CN107723308B - Biosynthesis method and gene cluster of compound balanol - Google Patents
Biosynthesis method and gene cluster of compound balanol Download PDFInfo
- Publication number
- CN107723308B CN107723308B CN201710827974.0A CN201710827974A CN107723308B CN 107723308 B CN107723308 B CN 107723308B CN 201710827974 A CN201710827974 A CN 201710827974A CN 107723308 B CN107723308 B CN 107723308B
- Authority
- CN
- China
- Prior art keywords
- balanol
- culture
- compound
- blnr
- biosynthesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/10—Nitrogen as only ring hetero atom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a biosynthesis method and a gene cluster of a compound balanol, wherein the biosynthesis method is efficient and convenient and comprises the following steps: connecting the blnR gene fragment into a vector to obtain an expression plasmid; transferring the expression plasmid into agrobacterium tumefaciens EHA105 by electric transformation, and screening and culturing to obtain agrobacterium tumefaciens with the expression plasmid; inoculating the strain to a liquid culture medium, and performing light-proof oscillation culture, taking a culture solution, and performing light-proof oscillation culture to obtain a recombinant agrobacterium EHA105 strain solution; collecting ascochyta megalobionoides conidia to obtain ascochyta megalobionoides conidia suspension; mixing the recombinant agrobacterium EHA105 bacterial liquid and the ascochyta fluviatilis conidium suspension, and carrying out light-resistant co-culture to obtain co-culture mixed thalli; obtaining OE, namely, a blnR ophioglossum transformant, fermenting and culturing, and separating fermentation liquor to obtain a compound balanol.
Description
Technical Field
The invention relates to the technical field of biosynthesis of a compound balanol, and particularly relates to a biosynthesis method and a gene cluster of the compound balanol.
Background
The natural products of fungi are a treasure house of natural human medicine sources, but many gene clusters are recessive under natural conditions, and in recent years, a plurality of new technical advances including sequencing and detection means make the activation of new products easier and easier. Cordyceps ophioglossoides is a traditional Chinese medicine used for treating metrorrhagia, irregular menstruation and other diseases and is distributed in Asia, Europe and the like.
Through genome sequencing, a PKS-NRPS hybrid gene cluster containing an AflR regulatory factor in a Cordyceps ophioglossoides genome sequence is found, but products which can correspond to the gene cluster are not detected in fermentation products, and the gene cluster is presumed to be a stealth gene cluster. The PKS-NRPS mixed gene cluster is confirmed to be activated by constructing an overexpression vector of a specific regulatory factor blnR in the gene cluster, performing liquid shake flask fermentation culture and HPLC detection, and obtaining balanol and other new products by separation and purification.
The structure of compound balanol is shown below:
balanol has strong PKC inhibitor activity, the three-dimensional structure of which is similar to that of ATP, and the binding affinity of which to ATP binding pockets of PKC and PKA protein kinase is 3000 times that of ATP, and PKA and PKC are important targets in oncology. In 1993, balanol was first isolated and identified from the fungus Verticillium balanoides, and in 1994 it was confirmed that it is the same substance as the ophiocordin found in Ophioglossum macrocarpon in 1977. Because the amount of the natural balanol product in the fungus is very small, in order to widen the use significance of the balanol and the chemical synthesis of the balanol and the derivatives thereof, a plurality of previous researches are carried out on the in vitro chemical total synthesis research of the balanol and the derivatives thereof, and most of the methods are time-consuming and labor-consuming.
Disclosure of Invention
The invention provides a biosynthesis method and a gene cluster of a compound balanol, the biosynthesis method is efficient and convenient, and the method for realizing the high-efficiency biosynthesis of the balanol in fungal ophioglossum ophioglossoides (Tolypocladium ophioglossoides). The invention utilizes an agrobacterium-mediated T-DNA conversion method to construct a conversion system in the ophioglossoides (Tolypocladium ophioglossoides), overexpresses a pathway specific regulatory factor blnR, activates a balanol synthetic gene cluster which is originally silenced under a laboratory condition, detects the generation of balanol in fermentation liquor by HPLC after liquid fermentation, and obtains the biosynthetic balanol by separation and purification.
A method for the biosynthesis of compound balanol comprising the steps of:
1) connecting the blnR gene fragment into a vector to obtain an expression plasmid;
2) the expression plasmid is transferred into agrobacterium tumefaciens EHA105 by electric transformation, and the agrobacterium tumefaciens with the expression plasmid is obtained by selecting, carrying out PCR identification on colonies through streptomycin (Str) and kanamycin resistance screening culture;
3) inoculating Agrobacterium with expression plasmid to liquid culture medium, shaking culturing in dark place, taking culture solution, and resuspending the strain to OD6000.1-0.15, and shake culturing in dark to make OD600Reaching 0.5-0.6 to obtain recombinant agrobacterium EHA105 bacterial liquid;
4) culturing Cordyceps ophioglossoides, collecting conidia of Cordyceps ophioglossoides, and counting by a blood ball counter to adjust the spore concentration to (0.5-5) × 106Obtaining a Cordyceps ophioglossoides conidium suspension liquid;
5) mixing the recombinant agrobacterium EHA105 bacterial liquid and the ascochyta fluviatilis conidium suspension, and carrying out light-resistant co-culture to obtain co-culture mixed thalli;
6) washing the co-cultured mixed thalli with sterile water, coating the co-cultured mixed thalli on a flat plate, performing inverted culture until a transformant appears, transferring the transformant to a selective flat plate for subculture for 3-5 times, and performing PCR identification to obtain an OE (OE: blnR) hydatid transformant;
7) carrying out fermentation culture on a correctly identified OE (bolan grass transformant of blnR ophioglossum, and separating fermentation liquor to obtain a compound balanol.
The following are preferred technical schemes of the invention:
in the step 1), the vector is a pFG vector containing a pTEF strong promoter, a kanamycin resistance gene (neo) and a chlorimuron-ethyl resistance gene (SUR).
In step 2), the agrobacterium tumefaciens EHA105 is commercially available, and specifically, a product of shanghai nationwide biotechnology limited can be used.
In the step 3), the liquid culture medium is a YEB culture medium. The thallus is suspended by using IM culture medium containing acetosyringone.
In the step 4), the Cordyceps Ophioglossoides adopts Chinese invention patents (patent numbers: ZL200410025774.6), the strain is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms in the preservation unit appointed by the China patent office, and the preservation number is as follows: CGMCC No. 1146.
Adjusting the spore concentration to (0.5-2) × 106Per ml, more preferably, the spore concentration is adjusted to 106One per ml.
In the step 5), the conditions of the light-shielding co-culture are as follows: co-culturing at 24-28 deg.C under dark condition for 36-60 hr, and further co-culturing at 26 deg.C under dark condition for 48 hr.
In step 6), performing inverted culture at 24-28 ℃ until a transformant appears, and further performing inverted culture at 26 ℃ until the transformant appears.
Transformants were transferred to selective plates for subculture 3-4 times.
And 7), inoculating the correctly identified OE (E) into a COB culture medium for fermentation culture, wherein the COB culture medium is calculated by 1L: polypeptone5g, Yeast extract5g, MgSO4.7H2O 1g、KH2PO40.5g, Sucrose30g, balance deionized water, final pH 5.5.
Detecting the obtained compound by a high Resolution Mass spectrum HR-MS (high Resolution Mass Spectrometer) to obtain the compound in a negative ion mode [ M-H ]]-The molecular weight is 549.1514, and the molecular formula obtained by fitting is C28H26N2O10。
The resulting compound was NMR-analyzed to obtain spectral data, which was in agreement with the reference (Nicolaou, K., M.E.Bunnage, and K.Koide, Total Synthesis of balanol. journal of the American chemical Society,1994.116(18): p.8402-8403) and was identified as compound balanol.
The inventor collects the fruiting body of the Cordyceps Ophioglossoides from the Xishuangbanna forest in the earlier stage, separates the fruiting body from the fruiting body to obtain the non-sexual mycelium of the Cordyceps Ophioglossoides, and the strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, which is the preservation unit designated by the China patent office, and the preservation number is as follows: CGMCC No.1146, an issued national invention patent (patent No. ZL 200410025774.6). The strain is subjected to shake flask culture, genomic DNA is extracted, a PKS-NRPS mixed synthetic gene cluster is obtained by analysis after sequencing, and the PKS-NRPS mixed synthetic gene cluster is proved to be a biosynthesis gene cluster of balanol for the first time. The gene cluster comprises 18 genes, wherein the genes comprise a regulatory gene blnR, a PKS synthetic gene blnA, two NRPS synthetic genes blnN and blnO and other modifying genes.
The base sequence of the blnR gene segment is shown as SEQ ID NO: 1 is shown.
A protein, the amino acid sequence of which is as shown in SEQ ID NO: 2, respectively. The protein is expressed from a blnR gene fragment. The amino acid sequence is subjected to blastn comparison (https:// blast. NCBI. nlm. nih. gov) of NCBI website, is a homologous sequence of protein AflR in Aspergillus flavus (Aspergillus flavus), and is Zn unique to fungi2Cys6A regulatory protein of the type.
The blnA gene fragment (namely, PKS synthetic gene blnA) has a base sequence shown in SEQ ID NO: 3, respectively.
The base sequence of the blnN gene fragment (namely, the synthetic gene blnN of NRPS) is shown as SEQ ID NO: 4, respectively.
The base sequence of the blnO gene fragment (i.e., the NRPS synthetic gene blnO) is shown in SEQ ID NO: 5, respectively.
Extracting genome DNA of the grass of the Cordyceps ophioglossoides and carrying out PCR to obtain a blnR gene segment, a blnA gene segment, a blnN gene segment and a blnO gene segment.
A gene cluster comprising: the base sequence is shown as SEQ ID NO: 1, the base sequence of the blnR gene segment shown in SEQ ID NO: 3, the base sequence of the blnA gene fragment is shown as SEQ ID NO: 4, the base sequence of the blnN gene fragment shown in SEQ ID NO: 5, or a fragment of the blnO gene.
The gene fragment is collected by self, and the collection place is as follows: zhejiang, China: new love, contact mode of collector: canola @ zju. The biological experiment center 410 of hong Kong school district, Zhejiang university, Hangzhou, Zhejiang province.
Compared with the prior art, the invention has the following advantages:
the biosynthesis method of the compound balanol is efficient and convenient, and the method for efficiently biosynthesis of balanol is realized in fungal ophioglossum ophioxoides (Tolypocladium ophioglossoides). The invention utilizes an agrobacterium-mediated T-DNA conversion method to construct a conversion system in the ophiobolus ophioglossoides (Tolypocladium ohioglossoides), overexpresses a pathway specific regulatory factor blnR, activates a balanol synthetic gene cluster which is originally silenced under laboratory conditions, detects the generation of balanol in fermentation liquor by HPLC after liquid fermentation, and obtains the biosynthetic balanol after separation and purification.
Drawings
FIG. 1 is a diagram of HPLC detection results (detection wavelength 254nm) of a blnR shake flask fermentation liquid (14 days) of a wild type WT and an over-expression strain OE of the Cordyceps ophioglossoides.
Detailed Description
The present invention will be described in further detail with reference to specific examples.
Example 1
The specific implementation steps of the method for activating the balanol biosynthesis in the grass of the hydnocarpus fasciatus are as follows:
1) analyzing and obtaining a PKS-NRPS hybrid gene cluster containing Zn2Cys2 family transcription factor AflR analog gene blnR in the genome sequence of the Cordyceps ophioglossoides strain, cloning by PCR to obtain the gene, and cloning the cloned DNA fragment of the blnR gene (the base sequence of the gene is shown as SEQ ID NO: 1) is connected into a pFG vector containing a pTEF strong promoter, a kanamycin resistance gene (neo) and a chlorimuron-ethyl resistance gene (SUR) to obtain a plasmid pTblnR;
2) transferring the plasmid into agrobacterium tumefaciens EHA105 by an electric transformation method, screening and culturing by streptomycin (Str) and kanamycin resistance, culturing for 2 days at 28 ℃, and obtaining positive recombinant agrobacterium ApTblnR by colony PCR identification;
3) inoculating the positive recombinant Agrobacterium ApTblnR monoclonal into liquid YEB culture medium, performing shake culture at 28 deg.C and 200rpm overnight, centrifuging 400 μ l culture solution at 10000rpm for 3min, resuspending the strain to OD with 5ml IM liquid culture medium containing 200 μ M AS (acetosyringone)600Shaking and culturing at 28 deg.C for about 6 hr to obtain OD600To 0.5-0.6;
4) collected on a PDA plate and cultivated upside downCulturing Cordyceps Ophioglossoides conidia for 4-6 days, and regulating spore concentration to 10 by counting with a blood ball counter6Per ml;
5) mixing 100 mu l of cultured recombinant agrobacterium ApTblnR bacterial liquid in 3) with 100 mu l of large-head bursitis grass conidium suspension, uniformly coating 200 mu l of the mixture on an IMAS plate, and carrying out photophobic co-culture at 26 ℃ for 48 h;
6) after the co-culture is finished, washing the co-culture mixed thalli by using 3-5ml of sterile water, coating the co-culture mixed thalli on a selective CD or MM plate by using 100-300 mu l of sterile water per plate, carrying out inverted culture at 26 ℃ until a transformant appears (about 10 days), transferring the transformant to the selective plate for subculture for 3-4 times, and identifying a positive transformant through PCR;
7) and inoculating the correct OE to the blnR Cordyceps ophioglossoides transformant and wild-type Cordyceps ophioglossoides, respectively, performing shake flask fermentation at 26 deg.C for 14 days, and respectively performing HPLC analysis on the fermentation liquid (the solvents used by HPLC are phase A water and phase B acetonitrile, respectively). Gradient conditions were 5% B phase hold at the first 5min, increasing B phase to 58% at 35min, and returning B phase to 5% at 36 min. Flow rate of 1ml/min, detection wavelength of 254nm), HPLC detection finds that the strain over-expressing the blnR gene newly produces compounds including balanol compared with the wild type;
8) the compound balanol is obtained by performing separation and purification steps such as ethanol extraction, silica gel column chromatography, preparative HPLC and the like on fermentation liquor of the blnR strain.
IM medium formulation (1L): 0.8ml K-buffer, 5ml Trace elements, 0.6g MgSO4·7H2O、0.3g NaCl、0.01g CaCl2·2H2O、0.001g FeSO4、0.5g NH4NO35ml Glycerol, 8.53g MES, 1.8g glucose, balance deionized water, pH 5.5.
The Trace elements formula is (1L): 100mg ZnSO4·7H2O、100mg CuSO4·5H2O、100mgH3BO3、100mg MnSO4·H2O、100mg Na2MoO4·2H2O and the balance of deionized water.
K-buffer: to 1.25M K2HPO4Adding 1.25M KH into the aqueous solution2PO4The aqueous solution was added until the final pH of the solution was 4.8.
COB medium calculated at 1L: polypeptone5g, Yeast extract5g, MgSO 54.7H2O1g、KH2PO40.5g, Sucrose30g, balance deionized water, final pH 5.5.
FIG. 1 is a diagram of HPLC detection results (detection wavelength 254nm) of a blnR shake flask fermentation liquid (14 days) of a wild type WT and an over-expression strain OE of the Cordyceps ophioglossoides. As can be seen from fig. 1, a transformation system in eremoths (Tolypocladium ohioglossoides) is constructed by using an agrobacterium-mediated T-DNA transformation method, a pathway-specific regulatory factor blnR is overexpressed, a balanol synthetic gene cluster which is originally silenced under laboratory conditions is activated, liquid fermentation is performed, the generation of balanol in a fermentation broth is detected by HPLC, and the biosynthetic balanol is obtained by separation and purification.
Sequence listing
<110> Zhejiang university
<120> biosynthesis method and gene cluster of compound balanol
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>1443
<212>DNA
<213> Cordyceps Ophioglossoides (Tolypocladium ohioglossoides)
<220>
<221>gene
<400>1
atggcctcag aaacccgcgc cgggggagtc ggcccagaga ccaagctgcg gaacagctgc 60
aatgcctgcg cggccgcgaa gatcaaatgc acgcaggaaa agccggcgtg cgcctactgc 120
gtcaagcggc tcaaggcctg cgtctacggc gtctccaagc gcgtcaggcg gacgccgcga 180
ggccacgcga gcgttactcg tgcaggtgac gcgccaaaga cgccggcttg tccgaatccg 240
gcttgtccaa acccgccacc gacggctttc gggtcgacga cgtccgtctc gtccctgggc 300
tccgcgaccg gcccggatgc caccacatgc caaacgtcgg cccctgccac gccgctgctt 360
ggccaagact ggcccgaatc cttgtcgacg ctcctcttcc cgggcatcac gacgccgtcg 420
acggagcctt ctctgtctgc ggaatgggcc agcttgggcg cctcgattga ttcattccca 480
tacctcgacg actctacctt ctccttcccg actcccctcg accagaatgc acccgttgat 540
ggaaatcaag tcgtccatgg catctcaaac gagggtgctg ctgcgggccc gaataacgac 600
accctcgacg attccttcac taggagcgac ggtggccgcg gtgttgatat tatgtccgcg 660
tttccgactg gccctcagac tggtgccgga gttgcgtcac ccacctcgcc cggacacccg 720
tcaggcgtgc gccgcagtcc cgatcaccgt acatccactg caatcccgcc ggtaccccgg 780
tgccattgct tcgtgcgtat tcttcggtct ctggctcagc tggccatgga tccatccgag 840
gcgtggactg cccctgaaag tggtgacgct tcgtcccaac agccgcgttt tgaccaagtc 900
caaaatcaag tcgaggccat gaacgacgat atggacaagg tcctgcaatg ctcttgctct 960
aaacaaagtg acatgattgt ccttttgtca cttgtcatat tcaaaatcct ggcctggtat 1020
gccgccgccg taaatgccgc gacaagcgac gacaacgagc ccgacacctt ggacagtgct 1080
gacgccaagc ccacgccgtc ccgccgcagg ctcgtgctgc cttcctcgtg ggcagacgtg 1140
gacggcgacg aatccgaggg cgaagaccag cgccgcatct ttatccagca tgtcctctcg 1200
aggctcacgg ggctgcagat cctcattggt cgcctgtcgc agctctttac caacgtcgag 1260
tccgagtcct ggccaagcgc cgctctcaga ccggcagctc aaggtccttt tcactctgtc 1320
atcgagggca agattattat catgcccttc tccaactctt tgttaagcgc tttatcctcc 1380
gatttgcgta atcgtctctg cggaatgtcg cgagctatta tggagaaact tagagtggta 1440
taa 1443
<210>2
<211>480
<212>PRT
<213> Cordyceps Ophioglossoides (Tolypocladium ohioglossoides)
<220>
<221>SIMILAR
<400>2
Met Ala Ser Glu Thr Arg Ala Gly Gly ValGly Pro Glu Thr Lys Leu
1 5 10 15
Arg Asn Ser Cys Asn Ala Cys Ala Ala Ala Lys Ile Lys Cys Thr Gln
20 25 30
Glu Lys Pro Ala Cys Ala Tyr Cys Val Lys Arg Leu Lys Ala Cys Val
35 40 45
Tyr Gly Val Ser Lys Arg Val Arg Arg Thr Pro Arg Gly His Ala Ser
50 55 60
Val Thr Arg Ala Gly Asp Ala Pro Lys Thr Pro Ala Cys Pro Asn Pro
65 70 75 80
Ala Cys Pro Asn Pro Pro Pro Thr Ala Phe Gly Ser Thr Thr Ser Val
85 90 95
Ser Ser Leu Gly Ser Ala Thr Gly Pro Asp Ala Thr Thr Cys Gln Thr
100 105 110
Ser Ala Pro Ala Thr Pro Leu Leu Gly Gln Asp Trp Pro Glu Ser Leu
115 120 125
Ser Thr Leu Leu Phe Pro Gly Ile Thr Thr Pro Ser Thr Glu Pro Ser
130 135 140
Leu Ser Ala Glu Trp Ala Ser Leu Gly Ala Ser Ile Asp Ser Phe Pro
145 150 155 160
Tyr Leu Asp Asp Ser Thr Phe Ser Phe Pro Thr Pro Leu Asp Gln Asn
165 170 175
Ala Pro Val Asp Gly Asn Gln Val Val His Gly Ile Ser Asn Glu Gly
180 185 190
Ala Ala Ala Gly Pro Asn Asn Asp Thr Leu Asp Asp Ser Phe Thr Arg
195 200 205
Ser Asp Gly Gly Arg Gly Val Asp Ile Met Ser Ala Phe Pro Thr Gly
210 215 220
Pro Gln Thr Gly Ala Gly Val Ala Ser Pro Thr Ser Pro Gly His Pro
225 230 235 240
Ser Gly Val Arg Arg Ser Pro Asp His Arg Thr Ser Thr Ala Ile Pro
245 250 255
Pro Val Pro Arg Cys His Cys Phe Val Arg Ile Leu Arg Ser Leu Ala
260 265 270
Gln Leu Ala Met Asp Pro Ser Glu Ala Trp Thr Ala Pro Glu Ser Gly
275 280 285
Asp Ala Ser Ser Gln Gln Pro Arg Phe Asp Gln Val Gln Asn Gln Val
290 295 300
Glu Ala Met Asn Asp Asp Met Asp Lys Val Leu Gln Cys Ser Cys Ser
305 310 315 320
Lys Gln Ser Asp Met Ile Val Leu Leu Ser Leu Val Ile Phe Lys Ile
325 330 335
Leu Ala Trp Tyr Ala Ala Ala Val Asn Ala Ala Thr Ser Asp Asp Asn
340 345 350
Glu Pro Asp Thr Leu Asp Ser Ala Asp Ala Lys Pro Thr Pro Ser Arg
355 360 365
Arg Arg Leu Val Leu Pro Ser Ser Trp Ala Asp Val Asp Gly Asp Glu
370 375 380
Ser Glu Gly Glu Asp Gln Arg Arg Ile Phe Ile Gln His Val Leu Ser
385 390 395 400
Arg Leu Thr Gly Leu Gln Ile Leu Ile Gly Arg Leu Ser Gln Leu Phe
405 410 415
Thr Asn Val Glu Ser Glu Ser Trp Pro Ser Ala Ala Leu Arg Pro Ala
420 425 430
Ala Gln Gly Pro Phe His Ser Val Ile Glu Gly Lys Ile Ile Ile Met
435 440 445
Pro Phe Ser Asn Ser Leu Leu Ser Ala Leu Ser Ser Asp Leu Arg Asn
450 455 460
Arg Leu Cys Gly Met Ser Arg Ala Ile Met Glu Lys Leu Arg Val Val
465 470 475 480
<210>3
<211>5614
<212>DNA
<213> Cordyceps Ophioglossoides (Tolypocladium ohioglossoides)
<220>
<221>gene
<400>3
atgggccagg cttctgaagg gcaaggcccg tcgcgcctcc tttatttcag caacgagttc 60
cctccccatg acctgcagac actactccgg cggttgcaca atcacagcaa agacaggaga 120
catccccacc tcgcccggtt cctcgacgaa gcgaccactg ccgttcgcga tgaggtggac 180
aggttgcctt tggagctgag aagacttgtc cctcgcttcg aatcggtaca gagcttggca 240
tcagacgaga gacttcgacg tggggtgttg agtggctcaa ttgacggcgt cctgctctgt 300
ctagtgcaaa ttgcatcttt cattgggtag gacggcactc gtccgaccag caacatacac 360
tttgctgacg gcaacaatgt agccactgcg agactgatcc cggacatatc gacttctccg 420
acttggagaa caatacagtg cttgcgggac tgggccttgg tctgctcgtg tccactgccg 480
tgtctgttgc accgaccctg ggagccctcc cgctcgtggg cgccgaggtg atccacattg 540
cgtttcgcct gggcgtcttt gtcgcccaag tctctcaaac ccttgagcct ttggacgagg 600
aaggaaagtt cgattcttgg gcacatgtcg tcgacggtgt cacgcccgag gatgcccagc 660
gggagcttca tgacatttat tctcgacagg tgcggatggc cccagccatt gcaagcgtaa 720
gctgacgagt cacagcaaac tccggaagcg tccaagatat tcgtaagcgc caaaagtcgg 780
tcctcgacca cggtgagcgg gccgccctca cggctcaagg agcttttccg cacgtcggcc 840
ttgttccgcg accacaagtc cgtcgcgttg cccgtgtttg gaggcctttg ccatgcagaa 900
cacgtgtaca cggaagagga tgccattcag gttgtcggtt cgcccgcgct cgatgcgccc 960
ttgtctccgc gagtgcctat ccttgcgacc agcactggcg ccccgtttct cgctgagagc 1020
accactcagc tgttccaaca agtcattctc gagattatga cccgccagat tgtttgggac 1080
aatgttctcg acggcgcaat taagggatgc atggggttcg cctctcgaga cgtgcaagtt 1140
atggcctttg gagcctcgtt acccgccaac gagctcaagg cagcgttggg tggagcagtt 1200
gaagaggcta caatcaagct tgtggatctc ctaacttggg ccaccgacac ggactcgttg 1260
ctgcatgagc gcaggcctag aacctgccat cagtccaaga ttgccattgt tggcatgtct 1320
tgcagaatgc cgtcgggcgc aacagacacc gccaaattct gggagctcct cgagcaagga 1380
ctcgacgtgc accggctgat accagaggac cgctttgacg tggcctcgca ctatgacccg 1440
gagcgcaaaa acaccaatgc cagccacacg gcatatggct gtttcatcga cgagccaggc 1500
ctgttcgatg ccccgttctt caacatgtct ccacgcgaag cagaacagac tgacccgatg 1560
caacggttag cccttgtaac agcttatgag gctctcgaaa gggccggctt tgtagccaac 1620
cggacggcct cttctgacaa gactcgggtt gggacatggt acggacaggc tagcgatgac 1680
tacagggaag tcaacacagc tcaggagatt agcacctact ttatccccgg tggctgccgt 1740
gcctttggac ccggccgcat taactacttt ttcaagttct cgggacccag ttacagctgt 1800
gacacggctt gttcatccag tttagcaact attcaagtca gtcgtaccgc ccctagctag 1860
ttggtcggat atcttactga acggtcttca gactgcctgc acagctcttt ggaacggcga 1920
agtcgacaca gtcgtagccg gaggaatgaa cgttctcagc aactcggacg cattttcggg 1980
gcttagccacggacatttcc tcaccgaaac acccaatgcc tgcaaaacat gggatattga 2040
cgcagacggc tactgtcgtg gtgatggagt cgcctcgatt gttatgagaa ggctagagga 2100
tgccgaggcg gacaacgaca acatattagg agtaatcctg ggcgcgggaa ccaaccattc 2160
tgccgaggcc gtgtccatca ctcaccccca tgcaggcact caatccttct tgtatcgcaa 2220
agttctcgac caagctggcg tagacgcatt tgatgtgagc tacatcgagg cgcacggtac 2280
tggaacgcag gctggcgatt ttcaagaact gacatccatc acggatgtct ttgcacccct 2340
cgcgaagcgc cgaacggcaa agcaaccact taccattggt gctgtcaaag ccaacgtcgg 2400
tcatggcgaa gcagttgctg gtgtgactgc attgctcaag gtgctgctca tgttcgagca 2460
cgagatgata ccaccgcacg tgggcatcaa gacgcagctg agccccaaac ttcctcggca 2520
tctagataaa agaaacctgc acatcccctt cgagtctact ccgtggactc gaacgccggg 2580
aagaaaacgg attgcattgg ttaacagctt cagcgcggcc ggtggcaata cgtcgctttt 2640
gctggaagaa ggcccggacc gatcgaccac agatgtcgac cctcgcccaa cccacaccgt 2700
caccttatca gccaagagca agagctcgtt aaggggcaat attgagcggt tgattgccta 2760
ccttgagcgg aacccagcag tctccctggc agacctggcc tacacaacca ctgctcggcg 2820
tcaccactac aaccacaggc tggtcttcca cgctccggac gtatcccagc tgcgcgagca 2880
gctcgtctcg agcttagagc gcgttgactc acgccggcca atccccaacg gcttccttcc 2940
gtccgtcgca ttcacattca ccggccaagg cgcgtccaac aagtccagca acctgcagct 3000
gttccaccat tcacacgtct tccgctccca aatcgctaca cttgacgcgc ttgcgcagcg 3060
tcttggcttc ccctcgttca tcccgtcgat tgacggcagc catgacaagg actacgacca 3120
tggcgccgtc atcacgcacg tcgcccttac ttgcgtagaa attgcgcttg ccaagtactg 3180
ggaatctctg ggcgtcaagc ctgatgcggt gatagggcat agtctaggcg agtttgccgc 3240
actttgtgtc gctggcgtga tctccgctag tgacgccatc tatctcgtcg gcaagcgagc 3300
gcaattactt cagcagagat gcgaggccgg gacccatgtc atgttggctg ttcgggcatc 3360
cgtggatcag atcaagggtg ctgttgggga cctgtcctac gagattgcct gcatcaacca 3420
tccagaagcc acggtgctca gcggtactag acaggagatg gaagccgtga aagcagtgct 3480
caaagagaaa ggataccatt gtaccgcact cgatattgcc tacgccttcc actcggcgca 3540
aaccgaccca atcctggatg atttcgaaca agtcgccaac cacagtgtcg ttttccggga 3600
gcccaagatc ccagtaattt caccgtcact ggccaaggtc atttgcgatg ataagactgt 3660
ggatggcacg tatctgcgaa gggcgactag ggagacgtgt gactttcttg cggctctctc 3720
gaaggccctt tcaatgtcca ttgtggacaa ggacacactt tggatagaga ttggtcctca 3780
ccccgtcaat gttggttttg tcaaggcaac tctggccctt tcttgtactg ctgtcccgtc 3840
tctccgtcgt ggcgaagaca attggacaac actcgcggaa agtcttggaa cgctccattg 3900
ctccggtcta gacgttagct ggagcgagtt tcatcgtccg tttgagagga atgtccgctt 3960
gctggacctg cctacgtata gctggaccaa caagaactac tggatccagt ataacggcaa 4020
ctgggcactc accaaaggca acacctttta cgacgatgga aacaagcttg aaccggctcc 4080
tgtctcatcc cttcaaactt cgcttgtcca gaccatcatc gaagaggact tctctggaac 4140
ctcaggcaat gtgacaatgc agtccaacct catgctatcc gacttcctta ttgcggctcg 4200
tggccatagc atgaacggat gcggcgtggt cacatcagta agcaatatct cgtctcttga 4260
ccttgatgtc tgtctaatca cacattgcta gtctatccac gccgacattg cctacacgct 4320
cgctgagtac atgacgaaga agcttggaac tcccctcaag tgtgaaaatt tgagcatttc 4380
aaacttgaag gttgccaaag gcctcgtcgt ccaggccgac acatcgaagc cacaactcat 4440
ccgtgtcaca gcgactacga gcgatgtcaa caacggcatg gacctcgcgt ggtacaacgt 4500
gctccacgat ggcacaccgg agtcggaata tttcgccact gccaatgtct tttgtggtag 4560
tgccgatgag tacctgaaat catgggcgcc catggcacac cttgttgaga gtcgcatcga 4620
cgtcctggag aacatggcac gtcaagggat tgcaaatcgg ttctctcgaa aaatggccta 4680
cactcttttc gcctccggtt tggtcgacta cgccgacaag taccgcggta tgcagtcggt 4740
cgtcatgcac gaattcgagg ctttcgcaaa tgtcaagctc acaacggaga agagcggagt 4800
gtggacggtg ccgccacact tcattgatag cgtcgcccat ctggctggat tcgtcatgaa 4860
cgtttctgat gctcacgata caacgaaaaa cttctgcgtc acacctggtt ggcaatacat 4920
gcggctggcg cagccgctcg aggccggagc cgagtatcgg tcttacgtca agatgattcc 4980
gtctcaggac gatcaaagtg tcttcgtcgg agatgtctat gtcatgagag gaggcagcat 5040
cgtaggcatg gtcggtggaa tccaattccg tcgataccct cggatcttgc tcgaccgttt 5100
cttctcgccc cccgactcga gtgctgccaa atcctttacc gccgctcagg agccccagaa 5160
ggctccatta ccgaaacaca ttcctcgcct gccagcttta tctgttagca aacagtgtcc 5220
ctcagatgac acaaaaagtc ctaggtctag cctaaccgag tcgtccaagt cgtctcaaag 5280
agatctcagc ataggatccg attacgccag tgaccccatg cgaagcgaga ctcctgcaac 5340
agacgaaggc tccgaaaagg tggctccggc tcccgaggac cccgacagca ccgcagttaa 5400
ggctattgct ctcattgcta gtcagactgg tatcgaaatt gcagacttga ccgacgatgc 5460
gaggtttggg gatcttggtg tcgacagtct catgagcctg gtacttgcag agaaattccg 5520
cgttgatctt agcattactg taaacagcag tcttttcctc gagtacccaa ctttaggcgc 5580
tttaaagcgc tggcttaagg aatattatga ctag 5614
<210>4
<211>4169
<212>DNA
<213> Cordyceps Ophioglossoides (Tolypocladium ohioglossoides)
<220>
<221>gene
<400>4
atgtttcttc aaagcctgga ggagctcttg gagcccagcc aggaagaata tcgttccatt 60
catcgaacaa tcgcggggtt cgacgttggc gacgtcgaac ggcgagctac tgccgagaag 120
ctcccggcgt ggcatctctg cagtgcagcg tggtcgatcg tattgacccg ccacatttct 180
caaagttggt tggcgtttct agccaccgat gtcttgcgcc aaaaaagccc aaatggatgg 240
gagttgggtt ctttcgcaaa tatccaggcc tctgttgatg aggacagcac tttttccgaa 300
ttgctgcaca agggtttggc cgtctccgtt gatgctcatc gaccacccct caccgcgaca 360
tcgtcgacca tgatcgttta ccctcttgca acttttgctg gaattacgga gttggctctg 420
cctcgggagg tgaagtcaga tataacgatt caattactgt ccaagcgacc aaagagtatt 480
caagcaactt gccgctatcg cacttcgcta ccgggacaat atgtcgagaa ggtcgtggac 540
catttcctac acctattacg gcatgtcatg aactacaggg catggaactc gctctgcatt 600
agagacctat ccatgtcatc tctcgaagag gagctccaac ttcgacagga ctgccgacct 660
ggccgcaccc ttgccgacat ggaaatcggg tcggtccatc aactcgtccg ccgtcaggcc 720
cggagaactc ccgatctccc tgcccttgag ggccctggtg gcgatgtgct atcgtacttc 780
gaactagatc tcatctccga cttgatggcc ggagacttgc gtcatcgact cctggacgta 840
agtccacgtc cgcttagcac tggtctgtca gcagacagtg gcgtggtggt gggcatcatg 900
ctgcaaagat cgcctggcgt tgtaatcgcc atattgtcct gctggaaggc cggttgcgcg 960
gtagtgctcg ttgatcccaa ccagcctgct tccaggaatg gcctcattat tgaggagtgc 1020
aactgcgatc tcttgctggt ggacgggtcg tgggacagca gtgttgggaa agacgttgca 1080
tggagatttg actttgctgg cttgagggac aaaatgaaga caaaagacca ggccaccgag 1140
gcaaacaacg catcggaaat tgatctctcg aaagaccttt ttcgaccagc atggctcagg 1200
gttacttcgg gctctaccgg gaggcccaag tgtgctttgc acagtcacgc agcgtttggt 1260
tcctcgattg ccagttacgc agggagaata cgtgcttcca agaccttact cttcttcagt 1320
cccatttcgt ctgcgtctgg aaatgccatt tggacctttc tcaccaatgg cggatgtgtg 1380
tgtataccgc ctcaggaaga aatcacttcc gatctcgcag gctgcattaa tcgctacggg 1440
atagacgaca tctgcattac accctcggcg ctctccctca caagcccgga ccaggtcccg 1500
aatttgaaga ctgtgtcgct cgttggcgaa gcggtcccac gtcctgctgg ggagacttgg 1560
agcccgtatg tgtcattgttgataggttat ggcgcaacgg aaatgaactc gcactcttta 1620
cccttccacg acgagccgta agtacatatt ggcatacaat gctttttgcc catggagctg 1680
tgctaatatg tctgccattc agtacgggaa ctcttcctcc tgcccatcca cttccaactt 1740
cagattactc gctctacatc ctgcgaccag gaacgatgga tatgtgtcct ctgtatgttc 1800
caggagagat ttgccttagc tcaacctaca tgagctcagg gtacatcaat aggcccgagg 1860
ctacctcgca agtctttgta cctcatccgt ttccgggaga cgctgggcac gcctacattt 1920
atcgaactgg cgacttaggc atgttcattg gggaccgacg cttcgtcgta ctcggtcgat 1980
ttgacttcca gttcaaggtt gatggtaacc gcatacagcc ggaagaggta gagtccatcg 2040
tcaaccaagt accacaagtg atcaagagca gggtcattct gattcagccc tcagcgggac 2100
gtccagtcat ggcatgctgt gtgatcttaa aaaaggcctt gacaaacggc cttggtgaag 2160
acaacggttg gaaggatttc gtgtccgcgg ccgaaaaggc ttgcaccgac catttgccgg 2220
tgtacatgat gcctcacaga tggctgcaat ttgaaacttt cccagaaacg cccacagcca 2280
agacagacac aaaggaatta gcccgagaag cgcaaagcat catcgaacaa gaaagtctgg 2340
tcgtttcagc tgacgactgc aagaagcagc aaggacgcat ctctaggaaa ggaaggcttt 2400
tcctggacct ggctctcgag accctggcag gccaaaatcc cgacacattg cctttggaag 2460
tacgtgaaaa gatgcaagcc caatctttca tcgcgagcgg aggtacctcc ttgctgtctc 2520
tgcaactcag gtcgcaatta agaaagcgag gtgttgagct tccaatctcg acattataca 2580
gccgacagag cctaatagag acggcgttgg cttttgcggt agcaaaggga gaaacagacg 2640
aggctccagc ggaagcagca gagactgttt caacggcaac agaagctctg cttccgagaa 2700
tgccacccga tgtccagcta gatcttgcgg gttacgaagc catctttccg acgacgatgc 2760
tccaaagaga gatgatcgtg acgagcatac tagatccaaa gtcatggatg ttctaccaat 2820
tctttgacct ttctcaatcc agctgcactg tttctcagct acaggaagcg atcggtctct 2880
tggtgtcggc aaagcagaat ctgaggacgg ttttgtcgct tctggacgtg cagagtaacc 2940
caacaacgat agaaagcccg gacagtgctt tcgacctgat caacaacggc gaatttgttc 3000
aggcaatctt gaagcccaac gtatttaaca tggaattctc gcaagaagac aacatggagg 3060
agccggagga gttccggaga cgagatgtca acaggaagtg ggcattcgcc caaccgctct 3120
ggagggtggc attcctgtca aaggtgagat tgctcgcatg gtctttccac cacgctcttt 3180
tcgacgcatg ggtagcccgt aatatctccc aagacctcca tgctatccta gtgggaatcc 3240
ttcagcggga cagttgccag ccaggaagtc agaaggcttt ggccgacgct tgcgagaatg 3300
ccacaaagcc ctcgattgaa cagtgggttc ttgccaatta cgggaccaac ggactcgacg 3360
gctcgccgac acctgttgtc caagaacaca ggagagtttg ggaagatttc atggcgaacg 3420
cgacgcccac cccaatatcc gatgaactca ggctgcctta cgaggcgtta ccagcacctc 3480
cgctcatgaa ggcggtcgag tttctttcct acggggattg gtgccgacgg catcacgtca 3540
cggctgccgc actgttccat gccgttggtg ccctgacaat tgctcggctg cttaattggt 3600
ggcgacccga tggaccccaa gaaccggccg aagaggtaac ttactatcgg ctcagttcga 3660
accgagccac ggcccagggt gctacggaga tggagggcgc cttggtttct ataagtccaa 3720
tgcgtgtctc ggttcctgct ggttctgatg ccgtcgccat ctcgcagtgc gctctgaaaa 3780
attggctggc gacacaggaa tcagacccct actaccttga cggacacctg gtgcccacag 3840
gccccgaacc aacggcaaga cggcgccgct ggggcaacgt gctgctcaac cacattgtca 3900
accaggaacc agaaggcgac gctgcgccat cttttcgcgg agtcgttgag gacaagtgtg 3960
gcttcgccat ggtttggcca tttgcagcgt tggagctcgc agttgtcgag acggactcca 4020
aaaaagcaga cgctctccag ctatgtgtca tgtctacgct agagcgacgg agcactgagg 4080
atttcgtcga tgcgtttgtt cagattctgc gggtagtggt cgagactgaa agtggtgtga 4140
atgccaagga gataattcag cagctatag 4169
<210>5
<211>6459
<212>DNA
<213> Cordyceps Ophioglossoides (Tolypocladium ohioglossoides)
<220>
<221>gene
<400>5
atgggcagca tcatcaagga atcatatcgc agctgcgagc agcagcaaca agacgacgtt 60
cccgaagctg gcgacttatt ccaccgggat gtttttttcc catctctcat agaaggccat 120
gcacgtttgc agcctttgcg catctgtctc gtttccacct cggcaacatt cgactatgcg 180
aatctctgga atctggtgct ggtcaacgcc aggcggttct cccaacatgg tgtcgaccaa 240
aactcaaggg tggccatagt gtccgagtca tgtccagcgg cagtagtggc tttgcttgcc 300
gttctcaaag tcggagctgt tggcgtgccc ctcggctcgt cgctccccga ggctcgcatt 360
cgagacatgg cccagctagg cgggctgaca cactgggttg ccttgacgcc tctttcgaag 420
cagttcagct tgcccgacgt gagtcgactc actattgatc tggatttgcg agagccagaa 480
cgcctgcccg aacacgcatc accctcggaa gtagatgctc aagcacctgc catcgtcata 540
tttacttcag gcagcactgg agagccaaaa ggtgtggttc actcccacgc aagtctgagc 600
acaatggcct ttactgtagc caaggccttg cacttggctc cgcacgagcg caattttctc 660
ttcccttctt tcggctgggc ggtcaacatc atcgacagct tttcaacact cgtagccggc 720
gcctgtcttt gcatgccgac agagaccgag aagtctcatg gcttggagga tgcaatatgt 780
cgtttcgatg ccactcgcac gacgctgccg tcttccgtgc tggggatcat ggagccaagc 840
accgtcccgt cgttgacgag catcgtcctt gccggggagc caatgcgccc agacctggtc 900
cgcaattggg gtcctcacgt ggccatttat tggaattatg gctcctcgga gacccttatg 960
gtgctggcag ggaacgctgc ccagcgcgac agcgacacct tgaacgccgg ccatgctctg 1020
acgtcctgcc gttgctacat tgttgacgat agtggcggcc aacttccacc tgggcgggcc 1080
ggccaactca tgatcgaagg ccacaccaac tccatgggct atttgcagga tgggaaaatc 1140
cgtcatcgtg agcgcggacg gagtggttgc gtagttgtac catccggaga tctttttgag 1200
caagacattc ggagcgcggc gtttatgcac cgtggacgga tcgactccca gctgaagctt 1260
gcaggccaga gatttgagcc acaggaggta gaaaataagc tgtgttcagc tcttaccggc 1320
gtcaaggagt tggccgtcac agtagcgacg ctgaaaggga acgcgagagg ccctgctctt 1380
gtggcagtag tagtcctcga acgcaaagac tcgaccgaaa ggccgtctcc cgggcgcttg 1440
gactgcgact tcgaacgcct tgtacagaca ctgccgccct acatgatacc gatcggaggc 1500
ttagaagtcg acaaactccc gaggctgcac aacggcaagc tcgaccgcag aggcgtcgtc 1560
tctttggcag aacagcgaga tgtcgccgac ttaatggact tgcgacctcc gcaagcggat 1620
caaatcatgg accatgacac ctgtttgaca agcaaagtcg ctctcgtatg ggctacggtc 1680
ttgggattgg acgtggaaga cgtcaaacct ggctcgagtt tcttcctcct tggtggtaac 1740
tctctttacg caatgagagc atgcaaagag ttgcgacaga ttggcattct ggtgtctgtc 1800
tctgacttct tcctccatcc gacattgggc ggcatggtgc atgtgattgc tacgcaaaac 1860
gagactcgat ccgaagaagc tcaacaaccg tcacaggacc gcccgtccct ttccgaggta 1920
gcggctagtg agcttcataa gatagcggcc aagcagtgcg gcgtccatga gggactgatt 1980
gagaacatct atcattgcac gccgatgcag gctgcactga tgacgctcag cgaagtgcaa 2040
gatggtgcat acgttgcgga gcacacgttt cgacttcccg catcttggtc aaggacagcc 2100
tttatccatg cgtggctacg agtcgccaac gcaaccccga tgttgcgcag ccggattgtg 2160
cggcatgaca atggaagact gcataatgtc acaatgcggt ttgaccaaga cgcggccctg 2220
cctttggagg cgctcccgga tccattgcca atgacctgtg gatcacaatt gttcctgcat 2280
tgtctcgaca tggatcagag caatgatggc ttgacatggc gctggcggat acaccattcc 2340
atatacgatc gatggtctac caaccttatc cttgagatgg tccagaaaga gtatcacaag 2400
caggagacga tacatatcat gcctttctca gtatttgcaa gtgccgtggt caagcaacaa 2460
caatctgaca aggcaaagga cttctggcac tccagactag aatcttttac cggcagcgtt 2520
tttccgcagc tgcctcttga tcatttcatc tgccgggctt ctagctcgct ttcttttgaa 2580
tgcagaatac agagacaaag gcgcgctaca acgcaggcca cttcgattca agccgccctt 2640
gccctgctca tctcgaaaat gcatggcgag tcagacgtcg tctttggaat gactgtccat 2700
ggaagagcat ggtccgagtg tccggacgct gaaaccgtag tcggtccagc catcgcaacc 2760
gtgcctatgc ggattcagct cgatggccgc atgcaagtgt gcgcatttct ccaacacgtg 2820
cagacccaag cggcactcat gtccgacttc gaacactacg ctttacagaa catcaagtcg 2880
attgggccag gttctgtatc cgctgcgtct ttcacaacgc tcttgattgt acagtcagac 2940
tttgaattgg gccttggccg cggccctgga agcattgtcg aaatcaacac tggttcgtct 3000
gacttatacg tcgactatcc gctggttatt gaatgcttcc cacattcagg gggcatcaag 3060
gtaaagatgc tctacgatgc tgccgtcatc tcggagtgga atgtacggat gatggccaag 3120
cactttggac agttgctcaa cgaaatcgaa tgcaactcgg atccatcggc agccatcatg 3180
gacttgaagc tactgagcta cgagactgcg tcagatgtcc ttcgcacgag ctgcggtgat 3240
ctcctcgaac gtcgcgagtg ccttcacgag cggatatttg ccaaagcgaa agcctgggag 3300
gccgaagatg cgctccacgg atgggacgcc aagtatacat atgacgagct gcatcgtcat 3360
gtccaggcac ttgccgcacg cctctcccta agccttgggg gtacctcggc aaagattgtt 3420
cctatttgct atcagaaatc cgcagccgcc gttgtcgcaa tgttggcgac cctttcagcc 3480
ggtcatgctt ttctcatgct tgatcccgct ctgcctgctc agaggatcaa gtatatgctc 3540
gaaaccgtca atgctgaccg gatagtctgc tcctccgata ccaggcgact tgtcgaagat 3600
gttggagccc atccagtcaa tttcgagggc atgatcaatg ccgcttcgtg cgctccaggg 3660
gccctagagc gcctcgtgga cgctcagagc tccgtgtcgc cagatgagcc ggcgtactgc 3720
atgtttacgt ctggctctac cggatcgcca aaaggagtgc ttcttctgca caaacaagtt 3780
acgagtggtc tcgaagcgca atgtagcgtc gggctctatc gtcggaagac gcgtatactc 3840
cagttctcca gctacggctt tgacacgtgc atcgccgaca tcttcgccac cttgctgagt 3900
ggaggatgcg tatgtgtctc caaggacgaa gacaagctgg tgcgaatctc tgaggatatc 3960
aacgacttct ctgccaccgc aatcgatctg acgccctcgg tcgcaagatt gatccatccg 4020
gaccgtgtac ccaaattgca gacacttcgt ctcggaggcg agccaatgca tcatcaccac 4080
gtccaaacat gggcgagccg ttgtaatctt cagaatacgt atggcccaac cgaatgctgc 4140
gtgcagtgca cgttcgtgga ccatgtacac gacaccatgc ctccgtcggt gattggaaag 4200
ggaattggct gtcatacttg ggtcgtagat ccggaaaatc acaagcatct tatgccattg 4260
ggagcaatcg gcgagctagc catccagggt cctgccgttg ccagtgggta tatcaacagc 4320
ccggccaagt cgaaggcctc atttctatcc aaggcgcctt ggctagagac ttacaacatc 4380
gaatgccact tcccgacata tctcactgga gacctggtca agttcaatga acaaggcaat 4440
ctagtcttca tcggaagaag agataatcag atcaagatcc gcggtcagcg cgtcgaaccg 4500
gaggaaatcg agcatatcct ccagcaagat ccacacacca agcaggctgt cgtatgctgc 4560
ccagcaactg gggtcatggc atcccagcta gtcgctctcc tcgagccgtc tcacttggac 4620
ccttgttcat cgtcatcatc atcaggcgcc ggcatgcatc aattgtctag acatacggta 4680
tcctggatgg aaagatgcgc ccaaaaggca gcagagttcc ttccccatta tatggtcccc 4740
gcggtgtact tgttagcgga tcagacgctg ctcatgtcct cgggtaagct tgatcgtcga 4800
agcatgcagc aatggcttga gcaaatgtcc cccgaccagc tcgactcctt gaatgtgtac 4860
gagaggacca caagcgcaat tccagtctca tcaccgcctg acctgccgga atcggtgata 4920
tccccaatcg tggaacaaat ccgttatctc ctctcgtgga catcaggtga ccagcctaat 4980
ttctcaaccc ggcactcatt ctcccgcatt ggcctcgatt ccattaccat agttcctctt 5040
ttgacctgga tcaacaagat ttatcaagca aagatggata tgcagacact gctcagactc 5100
gaaacggctc acgacctcgg gtgctacctc cataacagaa cagcgcaaga cgtgagtgga 5160
aatatttccg gcgaggacta cgaaatgttt caaggcatca tttccaaagg cgtgagccgg 5220
ctttgccgcg acaacgattc atttgatccg cggagggttc tcctgaccgg aggcagtagc 5280
cttgtcggtc tcaatatcct ccttgggctt ctgaatcgat tcccatcaac ccaagtgaca 5340
gttttgatgc gctgtgtcaa cgcagcggct ggcaaagaac gtctagtcga gaaacttgag 5400
cttcttggct catggagaga tgacttcaca gaccgaattg aggtctgggc cggggatttg 5460
agccgtcatc atttcggcct ttctcctttg cactggtcac agcttggagg acgcggagat 5520
ttatctacaa acgttgagtg cgtcatacat aacgccgcag ccgtcgattg gttccaagga 5580
ttccagagtc tcaaaagggt caatgtagac gcaacgcttg agcttgtcga atgcgtgagg 5640
gactctccaa gcatcaaacg gctgatttac gtgtctggcg gtcctcaatg ggatcctggc 5700
gaaagcgagg aagcgatatt gcaggggcga gggttggaag atgcatttgc acgatcgaac 5760
gcatatggcc agacaaagat gataaccagc actatcatcc agcgggcggc agctcgcatt 5820
ccctgtttgg cggccaaggt ctcgataatt cgccccgcgc tgatcattgg gtcctcaacg 5880
gatggtgtgc caaacattga cgatttcatc tggcgagtgg taatgggctg ctacgctatc 5940
cgcgctttcc cagaagagtc caaaggcaat tgggtctacc tttgtggcgc tgacggtttc 6000
gcgaacatgg tgattgagag tctttcgtct cctcctcgac tttgcgagac aagatttaac 6060
aacggtcttg ccgtcgacga attctgggac gtggtcaatc aagaattgga aggccagctg 6120
gagcgcctag actacgacac atggctgcaa cgcctgaaag ggagcatatc tgcacatcgt 6180
cttcgcagca ccgagaacca tccatgtcaa cctatcttgc acatgctcga gtcgtccccg 6240
gaagttcttg gcgcgccggc gccacagtcg gtcgatgccg aatggcgcca acaaacgcag 6300
caagagtctg cgcaggtggt gcagagaaac atacggtaca tggcagatat aggctgcttt 6360
tccaaggcag agtcggtttg gtcggcaaga gtattcaatc gtagcaaggt gcgggtagag 6420
gagaatgggc aacttgtgaa cggggatcga attcgatag 6459
Claims (5)
1. A method for the biosynthesis of a compound balanol, comprising the steps of:
1) connecting the blnR gene fragment into a vector to obtain an expression plasmid;
the base sequence of the blnR gene segment is shown as SEQ ID NO: 1 is shown in the specification; 2) the expression plasmid is transformed into agrobacterium tumefaciens EHA105 by electric transformation, streptomycin and kanamycin resistance screening culture is carried out, and colony PCR identification is carried out to obtain agrobacterium with the expression plasmid;
3) inoculating Agrobacterium with expression plasmid to liquid culture medium, shaking culturing in dark place, taking culture solution, and resuspending the strain to OD6000.1-0.15, and shake culturing in dark to make OD600Reaching 0.5-0.6 to obtain recombinant agrobacterium EHA105 bacterial liquid;
4) culturing Cordyceps ophioglossoides, collecting conidia of Cordyceps ophioglossoides, and counting by a blood ball counter to adjust the spore concentration to (0.5-5) × 106Obtaining a Cordyceps ophioglossoides conidium suspension liquid;
5) mixing the recombinant agrobacterium EHA105 bacterial liquid and the ascochyta fluviatilis conidium suspension, and carrying out light-resistant co-culture to obtain co-culture mixed thalli;
6) washing the co-cultured mixed thalli with sterile water, coating the co-cultured mixed thalli on a flat plate, performing inverted culture until a transformant appears, transferring the transformant to a selective flat plate for subculture for 3-5 times, and performing PCR identification to obtain an OE (OE: blnR) hydatid transformant;
7) carrying out fermentation culture on a correctly identified OE (bolan grass transformant of blnR ophioglossum, and separating fermentation liquor to obtain a compound balanol.
2. The method for the biosynthesis of compound balanol according to claim 1, wherein in step 4), the spore concentration is adjusted to (0.5-2) × 106One per ml.
3. A process for the biosynthesis of compound balanol according to claim 1, wherein in step 5) said conditions of co-cultivation in the absence of light are: co-culturing for 36-60 h at 24-28 ℃ in dark.
4. The method for the biosynthesis of compound balanol as claimed in claim 1, wherein in step 6), the transformant is grown upside down at 24 ℃ to 28 ℃.
5. The method for the biosynthesis of compound balanol as claimed in claim 1, wherein in step 6), the transformants are transferred onto selective plates for subculture 3-4 times.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710827974.0A CN107723308B (en) | 2017-09-14 | 2017-09-14 | Biosynthesis method and gene cluster of compound balanol |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710827974.0A CN107723308B (en) | 2017-09-14 | 2017-09-14 | Biosynthesis method and gene cluster of compound balanol |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107723308A CN107723308A (en) | 2018-02-23 |
CN107723308B true CN107723308B (en) | 2020-04-24 |
Family
ID=61206233
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710827974.0A Active CN107723308B (en) | 2017-09-14 | 2017-09-14 | Biosynthesis method and gene cluster of compound balanol |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107723308B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114231574A (en) * | 2021-11-25 | 2022-03-25 | 浙江大学 | Culture medium and method for producing protein kinase C inhibitor balanol |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1594541A (en) * | 2004-06-30 | 2005-03-16 | 浙江大学 | Chinese caterpillar fungus and its separating method |
-
2017
- 2017-09-14 CN CN201710827974.0A patent/CN107723308B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1594541A (en) * | 2004-06-30 | 2005-03-16 | 浙江大学 | Chinese caterpillar fungus and its separating method |
Non-Patent Citations (3)
Title |
---|
《COMPARISON OF BALANOL FROM VERTICILLIUM BALANOIDES AND OPHIOCORDIN FROM CORDYCEPS OPHIOGLOSSOIDES》;BOROS, C (BOROS, C); HAMILTON, SM (HAMILTON, SM); KATZ, B (KATZ,;《JOURNAL OF ANTIBIOTICS》;19940930;第47卷(第9期);全文 * |
《Formal total synthesis of (-)-balanol: a potent PKC inhibitor》;Yaragorla, S (Yaragorla, Srinivasarao)[ 1 ] ; Muthyala, R (Muthy;《TETRAHEDRON LETTERS》;20100120;第51卷(第3期);全文 * |
Yaragorla, S (Yaragorla, Srinivasarao)[ 1 ] * |
Also Published As
Publication number | Publication date |
---|---|
CN107723308A (en) | 2018-02-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110117601B (en) | Grifola frondosa glucan synthase, encoding gene and application thereof | |
CN113186183B (en) | Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product and application thereof | |
CN115197172B (en) | Sesterterpene compound, synthetic gene cluster and synthetic method thereof | |
CN107287171A (en) | A kind of enzyme and its application | |
CN115927029A (en) | Recombinant saccharomyces cerevisiae for producing cannabigerol acid and construction method and application thereof | |
CN113846024B (en) | Method for reducing byproduct fumaric acid in L-malic acid fermentation process, strain and application | |
Liu et al. | Identification of the genes involved in growth characters of medicinal fungus Ophiocordyceps sinensis based on Agrobacterium tumefaciens–mediated transformation | |
CN111471602A (en) | Construction method and application of mucor circinelloides engineering strain for efficiently synthesizing gamma-linolenic acid by using cellulose | |
CN113881579A (en) | Method for synthesizing trichoderma long-chain antibacterial peptide and improving antibacterial activity | |
CN107723308B (en) | Biosynthesis method and gene cluster of compound balanol | |
CN116926092B (en) | Pantothenate kinase gene RkPank and application thereof | |
CN116891808A (en) | Construction method and application of saccharomyces cerevisiae strain of cannabidiol synthase with subcellular structure positioning | |
Chen et al. | An efficient genetic transformation system for Chinese medicine fungus Tolypocladium ophioglossoides | |
CN107164400B (en) | Recombinant gene engineering bacterium for producing theophylline and caffeine and construction method and application thereof | |
CN107988092B (en) | Arthrobacter simplex mutant strain with stress tolerance and engineering bacterium | |
CN114262695B (en) | Saccharomyces cerevisiae engineering bacterium for producing CBGA precursor and construction method and application thereof | |
KR20020029767A (en) | Cyclic depsipeptide synthases, genes thereof and mass production system of cyclic depsipeptide | |
CN114525215A (en) | Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain | |
CN109777814B (en) | Application of ceramide synthetase gene in regulation and control of ganoderma triterpene biosynthesis | |
EP1223215A1 (en) | Transformant producing secondary metabolite modified with functional group and novel biosynthesis genes | |
CN111411122A (en) | Application of rice blast germ gene MoHXT2 in regulation and control of plant sugar transport function | |
CN110656097B (en) | Sucrose non-fermentation type protein kinase regulatory subunit and application thereof | |
CN112410353A (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
CN116121083B (en) | Beauveria bassiana strain as a spawning sporulation and application thereof in synthesis of oosporine in CZB | |
CN112661821B (en) | Citric acid transport protein and application thereof in lipid synthesis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |