CN114591923B - Cannabidiol synthetase mutant and construction method and application thereof - Google Patents
Cannabidiol synthetase mutant and construction method and application thereof Download PDFInfo
- Publication number
- CN114591923B CN114591923B CN202210502557.XA CN202210502557A CN114591923B CN 114591923 B CN114591923 B CN 114591923B CN 202210502557 A CN202210502557 A CN 202210502557A CN 114591923 B CN114591923 B CN 114591923B
- Authority
- CN
- China
- Prior art keywords
- cbdas
- mutant
- cbda
- cannabidiol
- ile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
Abstract
The invention discloses a cannabidiol synthetase mutant and a construction method and application thereof, belonging to the technical field of genetic engineering modification in the field of synthetic biology. Compared with the wild CBDAS, when the CBDAS point mutant provided by the invention is used for producing CBDA, the CBDA yield is improved in different ranges, wherein the CBDA yield corresponding to the C446A mutant is improved by 91.3% and reaches 123 mg/L.
Description
Technical Field
The invention relates to a cannabidiol synthetase mutant and a construction method and application thereof, belonging to the technical field of genetic engineering modification in the field of synthetic biology.
Background
The chemical name of CBDA is 2,4-dihydroxy-3- [ (1R,6R) -3-methyl-6-prop-1-en-2-ylcyclohex-2-en-1-yl]-6-pentylbenzoic acid with molecular formula C 22 H 30 O 4 CAS number 1244-58-2.
Cannabidiol (CBD) is a secondary metabolite of the cannabis plant and is obtained by decarboxylation of CBDA. The research finds that CBD has the effects of resisting tumor, protecting nerve, regulating metabolism and immunity, resisting inflammation and oxidation, protecting heart vessels and liver and the like, and FAD approves a CBD prescription drug Epidiolex from industrial cannabis plant in 2008 and is used for treating two very serious and rare infant epilepsy Dravet syndrome and Lennox-Gastut syndrome. In conventional industrial production, CBD is obtained mainly by extracting CBDA, a precursor of the cannabis plant, and then decarboxylating the extracted CBD by heating. The method has the disadvantages of long period, low efficiency, high cost, environmental friendliness, and possibility of containing hallucinogenic component Tetrahydrocannabinol (THC). Therefore, it is necessary to realize efficient synthesis of CBDA from cheap raw materials in a short period by using synthetic biological techniques.
CBDA is obtained in hemp (Cannabissativa) plant by cyclizing the substrate cannabigerolic acid (CBGA) with CBDAS (Cannabiolic acid synthase, cannabidiol synthase) as cofactor and consuming a portion of O 2 Generating a fraction H 2 O 2 . CBGA is a precursor for the synthesis of various cannabinoids, and can be synthesized by various enzymes, including CBDAS and tetrahydrocannabinol synthase (THCAS), as substrates, to synthesize CBDA and Tetrahydrocannabinolic acid (THCA), respectively. It has been reported that these two enzymes were originally identified in cannabis and that the enzymatic activities of both enzymes in cannabis are similar. Later researchers attempted to express them in different species, includingPichia pastorisInsect cellsSpodopterafrugiperdaTobacco Tobacco andKomagataellaphaffiiunlike THCAS, onlyP. pastorisAndK.phaffiiCBDAS activity can be detected. Xiaozhou Luo et al, Saccharomyces cerevisiae (B)Saccharomycescerevisiae) De novo synthesis of various cannabinoids in cells has shown that CBDA yields are more than 500-fold different from THCA. To sum up, toIn cannabis plants, the enzymatic activities of CBDAS and THCAS are similar, but CBDAS is difficult to express in other species than THCAS, and the yield is low, which brings difficulty to industrial biosynthesis of CBDA, so that CBDAS enzyme with higher yield needs to be modified, thereby improving the production economic benefit.
Disclosure of Invention
[ problem ] to
The technical problem to be solved by the invention is that the wild CBDAS has low activity when being directly expressed in saccharomyces cerevisiae, and correspondingly, the yield of CBDA is low, which brings difficulty to the industrial biosynthesis of CBDA.
[ solution ]
The invention utilizes site-directed mutagenesis to modify CBDAS to obtain a plurality of CBDAS mutants with improved activity. The CBDAS mutants with improved activity are obtained by expressing saccharomyces cerevisiae, and can synthesize CBDA in yeast cells, and the yield of CBDA is improved.
The invention discloses a cannabidiol synthetase mutant (CBDAS mutant) which is (a) or (b):
(a) the amino acid sequence is SED ID NO:1 by substituting one or more of asparagine at position 56, histidine at position 213, methionine at position 256, serine at position 116, glutamine at position 343, aspartic acid at position 362, asparagine at position 365, glutamine at position 398, cysteine at position 446 and lysine at position 474;
(b) a protein derived from (a) by substituting, deleting or adding one or more amino acids in the amino acid sequence of (a) and having cannabidiol synthase activity.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by replacing the asparagine at position 56 with a histidine, based on positions 29 to 544 of the sequence shown in figure 1.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by substituting the histidine at position 213 with an aspartic acid based on positions 29 to 544 of the sequence shown in figure 1.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by substituting methionine at position 256 with isoleucine or, substituting methionine at position 256 with isoleucine and serine at position 116 with alanine.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by replacing glutamine at position 343 with glutamic acid or by replacing glutamine at position 343 with glutamic acid and serine at position 116 with alanine.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by substituting asparagine at position 365 with lysine, or by substituting asparagine at position 365 with lysine and substituting aspartic acid at position 362 with alanine, or by substituting asparagine at position 365 with lysine and substituting serine at position 116 with alanine, or by substituting aspartic acid at position 362 with alanine, asparagine at position 365 with lysine, and substituting serine at position 116 with alanine.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by substituting glutamine at position 398 with lysine or glutamine at position 398 with lysine and serine at position 116 with alanine.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by substituting cysteine at position 446 with alanine on the basis of positions 29 to 544 of the sequence shown in figure 1.
In certain embodiments of the invention, the amino acid sequence of the mutant is SED as SED ID NO:1 by replacing the 474 th lysine with glutamine on the basis of positions 29 to 544 of the sequence shown in 1.
The invention also discloses CBDAS mutants with a signal peptide having an amino acid sequence as defined in SED ID NO:1, 1-28, or as shown in SEQ ID NO 2.
Also disclosed are nucleic acid constructs carrying genes encoding CBDAS mutants, e.g., expression vectors carrying genes encoding CBDAS mutants. The recombinant expression vector can be constructed by connecting the CBDAS point mutant to various empty commercial vectors by a conventional method in the field. The empty commercially available vector may be a conventional plasmid vector, as long as it can normally express the CBDAS point mutant, which can be normally replicated in the corresponding expression host, and can be selected by, for example, antibiotics or auxotrophy. It will be clear to one skilled in the art how to select appropriate vectors, promoters, enhancers, terminators and host cells. For Saccharomyces cerevisiae, the plasmid vector is preferably a pCEV vector. Illustratively, the CBDAS mutant coding gene and the pCEV vector skeleton can be amplified through PCR amplification, the amplified CBDAS mutant coding gene segment has homology arms with 20 bp at two ends of a vector insertion site, and a recombinant vector for expressing the CBDAS mutant is constructed through Gibson assembly (NEB). The expression vector for coding the CBDAS point mutant can be constructed by a point mutation kit sold in the market. Illustratively, the recombinant vector for expressing CBDAS can be constructed by designing primers with point mutation sequences, performing PCR amplification on the vector for expressing the CBDAS point mutant, recovering fragments, and performing KLD reaction (NEB).
Recombinant cells expressing the CBDAS mutants, e.g., Saccharomyces cerevisiae transformants expressing CBDAS mutants, are also disclosed. The transformant contains the CBDAS mutant coding gene. The transformant can assemble the coding gene sequence of the CBDAS mutant into a reading frame which can be normally expressed by a host cell by using a commonly used yeast promoter and terminator. It will be clear to one skilled in the art how to select an appropriate promoter and terminator so long as CBDAS is normally expressed. Illustratively, the galactose-inducible Gal1 promoter and the ADH1 terminator may be selected. The promoter and the terminator can be obtained by PCR amplification from a saccharomyces cerevisiae genome. The transformant can be transformed into a yeast body by jointly transforming the upstream and downstream 1000 bp fragments of the insertion site and the CBDAS mutant coding gene fragment, and is integrated onto a yeast genome through homologous recombination in the yeast body. The yeast transformants can be obtained by transformation methods conventional in the art. Illustratively, competent cells can be prepared by: yeast cells were grown overnight in YPD medium to log phase, diluted to 2 XYPD with an initial OD of 0.2, and after further culture for 4.5 h, washed three times with ddH 2O. And adding 36 mu L of 1M lithium acetate, 260 mu L of 50% PEG3350 and 10 mu L of denatured salmon sperm DNA, the upstream and downstream fragments and the CBDAS point mutation fragment into the competent cells, uniformly mixing, and thermally shocking at 42 ℃ for 40 min for transformation. The transformed cells can be screened out positive clones by a screening plate, and the positive clones are transformants.
The invention also discloses a fermentation culture method for inducing the transformant to express the CBDAS point mutant. The fermentation strain is the transformant. The induction adopts a conventional saccharomyces cerevisiae induction culture method. Illustratively, transformants were cultured to a logarithmic phase and transferred to fermentation medium YPG, where galactose was the inducer, to induce expression of CBDAS mutants. CBDA was synthesized by adding 1 mM OA as substrate to the fermentation medium. And (5) after fermentation culture for 96h, ending fermentation.
The invention also discloses a method for synthesizing cannabidiolic acid by applying the recombinant cell, which takes the olivine acid as a substrate and obtains the cannabidiolic acid by converting the cannabidiol synthetase mutant. The method may be a fermentation method, and after fermentation is completed, CBDA is extracted from the fermentation broth. The fermentation broth is the fermentation broth for inducing the transformant to express the CBDAS point mutant. Preferably, the invention uses ethyl acetate extraction method to extract CBDA from fermentation liquor. That is, the fermentation broth was ground using a grinder to break the cell walls. And adding ethyl acetate into the ground fermentation liquor for extraction, and repeating the extraction for three times to extract most of CBDA. After the extract was concentrated to dryness, the organic phase was redissolved by adding AHF resuspension. The heavy suspension was tested for CBDA concentration by HPLC.
[ advantageous effects ]
Compared with the wild CBDAS, when the CBDAS point mutant provided by the invention is used for producing CBDA, the CBDA yield is improved in different ranges, wherein the CBDA yield corresponding to the C446A mutant is improved by 91.3% and reaches 123 mg/L, which also shows that the modification method of the invention improves the activity of CBDAS. By using the mutant of the invention for fermentation, the CBDA yield can be improved, and the industrial biosynthesis of CBDA and other cannabinoids can be promoted.
Drawings
FIG. 1 is a CBDA yield comparison between mutant recombinant strains with higher yield screened in the examples and wild-type recombinant strains; wherein, WT is a wild type recombinant strain, and the rest is a recombinant strain expressing CBDAS point mutant.
FIG. 2 is an HPLC (high performance liquid chromatography) spectrum of CBDA synthesized by transforming a mutant recombinant strain C446A and a wild recombinant strain; wherein a is an HPLC (high performance liquid chromatography) spectrum of a fermentation liquid of the mutant recombinant bacterium C446A; b is a HPLC chromatogram of a wild recombinant strain WT fermentation liquid; and c is the HPLC map of the CBDA-CBGA mixed standard product.
Detailed Description
Term(s) for
Mutant: meaning a polypeptide having CBDAS activity that comprises an alteration (i.e. a substitution, insertion and/or deletion) at one or more (e.g. several) positions. Substitution means the substitution of an amino acid occupying a position with a different amino acid; deletion means the removal of an amino acid occupying a position; and an insertion means that an amino acid is added next to and immediately following the amino acid occupying a certain position.
Encoding gene means a polynucleotide that directly specifies the amino acid sequence of CBDAS. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence may be genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Expressing: the term "expression" includes any step involved in the production of CBDAS or CBDAS mutants, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Host cell: meaning any cell type that is amenable to transformation, transfection, transduction, and the like, with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
The methods of transformation or detection of the recombinant plasmid used in the examples described below may be combined or modified according to common knowledge in the art.
The method used in the following examples to measure CBDA production was: taking 200 mu L of the bacterial liquid after fermentation for 96h, adding 200 mu L of glass beads and 0.4 mL of ethyl acetate: formic acid (0.05%), treated in a high speed tissue grinder at 60 Hz for 30s, spaced 30s, and repeated 12 times. After the transient centrifugation, the upper organic layer was taken from 0.28 mL to 1.5 mL centrifuge tube, repeated twice, and the collected upper organic layers were combined. And (4) placing the organic layers extracted for three times in a vacuum concentrator for concentrating until no solvent remains. Placing the dried 1.5 mL centrifuge tube on ice, cooling to low temperature, adding acetonitrile/double distilled water/formic acid mixed solution (volume ratio: 80%/20%/0.05%) into each tube, re-suspending, shaking for 30s, centrifuging at 13000 rpm at 4 ℃ for 5 min, taking 60 mu L of supernatant from each tube, and filtering by using a 0.22 mu m organic membrane to a tube inserted in a liquid phase detection bottle to be used as a detection sample. Detection samples CBDA concentrations were detected using an agilent 1290 Infinity II UHPL DAD detector. The mobile phase is A phase: 95% water-5% acetonitrile +0.1% formic acid, phase B: 95% acetonitrile-5% water +0.1% formic acid, and Agilent EC-C182.7 μm chromatographic column of 4.6 × 100 mm. And detecting the concentration of the CBDA in the sample by taking the CBDA standard sample as a control.
The recombinant plasmid pCEV-CBDAS used in the following examples is a yeast expression plasmid pCEV-G4-Km as a starting plasmid, and a gene sequence encoding CBDAS shown in SEQ ID NO. 1 is inserted.
Host bacteria used in the following examplesSaccharomycescerevisiaeCan31 has the ability to convert the substrate Olivoic Acid (OA) to CBGA and the genome does not contain CBDAS expression sequences.SaccharomycescerevisiaeThe construction process of yCAN31 is described in: luo X, Reiter MA, d' Espatx L, Wong J, Denby CM, Lechner A, Zhang Y, Grzybowski AT, Harth S, Lin W, Lee H, Yu C, Shin J, Deng K, Bennites VT, Wang G, Baiduo EEK, Chen Y, Dev I, Petzold CJ, Keasling JD. composite biosyntheses of cannabinoids and the hair Unnatural analogues in yeast. Nature. 2019 Mar;567(7746):123-126. doi: 10.1038/s41586-019-0978-9. Epub 2019 Feb 27. Erratum in: Nature. 2020 Apr;580(7802):E2. PMID: 30814733。
Used in the following examplesE.coli DH5 alpha was purchased from Kiyokoku, Beijing. Both Gel Extraction Kit D2500 and Plasmid Mini Kit I D6943 were purchased from Omega. PEG3350, lithium acetate, amino acids, etc. are available from sigma. Salmon sperm DNA was purchased from Beijing Solebao science and technology, Inc. PCR amplification kit Q5 High-Fidelity DNA Polymerase, KLD enzyme mixture was purchased from New England Biolabs (NEB).
The primers used in the following examples were purchased from the manufacturer.
The primers used in the following examples are shown in Table 1, in which the underlined bases are point-mutated bases.
TABLE 1 primer Table
| Primer name | Primer sequence (5 '-3') | |
| F-416d up | TATCGTCCAACTGCATGGAGATGA | SEQ ID NO:3 |
| R-416d up-pGal1 | ggtttttttaggctaagataatGGGTCCGGTTAAACGGATCTCG | SEQ ID NO:4 |
| F-416d down-tADH1 | caaatgcctgcaaatcgctccccatttcCCGAACATGCTCCTTCACTATTTTAACA | SEQ ID NO:5 |
| R-416d down | ATTTTTCAATTGAGGAAACTTGAAAGGTGT | SEQ ID NO:6 |
| F-pGal1-416d up | CAATGCGAGATCCGTTTAACCGGACCCattatcttagcctaaaaaaaccttctctttgga | SEQ ID NO:7 |
| R-tADH1-416d down | AATAGTGAAGGAGCATGTTCGGgaaatggggagcgatttgcagg | SEQ ID NO:8 |
| F-pGal1-seq | ccactttaactaatactttc | SEQ ID NO:9 |
| R-tADH1-seq | CAACCTGACCTACAGGAA | SEQ ID NO:10 |
| F-416d-seq | TGGCTTTTTGATTGATTGTACAGGA | SEQ ID NO:11 |
| R-416d-seq | TCGCAATAATCTATATGCTCACCAA | SEQ ID NO:12 |
| F-CBDAS_N56H | ATACACTCAGcACAACCCTCTATATATG | SEQ ID NO:13 |
| R-CBDAS_N56H | ACTAACTTAAGGTTCGTCG | SEQ ID NO:14 |
| F-CBDAS_S116A | GGGACACGACgctGAGGGGATGAGTTATATTAG | SEQ ID NO:15 |
| R-CBDAS_S116A | CCGCTACGGGTACGTATT | SEQ ID NO:16 |
| F-CBDAS_H213D | AGTTAATGTTgATGGAAAAGTGTTAG | SEQ ID NO:17 |
| R-CBDAS_H213D | AAGTGAGCATCTATGATATTG | SEQ ID NO:18 |
| F-CBDAS_M256I | AAAGAGTACCattTTCTCAGTAAAGAAAATAATGG | SEQ ID NO:19 |
| R-CBDAS_M256I | GGAACAGCCACAAGCCTG | SEQ ID NO:20 |
| F-CBDAS_Q343E | AGATTGTAGAgAACTTTCCTGG | SEQ ID NO:21 |
| R-CBDAS_Q343E | GTCTTCTTGATACCTAGTTC | SEQ ID NO:22 |
| F-CBDAS_D362A+N365K | ttcaaaAAGGAAATTTTATTAGATAGGAG | SEQ ID NO:23 |
| R-CBDAS_D362A+N365K | gttggcAGTGTCATAATTGACGAC | SEQ ID NO:24 |
| F-CBDAS_N365K | ACAACTTCAAaAAGGAAATTTTATTAG | SEQ ID NO:25 |
| R-CBDAS_N365K | CAGTGTCATAATTGACGAC | SEQ ID NO:26 |
| F-FCBDAS_Q398K | TGTTTTTGTTaAGATTCTGGAGAAG | SEQ ID NO:27 |
| R-CBDAS_Q398K | CTTTCAGGAATGGGTTTTTTAAC | SEQ ID NO:28 |
| F-CBDAS_C446A | GTGGTATATCgccTCCTGGGAGAAAC | SEQ ID NO:29 |
| R-CBDAS_C446A | AACTCGTACAGGATACCAG | SEQ ID NO:30 |
| F-CBDAS K474Q | CTACGTTTCCcagAACCCCAGGT | SEQ ID NO:31 |
| R-CBDAS K474Q | GGCGTCATGAAATTGTAGATATTC | SEQ ID NO:32 |
The genetic information of the host strain yCAN31 used in the following examples is shown in table 2 below.
TABLE 2 Gene information of yCAN31
| Bacterial strains | Host bacterium | Genetic information |
| yCAN10 | CEN.PK2-1C | erg9::KanMX/CTR3p-ERG9; leu2-3_112::His3MX6/GAL1p-ERG19/GAL1p-ERG8; ura3-52::GAL1p-EfMvaS(A110G)-CYC1t/GAL10p-EfMvaE-ADH1t; his3Δ1:: hphMX4/GAL1p-ERG12/GAL10p-IDI1; 308a::GAL1p-ERG20(F96W-N127W)-TDH1t |
| yCAN14 | yCAN10 | 1114a::GAL1p-CsPT4-T-TDH1t |
| yCAN30 | yCAN14 | 607b::HHF1p-CsAAE1-ADH1t |
| yCAN31 | yCAN30 | 911b::GAL1p-CsTKS-CsOAC-ENO1t |
Example 1 CBDAS C446A Preparation and application of mutant
（1）CBDAS C446A Construction of Point mutation vector
Construction of site-directed mutagenesis plasmid pCEV-CBDAS C446A . Designing a site-directed mutagenesis primer, taking pCEV-CBDAS plasmid as a template, carrying out PCR amplification by using a primer F-CBDAS _ C446A and a primer R-CBDAS _ C446A, introducing a mutation base, and leading the amplified fragment to have the length of 8450 bp. The PCR amplification adopts a kit Q5 High-Fidelity DNA Polymerase, the system is Q5 enzyme 0.5 mu L, 10 xbuffer 5 mu L, upstream and downstream primers 2 mu L respectively, a template 50 ng and ddH 2 O make up to 50. mu.L. Reaction procedure: (1) pre-denaturation at 98 ℃ for 30 s; (2) denaturation at 98 ℃ for 15 s; (3) annealing at 57 ℃ for 30 s; (4) amplifying for 4.5 min at 72 ℃; (5) carrying out 25 cycles of steps (2) - (4); (6) finally, extension is carried out for 5 min at 72 ℃. The amplified fragment is subjected to agarose gel electrophoresis to verify the size of the fragment, and then is subjected to gel cutting and purification. The recovered fragment was subjected to KLD reaction in the following reaction scheme: 2 XKLD buffer 5. mu.L, 10 XKLD enzymes 1. mu.L, fragment 100 ng, ddH 2 Make up to 10. mu.L of O, and react at room temperature for 30 min. The ligation products obtained were all converted toIs converted intoE.coliDH 5. alpha. competent cells were plated on LB plates containing 50. mu.g/L ampicillin and cultured overnight at 37 ℃. The next day, single clones were picked for liquid culture and plasmid extraction. The extracted plasmid is sent to a biological sequencing part for sequencing verification, F-pGal1-seq and R-tADH1-seq are selected as sequencing primers, and the site-directed mutagenesis plasmid pCEV-CBDAS C446A And (5) storing.
（2）CBDAS M256I, S116A Construction of Point mutation vector
CBDAS M256I, S116A Construction of the point mutation load is performed in two parts. The first step refers to the method of example 1 (1), using pCEV-CBDAS plasmid as template, PCR amplification with primers F-CBDAS _ S116A and R-CBDAS _ S116A, and construction of point mutation vector pCEV-CBDAS S116A . Second, plasmid pCEV-CBDAS S116A As a template, PCR amplification was performed using primers F-CBDAS _ M256I and R-CBDAS _ M256I, and a point mutation vector pCEV-CBDAS M256I , S116A 。
（3）CBDAS C446A Construction of Point mutation transformants
Amplifying an upstream fragment and a downstream fragment of an insertion site from a saccharomyces cerevisiae genome, wherein primers for amplifying the upstream fragment are F-416d up and R-416d up-pGal1, and primers for amplifying the downstream fragment are F-416d down-tADH1 and R-416d down. CBDAS fragment with point mutation site-directed mutagenesis plasmid pCEV-CBDAS C446A Obtained by amplification using the primers F-pGal1-416d up and R-tADH1-416d down.
② the yeast transformation adopts lithium acetate/PEG 3350 method. Briefly, the host strain yCAN31 was inoculated into 10 mL/250 mL liquid YPD medium and cultured overnight at 200 rpm at 30 ℃. Determining bacterial liquid OD on the second day 600 Taking a proper amount of bacterial liquid, inoculating the bacterial liquid into 50 mL YPD, and diluting the bacterial liquid to OD 600 The value was 0.2 and the cultivation was continued for 4.5 h. Taking 5 OD bacterial liquid for each construction, centrifuging at the normal temperature of 3000 rcf for 5 min, discarding the supernatant, and using ddH 2 O wash twice. Finally, use 50mu.L of DNA mix (2. mu.g of CBDAS fragment with point mutation, upstream and downstream fragment of insertion site, pCUT 250 ng, plus ddH) 2 O to 50 μ L) of suspension cells. Then, lithium acetate was added to convert Mix (50% W/V PEG 3350260. mu.L, 36. mu.L of 1M lithium acetate, 10. mu.L of denatured protamine DNA, ddH 2 O4 μ L), mix well. Water bath at 42 deg.c for 40 min. Centrifuge at 25 ℃ and 5000 rpm for 1 min, discard the supernatant and use 500. mu.L ddH 2 And O, lightly and uniformly blowing. 50 μ L of the suspension was spread on a screening plate (labeled as plate A) and cultured at 30 ℃ for 2 days.
③ screening the flat plate to obtain a synthetic culture medium SD Ura - . The screening steps are as follows: 4 clones were picked randomly from each plate, circled with a mark pen and labeled #1, 2, 3, 4, and streaked onto YPD plates (labeled plate B) and incubated at 30 ℃ for 2 days. A single colony from plate B was inoculated into 5 mL YPD and cultured overnight at 30 ℃ and 200 rpm. The bacterial liquid is diluted 50 times into 5 mL YPD medium, and cultured for 4 h, then a small amount of bacterial liquid is selected and streaked into YPD plate (marked as plate C), and cultured for 2 days at 30 ℃. Randomly picked 4 clones in plate C and labeled # A, B, C, D were streaked onto YPD plate (labeled as plate D) and SD Ura, respectively - The plates were incubated at 30 ℃ for 2 days. 2 positive clones from plate D (i.e.capable of growing on YPD plates but not on SD Ura) were selected - Clones grown in plates).
Fourthly, colony PCR verification: a small number of cells were picked with a pipette tip and placed in 20. mu.L of 20 mM NaOH, vortexed, mixed and incubated in a metal bath at 95 ℃ for 20 min. Vortex and mix well. Taking 1 mu L of bacterial liquid as a template to carry out colony PCR reaction, preferably selecting primers of F-416d-seq and R-416d-seq, wherein a positive clone band is 3054 bp, and a negative clone band is 750 bp.
Fifthly, selecting bacterial liquid of colony PCR positive clone, sending the bacterial liquid to a sequencing department for sequencing verification, preferably selecting F-416d-seq, F-pGal1-seq, R-tADH1-seq and R-416d-seq as sequencing primers, and performing streak preservation and glycerol cryopreservation on of strains with correct sequencing.
Constructing a transformant expressing non-mutated CBDAS by referring to the above two to five steps, mainly co-transforming a gene fragment encoding CBDAS shown in SEQ ID NO:1, an upstream fragment and a downstream fragment of an insertion site and pCUT 250 ng into yCAN31, and screening to obtain WT.
(4) Applications ofCBDAS C446A Fermentation of point mutation transformant to produce CBDA
Mixing WT, a,CBDAS C446A Positive clones of the point-mutation transformants were inoculated in 3mL YPD medium (24-well plate) with 3 single colonies, and cultured overnight at 30 ℃ and 800 rpm. The OD was determined the next day and the broth was diluted in fresh fermentation medium 3mL YPG (pH 5.5) to an OD of 0.2. 333 μ M OA, and 2% galactose were added per well at 24 hr intervals. When the culture lasts for 96 hours, the WT is detected,CBDAS C446A The CBDA yields of the point-mutant transformants were 61.2 and 123.1 mg/L, respectively (FIG. 1).CBDAS C446A The HPLC pattern of CBDA synthesized by transforming the point mutation transformant with the wild type recombinant strain is shown in FIG. 2.
Example 2CBDAS N56H Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 N56H Point mutation vector pCEV-CBDAS N56H And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 74.0 mg/L (FIG. 1).
Example 3CBDAS H213D Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 H213D Point mutation vector pCEV-CBDAS H213D And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 73.8 mg/L (FIG. 1).
Example 4CBDAS M256I Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 M256I Point mutation vector pCEV-CBDAS M256I And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 94.6 mg/L (FIG. 1).
Example 5CBDAS M256I,S116A Preparation and application of mutant
Construction of CBDAS with reference to the method for constructing a Multi-site mutant in example 1 and the primers shown in Table 1 M256I,S116A Point mutation vector pCEV-CBDAS M256I,S116A And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 71.1 mg/L (FIG. 1).
Example 6CBDAS Q343E Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 Q343E Point mutation vector pCEV-CBDAS Q343E And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 88.9 mg/L (FIG. 1).
Example 7CBDAS Q343E,S116A Preparation and application of mutant
Construction of CBDAS with reference to the method of construction of the multisite mutant in example 1 and the primers shown in Table 1 Q343E,S116A Point mutation vector pCEV-CBDAS Q343E,S116A And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 87.9 mg/L (FIG. 1).
Example 8CBDAS D362A,N365K Preparation and application of mutant
Construction of CBDAS with reference to the method of construction of the multisite mutant in example 1 and the primers shown in Table 1 D362A,N365K Point mutation vector pCEV-CBDAS D362A,N365K And transforming the strain into a transformant, and synthesizing CBDA by using OA as a substrate by using the transformant. The CBDA yield was determined to be 111.9 mg/L (FIG. 1).
Example 9CBDAS D362A,N365K,S116A Preparation and application of mutant
Construction of CBDAS with reference to the method for constructing a Multi-site mutant in example 1 and the primers shown in Table 1 D362A,N365K,S116A Point mutation vector pCEV-CBDAS D362A,N365K,S116A And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was determined to be 80.2 mg/L (FIG. 1).
Example 10CBDAS N365K Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 N365K Point mutation vector pCEV-CBDAS N365K And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 106.2 mg/L (FIG. 1).
Example 11CBDAS N365K,S116A Preparation and application of mutant
Construction of CBDAS with reference to the method for constructing a Multi-site mutant in example 1 and the primers shown in Table 1 N365K,S116A Point mutation vector pCEV-CBDAS N365K,S116A And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 79.7 mg/L (FIG. 1).
Example 12CBDAS Q398K Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 Q398K Point mutation vector pCEV-CBDAS Q398K And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 84.3 mg/L (FIG. 1).
Example 13CBDAS Q398K,S116A Preparation and application of mutant
Construction of CBDAS with reference to the method for constructing a Multi-site mutant in example 1 and the primers shown in Table 1 Q398K,S116A Point mutation vector pCEV-CBDAS Q398K,S116A And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 90.0 mg/L (FIG. 1).
Example 14CBDAS K474Q Preparation and application of mutant
Construction of CBDAS with reference to the method of example 1 and the primers shown in Table 1 K474Q Point mutation vector pCEV-CBDAS K474Q And a transformant, and using the transformant to synthesize CBDA by using OA as a substrate. The CBDA yield was found to be 103.7 mg/L (FIG. 1).
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
SEQUENCE LISTING
<110> Sensley Biotechnology (Shenzhen) Limited
<120> cannabidiol synthetase mutant and construction method and application thereof
<130> IBAA211656A
<160> 32
<170> PatentIn version 3.3
<210> 1
<211> 544
<212> PRT
<213> Cannabis sativa
<400> 1
Met Lys Cys Ser Thr Phe Ser Phe Trp Phe Val Cys Lys Ile Ile Phe
1 5 10 15
Phe Phe Phe Ser Phe Asn Ile Gln Thr Ser Ile Ala Asn Pro Arg Glu
20 25 30
Asn Phe Leu Lys Cys Phe Ser Gln Tyr Ile Pro Asn Asn Ala Thr Asn
35 40 45
Leu Lys Leu Val Tyr Thr Gln Asn Asn Pro Leu Tyr Met Ser Val Leu
50 55 60
Asn Ser Thr Ile His Asn Leu Arg Phe Thr Ser Asp Thr Thr Pro Lys
65 70 75 80
Pro Leu Val Ile Val Thr Pro Ser His Val Ser His Ile Gln Gly Thr
85 90 95
Ile Leu Cys Ser Lys Lys Val Gly Leu Gln Ile Arg Thr Arg Ser Gly
100 105 110
Gly His Asp Ser Glu Gly Met Ser Tyr Ile Ser Gln Val Pro Phe Val
115 120 125
Ile Val Asp Leu Arg Asn Met Arg Ser Ile Lys Ile Asp Val His Ser
130 135 140
Gln Thr Ala Trp Val Glu Ala Gly Ala Thr Leu Gly Glu Val Tyr Tyr
145 150 155 160
Trp Val Asn Glu Lys Asn Glu Asn Leu Ser Leu Ala Ala Gly Tyr Cys
165 170 175
Pro Thr Val Cys Ala Gly Gly His Phe Gly Gly Gly Gly Tyr Gly Pro
180 185 190
Leu Met Arg Asn Tyr Gly Leu Ala Ala Asp Asn Ile Ile Asp Ala His
195 200 205
Leu Val Asn Val His Gly Lys Val Leu Asp Arg Lys Ser Met Gly Glu
210 215 220
Asp Leu Phe Trp Ala Leu Arg Gly Gly Gly Ala Glu Ser Phe Gly Ile
225 230 235 240
Ile Val Ala Trp Lys Ile Arg Leu Val Ala Val Pro Lys Ser Thr Met
245 250 255
Phe Ser Val Lys Lys Ile Met Glu Ile His Glu Leu Val Lys Leu Val
260 265 270
Asn Lys Trp Gln Asn Ile Ala Tyr Lys Tyr Asp Lys Asp Leu Leu Leu
275 280 285
Met Thr His Phe Ile Thr Arg Asn Ile Thr Asp Asn Gln Gly Lys Asn
290 295 300
Lys Thr Ala Ile His Thr Tyr Phe Ser Ser Val Phe Leu Gly Gly Val
305 310 315 320
Asp Ser Leu Val Asp Leu Met Asn Lys Ser Phe Pro Glu Leu Gly Ile
325 330 335
Lys Lys Thr Asp Cys Arg Gln Leu Ser Trp Ile Asp Thr Ile Ile Phe
340 345 350
Tyr Ser Gly Val Val Asn Tyr Asp Thr Asp Asn Phe Asn Lys Glu Ile
355 360 365
Leu Leu Asp Arg Ser Ala Gly Gln Asn Gly Ala Phe Lys Ile Lys Leu
370 375 380
Asp Tyr Val Lys Lys Pro Ile Pro Glu Ser Val Phe Val Gln Ile Leu
385 390 395 400
Glu Lys Leu Tyr Glu Glu Asp Ile Gly Ala Gly Met Tyr Ala Leu Tyr
405 410 415
Pro Tyr Gly Gly Ile Met Asp Glu Ile Ser Glu Ser Ala Ile Pro Phe
420 425 430
Pro His Arg Ala Gly Ile Leu Tyr Glu Leu Trp Tyr Ile Cys Ser Trp
435 440 445
Glu Lys Gln Glu Asp Asn Glu Lys His Leu Asn Trp Ile Arg Asn Ile
450 455 460
Tyr Asn Phe Met Thr Pro Tyr Val Ser Lys Asn Pro Arg Leu Ala Tyr
465 470 475 480
Leu Asn Tyr Arg Asp Leu Asp Ile Gly Ile Asn Asp Pro Lys Asn Pro
485 490 495
Asn Asn Tyr Thr Gln Ala Arg Ile Trp Gly Glu Lys Tyr Phe Gly Lys
500 505 510
Asn Phe Asp Arg Leu Val Lys Val Lys Thr Leu Val Asp Pro Asn Asn
515 520 525
Phe Phe Arg Asn Glu Gln Ser Ile Pro Pro Leu Pro Arg His Arg His
530 535 540
<210> 2
<211> 28
<212> PRT
<213> Artificial sequence
<400> 2
Met Asn Cys Ser Ala Phe Ser Phe Trp Phe Val Cys Lys Ile Ile Phe
1 5 10 15
Phe Phe Leu Ser Phe His Ile Gln Ile Ser Ile Ala
20 25
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<400> 3
tatcgtccaa ctgcatggag atga 24
<210> 4
<211> 44
<212> DNA
<213> Artificial sequence
<400> 4
ggttttttta ggctaagata atgggtccgg ttaaacggat ctcg 44
<210> 5
<211> 56
<212> DNA
<213> Artificial sequence
<400> 5
caaatgcctg caaatcgctc cccatttccc gaacatgctc cttcactatt ttaaca 56
<210> 6
<211> 30
<212> DNA
<213> Artificial sequence
<400> 6
atttttcaat tgaggaaact tgaaaggtgt 30
<210> 7
<211> 60
<212> DNA
<213> Artificial sequence
<400> 7
caatgcgaga tccgtttaac cggacccatt atcttagcct aaaaaaacct tctctttgga 60
<210> 8
<211> 44
<212> DNA
<213> Artificial sequence
<400> 8
aatagtgaag gagcatgttc gggaaatggg gagcgatttg cagg 44
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
ccactttaac taatactttc 20
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence
<400> 10
caacctgacc tacaggaa 18
<210> 11
<211> 25
<212> DNA
<213> Artificial sequence
<400> 11
tggctttttg attgattgta cagga 25
<210> 12
<211> 25
<212> DNA
<213> Artificial sequence
<400> 12
tcgcaataat ctatatgctc accaa 25
<210> 13
<211> 28
<212> DNA
<213> Artificial sequence
<400> 13
atacactcag cacaaccctc tatatatg 28
<210> 14
<211> 19
<212> DNA
<213> Artificial sequence
<400> 14
actaacttaa ggttcgtcg 19
<210> 15
<211> 33
<212> DNA
<213> Artificial sequence
<400> 15
gggacacgac gctgagggga tgagttatat tag 33
<210> 16
<211> 18
<212> DNA
<213> Artificial sequence
<400> 16
ccgctacggg tacgtatt 18
<210> 17
<211> 26
<212> DNA
<213> Artificial sequence
<400> 17
agttaatgtt gatggaaaag tgttag 26
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence
<400> 18
aagtgagcat ctatgatatt g 21
<210> 19
<211> 35
<212> DNA
<213> Artificial sequence
<400> 19
aaagagtacc attttctcag taaagaaaat aatgg 35
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence
<400> 20
ggaacagcca caagcctg 18
<210> 21
<211> 22
<212> DNA
<213> Artificial sequence
<400> 21
agattgtaga gaactttcct gg 22
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence
<400> 22
gtcttcttga tacctagttc 20
<210> 23
<211> 29
<212> DNA
<213> Artificial sequence
<400> 23
ttcaaaaagg aaattttatt agataggag 29
<210> 24
<211> 24
<212> DNA
<213> Artificial sequence
<400> 24
gttggcagtg tcataattga cgac 24
<210> 25
<211> 27
<212> DNA
<213> Artificial sequence
<400> 25
acaacttcaa aaaggaaatt ttattag 27
<210> 26
<211> 19
<212> DNA
<213> Artificial sequence
<400> 26
cagtgtcata attgacgac 19
<210> 27
<211> 25
<212> DNA
<213> Artificial sequence
<400> 27
tgtttttgtt aagattctgg agaag 25
<210> 28
<211> 23
<212> DNA
<213> Artificial sequence
<400> 28
ctttcaggaa tgggtttttt aac 23
<210> 29
<211> 26
<212> DNA
<213> Artificial sequence
<400> 29
gtggtatatc gcctcctggg agaaac 26
<210> 30
<211> 19
<212> DNA
<213> Artificial sequence
<400> 30
aactcgtaca ggataccag 19
<210> 31
<211> 23
<212> DNA
<213> Artificial sequence
<400> 31
ctacgtttcc cagaacccca ggt 23
<210> 32
<211> 24
<212> DNA
<213> Artificial sequence
<400> 32
ggcgtcatga aattgtagat attc 24
Claims (9)
1. A mutant of cannabidiol synthase, which is characterized in that,
the amino acid sequence of the mutant is the amino acid sequence of SED ID NO:1 by substituting asparagine at position 365 with lysine and aspartic acid at position 362 with alanine.
2. A mutant cannabidiol synthase bearing a signal peptide, consisting of SED ID NO:1 from position 1 to 28 of the mutant of claim 1, or 2 with the mutant of claim 1.
3. A gene encoding the cannabidiol synthetase mutant as claimed in claim 1 or 2.
4. A nucleic acid construct carrying the gene of claim 3.
5. A recombinant cell expressing the cannabidiol synthetase mutant as claimed in claim 1 or 2.
6. The recombinant cell according to claim 5, which is constructed using Saccharomyces cerevisiae as a host.
7. The method for synthesizing cannabidiolic acid by using the recombinant cell as claimed in claim 5, wherein cannabidiolic acid is obtained by converting cannabidiol synthetase mutants with olivinic acid as substrate.
8. Use of the mutant cannabidiol synthetase according to claim 1 or 2 for the synthesis of cannabidiolic acid.
9. Use according to claim 8, for the catalysis of olivopodic acid to cannabidiolic acid in an in vitro catalytic system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210502557.XA CN114591923B (en) | 2022-05-10 | 2022-05-10 | Cannabidiol synthetase mutant and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210502557.XA CN114591923B (en) | 2022-05-10 | 2022-05-10 | Cannabidiol synthetase mutant and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114591923A CN114591923A (en) | 2022-06-07 |
| CN114591923B true CN114591923B (en) | 2022-08-30 |
Family
ID=81813587
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210502557.XA Active CN114591923B (en) | 2022-05-10 | 2022-05-10 | Cannabidiol synthetase mutant and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114591923B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116622784B (en) * | 2023-02-14 | 2024-03-01 | 黑龙江八一农垦大学 | Application of cannabidiol synthase |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019209885A2 (en) * | 2018-04-23 | 2019-10-31 | Renew Biopharma, Inc. | Enzyme engineering to alter the functional repertoire of cannabinoid synthases |
| CN110914416A (en) * | 2017-04-27 | 2020-03-24 | 加州大学董事会 | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| WO2020236789A1 (en) * | 2019-05-22 | 2020-11-26 | Demetrix, Inc. | Optimized cannabinoid synthase polypeptides |
| WO2021081246A1 (en) * | 2019-10-23 | 2021-04-29 | Renew Biopharma, Inc. | Enzyme engineering to alter the functional repertoire of cannabinoid synthases |
| WO2021211611A1 (en) * | 2020-04-14 | 2021-10-21 | Genomatica, Inc. | Cannabinoid synthase variants and methods for their use |
| WO2022011175A1 (en) * | 2020-07-08 | 2022-01-13 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
| CN113999870A (en) * | 2020-02-26 | 2022-02-01 | 森瑞斯生物科技(深圳)有限公司 | Recombinant saccharomyces cerevisiae for expressing CBDAS and construction method and application thereof |
-
2022
- 2022-05-10 CN CN202210502557.XA patent/CN114591923B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110914416A (en) * | 2017-04-27 | 2020-03-24 | 加州大学董事会 | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| WO2019209885A2 (en) * | 2018-04-23 | 2019-10-31 | Renew Biopharma, Inc. | Enzyme engineering to alter the functional repertoire of cannabinoid synthases |
| WO2020236789A1 (en) * | 2019-05-22 | 2020-11-26 | Demetrix, Inc. | Optimized cannabinoid synthase polypeptides |
| WO2021081246A1 (en) * | 2019-10-23 | 2021-04-29 | Renew Biopharma, Inc. | Enzyme engineering to alter the functional repertoire of cannabinoid synthases |
| CN113999870A (en) * | 2020-02-26 | 2022-02-01 | 森瑞斯生物科技(深圳)有限公司 | Recombinant saccharomyces cerevisiae for expressing CBDAS and construction method and application thereof |
| WO2021211611A1 (en) * | 2020-04-14 | 2021-10-21 | Genomatica, Inc. | Cannabinoid synthase variants and methods for their use |
| WO2022011175A1 (en) * | 2020-07-08 | 2022-01-13 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
Non-Patent Citations (3)
| Title |
|---|
| Elucidation of structure-function relationship of THCA and CBDA synthase from Cannabis sativa L.;Bastian Zirpel 等;《Journal of Biotechnology》;20180724;第284卷;第17-26页 * |
| NACCESSION：P_001384865.1，"cannabidiolic acid synthase precursor [Cannabis sativa]";Onofri C 等;《Genbank》;20220415;origin、feature部分 * |
| Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype;Chiara Onofri 等;《Phytochemistry》;20150409;第116卷;第57-68页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114591923A (en) | 2022-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109777815B (en) | HMG-CoA synthetase gene RKHMGCS and application thereof | |
| CN110551701B (en) | Carbonyl reductase mutant and application thereof in reduction of cyclopentadione compounds | |
| CN110117601B (en) | Grifola frondosa glucan synthase, encoding gene and application thereof | |
| CN114591923B (en) | Cannabidiol synthetase mutant and construction method and application thereof | |
| CN105802943B (en) | A kind of pichia pastoris yeast mutant strain of the Pullulanase chimera and high yield of the performance improvement chimera | |
| CN111088254B (en) | Endogenous carried exogenous gene efficient controllable expression system | |
| CN110628738B (en) | Method for improving activity of glucose oxidase, mutant and application thereof | |
| CN107955067B (en) | Two MYB transcription factors involved in peach flavonol biosynthesis regulation and control and application thereof | |
| CN112899177A (en) | Recombinant yarrowia lipolytica expressing myrosinase TGG4 and application thereof | |
| CN114480512B (en) | Application of oxidoreductase and mutant thereof in biosynthesis of nootkatone | |
| CN112724217A (en) | Sweet wormwood MYB transcription factor AaMYB108 and application thereof | |
| CN109913380A (en) | Produce (-)-α-bisabolol recombination Yarrowia lipolytica and its construction method and application | |
| CN113249240B (en) | Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof | |
| CN114085784B (en) | Recombinant yeast for high expression of cytochrome P450 and application thereof | |
| CN115786389A (en) | Saccharomyces cerevisiae engineering bacterium for high-yield santalol as well as construction method and application thereof | |
| CN114277024B (en) | Novel triterpene synthase and application thereof | |
| CN112410353B (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| CN111647589A (en) | Euphorbia dienol synthase and coding gene and application thereof | |
| CN109735523B (en) | Cedarol synthase Lc-CedS coding gene and application thereof | |
| CN109401991B (en) | Recombinant saccharomyces cerevisiae and method for producing ethanol by fermenting raw materials | |
| CN114525215B (en) | Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain | |
| JP6979484B2 (en) | Recombinant microorganisms for producing 2,3-butanediol and methods for producing 2,3-butanediol | |
| CN116622784B (en) | Application of cannabidiol synthase | |
| CN114107267B (en) | Beta-ocimene synthase CsTPS as well as coding gene and application thereof | |
| CN112011469B (en) | Recombinant aspergillus terreus strain for producing trans-aconitic acid and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |