ile Thr Ile Asp

180 185 190

Gly Ala Thr Ser Ile Ser Phe Asp Glu Asp Val Ala Lys Arg Tyr Glu

195 200 205

Ala Tyr Gly Trp Glu Val Leu Tyr Val Glu Asn Gly Asn Glu Asp Leu

210 215 220

Ala Gly Ile Ala Lys Ala Ile Ala Gln Ala Lys Leu Ser Lys Asp Lys

225 230 235 240

Pro Thr Leu Ile Lys Met Thr Thr Thr Ile Gly Tyr Gly Ser Leu His

245 250 255

Ala Gly Ser His Ser Val His Gly Ala Pro Leu Lys Ala Asp Asp Val

260 265 270

Lys Gln Leu Lys Ser Lys Phe Gly Phe Asn Pro Asp Lys Ser Phe Val

275 280 285

Val Pro Gln Glu Val Tyr Asp His Tyr Gln Lys Thr Ile Leu Lys Pro

290 295 300

Gly Val Glu Ala Asn Asn Lys Trp Asn Lys Leu Phe Ser Glu Tyr Gln

305 310 315 320

Lys Lys Phe Pro Glu Leu Gly Ala Glu Leu Ala Arg Arg Leu Ser Gly

325 330 335

Gln Leu Pro Ala Asn Trp Glu Ser Lys Leu Pro Thr Tyr Thr Ala Lys

340 345 350

Asp Ser Ala Val Ala Thr Arg Lys Leu Ser Glu Thr Val Leu Glu Asp

355 360 365

Val Tyr Asn Gln Leu Pro Glu Leu Ile Gly Gly Ser Ala Asp Leu Thr

370 375 380

Pro Ser Asn Leu Thr Arg Trp Lys Glu Ala Leu Asp Phe Gln Pro Pro

385 390 395 400

Ser Ser Gly Ser Gly Asn Tyr Ser Gly Arg Tyr Ile Arg Tyr Gly Ile

405 410 415

Arg Glu His Ala Met Gly Ala Ile Met Asn Gly Ile Ser Ala Phe Gly

420 425 430

Ala Asn Tyr Lys Pro Tyr Gly Gly Thr Phe Leu Asn Phe Val Ser Tyr

435 440 445

Ala Ala Gly Ala Val Arg Leu Ser Ala Leu Ser Gly His Pro Val Ile

450 455 460

Trp Val Ala Thr His Asp Ser Ile Gly Val Gly Glu Asp Gly Pro Thr

465 470 475 480

His Gln Pro Ile Glu Thr Leu Ala His Phe Arg Ser Leu Pro Asn Ile

485 490 495

Gln Val Trp Arg Pro Ala Asp Gly Asn Glu Val Ser Ala Ala Tyr Lys

500 505 510

Asn Ser Leu Glu Ser Lys His Thr Pro Ser Ile Ile Ala Leu Ser Arg

515 520 525

Gln Asn Leu Pro Gln Leu Glu Gly Ser Ser Ile Glu Ser Ala Ser Lys

530 535 540

Gly Gly Tyr Val Leu Gln Asp Val Ala Asn Pro Asp Ile Ile Leu Val

545 550 555 560

Ala Thr Gly Ser Glu Val Ser Leu Ser Val Glu Ala Ala Lys Thr Leu

565 570 575

Ala Ala Lys Asn Ile Lys Ala Arg Val Val Ser Leu Pro Asp Phe Phe

580 585 590

Thr Phe Asp Lys Gln Pro Leu Glu Tyr Arg Leu Ser Val Leu Pro Asp

595 600 605

Asn Val Pro Ile Met Ser Val Glu Val Leu Ala Thr Thr Cys Trp Gly

610 615 620

Lys Tyr Ala His Gln Ser Phe Gly Ile Asp Arg Phe Gly Ala Ser Gly

625 630 635 640

Lys Ala Pro Glu Val Phe Lys Phe Phe Gly Phe Thr Pro Glu Gly Val

645 650 655

Ala Glu Arg Ala Gln Lys Thr Ile Ala Phe Tyr Lys Gly Asp Lys Leu

660 665 670

Ile Ser Pro Leu Lys Lys Ala Phe

675 680

<210> 16

<211> 2043

<212> DNA

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 16

atgactcaat tcactgacat tgataagcta gccgtctcca ccataagaat tttggctgtg 60

gacaccgtat ccaaggccaa ctcaggtcac ccaggtgctc cattgggtat ggcaccagct 120

gcacacgttc tatggagtca aatgcgcatg aacccaacca acccagactg gatcaacaga 180

gatagatttg tcttgtctaa cggtcacgcg gtcgctttgt tgtattctat gctacatttg 240

actggttacg atctgtctat tgaagacttg aaacagttca gacagttggg ttccagaaca 300

ccaggtcatc ctgaatttga gttgccaggt gttgaagtta ctaccggtcc attaggtcaa 360

ggtatctcca acgctgttgg tatggccatg gctcaagcta acctggctgc cacttacaac 420

aagccgggct ttaccttgtc tgacaactac acctatgttt tcttgggtga cggttgtttg 480

caagaaggta tttcttcaga agcttcctcc ttggctggtc atttgaaatt gggtaacttg 540

attgccatct acgatgacaa caagatcact atcgatggtg ctaccagtat ctcattcgat 600

gaagatgttg ctaagagata cgaagcctac ggttgggaag ttttgtacgt agaaaatggt 660

aacgaagatc tagccggtat tgccaaggct attgctcaag ctaagttatc caaggacaaa 720

ccaactttga tcaaaatgac cacaaccatt ggttacggtt ccttgcatgc cggctctcac 780

tctgtgcacg gtgccccatt gaaagcagat gatgttaaac aactaaagag caaattcggt 840

ttcaacccag acaagtcctt tgttgttcca caagaagttt acgaccacta ccaaaagaca 900

attttaaagc caggtgtcga agccaacaac aagtggaaca agttgttcag cgaataccaa 960

aagaaattcc cagaattagg tgctgaattg gctagaagat tgagcggcca actacccgca 1020

aattgggaat ctaagttgcc aacttacacc gccaaggact ctgccgtggc cactagaaaa 1080

ttatcagaaa ctgttcttga ggatgtttac aatcaattgc cagagttgat tggtggttct 1140

gccgatttaa caccttctaa cttgaccaga tggaaggaag cccttgactt ccaacctcct 1200

tcttccggtt caggtaacta ctctggtaga tacattaggt acggtattag agaacacgct 1260

atgggtgcca taatgaacgg tatttcagct ttcggtgcca actacaaacc atacggtggt 1320

actttcttga acttcgtttc ttatgctgct ggtgccgtta gattgtccgc tttgtctggc 1380

cacccagtta tttgggttgc tacacatgac tctatcggtg tcggtgaaga tggtccaaca 1440

catcaaccta ttgaaacttt agcacacttc agatccctac caaacattca agtttggaga 1500

ccagctgatg gtaacgaagt ttctgccgcc tacaagaact ctttagaatc caagcatact 1560

ccaagtatca ttgctttgtc cagacaaaac ttgccacaat tggaaggtag ctctattgaa 1620

agcgcttcta agggtggtta cgtactacaa gatgttgcta acccagatat tattttagtg 1680

gctactggtt ccgaagtgtc tttgagtgtt gaagctgcta agactttggc cgcaaagaac 1740

atcaaggctc gtgttgtttc tctaccagat ttcttcactt ttgacaaaca acccctagaa 1800

tacagactat cagtcttacc agacaacgtt ccaatcatgt ctgttgaagt tttggctacc 1860

acatgttggg gcaaatacgc tcatcaatcc ttcggtattg acagatttgg tgcctccggt 1920

aaggcaccag aagtcttcaa gttcttcggt ttcaccccag aaggtgttgc tgaaagagct 1980

caaaagacca ttgcattcta taagggtgac aagctaattt ctcctttgaa aaaagctttc 2040

taa 2043

<210> 17

<211> 258

<212> PRT

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 17

Met Ala Ala Gly Val Pro Lys Ile Asp Ala Leu Glu Ser Leu Gly Asn

1 5 10 15

Pro Leu Glu Asp Ala Lys Arg Ala Ala Ala Tyr Arg Ala Val Asp Glu

20 25 30

Asn Leu Lys Phe Asp Asp His Lys Ile Ile Gly Ile Gly Ser Gly Ser

35 40 45

Thr Val Val Tyr Val Ala Glu Arg Ile Gly Gln Tyr Leu His Asp Pro

50 55 60

Lys Phe Tyr Glu Val Ala Ser Lys Phe Ile Cys Ile Pro Thr Gly Phe

65 70 75 80

Gln Ser Arg Asn Leu Ile Leu Asp Asn Lys Leu Gln Leu Gly Ser Ile

85 90 95

Glu Gln Tyr Pro Arg Ile Asp Ile Ala Phe Asp Gly Ala Asp Glu Val

100 105 110

Asp Glu Asn Leu Gln Leu Ile Lys Gly Gly Gly Ala Cys Leu Phe Gln

115 120 125

Glu Lys Leu Val Ser Thr Ser Ala Lys Thr Phe Ile Val Val Ala Asp

130 135 140

Ser Arg Lys Lys Ser Pro Lys His Leu Gly Lys Asn Trp Arg Gln Gly

145 150 155 160

Val Pro Ile Glu Ile Val Pro Ser Ser Tyr Val Arg Val Lys Asn Asp

165 170 175

Leu Leu Glu Gln Leu His Ala Glu Lys Val Asp Ile Arg Gln Gly Gly

180 185 190

Ser Ala Lys Ala Gly Pro Val Val Thr Asp Asn Asn Asn Phe Ile Ile

195 200 205

Asp Ala Asp Phe Gly Glu Ile Ser Asp Pro Arg Lys Leu His Arg Glu

210 215 220

Ile Lys Leu Leu Val Gly Val Val Glu Thr Gly Leu Phe Ile Asp Asn

225 230 235 240

Ala Ser Lys Ala Tyr Phe Gly Asn Ser Asp Gly Ser Val Glu Val Thr

245 250 255

Glu Lys

<210> 18

<211> 777

<212> DNA

<213> Saccharomyces cerevisiae (CEN. PK2-1C)

<400> 18

atggctgccg gtgtcccaaa aattgatgcg ttagaatctt tgggcaatcc tttggaggat 60

gccaagagag ctgcagcata cagagcagtt gatgaaaatt taaaatttga tgatcacaaa 120

attattggaa ttggtagtgg tagcacagtg gtttatgttg ccgaaagaat tggacaatat 180

ttgcatgacc ctaaatttta tgaagtagcg tctaaattca tttgcattcc aacaggattc 240

caatcaagaa acttgatttt ggataacaag ttgcaattag gctccattga acagtatcct 300

cgcattgata tagcgtttga cggtgctgat gaagtggatg agaatttaca attaattaaa 360

ggtggtggtg cttgtctatt tcaagaaaaa ttggttagta ctagtgctaa aaccttcatt 420

gtcgttgctg attcaagaaa aaagtcacca aaacatttag gtaagaactg gaggcaaggt 480

gttcccattg aaattgtacc ttcctcatac gtgagggtca agaatgatct attagaacaa 540

ttgcatgctg aaaaagttga catcagacaa ggaggttctg ctaaagcagg tcctgttgta 600

actgacaata ataacttcat tatcgatgcg gatttcggtg aaatttccga tccaagaaaa 660

ttgcatagag aaatcaaact gttagtgggc gtggtggaaa caggtttatt catcgacaac 720

gcttcaaaag cctacttcgg taattctgac ggtagtgttg aagttaccga aaagtga 777

<210> 19

<211> 370

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 19

Met Ser Glu Ser Pro Met Phe Ala Ala Asn Gly Met Pro Lys Val Asn

1 5 10 15

Gln Gly Ala Glu Glu Asp Val Arg Ile Leu Gly Tyr Asp Pro Leu Ala

20 25 30

Ser Pro Ala Leu Leu Gln Val Gln Ile Pro Ala Thr Pro Thr Ser Leu

35 40 45

Glu Thr Ala Lys Arg Gly Arg Arg Glu Ala Ile Asp Ile Ile Thr Gly

50 55 60

Lys Asp Asp Arg Val Leu Val Ile Val Gly Pro Cys Ser Ile His Asp

65 70 75 80

Leu Glu Ala Ala Gln Glu Tyr Ala Leu Arg Leu Lys Lys Leu Ser Asp

85 90 95

Glu Leu Lys Gly Asp Leu Ser Ile Ile Met Arg Ala Tyr Leu Glu Lys

100 105 110

Pro Arg Thr Thr Val Gly Trp Lys Gly Leu Ile Asn Asp Pro Asp Val

115 120 125

Asn Asn Thr Phe Asn Ile Asn Lys Gly Leu Gln Ser Ala Arg Gln Leu

130 135 140

Phe Val Asn Leu Thr Asn Ile Gly Leu Pro Ile Gly Ser Glu Met Leu

145 150 155 160

Asp Thr Ile Ser Pro Gln Tyr Leu Ala Asp Leu Val Ser Phe Gly Ala

165 170 175

Ile Gly Ala Arg Thr Thr Glu Ser Gln Leu His Arg Glu Leu Ala Ser

180 185 190

Gly Leu Ser Phe Pro Val Gly Phe Lys Asn Gly Thr Asp Gly Thr Leu

195 200 205

Asn Val Ala Val Asp Ala Cys Gln Ala Ala Ala His Ser His His Phe

210 215 220

Met Gly Val Thr Leu His Gly Val Ala Ala Ile Thr Thr Thr Lys Gly

225 230 235 240

Asn Glu His Cys Phe Val Ile Leu Arg Gly Gly Lys Lys Gly Thr Asn

245 250 255

Tyr Asp Ala Lys Ser Val Ala Glu Ala Lys Ala Gln Leu Pro Ala Gly

260 265 270

Ser Asn Gly Leu Met Ile Asp Tyr Ser His Gly Asn Ser Asn Lys Asp

275 280 285

Phe Arg Asn Gln Pro Lys Val Asn Asp Val Val Cys Glu Gln Ile Ala

290 295 300

Asn Gly Glu Asn Ala Ile Thr Gly Val Met Ile Glu Ser Asn Ile Asn

305 310 315 320

Glu Gly Asn Gln Gly Ile Pro Ala Glu Gly Lys Ala Gly Leu Lys Tyr

325 330 335

Gly Val Ser Ile Thr Asp Ala Cys Ile Gly Trp Glu Thr Thr Glu Asp

340 345 350

Val Leu Arg Lys Leu Ala Ala Ala Val Arg Gln Arg Arg Glu Val Asn

355 360 365

Lys Lys

370

<210> 20

<211> 1113

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

atgagtgaat ctccaatgtt cgctgccaac ggcatgccaa aggtaaatca aggtgctgaa 60

gaagatgtca gaattttagg ttacgaccca ttagcttctc cagctctcct tcaagtgcaa 120

atcccagcca caccaacttc tttggaaact gccaagagag gtagaagaga agctatagat 180

attattaccg gtaaagacga cagagttctt gtcattgtcg gtccttgttc catccatgat 240

ctagaagccg ctcaagaata cgctttgaga ttaaagaaat tgtcagatga attaaaaggt 300

gatttatcca tcattatgag agcatacttg gagaagccaa gaacaaccgt cggctggaaa 360

ggtctaatta atgaccctga tgttaacaac actttcaaca tcaacaaggg tttgcaatcc 420

gctagacaat tgtttgtcaa cttgacaaat atcggtttgc caattggttc tgaaatgctt 480

gataccattt ctcctcaata cttggctgat ttggtctcct tcggtgccat tggtgccaga 540

accaccgaat ctcaactgca cagagaattg gcctccggtt tgtctttccc agttggtttc 600

aagaacggta ccgatggtac cttaaatgtt gctgtggatg cttgtcaagc cgctgctcat 660

tctcaccatt tcatgggtgt tactttgcat ggtgttgctg ctatcaccac tactaagggt 720

aacgaacact gcttcgttat tctaagaggt ggtaaaaagg gtaccaacta cgacgctaag 780

tccgttgcag aagctaaggc tcaattgcct gccggttcca acggtctaat gattgactac 840

tctcacggta actccaataa ggatttcaga aaccaaccaa aggtcaatga cgttgtttgt 900

gagcaaatcg ctaacggtga aaacgccatt accggtgtca tgattgaatc aaacatcaac 960

gaaggtaacc aaggcatccc agccgaaggt aaagccggct tgaaatatgg tgtttccatc 1020

actgatgctt gtataggttg ggaaactact gaagacgtct tgaggaaatt ggctgctgct 1080

gtcagacaaa gaagagaagt taacaagaaa tag 1113

<210> 21

<211> 256

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 21

Met Asp Phe Thr Lys Pro Glu Thr Val Leu Asn Leu Gln Asn Ile Arg

1 5 10 15

Asp Glu Leu Val Arg Met Glu Asp Ser Ile Ile Phe Lys Phe Ile Glu

20 25 30

Arg Ser His Phe Ala Thr Cys Pro Ser Val Tyr Glu Ala Asn His Pro

35 40 45

Gly Leu Glu Ile Pro Asn Phe Lys Gly Ser Phe Leu Asp Trp Ala Leu

50 55 60

Ser Asn Leu Glu Ile Ala His Ser Arg Ile Arg Arg Phe Glu Ser Pro

65 70 75 80

Asp Glu Thr Pro Phe Phe Pro Asp Lys Ile Gln Lys Ser Phe Leu Pro

85 90 95

Ser Ile Asn Tyr Pro Gln Ile Leu Ala Pro Tyr Ala Pro Glu Val Asn

100 105 110

Tyr Asn Asp Lys Ile Lys Lys Val Tyr Ile Glu Lys Ile Ile Pro Leu

115 120 125

Ile Ser Lys Arg Asp Gly Asp Asp Lys Asn Asn Phe Ser Ser Val Ala

130 135 140

Thr Arg Asp Ile Glu Cys Leu Gln Ser Leu Ser Arg Arg Ile His Phe

145 150 155 160

Gly Lys Phe Val Ala Glu Ala Lys Phe Gln Ser Asp Ile Pro Leu Tyr

165 170 175

Thr Lys Leu Ile Lys Ser Lys Asp Val Glu Gly Ile Met Lys Asn Ile

180 185 190

Thr Asn Ser Ala Val Glu Glu Lys Ile Leu Glu Arg Leu Thr Lys Lys

195 200 205

Ala Glu Val Tyr Gly Val Asp Pro Thr Asn Glu Ser Gly Glu Arg Arg

210 215 220

Ile Thr Pro Glu Tyr Leu Val Lys Ile Tyr Lys Glu Ile Val Ile Pro

225 230 235 240

Ile Thr Lys Glu Val Glu Val Glu Tyr Leu Leu Arg Arg Leu Glu Glu

245 250 255

<210> 22

<211> 771

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

atggatttca caaaaccaga aactgtttta aatctacaaa atattagaga tgaattagtt 60

agaatggagg attcgatcat cttcaaattt attgagaggt cgcatttcgc cacatgtcct 120

tcagtttatg aggcaaacca tccaggttta gaaattccga attttaaagg atctttcttg 180

gattgggctc tttcaaatct tgaaattgcg cattctcgca tcagaagatt cgaatcacct 240

gatgaaactc ccttctttcc tgacaagatt cagaaatcat tcttaccgag cattaactac 300

ccacaaattt tggcgcctta tgccccagaa gttaattaca atgataaaat aaaaaaagtt 360

tatattgaaa agattatacc attaatttcg aaaagagatg gtgatgataa gaataacttc 420

agttctgttg ccactagaga tatagaatgt ttgcaaagct tgagtaggag aatccacttt 480

ggcaagtttg ttgctgaagc caagttccaa tcggatatcc cgctatacac aaagctgatc 540

aaaagtaaag atgtcgaggg gataatgaag aatatcacca attctgccgt tgaagaaaag 600

attctagaaa gattaactaa gaaggctgaa gtctatggtg tggaccctac caacgagtca 660

ggtgaaagaa ggattactcc agaatatttg gtaaaaattt ataaggaaat tgttatacct 720

atcactaagg aagttgaggt ggaatacttg ctaagaaggt tggaagagta a 771

<210> 23

<211> 370

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 23

Met Phe Ile Lys Asn Asp His Ala Gly Asp Arg Lys Arg Leu Glu Asp

1 5 10 15

Trp Arg Ile Lys Gly Tyr Asp Pro Leu Thr Pro Pro Asp Leu Leu Gln

20 25 30

His Glu Phe Pro Ile Ser Ala Lys Gly Glu Glu Asn Ile Ile Lys Ala

35 40 45

Arg Asp Ser Val Cys Asp Ile Leu Asn Gly Lys Asp Asp Arg Leu Val

50 55 60

Ile Val Ile Gly Pro Cys Ser Leu His Asp Pro Lys Ala Ala Tyr Asp

65 70 75 80

Tyr Ala Asp Arg Leu Ala Lys Ile Ser Glu Lys Leu Ser Lys Asp Leu

85 90 95

Leu Ile Ile Met Arg Ala Tyr Leu Glu Lys Pro Arg Thr Thr Val Gly

100 105 110

Trp Lys Gly Leu Ile Asn Asp Pro Asp Met Asn Asn Ser Phe Gln Ile

115 120 125

Asn Lys Gly Leu Arg Ile Ser Arg Glu Met Phe Ile Arg Leu Val Glu

130 135 140

Lys Leu Pro Ile Ala Gly Glu Met Leu Asn Thr Ile Ser Pro Gln Phe

145 150 155 160

Leu Ser Asp Cys Phe Ser Leu Gly Ala Ile Gly Ala Arg Thr Thr Glu

165 170 175

Ser Gln Leu His Arg Glu Leu Ala Ser Gly Leu Ser Phe Pro Ile Gly

180 185 190

Phe Lys Asn Gly Thr Asp Gly Gly Leu Gln Val Ala Ile Asp Ala Met

195 200 205

Arg Ala Ala Ala His Asp His Tyr Phe Leu Ser Val Thr Lys Pro Gly

210 215 220

Val Thr Ala Ile Val Gly Thr Glu Gly Asn Lys Asp Thr Phe Leu Ile

225 230 235 240

Leu Arg Gly Gly Lys Asn Gly Thr Asn Phe Asp Lys Glu Ser Val Gln

245 250 255

Asn Thr Lys Lys Gln Leu Glu Lys Ala Gly Leu Thr Asp Asp Ser Gln

260 265 270

Lys Arg Ile Met Ile Asp Cys Ser His Gly Asn Ser Asn Lys Asp Phe

275 280 285

Lys Asn Gln Pro Lys Val Ala Lys Cys Ile Tyr Asp Gln Leu Thr Glu

290 295 300

Gly Glu Asn Ser Leu Cys Gly Val Met Ile Glu Ser Asn Ile Asn Glu

305 310 315 320

Gly Arg Gln Asp Ile Pro Lys Glu Gly Gly Arg Glu Gly Leu Lys Tyr

325 330 335

Gly Cys Ser Val Thr Asp Ala Cys Ile Gly Trp Glu Thr Thr Glu Gln

340 345 350

Val Leu Glu Leu Leu Ala Glu Gly Val Arg Asn Arg Arg Lys Ala Leu

355 360 365

Lys Lys

370

<210> 24

<211> 1113

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

atgttcatta aaaacgatca cgccggtgac aggaaacgct tggaagactg gagaatcaaa 60

ggttatgatc cattaacccc tccagatctg cttcaacatg aatttccaat ttcagccaaa 120

ggtgaggaaa acattatcaa ggcaagagac tccgtctgtg atattttgaa tggtaaagat 180

gatcgtttag ttatcgtgat cgggccatgt tccctacatg accccaaagc cgcttacgat 240

tacgctgaca gattggctaa aatttcagaa aagttgtcaa aagacttatt gattattatg 300

agagcgtatt tagaaaaacc aaggactacc gttggctgga aagggttgat taacgaccct 360

gatatgaata actcttttca aatcaataaa ggtctacgga tttcgagaga aatgttcata 420

agactggttg aaaaattacc cattgctggt gaaatgctga acaccatttc tccgcagttt 480

ttgagtgatt gtttctcctt gggtgccatc ggtgctagaa ctactgaatc ccaactgcac 540

agagaattag catccggtct atctttccct attggattta agaacggtac tgatggtggt 600

ttgcaagtcg ccatcgacgc tatgagagcc gctgcacatg atcattactt cctttctgtc 660

acaaagccag gtgtcactgc tatcgtgggc actgaaggta acaaggatac cttcctgatc 720

ttgagaggtg gtaagaacgg tactaacttt gacaaagaaa gtgttcaaaa tactaagaaa 780

caattagaaa aggccggttt gactgacgat tcacagaaaa gaatcatgat cgattgttca 840

cacgggaaca gtaataaaga tttcaagaac caaccgaagg ttgccaaatg catttatgac 900

caactgacgg aaggtgaaaa tagtctttgt ggtgttatga ttgagtccaa cataaatgaa 960

ggtagacaag atattcctaa agaaggtggc agagagggat tgaagtatgg ttgttctgta 1020

acggatgctt gtattggttg ggagaccacc gaacaggtat tggagctatt ggccgaaggt 1080

gttagaaaca gaagaaaagc cttgaagaaa taa 1113

<210> 25

<211> 373

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 25

Met Val Ala Glu Leu Thr Ala Leu Arg Asp Gln Ile Asp Glu Val Asp

1 5 10 15

Lys Ala Leu Leu Asn Leu Leu Ala Lys Arg Leu Glu Leu Val Ala Glu

20 25 30

Val Gly Glu Val Lys Ser Arg Phe Gly Leu Pro Ile Tyr Val Pro Glu

35 40 45

Arg Glu Ala Ser Ile Leu Ala Ser Arg Arg Ala Gln Ala Glu Ala Leu

50 55 60

Gly Val Pro Pro Asp Leu Ile Glu Asp Val Leu Arg Arg Val Met Arg

65 70 75 80

Glu Ser Tyr Ser Ser Glu Asn Asp Lys Gly Phe Lys Thr Leu Cys Pro

85 90 95

Ser Leu Arg Pro Val Val Ile Val Gly Gly Gly Gly Gln Met Gly Arg

100 105 110

Leu Phe Glu Lys Met Leu Thr Leu Ser Gly Tyr Gln Val Arg Ile Leu

115 120 125

Glu Gln His Asp Trp Asp Arg Ala Ala Asp Ile Val Ala Asp Ala Gly

130 135 140

Met Val Ile Val Ser Val Pro Ile His Val Thr Glu Gln Val Ile Gly

145 150 155 160

Lys Leu Pro Pro Leu Pro Lys Asp Cys Ile Leu Val Asp Leu Ala Ser

165 170 175

Val Lys Asn Gly Pro Leu Gln Ala Met Leu Ala Ala His Asp Gly Pro

180 185 190

Val Leu Gly Leu His Pro Met Phe Gly Pro Asp Ser Gly Ser Leu Ala

195 200 205

Lys Gln Val Val Val Trp Cys Asp Gly Arg Lys Pro Glu Ala Tyr Gln

210 215 220

Trp Phe Leu Glu Gln Ile Gln Val Trp Gly Ala Arg Leu His Arg Ile

225 230 235 240

Ser Ala Val Glu His Asp Gln Asn Met Ala Phe Ile Gln Ala Leu Arg

245 250 255

His Phe Ala Thr Phe Ala Tyr Gly Leu His Leu Ala Glu Glu Asn Val

260 265 270

Gln Leu Glu Gln Leu Leu Ala Leu Ser Ser Pro Ile Tyr Arg Leu Glu

275 280 285

Leu Ala Met Val Gly Arg Leu Phe Ala Gln Asp Pro Gln Leu Tyr Ala

290 295 300

Asp Ile Ile Met Ser Ser Glu Arg Asn Leu Ala Leu Ile Lys Arg Tyr

305 310 315 320

Tyr Lys Arg Phe Gly Glu Ala Ile Glu Leu Leu Glu Gln Gly Asp Lys

325 330 335

Gln Ala Phe Ile Asp Ser Phe Arg Lys Val Glu His Trp Phe Gly Asp

340 345 350

Tyr Val Gln Arg Phe Gln Ser Glu Ser Arg Val Leu Leu Arg Gln Ala

355 360 365

Asn Asp Asn Arg Gln

370

<210> 26

<211> 1122

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

atggttgctg aattgaccgc attacgcgat caaattgatg aagtcgataa agcgctgctg 60

aatttattag cgaagcgtct ggaactggtt gctgaagtgg gcgaggtgaa aagccgcttt 120

ggactgccta tttatgttcc ggagcgcgag gcatctatct tggcctcgag acgtgcacaa 180

gcggaagctc tgggtgtacc gccagatctg attgaggatg ttttgcgtcg ggtgatgcgt 240

gaatcttact ccagtgaaaa cgacaaagga tttaaaacac tttgtccgtc actgcgtccg 300

gtggttatcg tcggcggtgg cggtcagatg ggacgcctgt tcgagaagat gctgacacta 360

tcgggttatc aggtgcggat tctggagcaa catgactggg atcgagcggc tgatattgtt 420

gccgatgccg gaatggtgat tgttagtgtg ccaatccacg ttactgagca agttatcggc 480

aaattaccgc ctttaccgaa agattgtatt ctggttgatc tggcatcagt gaaaaatgga 540

ccattacagg ccatgctggc ggcgcacgat ggcccggtac tggggttaca cccgatgttc 600

ggcccggaca gcggtagcct ggcaaagcaa gttgtggtct ggtgtgatgg acgtaagccg 660

gaagcatacc aatggtttct ggagcaaatt caggtctggg gcgctcggct gcatcgtatt 720

agcgctgtcg agcacgatca gaatatggcg tttattcagg ctctgcgcca ctttgctact 780

tttgcttatg ggctgcatct ggcagaagaa aatgttcagc ttgagcaact tctggcgctc 840

tcttcgccga tttaccgcct tgagctggcg atggtcgggc gactgtttgc tcaggatccg 900

cagctttatg ccgacattat tatgtcgtca gagcgtaatc tggcgttaat caaacgttac 960

tataagcgtt tcggcgaggc gattgagttg ctggagcagg gcgataagca ggcgtttatt 1020

gacagtttcc gcaaggtgga gcactggttc ggcgattacg ttcagcgttt tcagagtgaa 1080

agccgcgtgt tattgcgtca ggcgaatgac aaccgccagt aa 1122

<210> 27

<211> 1378

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

accggagtgg ctctctttat caattaccgg gtttgataga atttgtccca tttttctttt 60

tctggttctc tatatgttat acaacaatgg aatagtcaaa atcctaggga tgttattaat 120

cggaaaacta ctatctcgaa cgaatagtta taattaatca atgaaaaaaa aaagagaaag 180

taaaaaatgt tacaacaact aatatacact aattgtcctt gataacagaa cttgttgtag 240

ttttattccg tggggaggag ggtgaatttt ttttatttag ttttaaagaa caaaacagaa 300

gtctatatac ttagcactat aatatccagt ttcaatttgc tctgtcagaa tccgaattgg 360

ctggttttct ttgttttacc acccccttcc atttatcagc atgatatttt ttttttagaa 420

taatcctttc aatcgttgaa gtagtttgtg ggaaaagaaa agttgttaaa ggcattaacg 480

tacacagtac tgaacggttg cattgataga ttttcattac ctctgaccac aatcctgagc 540

attggtatta tttgttttgc tattttcaga tcaaattact tgtaaaaaaa gaaatggtag 600

tatattggca ttgaacactg gctgttctat ttgtattact tttatatgta gacatatatt 660

attaggaatt tgtaatatca ctctaattat tatttgatat tctttctcta tctcccctgt 720

ttcttttgtc tatctctttc ttttttttta aacggccctt ttttaatggc attttctttt 780

tcttataatg cccacagttg aatgatttaa ctagcttttc actgacacat aaacaataat 840

gtatatgatc catcgaatga aatgacagtt ctattgcatt ttacctactt gtatattctg 900

gatactgcac aagaaaatga ccgcttccat caaaattcaa ccggatattg actctctaaa 960

gcaattacag cagcaaaatg acgatagttc cataaatatg tatcccgtgt atgcgtattt 1020

gccatcattg gatctgactc ctcacgtggc atatctaaaa ttggcacaat tgaacaaccc 1080

tgatagaaag gaatcatttc tgttggaaag tgctaagaca aataatgaat tagatcgtta 1140

ttcattcata ggtatctcgc cacgcaagac catcaaaacc ggtcctactg aaggcattga 1200

aacagatcct ttggaaattt tggaaaagga gatgtccacc tttaaagtag ccgaaaatgt 1260

tcctggttta ccgaagttaa gtggtggtgc tattggttat atttcttatg actgtgttcg 1320

ttatttcgag ccaaaaacaa gaaggccttt gaaagatgtc ctaagacttc cagaggca 1378

Claims

1. A saccharomyces cerevisiae with high hydroxytyrosol yield, which is characterized in that the following arbitrary combination of HpaB and HpaC are further expressed on the basis of the saccharomyces cerevisiae CEN.PK2-1C capable of synthesizing tyrosol:

(2) HpaB from Escherichia coli and HpaC from Pseudomonas aeruginosa;

the saccharomyces cerevisiae capable of synthesizing tyrosol is obtained by modifying the following modes:

(1) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L And ARO7 ^G141S Mutants, and knockdown of expression of Saccharomyces cerevisiae PHA2 and PDC 1.

2. The high-hydroxytyrosol producing saccharomyces cerevisiae according to claim 1 wherein the HpaB derived from pseudomonas aeruginosa is a mutant of the Q212D mutation; hpaC is derived from E.coli.

3. The saccharomyces cerevisiae with high production of hydroxytyrosol according to claim 1, wherein the saccharomyces cerevisiae capable of synthesizing tyrosol is obtained by modification in any one of the following ways:

(2) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutant and knockout brewingExpression of yeast PHA2 and PDC 1;

(3) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutant, over-expression of TyrA from E.coli ^{M53I A354V} Double mutant and expression of knocked-out Saccharomyces cerevisiae PHA2 and PDC 1.

4. A saccharomyces cerevisiae for high production of hydroxytyrosol according to any of claims 1-3 further comprising: endogenous to said Saccharomyces cerevisiae capable of synthesizing tyrosolTRP2The promoter of the gene is a weak promoter, which is a promoter having a weaker promoter ability than the original promoter.

5. The method for constructing the saccharomyces cerevisiae with high yield of hydroxytyrosol according to claim 1, which is characterized in that recombinant vectors expressing HpaB and HpaC which are arbitrarily combined are transferred into the saccharomyces cerevisiae CEN.PK2-1C capable of synthesizing tyrosol to obtain the saccharomyces cerevisiae with high yield of hydroxytyrosol;

or integrating the coding genes of HpaB and HpaC in any combination into a Saccharomyces cerevisiae CEN.PK2-1C genome capable of synthesizing tyrosol for expression to obtain the Saccharomyces cerevisiae with high hydroxytyrosol yield;

(1) HpaB derived from Pseudomonas aeruginosa, hpaC derived from Salmonella enterica, pseudomonas aeruginosa or Escherichia coli;

or (b)

(2) HpaB from Escherichia coli and HpaC from Pseudomonas aeruginosa;

6. The construction method according to claim 5, wherein the Saccharomyces cerevisiae capable of synthesizing tyrosol is obtained by modification in any one of the following ways:

(2) Overexpression of Saccharomyces cerevisiae ARO2, ARO10, TKL1 and RKI1, overexpression of Saccharomyces cerevisiae ARO4 ^K229L 、ARO7 ^G141S And ARO3 ^D154N Mutants and knockdown of expression of saccharomyces cerevisiae PHA2 and PDC 1;

7. The construction method according to claim 5 or 6, further comprising: endogenous Saccharomyces cerevisiae capable of synthesizing tyrosolTRP2The promoter of the gene is replaced with a promoter having a weaker promoter capacity than the original promoter.

8. Use of the high-yield hydroxytyrosol saccharomyces cerevisiae according to any of the claims 1-4 for the preparation of hydroxytyrosol.

9. A method for preparing hydroxytyrosol, which is characterized in that the high-yield hydroxytyrosol saccharomyces cerevisiae as claimed in any one of claims 1 to 4 is adopted for fermentation culture, and the supernatant of fermentation liquor is collected to separate out the hydroxytyrosol.