CN110117601B

CN110117601B - Grifola frondosa glucan synthase, encoding gene and application thereof

Info

Publication number: CN110117601B
Application number: CN201910429529.8A
Authority: CN
Inventors: 崔凤杰; 朱鸿安; 陶庭磊; 孙文敬; 昝新艺
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2019-01-10
Filing date: 2019-05-22
Publication date: 2023-06-30
Anticipated expiration: 2039-05-22
Also published as: CN110117602B; CN110117601A; CN110117602A; CN109609525A

Abstract

The invention belongs to the technical field of edible fungi inheritance and genetic engineering, and particularly relates to a grifola frondosa glucan synthase, a coding gene and application thereof; the invention clones the encoding gene of the key enzyme-glucan synthase for synthesizing glucan from the genome of the grifola frondosa mycelium for the first time, and proves the key role of the gene in the growth of the grifola frondosa mycelium and the glucan synthesis process through gene silencing; finally, through a genetic engineering technology, the glucan synthase is overexpressed in the grifola frondosa, so that the bacterial growth of the recombinant strain and the glucan synthesis yield are obviously improved; the invention is helpful for understanding the synthesis mechanism of the polysaccharide of the edible and medicinal fungi from the molecular level, and provides a technical scheme and guidance for improving the glucan synthesis way of the edible and medicinal fungi by utilizing the genetic engineering technology.

Description

Grifola frondosa glucan synthase, encoding gene and application thereof

Technical Field

The invention belongs to the technical field of edible fungi inheritance and genetic engineering, and particularly relates to a grifola frondosa glucan synthase, a coding gene and application thereof.

Background

The edible and medicinal fungus polysaccharide is one of the fields which are very active in research at home and abroad at present, and plays a key role in cell recognition, intercellular substance transportation, immunoregulation, anti-tumor and other important biological processes. The glucan is a polysaccharide polymerized by D-glucose through beta-1, 3 and/or beta-1, 6 glycosidic bonds, has obvious physiological functions of immunoregulation, anti-tumor, anti-aging, antivirus, blood fat reduction and the like, and is called as a biological reaction regulator.

However, the synthesis of fungal polysaccharides for edible and medicinal use is extremely complex, the substrates and enzymes involved in the synthesis are numerous, and the technical methods to be referred to are severely insufficient, so that knowledge and knowledge thereof are very limited. It was found that glucose was converted into the corresponding nucleotide sugars such as UDP-glucose, UDP-galactose, GDP-mannose and dTDP-rhamnose by various nucleotide sugar synthetases (e.g., UDP-glucose pyrophosphorylase, UDP-glucose-4-epimerase, GDP-mannose pyrophosphorylase and dTDP-glucose pyrophosphorylase) in addition to the growth requirement of the fungus body itself when used as a carbon source for fermentation of ganoderma lucidum, and presumably transported to the polysaccharide synthesis site by the glycosyltransferase to finally polymerize into mycelium polysaccharide or extracellular polysaccharide. Therefore, in order to realize efficient and stable synthesis of glucan by the edible and medicinal fungi, the function of the glucan synthesis related enzyme system needs to be clarified, and a targeted metabolic regulation means is adopted to effectively strengthen the synthesis of glucan.

Grifola frondosa (Frondosa)Grifola frondosa) Is an edible fungus rich in nutrients such as polysaccharide and protein. The existing research results show that the glucan (D-fraction) purified from the fruiting body of the grifola frondosa has remarkable anti-tumor activity, immune regulation activity and the like. It has been confirmed that monosaccharide composition and content in the mycelium polysaccharide or extracellular polysaccharide of Grifola frondosa are directly related to the activities of nucleotide sugar synthases (phosphoglucose isomerase, UDP-glucose pyrophosphorylase, UDP-glucose dehydrogenase, GDP-mannose pyrophosphorylase and UDP-glucose-4-epimerase). However, no detailed report has been made on which enzyme lines are involved in the grifola frondosa glucan synthesis pathway. No results have been searched so far regarding the molecular level of the enzyme and the synthesis mechanism related to the polysaccharide synthesis pathway of Grifola frondosa.

Disclosure of Invention

The invention aims to provide a technical means for effectively changing the synthesis amount of grifola frondosa glucan, in particular to a grifola frondosa glucan synthesis related enzyme, namely glucan synthase, and simultaneously provides a grifola frondosa glucan synthase coding gene sequence, a gene silencing and gene overexpression plasmid, a genetic engineering bacterium and a production method.

In order to realize the efficient and stable synthesis of the polysaccharide of the grifola frondosa mycelium and further improve the quality of the grifola frondosa fermentation product, the invention clones the encoding gene of the key enzyme-glucan synthase for synthesizing glucan from the genome of the grifola frondosa mycelium for the first time, and proves the key role of the gene in the growth of the grifola frondosa mycelium and the synthesis process of glucan through gene silencing; finally, through the genetic engineering technology, the glucan synthase is overexpressed in the grifola frondosa, so that the cell growth of the recombinant strain and the glucan synthesis yield are remarkably improved. The invention is helpful for understanding the synthesis mechanism of the edible and medicinal fungi polysaccharide from the molecular level, and provides important technical support and reference for developing metabolic engineering research of the edible and medicinal fungi polysaccharide synthesis and producing the dextran with stable quality by efficient fermentation.

According to the invention, the RNA interference (RNAi) technology is used for carrying out the gene silencing of the grifola frondosa glucan synthase, and the homologous recombination technology is used for carrying out the gene overexpression of the grifola frondosa glucan synthase, so that an effective solution strategy and a method are provided for understanding the synthesis mechanism of the edible and medicinal fungi polysaccharide at the molecular level and efficiently producing the immunopotentiator glucan, and the constructed recombinant strain can synthesize glucan by using substrates such as glucose, starch hydrolysate, lignocellulose and the like.

The invention firstly provides a grifola frondosa glucan synthase GFGLS, which comprises 1 complete open reading frame, and totally encodes 1781 amino acids, and the amino acid sequence is shown as SEQ ID NO. 2.

Encodes the glucan synthase (Glucan synthase of)G. frondosaGFGLS) is shown in SEQ ID No. 1.

The invention also provides the use of said grifola frondosa glucan synthase in altering the amount of glucan synthesis, said altering comprising up-regulating or down-regulating the amount of grifola frondosa polysaccharide synthesis; further, the up-regulation of the glucan synthesis amount is achieved by over-expressing a coding gene encoding a grifola frondosa glucan synthase GFGLS; the down-regulation of glucan synthesis is achieved by gene silencing of the gene encoding the grifola frondosa glucan synthase GFGLS.

The invention also provides a recombinant vector, namely an over-expression vector, comprisingThe CDS sequence (SEQ ID NO. 6) of the gene encoding the Grifola frondosa glucan synthase GFGLS is used for up-regulating the amount of Grifola frondosa glucan synthesized. The recombinant vector is prepared by amplifying a glucan synthase GFGLS coding gene sequence (SEQ ID NO. 6) and Aspergillus nidulans35sThe promoter (shown as SEQ ID NO. 6) is obtained by connecting a T4 DNA ligase with a plasmid pAN 7-1; according to one embodiment of the present invention, the gene overexpression vector is pAN7-gfgls。

The recombinant vector also comprises a gene silencing vector, wherein the vector comprises a conserved sequence (SEQ ID NO. 3) of the gene encoding the Grifola frondosa glucan synthase GFGLS and the Grifola frondosagpdPromoter (SEQ ID NO. 4) and Aspergillus nidulans35sPromoter (SEQ ID NO. 5). The recombinant vector is constructed by cloning SEQ ID NO.3 sequence, SEQ ID NO.4 sequence and SEQ ID NO.5 sequence respectively, connecting three gene fragments by overlap-PCR, carrying out enzyme digestion on plasmid pAN7-1 by BamI and HindIII, and connecting the gene fragments and the digested plasmid fragments by T4 DNA ligase to obtain the vector with the bidirectional promoter silencing glucan synthase gene conservation region. According to one embodiment of the present invention, the gene silencing vector ispAN7-gfgls-dual。

The invention also provides a recombinant engineering bacterium which comprises the gene silencing vector or the over-expression vector. The engineering bacteria are obtained by preparing a Grifola frondosa protoplast subjected to incomplete enzymolysis and transforming the protoplast by adopting an electric shock transformation method.

Wherein the preparation of the incomplete enzymolysis Maitake Mushroom protoplast is prepared by washing cultured Maitake Mushroom mycelium with 0.3-0.6-M mannitol solution, adding 0.5-4.0% lywallzyme (purchased from Guangdong microbiological institute) at 25-45 ^o And C, carrying out enzymolysis for 1-5h, centrifuging, collecting insoluble matters after enzymolysis, and filtering to obtain the product.

The electric shock transformation method transfers the gene silencing vector or the over-expression vector into protoplast, which is to transfer the gene silencing vectorpAN7-gfgls-dualOr gene overexpression vectorpAN7-gfglsMixing with Maitake Mushroom protoplast, and setting electric field strength at 0.5-3.5kVAfter electric shock for 2.0-8.0ms under the conditions of per cm, capacitance of 15-45 mu F, resistance of 200-600 omega and the like, the mixture is sequentially coated on a selective regeneration CYM culture medium (hygromycin 100 mu g/mL) and a hygromycin resistance plate, and the mixture is subjected to 28 ^o C, culturing and screening the culture medium.

The invention also provides the application of the recombinant engineering bacteria in changing the glucan synthesis amount; the altering includes up-regulating or down-regulating the amount of grifola frondosa polysaccharide synthesis.

The invention also provides a production method of high-yield grifola frondosa glucan, which adopts the grifola frondosa recombinant engineering bacterium to produce with substrates such as glucose, starch hydrolysate or lignocellulose, and the like, and comprises the following steps:

(1) Preparing a fermentation medium and a seed medium, wherein the carbon source of the fermentation medium and the seed medium is one or two of glucose, starch hydrolysate or lignocellulose, and the concentration is 5.0-100.0 g/L;

(2) Culturing the engineering bacteria, activating engineering bacteria seed liquid in a culture medium, and preparing seed culture liquid in a fermentation tank of a corresponding scale in a step-by-step amplifying manner;

(3) Inoculating the engineering bacteria seed liquid into a shake flask or a fermentation tank containing a fermentation medium in an inoculum size of 5.0% -15.0%.

The culture conditions of the fermentation tank are as follows: 20 ^o C-30 ^o C, the aeration rate is 0.5-2.0vvm, the stirring speed is 50-500 rpm, and the culture is carried out for 3-10d; the shaking conditions are as follows: 20-30 ^o C, culturing for 3-10d at the rotating speed of 80-200 rpm.

The total yield of glucan obtained by fermenting recombinant grifola frondosa by the method is more than 2.0-50.0 g/L.

The invention has the beneficial effects that:

the invention adopts the over-expression technology or gene silencing to regulate and control the synthesis of the grifola frondosa glucan for the first time. The recombinant bacteria of grifola frondosa with gene silencing has slow growth speed, and the synthesis amount and the synthesis speed of glucan are obviously reduced or even completely eliminated compared with the original strain, which proves that the glucan synthase has an irreplaceable effect in the glucan synthesis process. The recombinant Grifola frondosa strain with over-expressed gene has obviously raised glucan synthesizing amount and speed compared with that of original strain. The yield of the glucan by fermenting the gene over-expression grifola frondosa recombinant strain in a 25L fermentation tank can be improved by more than 50%, and the recombinant strain has the advantages of fast growth, low cost of culture medium, stable heredity, high yield and the like, and has obvious potential for industrial production. The invention provides a technical basis and a method guidance for improving the glucan synthesis way of the edible and medicinal fungi by utilizing a genetic engineering technology.

Drawings

FIG. 1 shows the result of the fragment cloning of the Grifola frondosa glucan synthase GFGLS gene; in the figure, M: DNA Maker,1GFGLS1Amplification product, 2GFGLS2Amplification products.

FIG. 2 shows the result of the functional domain prediction analysis of Grifola frondosa glucan synthase Dicer-Like protein 2.

FIG. 3 is a schematic diagram of the construction of a gene silencing vector for the Maitake Mushroom glucan synthase gene sequence.

FIG. 4 shows the results of the growth of the recombinant Grifola frondosa glucan synthase electrotransformation and regeneration in a medium containing 100. Mu.g/mL hygromycin.

FIG. 5 comparison of the results of the growth of recombinant strains with Maitake Mushroom glucan synthase gene silencing and gene overexpression on PDB plates.

FIG. 6 results of glucan synthase gene silencing and gene overexpression of Grifola frondosa recombinant bacteria in 25-L fermentors to synthesize glucan; in the figure, GF-WT: a control strain; GF-o-gfgls: over-expressing recombinant bacteria; g-i-gfgls: recombinant bacteria for gene silencing).

Detailed Description

The following examples are provided to further illustrate the practice of the present invention, and the plasmids, PCR reagents, etc., used in the following examples are commercially available, and the specific procedures are as described herein. Embodiments of the invention are not limited thereto and other non-specified experimental operations and process parameters are performed in accordance with conventional techniques.

The dextran determination method in the embodiment of the invention comprises the following steps: collecting Maitake Mushroom fermented mash, passing 10000 timesgCentrifuging to collect supernatant, concentrating, and precipitating with 95% ethanol at volume ratio of 1:3; 10000gCentrifuging to collect the alcohol precipitate, and vacuum drying at 50deg.C to constant weightI.e. the weight of glucan produced and recorded.

The method for measuring the monosaccharide composition in the glucan comprises the following steps: the dextran sample produced by 30 mg was weighed and 3 mL of 72% H was added ₂ SO ₄ ，30 ^o C water bath for 60 min, adding 8.4. 8.4 mL distilled water, and adding water at 121 ^o After 1h of reaction C, the pH of the calcium carbonate is adjusted to be neutral, 8000g of the calcium carbonate is centrifugally collected, and the supernatant is rotationally evaporated to dryness. Weighing the hydrolyzed sample, sequentially adding 1 mg internal standard inositol, 10 mg hydroxylamine hydrochloride and 1.0 mL pyridine, 90 ^o C water bath for 30 min, cooling to room temperature, adding 1.0 mL acetic anhydride, 90 ^o C, continuing the water bath for 30 min to obtain the sugar nitrile acetate derivatives of all the standard monosaccharides; accurately weighing 1 mg of each of the six monosaccharides, adding the same reagent, reacting according to the steps to obtain the sugar nitrile acetate derivative of the mixed standard monosaccharide, filtering with a 0.22 mu m microporous filter membrane, and performing GC analysis under the gas chromatographic analysis conditions: 7890A gas chromatograph, capillary column, FID detector, agilent company, usa. Sample inlet temperature 280 ^o C, detector temperature 300 ^o C, column incubator initial temperature 130 ^o C, holding for 5min, 4 ^o C/min to 240 ^o C, maintaining for 5min, and the split ratio is 40:1, sample injection amount is 1 mu L. And determining the types of the monosaccharides according to the retention time of the sample, calculating the percentage content of each monosaccharide by adopting an internal standard method, and determining the monosaccharide composition and the content in the produced glucan sample.

The grifola frondosa glucan synthase GFGLS referred to in this example comprises 1 complete open reading frame, which codes for 1781 amino acids in total, the amino acid sequence is shown in SEQ ID NO. 2.

The saidGFGLSThe cDNA sequence of the gene is shown as SEQ ID NO. 6; the sequence of the glucan synthase gene conserved sequence and the sequences of the gram Long Hui flowers gpd promoter and the aspergillus nidulans 35s promoter are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

EXAMPLE 1 cloning of the Gene encoding Maitake Mushroom glucan synthase

Grifola frondosa GF02 (purchased from American type culture Collection, american type culture collection, ATCC No. 60301 ™) cultured mycelia was collected by centrifugation, rapidly ground to a fine powder by adding liquid nitrogen, and the genome was extracted by a plant or fungal genome extraction kit.

Because the coding gene sequence of the grifola frondosa extracellular glucan synthase is relatively long, the whole sequence fragment is difficult to amplify, the gene sequence is divided into two sections (named GFGLS1 and GFGLS2 are given) according to the subunit sequence in the disclosed coding gene (Genbank ID: MK 808019) of the grifola frondosa extracellular glucan synthase, and primers are designed for amplifying and splicing, and the amplification steps are respectively as follows:

GFGLS1-F(SEQ ID NO .7)： 5'-acagaagggtctgcaccttaa-3'，

GFGLS1-R (SEQ ID No. 8): 5'-gtatatgtcgtggagatctatagg-3'; and

GFGLS2-F(SEQ ID NO .9)： 5'-ccgtaagagaaacgcacataga-3'，

GFGLS2-R(SEQ ID NO .10)：5'-tgcagagcacaaataacacataac-3'；

the whole length of the gene is amplified by using the published genome of grifola frondosa (GenBank assembly accession:GCA_ 001683735.1) as a template and adopting the primer, and the PCR reaction procedure is as follows: 94. pre-denaturing at the temperature of 3 min; 94. denaturation at 20℃ 20 s, annealing at 30 s, annealing at 52℃and extension at 72℃for a period determined by the length of the gene of interest, 35 cycles of reaction; separating PCR amplified product by 1% agarose gel electrophoresis, recovering target gene fragment (shown in figure 1) by agarose gel DNA recovery kit, sequencing, and splicing to obtain gene sequence, wherein the total length of the gene is 5927bp, the gene comprises 1 complete open reading frame, total 1781 amino acids, BLAST comparison is carried out in NCBI, and the gene sequence is confirmed to be the gene sequence for encoding the grifola frondosa glucan synthase, and is named as grifola frondosa glucan synthase genegfgls。

The comparison shows that the obtained grifola frondosa glucan synthase genegfglsSubunit in the Gene encoding the disclosed Grifola frondosa extracellular glucan synthase (Genbank ID: MK 808019)fks-1-1(GenBank ID: MK 256944) and subunitfks-1-0The homology of the combination of (GenBank ID: MK 256943) fragments was 98%, and the homology with the glucan synthase of Polyporus pseudoporous/Coriolus versicolor reached 90.60% and 90.32%, respectively. Further toAnalysis of Grifola frondosa extracellular glucan synthase encoding Genefks-1-1Andfks-1-0location on chromosome, findingfks-1-1Andfks-1-0on the same chromosome (number 2F), wherefks-1-1Located at 2F:284008-287973,fks-1-0located at 2F:288022-289929, sequence front-to-back interval 49 bp. Again takefks-1-1Andfks-1-0complete sequence on genome (2F: 284008-289929) was re-analyzed using FGENESH software using coriolus versicolor glucan synthase encoding gene as templatefks-1-1Andfks-1-0introns and exons of the complete sequence on the chromosome, NCBI pairs were foundfks-1-1Andfks-1-0in (2) an error exists in the analysis of introns and exons, wherein the ligationfks-1-1Andfks-1-049 bp of (2) belong to the exon part requiring transcription to amino acids. Thus, the grifola frondosa glucan synthase gene of the present invention was obtainedgfgls。

The cultured and collected Grifola frondosa GF02 mycelia were rapidly ground into powder in liquid nitrogen to extract total RNA. According to RACE technique, TAKARA 3' -FULL RACE Core Set V2.0 kit (Takara Code: D314) was used and specific primer 3RACE1 (SEQ ID NO. 11) was designed: 5'-ttctgggtatccatcctcgc-3',3RACE2 (SEQ ID NO. 12:5 '-gatacccagaagtaggtca-3'), using cDNA reverse transcribed from total RNA of Grifola frondosa as a template, PCR amplification to obtain a 3'cDNA specific fragment of the GFGLS gene, using TAKARA 5' -FULL RACE Kit (Takara Code: D315) Kit and designing specific primers 5RACE1 (SEQ ID NO. 13): 5'-cccatcagttctcttttgcg-3', 5RACE2 (SEQ ID NO. 14): 5'-aagaagaagaggctcgggca-3', removing the cap reaction, ligation of 5'RACE adapter and cDNA after reverse transcription reaction as a template, PCR amplification to obtain a 5' cDNA specific fragment of the GFGLS gene, and splicing to obtain the complete cDNA sequence of the GFGLS gene, see SEQ ID NO. 6.

Example 2: construction of Gene silencing vector pAN7-gfgls-dual

Based on the published whole gene sequence of Grifola frondosa (GenBank assembly accession:GCA_ 001683735.1), two Dicer-Like amino acid sequences (GenBank:OBZ 75102.1 and OBZ 68881.1) were found to exist in the Grifola frondosa genome, and further Dicer-Like protein 2 was analyzed by NCBI conserved functional domain prediction, resulting in FIG. 2, the Grifola frondosa Dicer-Like protein contains three functional domains: HELICc, dicer_dimer, and RIBOc, encodes 1438 amino acids and has homology of 95% or more with other species, indicating that Maitake Mushroom has typical RNAi-related enzyme, and is likely to have gene silencing.

The gene sequence of Maitake Mushroom glucan synthase cloned in example 1GFGLS) And designing an overlap-PCR upstream primer and a downstream primer according to the homologous region, wherein the primers are respectively as follows:

GFGLS-F (SEQ ID NO .15)：5'- cgtcatttgtacccaccagtgcgccatccataaggtcct -3'，

GFGLS-R(SEQ ID NO .16)：5' –tccgtagccgtgccgaaatcgacgatgagggcaacgaag -3'。

PCR amplification Using the Grifola frondosa cDNA obtained in example 1 as a templateGFGLSThe conserved region (SEQ ID NO. 3), the full length of which is 453 bp, is located on the conserved region 5363 bp-5814 bp of the Grifola frondosa GFGLS gene sequence, and encodes 151 amino acid residues in total.

According to grifola frondosagpdGene sequence (GenBank: A0H21_ 05461), GPD promoter overlap-PCR primer was designed as follows:

GPD-F(SEQ ID NO .17)：5'-cgggatcccgttcgcattacacacattg-3'；

GPD-R(SEQ ID NO .18)：5'- caggaccttatggatggcgcactggtgggtacaaatgacg -3'。

the target gene (SEQ ID NO. 4) was amplified by PCR using the genomic DNA of Grifola frondosa obtained in example 1 as a template.

Based on the Aspergillus nidulans 35s promoter sequence in plasmid pAN7-1 (available from Hunan Feng Hui Biotechnology Co., ltd.), 35s promoter overlap-PCR primers were designed, respectively:

35s -F(SEQ ID NO .19)：5'- tcttcgttgccctcatcgtcaaagctgcctaccagggact -3'；

35s -R(SEQ ID NO .20)：5'-ggggtaccactggtgggtacaaatgacg-3'。

the gene of interest (SEQ ID NO. 5) was amplified by PCR using plasmid pAN7-1 as a template.

Respectively using grifola frondosa glucan synthase genesGFGLSConserved region, maitake MushroomgpdThe gene promoter and the Aspergillus nidulans 35s promoter were ligated by using overlap-PCR, and the plasmid pAN7-1 andGPD-GFGLS-35SBamHI and HindIII cleavage was performed. Vector for obtaining bidirectional promoter silent glucan synthase gene conserved region by passing each enzyme digestion product through T4 DNA ligasepAN7-gfgls-dual(the schematic diagram of vector construction is shown in FIG. 3).

Example 3: incomplete enzymolysis for preparing Maitake Mushroom protoplast

Collecting mycelium obtained by PDA liquid culture of Maitake Mushroom, treating under aseptic condition for 1min with tissue pulverizer, inoculating into 100mL PDB culture medium at 10% inoculum size, 28 ^o C after 4d of stationary culture, 5000gCentrifuging for 15min to collect insoluble substances; washing with 0.6M mannitol solution for 2 times, adding 1mL 2% filamentous fungus wall breaking enzyme solution, 30 ^o And C, performing enzymolysis for 4 hours. Mixing the enzymolysis solution with 5000gCentrifuging for 15min, collecting insoluble substances, and performing aseptic filtration to obtain zymolytic protoplast; the prepared protoplast is added into 50mL of regenerated CYM culture medium (glucose 20g peptone 2g yeast extract 2g magnesium sulfate heptahydrate 0.5g dipotassium hydrogen phosphate 1.0g monopotassium phosphate 0.46g agar 20g, hygromycin 100 mu g/mL) and mixed evenly, poured into a flat plate and 28 ^o C, culturing and regenerating.

Example 4: grifola frondosa glucan synthase gene silencing recombinant strain GF i-gfglsConstruction of (3)

10. Mu.g of plasmid was takenpAN7-1AndpAN7-gfgls-dualrespectively mixing with 1mL of the suspension of the grifola frondosa protoplast, placing in an electrorotating cup, and electrorotating for 1min under the following conditions: electric shock for 4ms under the conditions of electric field strength of 2.5kV/cm, capacitance of 25 mu F, resistance of 400 omega and the like, pouring the mixture into a selective regeneration CYM culture medium (hygromycin 100 mu g/mL) and a hygromycin resistance plate, and carrying out 28 ^o C, culturing and screening to obtain Grifola frondosa glucan gene silencing recombinant bacterium GF i-gfgls under the condition, wherein as shown in figure 4, protoplast prepared from a Grifola frondosa starting strain is inhibited from regenerating in a hygromycin resistance plate with a concentration of 100 mug/mL; the empty vector carrying hygromycin resistance gene and the silencing transformant are transferred into protoplast and then cultured at 28 ℃ for 10dAll can be regenerated; the regeneration capacity and growth rate of the gene silencing recombinant strain GF i-gfgls in hygromycin resistance plates are obviously slowed down. As shown in FIG. 5, the mycelia of the gene silencing recombinant strain GF i-gfgls on the PDA plate are fine and tender, and part of the mycelia are transparent, so that the growth rate is remarkably reduced, which indicates that the growth of the Maitake Mushroom mycelia is slowed down due to the silencing of the glucan synthase gene.

Example 5: construction of vector pAN7 for overexpression of glucan synthase Genegfgls

Similar to example 2, the primers for the upstream and downstream of Grifola frondosa glucan synthase GFGLS were designed based on the homologous region:

GFGLS-F (SEQ ID NO .21)：5'-cccaagcttatggccggtcgctctgg-3'，

GFGLS-R(SEQ ID NO .22)：5'-ggggtacctcagacctgttggcaaatgct-3'。

PCR amplification using Grifola frondosa cDNA as template to obtain target geneGFGLS。

35s -F(SEQ ID NO .19)：5'- tcttcgttgccctcatcgtcaaagctgcctaccagggact -3'；

35s -R(SEQ ID NO .20)：5'-ggggtaccactggtgggtacaaatgacg-3'。

Will respectivelygfglsThe BamH I and Xba I digestion is carried out, the Aspergillus nidulans 35s promoter is carried out Xba I and Hind III digestion, the plasmid pAN7-1 is carried out BamH I and Hind III digestion, each digestion product is converted into E.coli Top10 through T4 DNA ligase, and PCR verification and sequencing verification are carried out, thus obtaining the glucan synthase gene overexpression vector pAN7-gfgls。

Example 6: construction of recombinant Grifola frondosa GF-o-gfgls overexpressed by glucan synthase genes

10 μg of the overexpression vector pAN7-gfglsAnd 1mL of the suspension of the grifola frondosa protoplast is placed in an electrorotating cup, and is electrorotated after being placed for 1min, wherein the electrorotating conditions are as follows: the electric field strength is3.0kV/cm, electric shock under the conditions of 20 mu F capacitance, 450 omega resistance and the like for 5ms, and then putting the electric shock on a selective regeneration CYM culture medium (hygromycin 100 mu g/mL) and a hygromycin resistance plate, 28 ^o C, culturing and screening to obtain the grifola frondosa glucan over-expression recombinant strain GF-o-gfgls. As shown in FIG. 5, the recombinant strain GF-o-gfglsHyphae on the PDA plate are multi-layer compact, and the top part is highly branched, so that the growth rate is obviously improved.

Example 6: production of glucan by fermentation of recombinant Grifola frondosa GF-i-gfgls and GF-o-gfgls 25-L using glucose as carbon source

(1) Slant Medium (g/L): potato 200, glucose 20, peptone 5, KH ₂ PO ₄ 1.5，MgSO ₄ ·7H ₂ O0.75, pH is natural. The culture medium is used for preserving and activating strains.

The primary seed culture medium is (g/L): glucose 20, peptone 5, KH ₂ PO ₄ 1.5，MgSO ₄ ·7H ₂ O0.75, pH is natural.

The secondary seed culture medium is (g/L): glucose 30, peptone 6, KH ₂ PO ₄ 3，MgSO ₄ ·7H ₂ O1.5, pH is natural.

(2) The fermentation medium is (g/L): glucose 60, peptone 6, KH ₂ PO ₄ 6，MgSO ₄ ·7H ₂ O1, soybean oil 50mL, pH was natural.

(3) Cutting fresh recombinant fungus mycelium blocks of 5 mm ×5 mm, placing on slant culture medium, and adding at 28 ^o C, culturing in a constant temperature incubator for 5d.

Primary and secondary seed media were prepared separately. 10 recombinant fungus blocks 5 mm multiplied by 5 mm are inoculated, the liquid loading amount is 75/250 mL,28 ^o C. Shaking culture at 150 rpm for 3d to obtain first-stage seed liquid. Inoculating the first seed solution into the second seed culture medium with an inoculum size of 10% (v/v), a liquid loading amount of 150/500 mL, and a shaking table (28) ^o C,150 rpm) for 3d to obtain a secondary seed solution.

(4) Inoculating the cultured secondary seed solution into 25L fermentation tank with 10% of inoculation amount, 60% of liquid loading amount, and controlling temperature to 28% ^o C, culturing for 7d, controlling the stirring speed and aeration rate to be 90rpm and 0.8vvm respectively. Fermenting and mixing for every 24 hr to obtain 10000gCentrifuging for 10 min to obtain Maitake Mushroom mycelium precipitate, repeatedly washing thallus with distilled water, freeze drying, and weighing to calculate mycelium dry weight; the supernatant was precipitated with concentrated ethanol, dried, weighed to calculate the amount of glucan, and the monosaccharide composition of the glucan sample was measured. After 6d fermentation, the original grifola frondosa strain WT has a thallus quantity of 23.4g/L and an extracellular glucan yield of 1.03g/L; the thallus quantity of the Grifola frondosa glucan synthase gene silencing recombinant bacterium GF i-gfgls is only 5 g/L, the glucan yield is 0.4g/L, and the glucose composition is more than 98%; whereas the glucan synthase gene overexpressing strain GF o-gfglsThe cell amount of (a) was increased to 33.2 g/L, the glucan amount was 1.7g/L, and the glucose composition was 99% or more (as shown in FIG. 6). This also indicates that gene silencing or overexpression of the major subunits of glucan synthase has a direct and significant impact on both grifola frondosa mycelium growth and glucan synthesis.

Sequence listing

<110> university of Jiangsu

<120> Maitake mushroom glucan synthase, coding gene and use thereof

<150> 201910022178.9

<151> 2019-01-10

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5927

<212> DNA

<213> Grifola frondosa (Grifola frondosa)

<400> 1

atggccggtc gctctggtcc acgaagccag gagggcatgt atgtctcctc gtctccgtct 60

tcagaccccc acgatccctt cagcaacgtc cacgcacaaa tgcccgagcc ccagaggtac 120

tacgacaacg actctgacca gatagataat tacggtcggc gcgacaccta tggctcggat 180

ggcagtaatg gaggaaacga cgacgatcgt tattatgacc acaacggcgc ctacgatccg 240

tatggccgtg agtgcctttt cctcatgttt ccattctctg tgagcttagt ttcccccagc 300

acaacccgac accgactcgg acgtcgatgt ttacggtcag aagtatgccc cctcagcgga 360

gtctcttggc cctcctcgcg tgggcgtctc agagtcctcc accccgactt tcattgatca 420

caatggttcc ggcgggcgag agccataccc agcttggagt tccgagcgcc aaattccact 480

atcgaaggag gagatcgagg acatcttcct ggaccttacg cagaagtttg gttttcagcg 540

ggattccatg cggaacatgg tatgcttctg ggtgaaagct atctgggttg aattcttaca 600

caagtcttta gttcgacttt acgatgcagc tactggatag tcgcgcctcg cgcatgtcgc 660

ctaatcaggc tctcctcact ttgcatgctg attacatcgg tggccagcac gcaaattacc 720

gcaagtggta cttcgctgcc cagctggatc tcgacgacgc tattggacag acacaaaacc 780

ccggtttaag gtctacaaag cgcaagggac acaaggccgt ggaaaagtcc ctgaacatcg 840

ctctggaccg atggcggcag gccatgaaca acatgagcca gtacgacagg atgcgacaga 900

tcgcactata tctcctttgc tggggcgaag ctgcgcaggt gcgatttgtc ccagaatgcc 960

tatgtttcat cttcaagtgt gcagacgact actaccgatc gccggagtgc cagagtcgga 1020

tagatcccgt gccagaaggc ctgtacttgc atgccgtcat caagcccctg tacaggttta 1080

ttcgcgacca aggttacgag gtagtcgatg ggaagtttgt ccgacgggag aaggaccatg 1140

acacaattat cgggtacgac gatgtgaacc agctattttg gtatccggag ggcatcgctc 1200

gaattgtcct cgcggacaag gtatgccgtc tgacatatac ttttctggtg ttactcatgc 1260

catctacgta tacagacacg actggtcgac ttggcaccag cgcaacgttt catgaaattt 1320

gaccggatcg actggaaccg tgcattcttt aagacgtact atgagaaacg atctttcggc 1380

cacttgcttg tgaactttaa caggatatgg gtcattcatg tgtccatgta ctggtactac 1440

acggcttaca actcaccaac cgtctacaat ggcatcaggt caacagcgat gcgatggtcg 1500

gcaactgcgc tcggaggcgc agttgccact gtgatcatga tcttggcgac gctcgccgaa 1560

ttttcgtaca ttccgacaac atggaacaat acctcgcatc tcactcgacg tctcattttc 1620

ctcgccatta cccttgccct cacggccggt cccacgtttt acatcgcgat cgccgagagc 1680

agctctcccg gcggctcgtt ggccctcatt ctcggcattg tccaattttt catctcggtc 1740

gtcgcgacgc tgctgttcgc gttcctgccc tctggacgca tgttcggcga tagggtggcc 1800

ggcaagtctc ggaagtatct ggcaagtcag acgttcacgg ccagctaccc gacgctgaag 1860

gcatcagcac ggctggcttc cgtgtgcctc tggattctcg tcttcggctg caagttcacc 1920

gaatcgtact ttttcctcac gcaatccttc aaaaacccca tcttggtcat ggtgggcatg 1980

aagatccagg gatgcaatga caagtacttc ggagacaatc tgtgtcgcaa ccaggcggcg 2040

ttcacgctga cgatcatgta cctgatggat ctcgttctgt tctttttgga caccttcttg 2100

tggtggatca tctggaatac tgtctttagt atcgcccgat cattcatgct tggattatcg 2160

atatggacac cttggaagga tatctatacg cgcctgccta agcgaattta ctcaaagttg 2220

ctggcgacct cagatatgga gacaaagtac aagccaaagg tcagtgaacc gtctacagat 2280

agagccatct aacgtgaacg tattgcaggt gctggtgtct caaatctgga acgcgatcat 2340

catctcaatg taccgtgaac acttgctctc catcgaccac gtgcaaaagt tgttgtatca 2400

tcaggtcgac gctggccaag acggacgtcg cagccttaga gcacctcctt tcttcatctc 2460

gcagagcgac aagggcttca agggcgagtt cttcactcct ggcagcgaag cagagcggcg 2520

gatatcattc ttcgcgcagt cgcttacgac ggctgttccg gaaccgttac ccgtcgatgc 2580

gatgccgaca tttaccgtgc tgacacccca ttacagcgag aaggtaagcg gtactcgtat 2640

tcgtcttgat ggaggttcat gtgtcctttg tagatcctgc tctcgcttag ggagatcatt 2700

agagaggagg accagaacac ccgagtaacg ttgctggaat acctcaagca gttgcatcct 2760

gtcgagtggg ataatttcgt caaggacacg aagattctcg cggaagagtc tgctatgtac 2820

aacggaccca gtccattcgg cactgacgag aaaggacagt ccaagactga cgacctaccg 2880

ttctactgca tcggcttcaa gtccgccgca cccgagttta ctcttcgtac gcgtatatgg 2940

gcctcgctcc gtgcacagac gctctatcgc acagtatcgg gcatgatgaa ctattcgaag 3000

gcgatcaaac tgttgtaccg tgttgagaac cccgaagtcg tacagctctt tggaggcaac 3060

accgacaaac tcgagcggga actcgagcgt atggcacggc gcaagttcaa gtttgtcgtc 3120

tctatgcagc ggtactccaa gttcaaccgg gaagaacaag agaacgccga atttctactt 3180

cgtgcatatc cggacctgca aatcgcgtat ctcgaagagg aacccgcgcg caaggagggc 3240

ggtgaccctc gtctgttctc cgcgctgatc gacggccact cggagttcat caacgaaagt 3300

ggccgccgtc gacccaagtt ccgcatcgag cttcctggta accccattct cggagacgga 3360

aagtccgaca accagaatca cgctatcatt ttctaccgcg gcgagtatct ccagctcatc 3420

gatgcgaatc aggacaacta ccttgaggaa tgtctcaaga tccgtaacgt acttggcgaa 3480

ttcgaggagt actcagtctc gagccagagc ccgtacgcac aatggggcca caaggacttc 3540

aagaaatccc ccattgccat cgtcggtgcg cgcgagtata tcttctcgga aaatatcggc 3600

attctcggtg atctcgcggc cggaaaggaa cagacattcg gtaccctcac cgcgcggtcg 3660

ttggcatgga ttggcggcaa gctgcattat ggccaccccg atttcctcaa cgcgctgtac 3720

atgaccaccc gtggcggtgt ctcgaaggcg cagaagggtc tgcaccttaa cgaggatatc 3780

tacgctggaa tgacggcgtt cgggcgcgga ggtcgcatca agcacacaga gtactatcag 3840

tgcggtaaag gtcgcgacct cggctttggc acgatcctca acttccagac gaagatcggc 3900

acgggtatgg gcgagcagat gctcagtcgg gaatactact acctcggcac gcagctcccg 3960

attgatcgtt tcctcacttt ctactatggg catcctgggt tccacatcaa taacatgctt 4020

gtcatcctgt ccgttcagat attcattgtg acgagtaagt gttatgtgtt atttgtgctc 4080

tgcatggtgc ttatgaattt gattcgcagt ggttttcttg gggacgttga acgaccagct 4140

gctcgtctgc aagtattcct cttcgggcca gtttatcggt acaacaggat gctacaatct 4200

cactcctgcg ttccagtgga tcgaccattg catcatcagt attttcttgg tatttatgat 4260

tgcatacctc cccctgttcc tacaaggtac gtcgaagtgt catgattata acgtccaatt 4320

cgataaccgt aattccgcag agcttgttga gcgtggaact ggcaaagctg tatttcgact 4380

ggcgaagcac ttcggttcgg cgtctcctgc gttcgaagtg ttctcgacac agatctcttc 4440

tcattcaatt atcaccaact tgactttcgg aggtgcaaga tacatcgcca ccggccgtgg 4500

cttcgcgacg acgagaattt catttagcat cctatactcg agatttgcgg ggccaagtat 4560

ctatctcggg atgaggacat tgattatgtt gttatatgtg actctgacca tctggacggg 4620

ttgggtgacc tacttctggg tatccatcct cgctttgtgc atttcgccgt tcctcttcaa 4680

tccccatcag ttctcttttg cggactttat cattgactac aggtaagcta gaattgtaga 4740

cctaatcgtt cacgtcacta acttgaattc cagggagttc ttgcggtgga tgaaccgcgg 4800

caactcgcgc gtacaccaga actcttggat tggctattgc cggttatcac ggactatgat 4860

tacaggctac aagaagaaga ggctcgggca tccttcagag aaattgtcgg gtgacgtccc 4920

gcgtgcgggc tggcgagcgg tcttgttctc ggaggtcatc ttccccatcg tgatggccac 4980

cctgttcgtc atcgcataca tgctcgtgaa gtcgttcccg gacaaggatg ggaagcaacc 5040

gcccagcccc ctcattcgaa tcgcaatcgt atctcttggg ccgattgttt ggaatgctgc 5100

gatattgctc gtcctgttca tgttctcgct tttccttgga ccgatgctcg acacaccgtt 5160

ccccaagttc ggatcattga tggctttcct tgggcactcg ctcggtgtca tcggcatgat 5220

cgcattcttc gagttcctcg taagtcgtct caccttatct atttcttgac atcgctcact 5280

ttccgcggca catagtggtt cctcgagctg tggaacgtcg cacacgccgt gctcggtctg 5340

atcgcagtca tcttcattca gcgcgccatc cataaggtcc tgatttcggt gttcctgtcg 5400

cgcgagttca agcatgacga gacgaaccgg gcgtggtgga caggtaaatg gtacggccgc 5460

gggctgggct cgcacgcgat gtcacagcct gcacgagagt tcatcgtgaa gatcatcgag 5520

ctgtcgctgt ggagctcaga tttcctcact ggccacctat tgctcttctt gttgacaccg 5580

ccaatcctca taccgtactt cgaccggcta cactcgacga tgctctgtga gtagctatgc 5640

tatgatttat gctaatgatg ttactgatat cgagtctgca gtctggttga ggccgtcaaa 5700

acaaatccgc gcaccgttgt attccatcaa gcagaagcgg caacgtcggt ggattgtcat 5760

caagtatggt gctgtctacg tgctcgcgat cggcatcttc gttgccctca tcgtcatccg 5820

tgggtattgc tcatctgtat ggtgtcattg ttgctcatcc cgcccatgta gcgctcgtct 5880

tccggcaatc gctgaccttc aactgcagca tttgccaaca ggtctga 5927

<210> 2

<211> 1781

<212> PRT

<213> Grifola frondosa (Grifola frondosa)

<400> 2

Met Ala Gly Arg Ser Gly Pro Arg Ser Gln Glu Gly Met Tyr Val Ser

1 5 10 15

Ser Ser Pro Ser Ser Asp Pro His Asp Pro Phe Ser Asn Val His Ala

20 25 30

Gln Met Pro Glu Pro Gln Arg Tyr Tyr Asp Asn Asp Ser Asp Gln Ile

35 40 45

Asp Asn Tyr Gly Arg Arg Asp Thr Tyr Gly Ser Asp Gly Ser Asn Gly

50 55 60

Gly Asn Asp Asp Asp Arg Tyr Tyr Asp His Asn Gly Ala Tyr Asp Pro

65 70 75 80

Tyr Gly Pro Gln Pro Asp Thr Asp Ser Asp Val Asp Val Tyr Gly Gln

85 90 95

Lys Tyr Ala Pro Ser Ala Glu Ser Leu Gly Pro Pro Arg Val Gly Val

100 105 110

Ser Glu Ser Ser Thr Pro Thr Phe Ile Asp His Asn Gly Ser Gly Gly

115 120 125

Arg Glu Pro Tyr Pro Ala Trp Ser Ser Glu Arg Gln Ile Pro Leu Ser

130 135 140

Lys Glu Glu Ile Glu Asp Ile Phe Leu Asp Leu Thr Gln Lys Phe Gly

145 150 155 160

Phe Gln Arg Asp Ser Met Arg Asn Met Phe Asp Phe Thr Met Gln Leu

165 170 175

Leu Asp Ser Arg Ala Ser Arg Met Ser Pro Asn Gln Ala Leu Leu Thr

180 185 190

Leu His Ala Asp Tyr Ile Gly Gly Gln His Ala Asn Tyr Arg Lys Trp

195 200 205

Tyr Phe Ala Ala Gln Leu Asp Leu Asp Asp Ala Ile Gly Gln Thr Gln

210 215 220

Asn Pro Gly Leu Arg Ser Thr Lys Arg Lys Gly His Lys Ala Val Glu

225 230 235 240

Lys Ser Leu Asn Ile Ala Leu Asp Arg Trp Arg Gln Ala Met Asn Asn

245 250 255

Met Ser Gln Tyr Asp Arg Met Arg Gln Ile Ala Leu Tyr Leu Leu Cys

260 265 270

Trp Gly Glu Ala Ala Gln Val Arg Phe Val Pro Glu Cys Leu Cys Phe

275 280 285

Ile Phe Lys Cys Ala Asp Asp Tyr Tyr Arg Ser Pro Glu Cys Gln Ser

290 295 300

Arg Ile Asp Pro Val Pro Glu Gly Leu Tyr Leu His Ala Val Ile Lys

305 310 315 320

Pro Leu Tyr Arg Phe Ile Arg Asp Gln Gly Tyr Glu Val Val Asp Gly

325 330 335

Lys Phe Val Arg Arg Glu Lys Asp His Asp Thr Ile Ile Gly Tyr Asp

340 345 350

Asp Val Asn Gln Leu Phe Trp Tyr Pro Glu Gly Ile Ala Arg Ile Val

355 360 365

Leu Ala Asp Lys Thr Arg Leu Val Asp Leu Ala Pro Ala Gln Arg Phe

370 375 380

Met Lys Phe Asp Arg Ile Asp Trp Asn Arg Ala Phe Phe Lys Thr Tyr

385 390 395 400

Tyr Glu Lys Arg Ser Phe Gly His Leu Leu Val Asn Phe Asn Arg Ile

405 410 415

Trp Val Ile His Val Ser Met Tyr Trp Tyr Tyr Thr Ala Tyr Asn Ser

420 425 430

Pro Thr Val Tyr Asn Gly Ile Arg Ser Thr Ala Met Arg Trp Ser Ala

435 440 445

Thr Ala Leu Gly Gly Ala Val Ala Thr Val Ile Met Ile Leu Ala Thr

450 455 460

Leu Ala Glu Phe Ser Tyr Ile Pro Thr Thr Trp Asn Asn Thr Ser His

465 470 475 480

Leu Thr Arg Arg Leu Ile Phe Leu Ala Ile Thr Leu Ala Leu Thr Ala

485 490 495

Gly Pro Thr Phe Tyr Ile Ala Ile Ala Glu Ser Ser Ser Pro Gly Gly

500 505 510

Ser Leu Ala Leu Ile Leu Gly Ile Val Gln Phe Phe Ile Ser Val Val

515 520 525

Ala Thr Leu Leu Phe Ala Phe Leu Pro Ser Gly Arg Met Phe Gly Asp

530 535 540

Arg Val Ala Gly Lys Ser Arg Lys Tyr Leu Ala Ser Gln Thr Phe Thr

545 550 555 560

Ala Ser Tyr Pro Thr Leu Lys Ala Ser Ala Arg Leu Ala Ser Val Cys

565 570 575

Leu Trp Ile Leu Val Phe Gly Cys Lys Phe Thr Glu Ser Tyr Phe Phe

580 585 590

Leu Thr Gln Ser Phe Lys Asn Pro Ile Leu Val Met Val Gly Met Lys

595 600 605

Ile Gln Gly Cys Asn Asp Lys Tyr Phe Gly Asp Asn Leu Cys Arg Asn

610 615 620

Gln Ala Ala Phe Thr Leu Thr Ile Met Tyr Leu Met Asp Leu Val Leu

625 630 635 640

Phe Phe Leu Asp Thr Phe Leu Trp Trp Ile Ile Trp Asn Thr Val Phe

645 650 655

Ser Ile Ala Arg Ser Phe Met Leu Gly Leu Ser Ile Trp Thr Pro Trp

660 665 670

Lys Asp Ile Tyr Thr Arg Leu Pro Lys Arg Ile Tyr Ser Lys Leu Leu

675 680 685

Ala Thr Ser Asp Met Glu Thr Lys Tyr Lys Pro Lys Val Leu Val Ser

690 695 700

Gln Ile Trp Asn Ala Ile Ile Ile Ser Met Tyr Arg Glu His Leu Leu

705 710 715 720

Ser Ile Asp His Val Gln Lys Leu Leu Tyr His Gln Val Asp Ala Gly

725 730 735

Gln Asp Gly Arg Arg Ser Leu Arg Ala Pro Pro Phe Phe Ile Ser Gln

740 745 750

Ser Asp Lys Gly Phe Lys Gly Glu Phe Phe Thr Pro Gly Ser Glu Ala

755 760 765

Glu Arg Arg Ile Ser Phe Phe Ala Gln Ser Leu Thr Thr Ala Val Pro

770 775 780

Glu Pro Leu Pro Val Asp Ala Met Pro Thr Phe Thr Val Leu Thr Pro

785 790 795 800

His Tyr Ser Glu Lys Ile Leu Leu Ser Leu Arg Glu Ile Ile Arg Glu

805 810 815

Glu Asp Gln Asn Thr Arg Val Thr Leu Leu Glu Tyr Leu Lys Gln Leu

820 825 830

His Pro Val Glu Trp Asp Asn Phe Val Lys Asp Thr Lys Ile Leu Ala

835 840 845

Glu Glu Ser Ala Met Tyr Asn Gly Pro Ser Pro Phe Gly Thr Asp Glu

850 855 860

Lys Gly Gln Ser Lys Thr Asp Asp Leu Pro Phe Tyr Cys Ile Gly Phe

865 870 875 880

Lys Ser Ala Ala Pro Glu Phe Thr Leu Arg Thr Arg Ile Trp Ala Ser

885 890 895

Leu Arg Ala Gln Thr Leu Tyr Arg Thr Val Ser Gly Met Met Asn Tyr

900 905 910

Ser Lys Ala Ile Lys Leu Leu Tyr Arg Val Glu Asn Pro Glu Val Val

915 920 925

Gln Leu Phe Gly Gly Asn Thr Asp Lys Leu Glu Arg Glu Leu Glu Arg

930 935 940

Met Ala Arg Arg Lys Phe Lys Phe Val Val Ser Met Gln Arg Tyr Ser

945 950 955 960

Lys Phe Asn Arg Glu Glu Gln Glu Asn Ala Glu Phe Leu Leu Arg Ala

965 970 975

Tyr Pro Asp Leu Gln Ile Ala Tyr Leu Glu Glu Glu Pro Ala Arg Lys

980 985 990

Glu Gly Gly Asp Pro Arg Leu Phe Ser Ala Leu Ile Asp Gly His Ser

995 1000 1005

Glu Phe Ile Asn Glu Ser Gly Arg Arg Arg Pro Lys Phe Arg Ile Glu

1010 1015 1020

Leu Pro Gly Asn Pro Ile Leu Gly Asp Gly Lys Ser Asp Asn Gln Asn

1025 1030 1035 1040

His Ala Ile Ile Phe Tyr Arg Gly Glu Tyr Leu Gln Leu Ile Asp Ala

1045 1050 1055

Asn Gln Asp Asn Tyr Leu Glu Glu Cys Leu Lys Ile Arg Asn Val Leu

1060 1065 1070

Gly Glu Phe Glu Glu Tyr Ser Val Ser Ser Gln Ser Pro Tyr Ala Gln

1075 1080 1085

Trp Gly His Lys Asp Phe Lys Lys Ser Pro Ile Ala Ile Val Gly Ala

1090 1095 1100

Arg Glu Tyr Ile Phe Ser Glu Asn Ile Gly Ile Leu Gly Asp Leu Ala

1105 1110 1115 1120

Ala Gly Lys Glu Gln Thr Phe Gly Thr Leu Thr Ala Arg Ser Leu Ala

1125 1130 1135

Trp Ile Gly Gly Lys Leu His Tyr Gly His Pro Asp Phe Leu Asn Ala

1140 1145 1150

Leu Tyr Met Thr Thr Arg Gly Gly Val Ser Lys Ala Gln Lys Gly Leu

1155 1160 1165

His Leu Asn Glu Asp Ile Tyr Ala Gly Met Thr Ala Phe Gly Arg Gly

1170 1175 1180

Gly Arg Ile Lys His Thr Glu Tyr Tyr Gln Cys Gly Lys Gly Arg Asp

1185 1190 1195 1200

Leu Gly Phe Gly Thr Ile Leu Asn Phe Gln Thr Lys Ile Gly Thr Gly

1205 1210 1215

Met Gly Glu Gln Met Leu Ser Arg Glu Tyr Tyr Tyr Leu Gly Thr Gln

1220 1225 1230

Leu Pro Ile Asp Arg Phe Leu Thr Phe Tyr Tyr Gly His Pro Gly Phe

1235 1240 1245

His Ile Asn Asn Met Leu Val Ile Leu Ser Val Gln Ile Phe Ile Val

1250 1255 1260

Thr Met Val Phe Leu Gly Thr Leu Asn Asp Gln Leu Leu Val Cys Lys

1265 1270 1275 1280

Tyr Ser Ser Ser Gly Gln Phe Ile Gly Thr Thr Gly Cys Tyr Asn Leu

1285 1290 1295

Thr Pro Ala Phe Gln Trp Ile Asp His Cys Ile Ile Ser Ile Phe Leu

1300 1305 1310

Val Phe Met Ile Ala Tyr Leu Pro Leu Phe Leu Gln Glu Leu Val Glu

1315 1320 1325

Arg Gly Thr Gly Lys Ala Val Phe Arg Leu Ala Lys His Phe Gly Ser

1330 1335 1340

Ala Ser Pro Ala Phe Glu Val Phe Ser Thr Gln Ile Ser Ser His Ser

1345 1350 1355 1360

Ile Ile Thr Asn Leu Thr Phe Gly Gly Ala Arg Tyr Ile Ala Thr Gly

1365 1370 1375

Arg Gly Phe Ala Thr Thr Arg Ile Ser Phe Ser Ile Leu Tyr Ser Arg

1380 1385 1390

Phe Ala Gly Pro Ser Ile Tyr Leu Gly Met Arg Thr Leu Ile Met Leu

1395 1400 1405

Leu Tyr Val Thr Leu Thr Ile Trp Thr Gly Trp Val Thr Tyr Phe Trp

1410 1415 1420

Val Ser Ile Leu Ala Leu Cys Ile Ser Pro Phe Leu Phe Asn Pro His

1425 1430 1435 1440

Gln Phe Ser Phe Ala Asp Phe Ile Ile Asp Tyr Arg Glu Phe Leu Arg

1445 1450 1455

Trp Met Asn Arg Gly Asn Ser Arg Val His Gln Asn Ser Trp Ile Gly

1460 1465 1470

Tyr Cys Arg Leu Ser Arg Thr Met Ile Thr Gly Tyr Lys Lys Lys Arg

1475 1480 1485

Leu Gly His Pro Ser Glu Lys Leu Ser Gly Asp Val Pro Arg Ala Gly

1490 1495 1500

Trp Arg Ala Val Leu Phe Ser Glu Val Ile Phe Pro Ile Val Met Ala

1505 1510 1515 1520

Thr Leu Phe Val Ile Ala Tyr Met Leu Val Lys Ser Phe Pro Asp Lys

1525 1530 1535

Asp Gly Lys Gln Pro Pro Ser Pro Leu Ile Arg Ile Ala Ile Val Ser

1540 1545 1550

Leu Gly Pro Ile Val Trp Asn Ala Ala Ile Leu Leu Val Leu Phe Met

1555 1560 1565

Phe Ser Leu Phe Leu Gly Pro Met Leu Asp Thr Pro Phe Pro Lys Phe

1570 1575 1580

Gly Ser Leu Met Ala Phe Leu Gly His Ser Leu Gly Val Ile Gly Met

1585 1590 1595 1600

Ile Ala Phe Phe Glu Phe Leu Trp Phe Leu Glu Leu Trp Asn Val Ala

1605 1610 1615

His Ala Val Leu Gly Leu Ile Ala Val Ile Phe Ile Gln Arg Ala Ile

1620 1625 1630

His Lys Val Leu Ile Ser Val Phe Leu Ser Arg Glu Phe Lys His Asp

1635 1640 1645

Glu Thr Asn Arg Ala Trp Trp Thr Gly Lys Trp Tyr Gly Arg Gly Leu

1650 1655 1660

Gly Ser His Ala Met Ser Gln Pro Ala Arg Glu Phe Ile Val Lys Ile

1665 1670 1675 1680

Ile Glu Leu Ser Leu Trp Ser Ser Asp Phe Leu Thr Gly His Leu Leu

1685 1690 1695

Leu Phe Leu Leu Thr Pro Pro Ile Leu Ile Pro Tyr Phe Asp Arg Leu

1700 1705 1710

His Ser Thr Met Leu Phe Trp Leu Arg Pro Ser Lys Gln Ile Arg Ala

1715 1720 1725

Pro Leu Tyr Ser Ile Lys Gln Lys Arg Gln Arg Arg Trp Ile Val Ile

1730 1735 1740

Lys Tyr Gly Ala Val Tyr Val Leu Ala Ile Gly Ile Phe Val Ala Leu

1745 1750 1755 1760

Ile Val Ile Pro Leu Val Phe Arg Gln Ser Leu Thr Phe Asn Cys Ser

1765 1770 1775

Ile Cys Gln Gln Val

1780

<210> 3

<211> 453

<212> DNA

<213> Grifola frondosa (Grifola frondosa)

<400> 3

gcgccatcca taaggtcctg atttcggtgt tcctgtcgcg cgagttcaag catgacgaga 60

cgaaccgggc gtggtggaca ggtaaatggt acggccgcgg gctgggctcg cacgcgatgt 120

cacagcctgc acgagagttc atcgtgaaga tcatcgagct gtcgctgtgg agctcagatt 180

tcctcactgg ccacctattg ctcttcttgt tgacaccgcc aatcctcata ccgtacttcg 240

accggctaca ctcgacgatg ctctgtgagt agctatgcta tgatttatgc taatgatgtt 300

actgatatcg agtctgcagt ctggttgagg ccgtcaaaac aaatccgcgc accgttgtat 360

tccatcaagc agaagcggca acgtcggtgg attgtcatca agtatggtgc tgtctacgtg 420

ctcgcgatcg gcatcttcgt tgccctcatc gtc 453

<210> 4

<211> 966

<212> DNA

<213> Grifola frondosa (Grifola frondosa)

<400> 4

tcgggatccc cgtcgcatta cacacattgt tcgaacatgt acagagagtt tgacagacaa 60

aacagtaaca cttgtttcga gagagacgct cgtagctaaa cccgatgtcc gaagaggacc 120

ctccccacgc gagtccgcaa gatgaatgcg acagttggtt gccacgagca cagagagcgg 180

caaataccct cgagtcatcg tacggagctt gtcaatccag caaatgtaca cgagcatggc 240

aggatccaat cgtaattagg tggctgagat ctgaccaccg agaatgtgcg ccctagggga 300

tgagtaaacg cacgtttgcg cgtgaatcag cgatgatgct gtacggtggt gcttagagat 360

acgaaaagtt gcaagtgaac gtaaatggag gaaagggact ggttgggaat attcatgaca 420

agctggctag aacaagtcgg aaatctagtc tgaggcaaag ccaccagcgg agagccgttc 480

gcggccttgc ggtgacagtc gggcaacggc cggaagctgc ccggtgtaat catccatctt 540

agataacgat caccacccca ccctataaga cccctctcca tctctgctct tctccccatc 600

cttcgtctcc aaaaccatta tcctcagcaa tgccagtgag tcctgcagac aatctgcatc 660

gtcttcgagc atccgtctca cccgtggttt tcacaggtca aggtcggaat caacgggtgc 720

gtcggctgtg ggtgtgtgaa cgttcagact gattaatacc gtttctcgtg tcgccctact 780

ccagcttcgg taagaacttg catatttgct ggcttcgccg tgctcacggc agtgtgtagg 840

tcgcattggc cgtattgtgc tccgtaatgc tctcctcaac cccgaaatcg aggtcgtcgc 900

tgtgaacgag tgcgtattag ttgatcccca cccaatctcc actgacgtca tttgtaccca 960

ccagta 966

<210> 5

<211> 977

<212> DNA

<213> Aspergillus nidulans (Aspergillus nidulans)

<400> 5

gatttcggca cggctacgga agacggagaa gccaccttca gtggactcga gtaccattta 60

attctatttg tgtttgatcg agacctaata cagcccctac aacgaccatc aaagtcgtat 120

agctaccagt gaggaagtgg actcaaatcg acttcagcaa catctcctgg ataaacttta 180

agcctaaact atacagaata agataggtgg agagcttata ccgagctccc aaatctgtcc 240

agatcatggt tgaccggtgc ctggatcttc ctatagaatc atccttattc gttgacctag 300

ctgattctgg agtgacccag agggtcatga cttgagccta aaatccgccg cctccaccat 360

ttgtagaaaa atgtgacgaa ctcgtgagct ctgtacagtg accggtgact ctttctggca 420

tgcggagaga cggacggacg cagagagaag ggctgagtaa taagccactg gccagacagc 480

tctggcggct ctgaggtgca gtggatgatt attaatccgg gaccggccgc ccctccgccc 540

cgaagtggaa aggctggtgt gcccctcgtt gaccaagaat ctattgcatc atcggagaat 600

atggagcttc atcgaatcac cggcagtaag cgaaggagaa tgtgaagcca ggggtgtata 660

gccgtcggcg aaatagcatg ccattaacct aggtacagaa gtccaattgc ttccgatctg 720

gtaaaagatt cacgagatag taccttctcc gaagtaggta gagcgagtac ccggcgcgta 780

agctccctaa ttggcccatc cggcatctgt agggcgtcca aatatcgtgc ctctcctgct 840

ttgcccggtg tatgaaaccg gaaaggccgc tcaggagctg gccagcggcg cagaccggga 900

acacaagctg gcagtcgacc catccggtgc tctgcactcg acctgctgag gtccctcagt 960

ccctggtagg cagcttt 977

<210> 6

<211> 5346

<212> DNA

<213> Grifola frondosa (Grifola frondosa)

<400> 6

atggccggtc gctctggtcc acgaagccag gagggcatgt atgtctcctc gtctccgtct 60

tcagaccccc acgatccctt cagcaacgtc cacgcacaaa tgcccgagcc ccagaggtac 120

tacgacaacg actctgacca gatagataat tacggtcggc gcgacaccta tggctcggat 180

ggcagtaatg gaggaaacga cgacgatcgt tattatgacc acaacggcgc ctacgatccg 240

tatggcccac aacccgacac cgactcggac gtcgatgttt acggtcagaa gtatgccccc 300

tcagcggagt ctcttggccc tcctcgcgtg ggcgtctcag agtcctccac cccgactttc 360

attgatcaca atggttccgg cgggcgagag ccatacccag cttggagttc cgagcgccaa 420

attccactat cgaaggagga gatcgaggac atcttcctgg accttacgca gaagtttggt 480

tttcagcggg attccatgcg gaacatgttc gactttacga tgcagctact ggatagtcgc 540

gcctcgcgca tgtcgcctaa tcaggctctc ctcactttgc atgctgatta catcggtggc 600

cagcacgcaa attaccgcaa gtggtacttc gctgcccagc tggatctcga cgacgctatt 660

ggacagacac aaaaccccgg tttaaggtct acaaagcgca agggacacaa ggccgtggaa 720

aagtccctga acatcgctct ggaccgatgg cggcaggcca tgaacaacat gagccagtac 780

gacaggatgc gacagatcgc actatatctc ctttgctggg gcgaagctgc gcaggtgcga 840

tttgtcccag aatgcctatg tttcatcttc aagtgtgcag acgactacta ccgatcgccg 900

gagtgccaga gtcggataga tcccgtgcca gaaggcctgt acttgcatgc cgtcatcaag 960

cccctgtaca ggtttattcg cgaccaaggt tacgaggtag tcgatgggaa gtttgtccga 1020

cgggagaagg accatgacac aattatcggg tacgacgatg tgaaccagct attttggtat 1080

ccggagggca tcgctcgaat tgtcctcgcg gacaagacac gactggtcga cttggcacca 1140

gcgcaacgtt tcatgaaatt tgaccggatc gactggaacc gtgcattctt taagacgtac 1200

tatgagaaac gatctttcgg ccacttgctt gtgaacttta acaggatatg ggtcattcat 1260

gtgtccatgt actggtacta cacggcttac aactcaccaa ccgtctacaa tggcatcagg 1320

tcaacagcga tgcgatggtc ggcaactgcg ctcggaggcg cagttgccac tgtgatcatg 1380

atcttggcga cgctcgccga attttcgtac attccgacaa catggaacaa tacctcgcat 1440

ctcactcgac gtctcatttt cctcgccatt acccttgccc tcacggccgg tcccacgttt 1500

tacatcgcga tcgccgagag cagctctccc ggcggctcgt tggccctcat tctcggcatt 1560

gtccaatttt tcatctcggt cgtcgcgacg ctgctgttcg cgttcctgcc ctctggacgc 1620

atgttcggcg atagggtggc cggcaagtct cggaagtatc tggcaagtca gacgttcacg 1680

gccagctacc cgacgctgaa ggcatcagca cggctggctt ccgtgtgcct ctggattctc 1740

gtcttcggct gcaagttcac cgaatcgtac tttttcctca cgcaatcctt caaaaacccc 1800

atcttggtca tggtgggcat gaagatccag ggatgcaatg acaagtactt cggagacaat 1860

ctgtgtcgca accaggcggc gttcacgctg acgatcatgt acctgatgga tctcgttctg 1920

ttctttttgg acaccttctt gtggtggatc atctggaata ctgtctttag tatcgcccga 1980

tcattcatgc ttggattatc gatatggaca ccttggaagg atatctatac gcgcctgcct 2040

aagcgaattt actcaaagtt gctggcgacc tcagatatgg agacaaagta caagccaaag 2100

gtgctggtgt ctcaaatctg gaacgcgatc atcatctcaa tgtaccgtga acacttgctc 2160

tccatcgacc acgtgcaaaa gttgttgtat catcaggtcg acgctggcca agacggacgt 2220

cgcagcctta gagcacctcc tttcttcatc tcgcagagcg acaagggctt caagggcgag 2280

ttcttcactc ctggcagcga agcagagcgg cggatatcat tcttcgcgca gtcgcttacg 2340

acggctgttc cggaaccgtt acccgtcgat gcgatgccga catttaccgt gctgacaccc 2400

cattacagcg agaagatcct gctctcgctt agggagatca ttagagagga ggaccagaac 2460

acccgagtaa cgttgctgga atacctcaag cagttgcatc ctgtcgagtg ggataatttc 2520

gtcaaggaca cgaagattct cgcggaagag tctgctatgt acaacggacc cagtccattc 2580

ggcactgacg agaaaggaca gtccaagact gacgacctac cgttctactg catcggcttc 2640

aagtccgccg cacccgagtt tactcttcgt acgcgtatat gggcctcgct ccgtgcacag 2700

acgctctatc gcacagtatc gggcatgatg aactattcga aggcgatcaa actgttgtac 2760

cgtgttgaga accccgaagt cgtacagctc tttggaggca acaccgacaa actcgagcgg 2820

gaactcgagc gtatggcacg gcgcaagttc aagtttgtcg tctctatgca gcggtactcc 2880

aagttcaacc gggaagaaca agagaacgcc gaatttctac ttcgtgcata tccggacctg 2940

caaatcgcgt atctcgaaga ggaacccgcg cgcaaggagg gcggtgaccc tcgtctgttc 3000

tccgcgctga tcgacggcca ctcggagttc atcaacgaaa gtggccgccg tcgacccaag 3060

ttccgcatcg agcttcctgg taaccccatt ctcggagacg gaaagtccga caaccagaat 3120

cacgctatca ttttctaccg cggcgagtat ctccagctca tcgatgcgaa tcaggacaac 3180

taccttgagg aatgtctcaa gatccgtaac gtacttggcg aattcgagga gtactcagtc 3240

tcgagccaga gcccgtacgc acaatggggc cacaaggact tcaagaaatc ccccattgcc 3300

atcgtcggtg cgcgcgagta tatcttctcg gaaaatatcg gcattctcgg tgatctcgcg 3360

gccggaaagg aacagacatt cggtaccctc accgcgcggt cgttggcatg gattggcggc 3420

aagctgcatt atggccaccc cgatttcctc aacgcgctgt acatgaccac ccgtggcggt 3480

gtctcgaagg cgcagaaggg tctgcacctt aacgaggata tctacgctgg aatgacggcg 3540

ttcgggcgcg gaggtcgcat caagcacaca gagtactatc agtgcggtaa aggtcgcgac 3600

ctcggctttg gcacgatcct caacttccag acgaagatcg gcacgggtat gggcgagcag 3660

atgctcagtc gggaatacta ctacctcggc acgcagctcc cgattgatcg tttcctcact 3720

ttctactatg ggcatcctgg gttccacatc aataacatgc ttgtcatcct gtccgttcag 3780

atattcattg tgacgatggt tttcttgggg acgttgaacg accagctgct cgtctgcaag 3840

tattcctctt cgggccagtt tatcggtaca acaggatgct acaatctcac tcctgcgttc 3900

cagtggatcg accattgcat catcagtatt ttcttggtat ttatgattgc atacctcccc 3960

ctgttcctac aagagcttgt tgagcgtgga actggcaaag ctgtatttcg actggcgaag 4020

cacttcggtt cggcgtctcc tgcgttcgaa gtgttctcga cacagatctc ttctcattca 4080

attatcacca acttgacttt cggaggtgca agatacatcg ccaccggccg tggcttcgcg 4140

acgacgagaa tttcatttag catcctatac tcgagatttg cggggccaag tatctatctc 4200

gggatgagga cattgattat gttgttatat gtgactctga ccatctggac gggttgggtg 4260

acctacttct gggtatccat cctcgctttg tgcatttcgc cgttcctctt caatccccat 4320

cagttctctt ttgcggactt tatcattgac tacagggagt tcttgcggtg gatgaaccgc 4380

ggcaactcgc gcgtacacca gaactcttgg attggctatt gccggttatc acggactatg 4440

attacaggct acaagaagaa gaggctcggg catccttcag agaaattgtc gggtgacgtc 4500

ccgcgtgcgg gctggcgagc ggtcttgttc tcggaggtca tcttccccat cgtgatggcc 4560

accctgttcg tcatcgcata catgctcgtg aagtcgttcc cggacaagga tgggaagcaa 4620

ccgcccagcc ccctcattcg aatcgcaatc gtatctcttg ggccgattgt ttggaatgct 4680

gcgatattgc tcgtcctgtt catgttctcg cttttccttg gaccgatgct cgacacaccg 4740

ttccccaagt tcggatcatt gatggctttc cttgggcact cgctcggtgt catcggcatg 4800

atcgcattct tcgagttcct ctggttcctc gagctgtgga acgtcgcaca cgccgtgctc 4860

ggtctgatcg cagtcatctt cattcagcgc gccatccata aggtcctgat ttcggtgttc 4920

ctgtcgcgcg agttcaagca tgacgagacg aaccgggcgt ggtggacagg taaatggtac 4980

ggccgcgggc tgggctcgca cgcgatgtca cagcctgcac gagagttcat cgtgaagatc 5040

atcgagctgt cgctgtggag ctcagatttc ctcactggcc acctattgct cttcttgttg 5100

acaccgccaa tcctcatacc gtacttcgac cggctacact cgacgatgct cttctggttg 5160

aggccgtcaa aacaaatccg cgcaccgttg tattccatca agcagaagcg gcaacgtcgg 5220

tggattgtca tcaagtatgg tgctgtctac gtgctcgcga tcggcatctt cgttgccctc 5280

atcgtcatcc cgctcgtctt ccggcaatcg ctgaccttca actgcagcat ttgccaacag 5340

gtctga 5346

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

acagaagggt ctgcacctta a 21

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gtatatgtcg tggagatcta tagg 24

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ccgtaagaga aacgcacata ga 22

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tgcagagcac aaataacaca taac 24

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ttctgggtat ccatcctcgc 20

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gatacccaga agtaggtca 19

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

cccatcagtt ctcttttgcg 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

aagaagaaga ggctcgggca 20

<210> 15

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

cgtcatttgt acccaccagt gcgccatcca taaggtcct 39

<210> 16

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

tccgtagccg tgccgaaatc gacgatgagg gcaacgaag 39

<210> 17

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

cgggatcccg ttcgcattac acacattg 28

<210> 18

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

caggacctta tggatggcgc actggtgggt acaaatgacg 40

<210> 19

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

tcttcgttgc cctcatcgtc aaagctgcct accagggact 40

<210> 20

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

ggggtaccac tggtgggtac aaatgacg 28

<210> 21

<211> 26

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

cccaagctta tggccggtcg ctctgg 26

<210> 22

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

ggggtacctc agacctgttg gcaaatgct 29

Claims

1. The gene silencing expression vector of the grifola frondosa glucan synthase gene sequence is characterized by comprising a grifola frondosa gpd gene promoter sequence shown as SEQ ID No.4, an aspergillus nidulans 35s promoter sequence shown as SEQ ID No.5 and a grifola frondosa glucan synthase gene conserved sequence shown as SEQ ID No. 3.

2. A recombinant engineering bacterium comprising the gene silencing expression vector of claim 1.

3. A method for reducing the synthesis amount of grifola frondosa glucan, which is characterized by adopting the recombinant engineering bacterium of claim 2.

4. A method according to claim 3, characterized in that it is produced from a substrate such as glucose, starch hydrolysate or lignocellulose, comprising the steps of:

(2) Culturing the recombinant engineering bacteria of claim 2, activating engineering bacteria seed liquid in a culture medium, and preparing seed culture liquid in a fermentation tank of a corresponding scale in a step-by-step amplification manner;