CN117025421A

CN117025421A - Recombinant strain for producing abscisic acid and construction method and application thereof

Info

Publication number: CN117025421A
Application number: CN202310933156.4A
Authority: CN
Inventors: 黄和; 施天穹; 王伶如; 聂志奎
Original assignee: Jiangxi New Reyphon Biochemical Co ltd; Nanjing Normal University
Current assignee: Jiangxi New Reyphon Biochemical Co ltd; Nanjing Normal University
Priority date: 2023-07-26
Filing date: 2023-07-26
Publication date: 2023-11-10

Abstract

The invention relates to a microbial gene modification technology, and discloses a recombinant strain for producing abscisic acid, a construction method and application thereof. The recombinant strain is obtained by genetic modification of an original strain, and compared with the original strain, the recombinant strain has the advantages that the activity of HMG-CoA reductase is enhanced and the hemoglobin VHB is expressed; wherein, the recombinant strain contains the coding amino acid sequence shown in SEQ ID NO:1 and the coding amino acid sequence of the HMG-CoA reductase is shown as SEQ ID NO:2, and a gene of hemoglobin VHB. The method for producing abscisic acid by fermentation comprises the following steps: inoculating the recombinant strain into an acidogenic fermentation medium for fermentation culture. The recombinant strain can be used for efficiently and stably fermenting and producing the abscisic acid, and has the advantages of higher yield and lower fermentation cost.

Description

Recombinant strain for producing abscisic acid and construction method and application thereof

Technical Field

The invention relates to a microorganism gene modification technology, in particular to a recombinant strain for producing abscisic acid, a construction method and application thereof.

Background

Abscisic acid (Abscisic acid) is an important plant hormone which is widely used in higher plants, plays an important role in regulating the growth and development of plants, and can improve the tolerance of the plants to various biotic or abiotic stresses, such as the enhancement of drought resistance, disease and pest resistance, cold resistance and the like of crops, thereby improving the quality and yield of the crops. In addition, abscisic acid has also been found in metazoan and mammals, and it has been shown that abscisic acid not only regulates blood sugar and inflammation, but also has good therapeutic effects on obesity, diabetes, atherosclerosis and inflammatory diseases in animals. Therefore, abscisic acid has great potential as a nutritional health product and a medicine. With the intensive research on the action mechanism and application technology of the abscisic acid, the market of practical preparations of the abscisic acid is gradually opened, and great economic and social benefits are brought.

At present, the existing strain still has the problems of low substrate conversion rate, insufficient supply rate of precursor substances for synthesizing the abscisic acid and the like, and limits the output of the abscisic acid. The production of abscisic acid has been studied in a manner of adding a key substrate during fermentation, for example, CN102399827a discloses a new species of botrytis cinerea and acetyl-coa, a precursor substance of abscisic acid, is added in a flow manner during fermentation to promote the synthesis of abscisic acid, but acetyl-coa is relatively expensive and is disadvantageous in cost saving. During the growth and metabolism of microorganisms, oxygen acts as a substrate for cellular respiration, and is involved in the late oxidation process of cellular energy metabolism and product synthesis. The appropriate oxygen supply may improve dissolved oxygen concentration and provide the necessary oxidizing power for the cell, thereby promoting hyphal growth and product synthesis. However, in the fermentation process of filamentous fungi such as botrytis cinerea, the thalli grow in a filamentous form, and more grease byproducts lead to very viscous fermentation liquor, and partial oxygen supply is insufficient, so that the fermentation liquor becomes one of main factors for limiting the biosynthesis of abscisic acid. Therefore, finding a method for improving the oxygen uptake capacity of microorganisms in an oxygen-deficient environment is a problem to be solved in the current abscisic acid fermentation production.

Disclosure of Invention

The invention aims to solve the problem of limited yield in the fermentation production of abscisic acid in the prior art, and provides a recombinant strain for producing abscisic acid, a construction method and application thereof.

In order to achieve the above object, a first aspect of the present invention provides a recombinant strain for producing abscisic acid, which is obtained by genetic engineering of a starting strain, has an enhanced HMG-CoA reductase activity and expresses hemoglobin VHB as compared to the starting strain; wherein, the recombinant strain contains the coding amino acid sequence shown in SEQ ID NO:1 and the coding amino acid sequence of the HMG-CoA reductase is shown as SEQ ID NO:2, and a gene of hemoglobin VHB.

Preferably, the nucleotide sequence of the gene encoding HMG-CoA reductase is shown in SEQ ID NO: 3.

Preferably, the nucleotide sequence of the gene encoding hemoglobin VHB is as set forth in SEQ ID NO: 4.

Preferably, the starting strain is Botrytis cinerea.

In a second aspect, the present invention provides a method for constructing a recombinant strain producing abscisic acid, the method comprising: genetically engineering the starting strain to enhance HMG-CoA reductase activity of the starting strain and express hemoglobin VHB; wherein, the mode of enhancing the activity of HMG-CoA reductase of the starting strain is overexpression of the HMG-CoA reductase of which the coded amino acid sequence is shown as SEQ ID NO:1, the gene of HMG-CoA reductase; the way of expressing the hemoglobin VHB by the original strain is to exogenously introduce a coding amino acid sequence shown as SEQ ID NO:2, and a gene of hemoglobin VHB.

Preferably, the starting strain is Botrytis cinerea.

In a third aspect, the invention provides the use of a recombinant strain as described above or a method as described above in the preparation of abscisic acid.

In a fourth aspect, the present invention provides a method for fermentatively producing abscisic acid, the method comprising: inoculating the recombinant strain into an acidogenic fermentation medium for fermentation culture;

alternatively, the recombinant strain is constructed according to the above method, and the obtained recombinant strain is inoculated into an acidogenic fermentation medium for fermentation culture.

Preferably, the recombinant strain is inoculated into the acidogenic fermentation medium in the form of a seed solution.

Preferably, the preparation process of the seed liquid comprises the following steps: and inoculating single colonies of the recombinant strain into a seed culture medium for seed culture.

Preferably, the seed medium contains: glucose 20-30g/L, wheat bran 70-90g/L, magnesium sulfate 0.5-1.5g/L, monopotassium phosphate 0.5-1.5g/L, and ammonium nitrate 0.3-1g/L.

Preferably, the seed culture conditions include at least: the temperature is 20-25 ℃, the rotating speed is 150-200rpm, and the time is 48-72h.

Preferably, the acidogenic fermentation medium contains: glucose 20-30g/L, yeast extract 5-15g/L, wheat bran 70-90g/L, magnesium sulfate 0.5-1.5g/L, potassium dihydrogen phosphate 0.5-1.5g/L, vitamin B ₁ 0.02-0.06mg/L。

Preferably, the conditions of the fermentation culture include at least: the inoculation amount is 4-8 vol%, the temperature is 20-25 ℃, the rotating speed is 150-200rpm, and the time is 150-200h.

Through the technical scheme, the invention has the beneficial effects that:

the recombinant strain provided by the invention can improve the supply of acetyl coenzyme A precursor by enhancing the expression of key speed-limiting enzyme HMG-CoA reductase in an endogenous mevalonate pathway, and introduce exogenous hemoglobin VHB gene, so that the dissolved oxygen level in the fermentation process is obviously enhanced, the strain can more effectively utilize nutrient substances to synthesize abscisic acid in the later stage of fermentation, the two are mutually synergistic, the synthesis pathway of the abscisic acid is enhanced, the production capacity of the abscisic acid is obviously improved, the production capacity of the abscisic acid produced by fermenting the recombinant strain is high, the cost is low, and the recombinant strain can be applied to large-scale abscisic acid production.

Drawings

FIG. 1 is a plasmid map of pHPH-HMGR recombinant vector in example 1;

FIG. 2 is a plasmid map of pHPH-VHB recombinant vector in example 2;

FIG. 3 is a plasmid map of pHPH-HMGR-VHB recombinant vector in example 3;

FIG. 4 is a graph showing the content of abscisic acid in fermentation broths of each of the recombinant strain and the starting strain in example 4;

FIG. 5 is a graph showing the content of abscisic acid in fermentation broth at the time of subculture of recombinant strain B.cinerea-OE: HMGROE: VHB in example 5.

Detailed Description

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

The terms "increase", "increase" or "enhancement" as used herein generally mean a statistically significant amount of increase. However, for the avoidance of doubt, the terms "increase", "enhance" or "activation" mean an increase of at least 10% from a reference level (e.g. the level in the starting strain), for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including an increase of 100%, or any amount between 10% and 100% from the reference level; or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any amount between 2-fold and 10-fold increase, or a greater amount increase, from a reference level.

In a first aspect, the present invention provides a recombinant strain for producing abscisic acid, obtained by genetic engineering of a starting strain, having an increased HMG-CoA reductase (HMGR) activity and expressing hemoglobin VHB as compared to the starting strain.

The recombinant strain provided by the invention can enhance the expression of the key speed-limiting enzyme HMGR in an endogenous mevalonic acid pathway, improve the supply of acetyl coenzyme A precursor, and exogenously introduce the gene for expressing hemoglobin VHB, so that the dissolved oxygen level in the fermentation process is obviously enhanced, the strain can more effectively utilize nutrient substances to synthesize the abscisic acid in the later stage of fermentation, the two are mutually synergistic, and the synthesis pathway of the abscisic acid is enhanced, thereby obviously improving the production capacity of the abscisic acid, and the recombinant strain has high production rate and low cost of the abscisic acid produced by fermentation and can be applied to large-scale abscisic acid production.

According to the invention, preferably, the starting strain is Botrytis cinerea. Specifically, the starting strain is Botrytis cinerea (CGMCC No.3.4582, and is purchased from China general microbiological culture collection center).

According to the present invention, in order to increase the productivity of abscisic acid in the recombinant strain, it is preferable that the recombinant strain contains a polypeptide having an amino acid sequence as shown in SEQ ID NO:1 and the coding amino acid sequence of the HMG-CoA reductase is shown as SEQ ID NO:2, and a gene of hemoglobin VHB. Further preferably, the nucleotide sequence of the gene encoding HMG-CoA reductase is as shown in SEQ ID NO:3 is shown in the figure; the gene for encoding the hemoglobin VHB is derived from Vitreoscilla (Vitreoscilla), and the nucleotide sequence of the gene is shown in SEQ ID NO: 4.

In a second aspect, the present invention provides a method for constructing a recombinant strain producing abscisic acid, the method comprising: the starting strain is genetically engineered so that the HMG-CoA reductase activity of the starting strain is enhanced and the hemoglobin VHB is expressed.

According to the invention, preferably, the starting strain is Botrytis cinerea.

According to the present invention, the activity of HMG-CoA reductase of the starting strain is preferably enhanced by over-expression of the amino acid sequence encoded by SEQ ID NO:1, the gene of HMG-CoA reductase; the way of expressing the hemoglobin VHB by the original strain is to exogenously introduce a coding amino acid sequence shown as SEQ ID NO:2, and a gene of hemoglobin VHB.

In the invention, the overexpression of the gene encoding HMG-CoA reductase and the exogenous introduction of the gene encoding hemoglobin VHB in the original strain can be realized by randomly integrating genes, wherein the random integration of the genes is realized by randomly integrating target genes into a genome by using a screening marker.

In the present invention, a recombinant vector capable of introducing additional copies of the gene encoding HMG-CoA reductase and the gene encoding exogenously hemoglobin VHB into an original strain (e.g., botrytis cinerea) can be constructed first. Various methods are known in the art for constructing recombinant vectors for ligating a gene fragment of interest into an expression vector to prepare the recombinant vector, such as, but not limited to, classical "digestion-ligation" methods, gateway cloning systems developed by Invitrogen, creator cloning systems developed by Clontech, unicator cloning systems developed by Stephen Elledge laboratories, and Golden Gate cloning methods based on type IIs restriction enzymes (such as those provided by ThermoFisher under the name GeneArt Type IIs Assembly Kits kit).

For example, recombinant vectors of the invention can be constructed using recombinant enzyme methods: the gene sequence expression cassette to be inserted is ligated to a vector to obtain a recombinant vector, but the present invention is not limited thereto.

Subsequently, the recombinant vector may be introduced into an original strain by a method conventional in the art (e.gBotrytis cinerea) such as, but not limited to, microinjection, gene gun, transformation (e.g., electrotransformation), infection, or transfection. Microinjection, gene gun, transformation, infection or transfection are all routine procedures in the art. For example, transformation refers to the manipulation of cells by some known methods in molecular biology and genetic engineering, such that the manipulated cells are rendered competent and thereby contacted with exogenous DNA, thereby allowing the exogenous DNA to enter the competent cells. Common transformation methods include protoplast transformation, chemical transformation, and electroporation transformation; infection refers to the use of an artificially modified phage live virus as a vector, the recombinant DNA sequence of the vector and the target DNA sequence are recombined, and the recombinant DNA is packaged into a viable phage or virus in vitro by using the coat protein of the phage or virus, so that the recombinant DNA enters host cells in an infectious manner; transfection is by CaCl ₂ Methods such as electroporation treat cells into competent cells, which are then subjected to recombinant phage DNA.

After introducing the recombinant vector into an original strain (e.g., botrytis cinerea), positive clones can be selected by a selection marker (e.g., a resistance gene) and verified by genomic PCR or by sequencing genomic DNA to obtain the recombinant strain producing abscisic acid.

According to the present invention, preferably, the nucleotide sequence of the gene encoding HMG-CoA reductase is as shown in SEQ ID NO:3, the nucleotide sequence comprises an intron; preferably, the nucleotide sequence of the gene encoding hemoglobin VHB is as set forth in SEQ ID NO: 4.

The fourth aspect of the present invention provides a method for producing abscisic acid by fermentation, comprising inoculating the recombinant strain into an acid-producing fermentation medium for fermentation culture;

According to the present invention, in order to increase the yield of abscisic acid synthesized by fermentation of the recombinant strain. Preferably, the recombinant strain is inoculated into the acidogenic fermentation medium in the form of a seed solution. Further preferably, the preparation process of the seed liquid comprises: and inoculating single colonies of the recombinant strain into a seed culture medium for seed culture.

In the present invention, the single colony of the recombinant strain may be selected from the recombinant strain freshly prepared or the recombinant strain frozen at low temperature (e.g., an abscisic acid producing strain frozen in a glycerol freezing tube in a refrigerator of, for example, -80 ℃).

In the present invention, the seed medium is not particularly limited, and may be a seed medium conventionally used in the art for preparing a botrytis cinerea seed solution, preferably the seed medium contains: glucose 20-30g/L, wheat bran 70-90g/L, magnesium sulfate 0.5-1.5g/L, monopotassium phosphate 0.5-1.5g/L, and ammonium nitrate 0.3-1g/L.

In the present invention, conditions such as temperature and time of the seed culture are not particularly limited, and conventional conditions corresponding to the starting strain may be employed. Preferably, when the starting strain is botrytis cinerea, the seed culture conditions at least include: the temperature is 20-25 ℃, the rotating speed is 150-200rpm, and the time is 48-72h.

In the present invention, the fermentation medium is not particularly limited, and may be a fermentation medium of Botrytis cinerea conventionally used in the art, preferably the acid-producing fermentation medium contains: glucose, yeast extract, wheat bran, magnesium sulfate, potassium dihydrogen phosphate and vitamin B ₁ The method comprises the steps of carrying out a first treatment on the surface of the Further preferably, the acidogenic fermentation medium contains: glucose 20-30g/L, yeast extract 5-15g/L, wheat bran 70-90g/L, magnesium sulfate 0.5-1.5g/L, potassium dihydrogen phosphate 0.5-1.5g/L, vitamin B ₁ 0.02-0.06mg/L。

In the present invention, in order to increase the yield of abscisic acid, preferably, the conditions of the fermentation culture include at least: the inoculation amount is 4-8 vol%, the temperature is 20-25 ℃, the rotating speed is 150-200rpm, and the time is 150-200h.

In the present invention, the abscisic acid in the obtained fermentation broth may be isolated by a known method, for example, by removing cells in the fermentation broth, and then concentrating the fermentation broth from which the cells have been removed to crystallize the product, or by ion exchange chromatography or the like.

In the present invention, the abscisic acid in the fermentation broth or the abscisic acid separated from the fermentation broth can also be detected by a known method. For example, the production amount of abscisic acid can be detected by high performance liquid chromatography and the like.

The present invention will be described in detail by examples.

In the following examples, the method for detecting the content of abscisic acid in the fermentation broth comprises the following steps: filtering a fermentation liquor sample by using a 0.22 mu m water-based filter membrane, filling the filtered fermentation liquor sample into a liquid phase small bottle for testing, putting all the samples to be tested and an abscisic acid standard substance into an automatic sample injection chamber of a high performance liquid chromatograph (model Shimadzu LC 20) for testing, wherein a chromatographic column is a liuna 5u C18 column, a mobile phase is 0.1 volume percent formic acid and 100 volume percent methanol, the column temperature is 30 ℃, the flow rate is 0.3mL/min, and the wavelength is 260nm; preparing an abscisic acid standard substance into gradient concentration, detecting, determining the peak time of the abscisic acid, fitting a linear equation of the peak area and the concentration of the abscisic acid standard substance, bringing the peak area of the abscisic acid in the fermentation broth into the linear equation, and calculating the content of the abscisic acid in the fermentation broth.

The original strain Botrytis cinerea is purchased from China general microbiological culture collection center (CGMCC) with the number of 3.4582; the remaining reagents were conventional commercial products without specific description.

The formula of the LB liquid medium is as follows: 10g/L of tryptone, 5g/L of yeast extract and 10g/L of sodium chloride;

the formula of the LB solid medium is as follows: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of sodium chloride and 20g/L of agar powder;

the formula of the soft agar regeneration culture medium is as follows: 200g/L of potato, 20g/L of glucose, 206g/L of sucrose and 10g/L of agar powder;

the formula of the PDA solid culture medium is as follows: 200g/L of potato, 20g/L of glucose and 20g/L of agar powder;

the formula of the selective medium is as follows: 200g/L of potato, 20g/L of glucose, 20g/L of agar powder and 100 mu g/mL of hygromycin;

the formula of the seed culture medium is as follows: 25g/L of glucose, 83g/L of wheat bran, 1.2g/L of magnesium sulfate, 1g/L of monopotassium phosphate and 0.6g/L of ammonium nitrate, and sterilizing for 30min at 121 ℃;

the formula of the acidogenic fermentation medium is as follows: 25g/L glucose, 10g/L yeast extract, 83g/L wheat bran, 1.2g/L magnesium sulfate, 1g/L potassium dihydrogen phosphate and vitamin B ₁ 0.04mg/L, sterilizing at 121deg.C for 30min;

the STC solution comprises the following formula: 1M sorbitol, 10mM Tris-HCl,50mM CaCl ₂ ，pH＝7.5；

The formulation of the PEG4000 solution is: 25 wt% PEG4000, 10mM Tris-HCl,50mM CaCl ₂ ，pH＝7.5。

In the examples which follow, room temperature refers to 25.+ -. 5 ℃ without specific description.

Example 1

S1, construction of overexpression vector

Primer 1 (nucleotide sequence shown in SEQ ID NO:5, see Table 1) and primer 2 (nucleotide sequence shown in SEQ ID NO:6, see Table 1) were designed, and the PCR reaction conditions were as follows, using Aspergillus nidulans Aspergillus nidulans genome (NCBI No. 227321) as a template, and obtaining the old promoter gene fragment (nucleotide sequence shown in SEQ ID NO: 17) by PCR amplification: repeating 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C for 0.5min, and continuing at 72 deg.C for 5min; designing a primer 3 (the nucleotide sequence of which is shown as SEQ ID NO:7, see Table 1) and a primer 4 (the nucleotide sequence of which is shown as SEQ ID NO:8, see Table 1), taking a Botrytis cinerea genome as a template, and performing PCR amplification to obtain an HMGR+HMGR terminator gene fragment (the amino acid sequence of HMGR is shown as SEQ ID NO:1, the nucleotide sequence of which is shown as SEQ ID NO:3, and the nucleotide sequence of an HMGR terminator is shown as SEQ ID NO: 18), wherein the PCR reaction conditions are as follows: repeating 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C for 2.5min, and continuing at 72 deg.C for 5min;

the old promoter gene fragment and the HMGR+HMGR terminator gene fragment were subjected to fusion PCR using primers 1 and 4 under the following conditions: repeating the above steps for 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C, and 3min, and continuing for 5min at 72 deg.C;

the pHPH vector (the nucleotide sequence of which is shown as SEQ ID NO: 21) is used as a template, a pHPH-HMGR overexpression vector is constructed by connecting a one-step cloning kit ClonExpII One Step Cloning Kit produced by Nanjinouzan biotechnology Co., ltd (Vazyme), the connection product is transformed into E.coli DH5 alpha receptor bacteria, positive transformants are screened on plates with an ampicillin-resistant LB solid medium (the concentration of ampicillin is 100 mu g/mL) and verified by colony PCR; the correct positive transformants were picked and cultured overnight in ampicillin-resistant LB liquid medium (ampicillin concentration: 100. Mu.g/mL), and pHPH-HMGR recombinant vector was obtained by collecting the cells and extracting them with plasmid extraction kit RapidLyse Plasmid Mini Kit manufactured by Nanjinotazan Biotechnology Co., ltd (Vazyme), and the plasmid map is shown in FIG. 1.

S2, preparation of Botrytis cinerea protoplast

(1) Eluting Botrytis cinerea from a PDA flat plate to form spore liquid, inoculating the spore liquid into 50mL of seed culture medium, culturing for 48 hours at the temperature of 25 ℃ and the rotating speed of 180rpm to obtain regenerated bacterial liquid, inoculating the regenerated bacterial liquid into a new seed culture medium with the inoculation amount of 10 volume percent, culturing for 18 hours at the temperature of 25 ℃ and the rotating speed of 180rpm, filtering the culture liquid by using sterile mirror wiping paper, and collecting Botrytis cinerea for preparing protoplasts;

(2) Preparing an enzymolysis reagent according to 1% Dryalase,1% lysine and 0.7mol/L sodium chloride, filtering and sterilizing with a sterile filter head with the diameter of 0.22 mu m, weighing 1g of Botrytis cinerea, adding 10mL of the enzymolysis reagent, and performing enzymolysis for 2 hours at 25 ℃ and 180rpm to obtain an enzymolysis solution;

(3) Filtering the enzymolysis solution with sterile lens wiping paper to remove mycelium residues, collecting the enzymolysis solution containing protoplast, centrifuging at 4000rpm for 10min to obtain protoplast precipitate, washing the protoplast precipitate twice with STC solution pre-cooled at 4deg.C, and re-suspending the protoplast in a proper amount of STC solutionIn the liquid, the concentration of the protoplast is adjusted to 10 ⁷ -10 ⁸ Obtaining protoplast suspension by/mL, and freezing and storing at-80 ℃ for standby;

s3, conversion

Taking 100 mu L of protoplast suspension, sequentially adding 10-15 mu g of pHPH-HMGR recombinant vector (volume of which is maximum 10 mu L) obtained in the step S1 and 50 mu L of PEG4000 solution, mixing for 20min, adding 1mL of PEG4000 solution, mixing for 10min at room temperature, adding 2mL of STC solution, uniformly mixing, taking 160 mu L of the mixed solution, coating the mixed solution on a PDA solid culture medium plate containing 0.6M sucrose, culturing for 12h, and taking 10mL of soft agar regeneration culture medium (42 ℃) containing corresponding screening resistance for covering. Culturing the plate at 25 ℃ for 5-7 days, subculturing the grown transformant on a selective medium, and purifying by three to five rounds of monospore separation;

s4, genome extraction

Inoculating the transformant into a seed culture medium, culturing for 24 hours at the temperature of 28 ℃ and the rotating speed of 200rpm, taking 20mL of bacterial liquid, centrifuging at 8000rpm for 10min to obtain transformant thalli, and repeatedly grinding the thalli with liquid nitrogen; next, the genome was extracted using a fungal genome extraction kit (purchased from Biotechnology (Shanghai) Co., ltd.) and PCR was performed using primer 1 and primer 4 for confirming integration of the exogenous fragment pHPH-HMGR into the genome; a recombinant strain with successful pHPH-HMGR integration was obtained and designated as B.cinerea-OE: HMGR.

TABLE 1

Example 2

S1, construction of overexpression vector

Primer 5 (nucleotide sequence shown in SEQ ID NO:9, see Table 2) and primer 6 (nucleotide sequence shown in SEQ ID NO:10, see Table 2) were designed, aspergillus nidulans genome was used as a template, and a trpc promoter gene fragment (nucleotide sequence shown in SEQ ID NO: 19) was obtained by PCR amplification under the following conditions: repeating 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C for 0.5min, and continuing at 72 deg.C for 5min; primer 7 (nucleotide sequence shown as SEQ ID NO:11, see Table 2) and primer 8 (nucleotide sequence shown as SEQ ID NO:12, see Table 2) were designed, and the trpc terminator gene fragment (nucleotide sequence shown as SEQ ID NO: 20) was obtained by PCR amplification using Aspergillus nidulans genome as a template, and the PCR reaction conditions were as follows: repeating 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C for 0.5min, and continuing at 72 deg.C for 5min;

the trpc promoter gene fragment, trpc terminator gene fragment and VHB gene fragment (obtained by synthesis from the company of the Enterprise of the family of the Prinsepia, inc. according to the nucleotide sequence provided on NCBI, the amino acid sequence is shown in SEQ ID NO:2, and the nucleotide sequence is shown in SEQ ID NO: 4) were subjected to fusion PCR using the primers 5 and 8 under the following conditions: repeating 33 cycles at 98deg.C, 5min, 98deg.C, 30s,56 deg.C, 30s,72 deg.C for 2.5min, and continuing at 72 deg.C for 5min;

connecting the pHPH vector with a one-step cloning kit ClonExpII One Step Cloning Kit produced by Nanjinouzan biotechnology Co-Ltd (Vazyme) to construct a pHPH-VHB overexpression vector, converting the connection product into E.coli DH5 alpha receptor bacteria, screening positive transformants on plates with an ampicillin-resistant LB solid medium (ampicillin concentration is 100 mug/mL), and verifying by colony PCR; the correct positive transformants were picked and cultured overnight in ampicillin-resistant LB liquid medium (ampicillin concentration: 100. Mu.g/mL), and pHPH-VHB recombinant vector was obtained by collecting the cells and extracting them with a plasmid extraction kit RapidLyse Plasmid MiniKit manufactured by Nanjinouzan Biotechnology Co., ltd (Vazyme) and the plasmid map is shown in FIG. 2.

TABLE 2

Primer 5	GTAGGTATAAACCTCGAAATCtttggatgcttgggtagaatagg	SEQ ID NO：9
			Primer 6	taatggtttgctggtctaacatcattttttgggcttggctggag	SEQ ID NO：10
Primer 7	gtacgctcaagcggttgaataaCACTTAACGTTACTGAAATCAT	SEQ ID NO：11
			Primer 8	gggcccgggatccgatatctagGATTTCGAGGTTTATACCTAC	SEQ ID NO：12

The pHPH-VHB recombinant vector was transformed into Botrytis cinerea in the same manner as in step S2-step S4 of example 1, and PCR was performed with primer 5 and primer 8 for confirming integration of the exogenous fragment pHPH-VHB into the genome; recombinant strains were obtained which were successfully integrated by pHPH-VHB and designated as B.cinerea-OE: VHB.

Example 3

Designing a primer 9 (the nucleotide sequence of which is shown as SEQ ID NO. 13 and is shown as table 3) and a primer 10 (the nucleotide sequence of which is shown as SEQ ID NO. 14 and is shown as table 3), and carrying out PCR amplification by taking the pHPH-HMGR recombinant vector in the example 1 as a template to obtain an HMGR complete expression cassette; the PCR conditions were as follows: repeating 33 cycles at 98deg.C for 8min, 98deg.C for 30s, 60deg.C for 30s, 72deg.C for 3 min; continuing at 72 ℃ for 5min;

the pHPH-VHB vector is used as a template, is connected through a one-step cloning kit ClonExpII One Step Cloning Kit produced by Nanjinouzan biotechnology Co-Ltd (Vazyme), a pHPH-HMGR-VHB recombinant vector is constructed, the connection product is transformed into E.coli DH5 alpha receptor bacteria, positive transformants are screened on plates by using an ampicillin-resistant LB solid medium (ampicillin concentration is 100 mu g/mL), and are verified through colony PCR; the correct positive transformants were picked and cultured overnight in ampicillin-resistant LB liquid medium (ampicillin concentration: 100. Mu.g/mL), and pHPH-HMGR-VHB recombinant vector was obtained by collecting the cells and extracting them with plasmid extraction kit RapidLyse Plasmid Mini Kit manufactured by Nanjinouzan Biotechnology Co., ltd (Vazyme), and the plasmid map is shown in FIG. 3.

According to the method of step S2-step S4 of example 1, pHPH-HMGR-VHB recombinant vector was transformed into Botrytis cinerea, and PCR was performed with primer 11 (nucleotide sequence shown in SEQ ID NO:15, see Table 3) and primer 12 (nucleotide sequence shown in SEQ ID NO:16, see Table 3) for confirming integration of the exogenous fragment pHPH-HMGR-VHB into the genome; recombinant strains were obtained which were successfully integrated with pHPH-HMGR-VHB and designated B.cinerea-a-OE HMGROE VHB.

TABLE 3 Table 3

Primer 9	AACCTCGAAATCctagatatcgctgcagctgtggagccgcattc	SEQ ID NO：13
			Primer 10	tgcagtcgacgggcccgggatcGGTGACGCGGTGAGAAAGGCAT	SEQ ID NO：14
Primer 11	ttggatgcttgggtagaataggtaagtcag	SEQ ID NO：15
			Primer 12	ctatttctttccccctgcagctctaagaac	SEQ ID NO：16

Example 4 shake flask fermentation verification of different genotypes of abscisic acid-producing engineering bacteria

The recombinant strain B.cinerea-OE obtained in example 1, the recombinant strain B.cinerea-OE obtained in example 2, VHB and the recombinant strain B.cinerea-a-OE obtained in example 3 were inoculated with HMGR OE VHB and the starting strain B.cinerea, respectively, in 250mL shake flasks containing 50mL of seed medium, and cultured at 25℃and 180rpm for 48 hours to obtain seed solutions; inoculating 4mL of seed solution into 500mL shaking flask containing 100mL of acidogenic fermentation medium, culturing at 25deg.C and rotation speed of 180rpm for 7 days, collecting fermentation liquid, and detecting abscisic acid content in the fermentation liquid, wherein the results are shown in FIG. 4 and Table 4. Recombinant strain B.cinerea-a-OE of over-expression HMGR and VHB after fermentation, the yield of abscisic acid is increased by more than 60% compared with the original strain.

TABLE 4 Table 4

Bacterial strain	Abscisic acid yield (g/L)
		B.cinerea	1.45
B.cinerea-OE:HMGR	1.89
		B.cinerea-OE:VHB	1.76
B.cinerea-OE:HMGR OE:VHB	2.37

EXAMPLE 5 passage verification

Recombinant strain B.cinerea-OE constructed in example 3, HMGR OE and VHB are subjected to continuous 4 times of selective medium plate streaking and passage to obtain 5 generations of strains, fermentation is carried out according to the method in example 4, and the content of abscisic acid in fermentation broth is detected, wherein the result is shown in FIG. 5; the recombinant strain B.cinerea-OE, HMGR OE and VHB provided by the invention are proved to have stable yield in fermentation production of abscisic acid.

Example 6

Recombinant strain b.cinerea-OE: HMGR OE: VHB constructed in example 3 was fermented as in example 4, except that the seed medium was replaced with: 30g/L of glucose, 70g/L of wheat bran, 1.5g/L of magnesium sulfate, 1.5g/L of monopotassium phosphate and 1g/L of ammonium nitrate;

the acidogenic fermentation medium was replaced with: 30g/L glucose, 15g/L yeast extract, 70g/L wheat bran, 1.5g/L magnesium sulfate, 1.5g/L potassium dihydrogen phosphate and vitamin B ₁ 0.06mg/L；

The abscisic acid content of the fermentation broth was measured and the results are shown in Table 5.

Example 7

Recombinant strain b.cinerea-OE: HMGR OE: VHB constructed in example 3 was fermented as in example 4, except that the seed medium was replaced with: glucose 20g/L, wheat bran 90g/L, magnesium sulfate 0.5g/L, monopotassium phosphate 0.5g/L and ammonium nitrate 0.3g/L;

the acidogenic fermentation medium was replaced with: 20g/L glucose, 5g/L yeast extract, 90g/L wheat bran, 0.5g/L magnesium sulfate, 0.5g/L potassium dihydrogen phosphate and vitamin B ₁ 0.02mg/L；

Example 8

Recombinant strain b.cinerea-OE: HMGR OE: VHB constructed in example 3 was fermented as in example 4, except that the seed medium was replaced with: peeling 200g of potato, cutting into pieces, boiling for 30min, filtering with gauze, adding 20g of sucrose, melting, and supplementing water to 1000mL;

Example 9

Recombinant strain b.cinerea-OE: HMGR OE: VHB constructed in example 3 was fermented as in example 4, except that the acidogenic fermentation medium was replaced with: 200g/L of glucose, 0.05g/L of copper sulfate, 10g/L of peptone, 3g/L of citric acid and 5g/L of yeast extract powder;

TABLE 5

Numbering device	Abscisic acid yield (g/L)
		Example 6	2.41
Example 7	2.23
		Example 8	1.76
Example 9	1.87

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, a number of simple variants of the technical solution of the invention are possible, including combinations of the individual technical features in any other suitable way, which simple variants and combinations should likewise be regarded as being disclosed by the invention, all falling within the scope of protection of the invention.

Claims

1. A recombinant strain for producing abscisic acid, characterized in that it is obtained by genetic modification of a starting strain, said recombinant strain having an enhanced HMG-CoA reductase activity and expressing hemoglobin VHB compared to the starting strain; wherein, the recombinant strain contains the coding amino acid sequence shown in SEQ ID NO:1 and the coding amino acid sequence of the HMG-CoA reductase is shown as SEQ ID NO:2, and a gene of hemoglobin VHB.

2. The recombinant strain according to claim 1, wherein the gene encoding HMG-CoA reductase has a nucleotide sequence as set forth in SEQ ID NO:3 is shown in the figure;

3. The recombinant strain according to claim 1 or 2, characterized in that the starting strain is Botrytis cinerea (Botrytis cinerea).

4. A method of constructing a recombinant strain that produces abscisic acid, the method comprising: genetically engineering the starting strain to enhance HMG-CoA reductase activity of the starting strain and express hemoglobin VHB;

wherein, the mode of enhancing the activity of HMG-CoA reductase of the starting strain is overexpression of the HMG-CoA reductase of which the coded amino acid sequence is shown as SEQ ID NO:1, the gene of HMG-CoA reductase;

the way of expressing the hemoglobin VHB by the original strain is to exogenously introduce a coding amino acid sequence shown as SEQ ID NO:2, and a gene of hemoglobin VHB.

5. The method of claim 4, wherein the gene encoding HMG-CoA reductase has a nucleotide sequence set forth in SEQ ID NO:3 is shown in the figure;

6. The method of claim 4 or 5, wherein the starting strain is Botrytis cinerea (Botrytis cinerea).

7. Use of a recombinant strain according to any one of claims 1 to 3 or a method according to any one of claims 4 to 6 for the preparation of abscisic acid.

8. A method for producing abscisic acid by fermentation, characterized in that the recombinant strain of any one of claims 1 to 3 is inoculated into an acidogenic fermentation medium for fermentation culture;

alternatively, a recombinant strain is constructed according to the method of any one of claims 4 to 6, and the resulting recombinant strain is inoculated into an acidogenic fermentation medium for fermentation culture.

9. The method of claim 8, wherein the recombinant strain is inoculated into the acidogenic fermentation medium in the form of a seed solution;

preferably, the preparation process of the seed liquid comprises the following steps: inoculating single colony of the recombinant strain into a seed culture medium for seed culture;

preferably, the seed medium contains: 20-30g/L of glucose, 70-90g/L of wheat bran, 0.5-1.5g/L of magnesium sulfate, 0.5-1.5g/L of monopotassium phosphate and 0.3-1g/L of ammonium nitrate;

10. The method according to claim 8 or 9, wherein the acidogenic fermentation medium contains: glucose 20-30g/L, yeast extract 5-15g/L, wheat bran 70-90g/L, magnesium sulfate 0.5-1.5g/L, potassium dihydrogen phosphate 0.5-1.5g/L, vitamin B ₁ 0.02-0.06mg/L；