CN114107267B

CN114107267B - Beta-ocimene synthase CsTPS as well as coding gene and application thereof

Info

Publication number: CN114107267B
Application number: CN202111289314.4A
Authority: CN
Inventors: 张欣欣; 宾敏良; 易干军
Original assignee: Pomology Research Institute Guangdong Academy of Agricultural Sciences
Current assignee: Pomology Research Institute Guangdong Academy of Agricultural Sciences
Priority date: 2021-11-02
Filing date: 2021-11-02
Publication date: 2022-12-02
Anticipated expiration: 2041-11-02
Also published as: CN114107267A

Abstract

The invention discloses a beta-ocimene synthase CsTPS as well as a coding gene and application thereof, belonging to the technical field of genetic engineering. The amino acid sequence of the beta-ocimene synthase CsTPS is shown in SEQ ID NO. 1. The invention also discloses a recombinant vector, a recombinant bacterium, a preparation method of the beta-ocimene synthase CsTPS, application of the beta-ocimene synthase CsTPS in beta-ocimene synthesis and a synthesis method of the beta-ocimene. The invention separates a section of full-length cDNA for coding beta-ocimene synthase from citrus, and the enzyme has the capability of synthesizing monoterpene compound beta-ocimene and high catalytic efficiency.

Description

Beta-ocimene synthase CsTPS as well as coding gene and application thereof

Technical Field

The invention relates to a beta-ocimene synthase CsTPS and a coding gene and application thereof, belonging to the technical field of genetic engineering.

Background

β -Ocimene (β -Ocimene) is a volatile monoterpene (monoterpenes) compound that includes two isomers in nature: cis-beta-ocimene and trans-beta-ocimene. The beta-ocimene is mainly used as essential oil to be applied to various perfume additives. In addition, the beta-ocimene also has the function of inducing and regulating the defense response of the plants to insects.

Beta-ocimene is present in leaves, fruits and floral organs of many plants (e.g. basil, litsea cubeba, lavender and citrus). The citrus is rich in volatile substances, mainly terpenoids, wherein terpenoids are the most important. The main volatile substances in the citrus peel are monoterpenes, particularly the content of d-limonene is the highest, and the d-limonene content accounts for 60% -95% of the total volatile substances in most of the germplasms. Different from the peel, the main volatile substances in the citrus leaves have larger variation in different citrus varieties, and mainly comprise d-limonene, linalool, beta-ocimene and linalyl acetate. However, in the prior art, the beta-ocimene is extracted from plants, and no artificial synthesis report exists.

In view of the above, it is desirable to provide a method for artificially synthesizing β -ocimene with high yield, so as to solve the deficiencies of the prior art.

Disclosure of Invention

One of the purposes of the invention is to provide a beta-ocimene synthase CsTPS.

The technical scheme for solving the problems is as follows: the amino acid sequence of the beta-ocimene synthase CsTPS is shown as SEQ ID NO. 1.

The beta-ocimene synthase CsTPS has the beneficial effects that:

the beta-ocimene synthase CsTPS has the capability of synthesizing the monoterpene compound beta-ocimene, and is expected to provide a new way for continuously supplying the beta-ocimene.

The second object of the present invention is to provide the coding gene of the above-mentioned β -ocimene synthase CsTPS.

The technical scheme for solving the problems is as follows: the nucleotide sequence of the coding gene of the beta-ocimene synthase CsTPS is shown in SEQ ID NO. 2.

The coding gene of the beta-ocimene synthase CsTPS has the beneficial effects that:

the gene for coding the beta-ocimene synthase is cloned and obtained, and is named as CsTPS. The gene encodes a protein having an amino acid sequence shown in SEQ ID NO.1, and is a protein having a beta-ocimene synthase activity. The nucleotide sequence of the gene is not cloned and published from citrus at present.

It is a further object of the present invention to provide a recombinant vector.

The technical scheme for solving the problems is as follows: a recombinant vector, comprising the coding gene of the beta-ocimene synthase CsTPS.

The recombinant vector has the beneficial effects that:

the recombinant expression vector contains the coding gene of the beta-ocimene synthase CsTPS, and can efficiently express the coding gene in a host saccharomyces cerevisiae.

On the basis of the technical scheme, the invention can be further improved as follows.

Further, the recombinant vector is a recombinant vector pYES2-CsTPS.

The fourth object of the present invention is to provide a recombinant bacterium.

The technical scheme for solving the problems is as follows: a recombinant bacterium obtained by introducing the above recombinant vector into a host bacterium.

The recombinant bacterium has the beneficial effects that:

the recombinant vector can stably exist in host bacteria after being transformed into the host bacteria, and expresses the CsTPS protein.

On the basis of the technical scheme, the invention can be improved as follows.

Further, the host bacterium is Saccharomyces cerevisiae INVSC1.

The adoption of the further beneficial effects is as follows: the recombinant vector can be stably positioned in saccharomyces cerevisiae after being transformed into saccharomyces cerevisiae, and expresses CsTPS protein.

The fifth object of the present invention is to provide a method for producing the above-mentioned β -ocimene synthase CsTPS.

The technical scheme for solving the problems is as follows: a preparation method of beta-ocimene synthase CsTPS comprises the following steps:

and (2) introducing the coding gene of the beta-ocimene synthase CsTPS into host bacteria to obtain recombinant bacteria for expressing the beta-ocimene synthase CsTPS, culturing the recombinant bacteria, and collecting the beta-ocimene synthase CsTPS.

The preparation method of the beta-ocimene synthase CsTPS has the beneficial effects that:

by adopting the method, the beta-ocimene synthase CsTPS can be quickly, simply and massively obtained, so that the beta-ocimene synthase CsTPS can be used for synthesizing the beta-ocimene on a large scale.

Further, the host bacterium is saccharomyces cerevisiae INVSC1.

Further, the temperature of the culture is 30 ℃, and the time is 12-48 h.

Adopt above-mentioned further beneficial effect to be: by adopting the parameters, the growth requirement of the recombinant bacteria can be met.

The invention also aims to provide application of the beta-ocimene synthase CsTPS in synthesizing beta-ocimene.

The technical scheme for solving the problems is as follows: the application of the beta-ocimene synthase CsTPS in synthesizing beta-ocimene.

The application of the beta-ocimene synthase CsTPS has the beneficial effects that:

the beta-ocimene synthase CsTPS can be used for synthesizing beta-ocimene and has wide application prospect.

The seventh object of the present invention is to provide a method for synthesizing β -ocimene.

The technical scheme for solving the problems is as follows: a method for synthesizing beta-ocimene comprises the following steps: beta-ocimene is catalytically synthesized by the beta-ocimene synthase CsTPS by taking geranyl pyrophosphate as a substrate.

The method for synthesizing the beta-ocimene by utilizing the beta-ocimene synthase CsTPS has the beneficial effects that:

the invention can utilize beta-ocimene synthase CsTPS to catalyze geranyl pyrophosphate to synthesize beta-ocimene, has high catalysis efficiency, high yield, low cost and wide market prospect, and is suitable for large-scale popularization and application.

Interpretation of terms

The term "host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce a recombinant host cell, e.g., direct uptake, transduction, f-pairing or other methods known in the art. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

The term "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, and the like). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues.

The term "enzyme" is used interchangeably herein to mean a polymer of amino acid residues. That is, the description for a polypeptide applies equally to the description of a peptide and to the description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

Drawings

FIG. 1 is a graph showing the results of GC-MS detection of yeasts overexpressing the CsTPS gene catalyzing the synthesis of β -ocimene using geranyl pyrophosphate (GPP) as a substrate in example 3 of the present invention, using yeasts transformed with pYES2-CsTPS as a sample.

FIG. 2 is a graph showing the results of GC-MS detection of empty vector-transformed yeast catalyzing the synthesis of β -ocimene using geranyl pyrophosphate (GPP) as a substrate, using yeast transformed with empty vector pYES2 as a negative control in example 3 of the present invention.

FIG. 3 is a graph showing the results of detecting β -ocimene by GC-MS using β -ocimene standard as a positive control in example 3 of the present invention.

Detailed Description

The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.

Example 1: cloning of Citrus beta-Ocimum synthase CsTPS Gene

Extracting RNA of orange (Citrus sinensis (L.) Osbeck) leaf with RNA extraction kit (Biotake), and reverse transcription kit PrimeScript with RNA as template ^TM And carrying out reverse transcription on the RT Reagent Kit (TaKaRa) to obtain cDNA, carrying out PCR reaction on CsTPS-F and CsTPS-R by using the cDNA as a template and cloning the coding region sequence of the CsTPS gene. The PCR reaction system is as follows: a50. Mu.L system containing 25. Mu.L of high fidelity Taq enzyme 2X Phanta MaxMaster Mix (Dye Plus), 2. Mu.L each of the forward primer CsTPS-F and the reverse primer CsTPS-R, 1. Mu.L of cDNA template, and 20. Mu.L of water. The PCR reaction program is: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 15s, annealing at 50 ℃ for 15s, extension at 72 ℃ for 2min, circulation for 35 times, and full extension at 72 ℃ for 5min.

The sequence fragment of the coding region of the cloned CsTPS gene was recovered, ligated with pMD18-T vector (Takara) at 16 ℃ for 2 hours, introduced into E.coli competent DH 5. Alpha. (Sangon Biotech) and cultured by selection on solid LB medium (containing 50. Mu.g/mL ampicillin). After overnight culture at 37 ℃, selecting a monoclonal, verifying positive clones by PCR, culturing the confirmed positive strains in a liquid LB culture medium (containing 50 mug/mL of ampicillin) for 12h, extracting plasmids, and performing PCR verification on CsTPS-F and CsTPS-R by using primers to obtain a plasmid pMD18-T-CsTPS. After sequencing the plasmid, the full-length coding region sequence of the CsTPS gene was obtained. The coding region sequence of the CsTPS gene has the full length of 1878bp and codes 625 amino acid sequence proteins (namely beta-ocimene synthase). The amino acid sequence of the CsTPS gene is shown as SEQ ID NO.1, the full-length nucleotide sequence of the coding region of the CsTPS gene is shown as SEQ ID NO.2, the nucleotide sequence of an upstream primer CsTPS-F is shown as SEQ ID NO.3, and the nucleotide sequence of a downstream primer CsTPS-R is shown as SEQ ID NO. 4.

The amino acid sequence of the beta-ocimene synthase CsTPS is as follows:

MAHQLMTSVPALTRLQEPRSFISSLGSPSISKSNSKSNSNGFCASPIQCMAATKARDKAINDNRRSANYQPSIWSYDYLQSLSNGYAGESCAQRIEKLKGEVRLMLDNYKELDDYVDALYYLEIVDNLQRLGVSYHFEGEIKRFLNRIYNKRNSRRSSTYHAKENQESLLYAASLEFRLLRQHGYDIHAHGTLSSFMDEKGKFKSCLGDDIKGILALYEAAYLLGEEESTIFHEAINFTTTHLEEYVKKHNDDDDDDGGYFSALVKHALELPLHWRMVRLEARWFIDVYERGTDMNPVLVELAKLDFNSVQAAHQDELKYVSWWWRKTGLGELHFARDRIVENFFWALGEIWEPQFGYCRRMSTKVNALITTVDDVYDVYGTLDELEQFTNAVERWDVNAMDQLPYYMKMCFHVLHSSTNEMAFDALKDQGVHVVPYLKKAWADMCKSFLLEAKWYSSGYIPTLDEYIENAWVSVSGPVILLHAYSLIANPAKEEALQFLQEYPHIIRWPSMIFRLANDLATSSDEVKRGDVPKAIQCYMHETGASESDARQHIRDLITAAWMKMNNKREGDENPDHLLLPNNFVQFAMNLARMAQCTYQNGDGHTVQDNSKNRVLPLLIHPIKS(SEQ ID NO.1)。

the nucleotide sequence of the coding gene of the beta-ocimene synthase CsTPS is as follows:

atggctcatcaactgatgacttcagtgcctgccttgactagattgcaggaacctagaagtttcatctcatcacttggatcacccagcatcagcaaaagcaacagcaaaagcaacagcaatggcttctgtgcatctccaatccaatgcatggctgctacaaaagctcgtgacaaggcaattaatgataataggcgatcagccaattatcagccttccatatggagctatgattaccttcaatctctgtcaaatggatatgcgggagaatcatgtgcccaacggatcgaaaagctgaagggagaagtgaggttaatgcttgacaattataaagagcttgacgattatgtggatgcgctatattacctggagattgttgataatttgcaaagacttggagtatcttatcactttgagggcgaaattaaaagatttctcaataggatatacaacaagagaaacagtcgcagaagcagtacttaccatgccaaggaaaatcaagaaagtttattatatgccgcatctcttgaatttagactcctaagacaacatggttatgatatacatgcacatggaactctttctagtttcatggatgagaaggggaagtttaagtcatgcctcggagacgatatcaaaggaattttagcattgtatgaagctgcatatcttttgggagaagaagagagcaccatcttccatgaagctatcaatttcacaaccacacatctcgaagaatacgtgaagaagcataatgatgatgatgatgatgatggtggatatttttcagcattagtgaagcatgcattggaacttcccttacactggaggatggtaagattggaggcaaggtggttcattgatgtatatgaaagaggaacggacatgaacccagttttggtcgagcttgctaaactggactttaattctgtgcaagcagcacaccaagacgagctcaagtatgtgtcttggtggtggaggaagacgggacttggcgagttgcattttgcaagggacaggatagtggaaaatttcttctgggctttgggggagatatgggagcctcaatttggatactgtagaaggatgtccacgaaagttaacgcattaataacgaccgttgacgatgtttatgatgtgtatggtaccttggatgaacttgaacaattcacaaatgccgttgaaagatgggatgtcaatgcgatggatcaacttccatactatatgaagatgtgttttcatgttcttcatagttcaacaaacgaaatggcttttgatgctctcaaggatcaaggagttcacgtcgttccttaccttaaaaaagcttgggcagatatgtgcaaatcttttttgttggaggcaaaatggtacagcagcggatacataccaacccttgatgaatacatagagaatgcttgggtttcagtctcaggacctgtaattctactccatgcttattccttgattgcaaatccagcaaaagaggaggccttgcaattcttacaagagtacccccatataattcgttggccatcaatgatttttcgacttgccaatgacctggcaacatcatcggatgaggtgaaaagaggagatgttcctaaggcaattcaatgttacatgcatgaaactggagcttcagaaagcgatgctcgtcaacacataagagatttgatcacagcagcatggatgaagatgaacaataaaagagaaggagatgaaaatcctgatcacttattactgcccaacaattttgtccagtttgcaatgaatctagcgagaatggctcaatgcacataccaaaacggagatgggcataccgttcaagacaatagtaaaaatcgtgtattgccattactcattcaccccataaagtcctaa(SEQ ID NO.2)。

the nucleotide sequence of the upstream primer CsTPS-F is as follows:

atggctcatcaactgatgac(SEQ ID NO.3)。

the nucleotide sequence of the downstream primer CsTPS-R is as follows:

ttaggactttatggggtgaa(SEQ ID NO.4)。

example 2: construction of Yeast expression vector for beta-Oclerene synthase CsTPS Gene

PCR was performed using the correctly sequenced plasmid pMD18-T-CsTPS in example 1 as a template, and pYES2-CsTPS-F and pYES2-CsTPS-R as primers. The PCR reaction system is as follows: a50. Mu.L system with high fidelity Taq enzyme 2 × Phanta Max Master Mix (Dye Plus) 25. Mu.L, 2. Mu.L each of the forward primer pYES2-CsTPS-F and the reverse primer pYES2-CsTPS-R, 1. Mu.L plasmid template and 20. Mu.L water. The PCR reaction program is: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 15s, annealing at 50 ℃ for 15s, extension at 72 ℃ for 2min, circulation for 35 times, and full extension at 72 ℃ for 5min. Then, agarose electrophoresis was performed, and the PCR product was recovered using a DNA gel recovery kit (Tiangen), while the restriction enzyme product obtained by digesting the pYES2 vector (Invitrogen) with the restriction enzyme BamH I (Takara) was recovered by agarose electrophoresis, followed by using a recombinant cloning kit

The two fractions of recovered product were ligated by the Ultra One Step Cloning Kit (Vazyme) according to the instructions. The ligation products were transformed into E.coli competent DH 5. Alpha. And screened on solid LB medium (containing 50. Mu.g/mL ampicillin). After overnight culture at 37 ℃, selecting monoclonals, carrying out amplification culture on the selected monoclonals for 12h by using a liquid LB culture medium (containing 50 mu g/mL ampicillin), and extracting plasmids by using a plasmid miniprep (Tiangen) to obtain the plasmidPlasmid pYES2-CsTPS. And carrying out PCR (polymerase chain reaction) verification on positive clones by using primers pYES2-CsTPS-F and pYES2-CsTPS-R to obtain a recombinant vector pYES2-CsTPS for protein expression, which is sequenced correctly. Wherein the nucleotide sequences of the upstream primer pYES2-CsTPS-F and the downstream primer pYES2-CsTPS-R are respectively shown as SEQ ID NO 5 and SEQ ID NO 6.

The nucleotide sequence of the upstream primer pYES2-CsTPS-F is as follows:

cttggtaccgagctcggatccacaatggctcatcaactgatg(SEQ ID NO 5)。

the nucleotide sequence of the downstream primer pYES2-CsTPS-R is as follows:

gcggccgttactagtggatccttaggactttatggggtga(SEQ ID NO 6)。

example 3: beta-ocimene synthase CsTPS yeast in-vitro expression catalysis synthesis of beta-ocimene

Beta-ocimene synthase can catalyze Geranyl pyrophosphate (GPP) to generate monoterpene metabolites mainly containing beta-ocimene, and the catalytic function of the monoterpene metabolites is verified by the following method.

Enzymatic reaction: the plasmid pYES2-CsTPS obtained in example 2 was transformed into yeast competent INVSc1, while pYES2 transformed in no-load was used as a control, spread on SD-Uracil solid medium (carbon source 20% by mass of glucose), and cultured in 30 ℃ incubator for 3d. Then, single clones of the pYES2-CsTPS and pYES2 yeast transformants were picked up and cultured in 3mL of SD-Uracil liquid medium (carbon source is 20% by mass of glucose), followed by amplification culture in 50mL of SD-Uracil liquid medium. When cultured to OD ₆₀₀ When =0.6, the cells were centrifuged at 3000rpm/min for 5min to remove the supernatant, the cells were resuspended in 50mL of sterile water, and centrifuged at 3000rpm/min for 5min to remove the supernatant. After 3 repeated washes with sterile water, the cells were resuspended in 50mL of SC-Uracil broth (carbon source 20% by mass galactose and 10% by mass raffinose), and 156. Mu.L of GPP (Sigma) was added to a final concentration of 10. Mu.M. Culturing the bacterial liquid at 30 ℃ and 180rpm/min for 12h, inducing CsTPS protein expression and catalyzing substrate reaction. After 12 hours of incubation, the cells were inoculated with SPME cellulose heads (100 μm polydimethylsiloxane fiber, supelco) into the cellsThe product was collected by adsorption for 1h and then subjected to GC-MS measurement.

And (3) GC-MS determination: inserting SPME cellulose head into the sample inlet connected with gas chromatography column (DB-5, 60m × 0.25mm, film thickness 0.25 μm, J & W Scientific, folsom, CA, USA) for non-split sample injection for 5min; the temperature gradient was increased from 40 deg.C (maintained for 3 min) to 160 deg.C at a rate of 3 deg.C/min for 1min, from 160 deg.C to 200 deg.C at a rate of 5 deg.C/min for 1min, and from 200 deg.C to 240 deg.C at a rate of 8 deg.C/min for 3min. The detector temperature was set at 250 ℃.

The GC-MS detection results are shown in figures 1-3, and the heterogeneously expressed beta-ocimene synthase CsTPS in yeast can catalyze the synthesis of beta-ocimene by using geranyl pyrophosphate (GPP) as a substrate. The peak value of the beta-ocimene appears when the retention time is 16.26min-16.28min, and the peak value does not appear in other retention times, which shows that the CsTPS independently catalyzes the synthesis of the beta-ocimene by using GPP as a substrate and has high catalysis efficiency.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> research institute for fruit trees of Guangdong province academy of agricultural sciences

<120> beta-ocimene synthase CsTPS and coding gene and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 625

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala His Gln Leu Met Thr Ser Val Pro Ala Leu Thr Arg Leu Gln

1 5 10 15

Glu Pro Arg Ser Phe Ile Ser Ser Leu Gly Ser Pro Ser Ile Ser Lys

20 25 30

Ser Asn Ser Lys Ser Asn Ser Asn Gly Phe Cys Ala Ser Pro Ile Gln

35 40 45

Cys Met Ala Ala Thr Lys Ala Arg Asp Lys Ala Ile Asn Asp Asn Arg

50 55 60

Arg Ser Ala Asn Tyr Gln Pro Ser Ile Trp Ser Tyr Asp Tyr Leu Gln

65 70 75 80

Ser Leu Ser Asn Gly Tyr Ala Gly Glu Ser Cys Ala Gln Arg Ile Glu

85 90 95

Lys Leu Lys Gly Glu Val Arg Leu Met Leu Asp Asn Tyr Lys Glu Leu

100 105 110

Asp Asp Tyr Val Asp Ala Leu Tyr Tyr Leu Glu Ile Val Asp Asn Leu

115 120 125

Gln Arg Leu Gly Val Ser Tyr His Phe Glu Gly Glu Ile Lys Arg Phe

130 135 140

Leu Asn Arg Ile Tyr Asn Lys Arg Asn Ser Arg Arg Ser Ser Thr Tyr

145 150 155 160

His Ala Lys Glu Asn Gln Glu Ser Leu Leu Tyr Ala Ala Ser Leu Glu

165 170 175

Phe Arg Leu Leu Arg Gln His Gly Tyr Asp Ile His Ala His Gly Thr

180 185 190

Leu Ser Ser Phe Met Asp Glu Lys Gly Lys Phe Lys Ser Cys Leu Gly

195 200 205

Asp Asp Ile Lys Gly Ile Leu Ala Leu Tyr Glu Ala Ala Tyr Leu Leu

210 215 220

Gly Glu Glu Glu Ser Thr Ile Phe His Glu Ala Ile Asn Phe Thr Thr

225 230 235 240

Thr His Leu Glu Glu Tyr Val Lys Lys His Asn Asp Asp Asp Asp Asp

245 250 255

Asp Gly Gly Tyr Phe Ser Ala Leu Val Lys His Ala Leu Glu Leu Pro

260 265 270

Leu His Trp Arg Met Val Arg Leu Glu Ala Arg Trp Phe Ile Asp Val

275 280 285

Tyr Glu Arg Gly Thr Asp Met Asn Pro Val Leu Val Glu Leu Ala Lys

290 295 300

Leu Asp Phe Asn Ser Val Gln Ala Ala His Gln Asp Glu Leu Lys Tyr

305 310 315 320

Val Ser Trp Trp Trp Arg Lys Thr Gly Leu Gly Glu Leu His Phe Ala

325 330 335

Arg Asp Arg Ile Val Glu Asn Phe Phe Trp Ala Leu Gly Glu Ile Trp

340 345 350

Glu Pro Gln Phe Gly Tyr Cys Arg Arg Met Ser Thr Lys Val Asn Ala

355 360 365

Leu Ile Thr Thr Val Asp Asp Val Tyr Asp Val Tyr Gly Thr Leu Asp

370 375 380

Glu Leu Glu Gln Phe Thr Asn Ala Val Glu Arg Trp Asp Val Asn Ala

385 390 395 400

Met Asp Gln Leu Pro Tyr Tyr Met Lys Met Cys Phe His Val Leu His

405 410 415

Ser Ser Thr Asn Glu Met Ala Phe Asp Ala Leu Lys Asp Gln Gly Val

420 425 430

His Val Val Pro Tyr Leu Lys Lys Ala Trp Ala Asp Met Cys Lys Ser

435 440 445

Phe Leu Leu Glu Ala Lys Trp Tyr Ser Ser Gly Tyr Ile Pro Thr Leu

450 455 460

Asp Glu Tyr Ile Glu Asn Ala Trp Val Ser Val Ser Gly Pro Val Ile

465 470 475 480

Leu Leu His Ala Tyr Ser Leu Ile Ala Asn Pro Ala Lys Glu Glu Ala

485 490 495

Leu Gln Phe Leu Gln Glu Tyr Pro His Ile Ile Arg Trp Pro Ser Met

500 505 510

Ile Phe Arg Leu Ala Asn Asp Leu Ala Thr Ser Ser Asp Glu Val Lys

515 520 525

Arg Gly Asp Val Pro Lys Ala Ile Gln Cys Tyr Met His Glu Thr Gly

530 535 540

Ala Ser Glu Ser Asp Ala Arg Gln His Ile Arg Asp Leu Ile Thr Ala

545 550 555 560

Ala Trp Met Lys Met Asn Asn Lys Arg Glu Gly Asp Glu Asn Pro Asp

565 570 575

His Leu Leu Leu Pro Asn Asn Phe Val Gln Phe Ala Met Asn Leu Ala

580 585 590

Arg Met Ala Gln Cys Thr Tyr Gln Asn Gly Asp Gly His Thr Val Gln

595 600 605

Asp Asn Ser Lys Asn Arg Val Leu Pro Leu Leu Ile His Pro Ile Lys

610 615 620

Ser

625

<210> 2

<211> 1878

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggctcatc aactgatgac ttcagtgcct gccttgacta gattgcagga acctagaagt 60

ttcatctcat cacttggatc acccagcatc agcaaaagca acagcaaaag caacagcaat 120

ggcttctgtg catctccaat ccaatgcatg gctgctacaa aagctcgtga caaggcaatt 180

aatgataata ggcgatcagc caattatcag ccttccatat ggagctatga ttaccttcaa 240

tctctgtcaa atggatatgc gggagaatca tgtgcccaac ggatcgaaaa gctgaaggga 300

gaagtgaggt taatgcttga caattataaa gagcttgacg attatgtgga tgcgctatat 360

tacctggaga ttgttgataa tttgcaaaga cttggagtat cttatcactt tgagggcgaa 420

attaaaagat ttctcaatag gatatacaac aagagaaaca gtcgcagaag cagtacttac 480

catgccaagg aaaatcaaga aagtttatta tatgccgcat ctcttgaatt tagactccta 540

agacaacatg gttatgatat acatgcacat ggaactcttt ctagtttcat ggatgagaag 600

gggaagttta agtcatgcct cggagacgat atcaaaggaa ttttagcatt gtatgaagct 660

gcatatcttt tgggagaaga agagagcacc atcttccatg aagctatcaa tttcacaacc 720

acacatctcg aagaatacgt gaagaagcat aatgatgatg atgatgatga tggtggatat 780

ttttcagcat tagtgaagca tgcattggaa cttcccttac actggaggat ggtaagattg 840

gaggcaaggt ggttcattga tgtatatgaa agaggaacgg acatgaaccc agttttggtc 900

gagcttgcta aactggactt taattctgtg caagcagcac accaagacga gctcaagtat 960

gtgtcttggt ggtggaggaa gacgggactt ggcgagttgc attttgcaag ggacaggata 1020

gtggaaaatt tcttctgggc tttgggggag atatgggagc ctcaatttgg atactgtaga 1080

aggatgtcca cgaaagttaa cgcattaata acgaccgttg acgatgttta tgatgtgtat 1140

ggtaccttgg atgaacttga acaattcaca aatgccgttg aaagatggga tgtcaatgcg 1200

atggatcaac ttccatacta tatgaagatg tgttttcatg ttcttcatag ttcaacaaac 1260

gaaatggctt ttgatgctct caaggatcaa ggagttcacg tcgttcctta ccttaaaaaa 1320

gcttgggcag atatgtgcaa atcttttttg ttggaggcaa aatggtacag cagcggatac 1380

ataccaaccc ttgatgaata catagagaat gcttgggttt cagtctcagg acctgtaatt 1440

ctactccatg cttattcctt gattgcaaat ccagcaaaag aggaggcctt gcaattctta 1500

caagagtacc cccatataat tcgttggcca tcaatgattt ttcgacttgc caatgacctg 1560

gcaacatcat cggatgaggt gaaaagagga gatgttccta aggcaattca atgttacatg 1620

catgaaactg gagcttcaga aagcgatgct cgtcaacaca taagagattt gatcacagca 1680

gcatggatga agatgaacaa taaaagagaa ggagatgaaa atcctgatca cttattactg 1740

cccaacaatt ttgtccagtt tgcaatgaat ctagcgagaa tggctcaatg cacataccaa 1800

aacggagatg ggcataccgt tcaagacaat agtaaaaatc gtgtattgcc attactcatt 1860

caccccataa agtcctaa 1878

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggctcatc aactgatgac 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttaggacttt atggggtgaa 20

<210> 5

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cttggtaccg agctcggatc cacaatggct catcaactga tg 42

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcggccgtta ctagtggatc cttaggactt tatggggtga 40

Claims

1. The application of the beta-ocimene synthase CsTPS in synthesizing the beta-ocimene, wherein the nucleotide sequence of the coding gene of the beta-ocimene synthase CsTPS is shown as SEQ ID NO. 2.

2. A method for synthesizing beta-ocimene is characterized by comprising the following steps: catalytic synthesis is carried out by taking geranyl pyrophosphate as substrate and utilizing beta-ocimene synthase CsTPS

The nucleotide sequence of the coding gene of the beta-ocimene synthase CsTPS is shown as SEQ ID NO. 2.