CN112410353A

CN112410353A - fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene

Info

Publication number: CN112410353A
Application number: CN201910785355.9A
Authority: CN
Inventors: 陈少欣; 余志拓; 吴远杰; 张正玉; 赵苗苗
Original assignee: Shanghai Institute of Pharmaceutical Industry; China State Institute of Pharmaceutical Industry
Current assignee: Shanghai Institute of Pharmaceutical Industry; China State Institute of Pharmaceutical Industry
Priority date: 2019-08-23
Filing date: 2019-08-23
Publication date: 2021-02-26
Anticipated expiration: 2039-08-23
Also published as: CN112410353B

Abstract

The invention provides an fkbS gene, and an encoded amino acid sequence of the fkbS gene is shown in SEQ ID No. 2. The invention also provides a genetically engineered bacterium for producing ascomycin, which is an engineered bacterium for over-expressing the fkbS gene in Streptomyces hygroscopicus (Streptomyces hygroscopicus) naturally producing ascomycin. In addition, the invention also provides a preparation method and application of the genetic engineering bacteria. The genetic engineering bacteria can effectively improve the yield of the ascomycin and reduce the impurity content; the ascomycin produced by using the genetic engineering bacteria has lower cost and is suitable for industrial production.

Description

fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene

Technical Field

The invention relates to the field of genetic engineering, in particular to an fkbS gene, a genetic engineering bacterium containing the fkbS gene, a preparation method and application of the fkbS gene.

Background

crotonyl-CoA reductase (CCR) plays an important role in the secondary metabolic processes of microorganisms, and it catalyzes crotonyl-CoA to synthesize ethylmalonyl-CoA, which is a key precursor for the formation of ascomycin (FK 520) structure. In the ascomycin producing strain (Streptomyces hygroscopicus var. ascomyces ATCC 14891), the biosynthetic cluster reported so far is not complete, and in particular only 460bp of the gene fkbS encoding crotonyl-CoA reductase is reported. A recently published patent (CN107629994A) raised ascomycin to 550mg/L and 10% FK523/FK520 (FIG. 1, R is CH) by incorporating exogenous genes encoding crotonyl-CoA reductase and 3-oxoacyl-acyl carrier protein synthase III into ascomycin-producing bacteria₂CH₃The structural diagram is shown as ascomycin FK 520; r is CH₂The structural diagram is shown as key impurity FK 523). Overexpression of a Streptomyces coelicolor-derived crotonyl-CoA reductase gene in an ascomycin-producing strain has also been reported to increase ascomycin to 361.67mg/L (Microbial Cell factors, 2017,16(1): 169.). However, both examples employ the means of exogenous crotonyl-CoA reductase gene overexpressionThe functions of increasing the yield of ascomycin and reducing impurities are limited, and the requirements of industrial production cannot be met. At present, no report is found on the research and application of self-crotonyl-CoA reductase gene fkbS in Streptomyces hygroscopicus (Streptomyces hygroscopicus) as a strain for producing ascomycin.

Disclosure of Invention

The invention aims to overcome the defects of low yield and high impurity content of ascomycin produced by a microbial fermentation method in the prior art, and provides an fkbS gene, a genetic engineering bacterium containing the fkbS gene, a preparation method and application of the fkbS gene. The genetic engineering bacteria can effectively improve the yield of the ascomycin and reduce the impurity content; the ascomycin produced by using the genetic engineering bacteria has lower cost and is suitable for industrial production.

In the prior art, the result of over-expressing exogenous crotonyl-CoA reductase gene is not ideal, and when the gene of endogenous crotonyl-CoA reductase is required to be over-expressed, the prior art only discloses 460bp endogenous crotonyl-CoA reductase coding gene fkbS, which cannot be transcribed and translated in ascomycin producing bacteria, so that crotonyl-CoA cannot be expressed. In the prior art, there are many methods for obtaining the complete sequence of the gene fkbS, the inventor designs a specific degenerate primer by using the conservative form of the amino acid sequence of the crotonyl-CoA reductase from different streptomyces through a large number of experiments, and successfully clones the endogenous crotonyl-CoA reductase coding gene fkbS full length from the ascomycin producing strain by matching with other improved PCR methods and the like, and obtains a very good effect when the full length gene is over-expressed in the ascomycin producing strain.

In order to solve the above technical problems, the first aspect of the present invention provides an fkbS gene, wherein the amino acid sequence encoded by the fkbS gene is shown in SEQ ID No. 2.

Preferably, the nucleotide sequence of the fkbS gene is shown in SEQ ID No. 1.

In order to solve the above-mentioned technical problems, the second aspect of the present invention provides a recombinant expression vector comprising the fkbS gene according to the first aspect of the present invention.

Preferably, the skeleton of the recombinant expression vector is a plasmid containing a strong promoter; more preferably, the skeleton of the recombinant expression vector is a plasmid containing an erythromycin resistance gene promoter, a streptomycete promoter or a thiostrepton inducible promoter; more preferably still, the backbone of the recombinant expression vector is a plasmid comprising Perm, kasOp or tipAp, preferably plasmid pSET-152.

In order to solve the above-mentioned technical problems, the third aspect of the present invention provides a transformant in which the fkbS gene according to the first aspect of the present invention or the recombinant expression vector according to the second aspect of the present invention is introduced into a host.

Preferably, the host is escherichia coli; preferably E.coli ET 12567.

In order to solve the above technical problems, a fourth aspect of the present invention provides an FKBS protein, the amino acid sequence of which is shown in SEQ ID No. 2.

In order to solve the above technical problems, a fifth aspect of the present invention provides a genetically engineered bacterium for producing ascomycin, which is an engineered bacterium that overexpresses the fkbS gene according to the first aspect of the present invention in Streptomyces hygroscopicus (Streptomyces hygroscopicus) naturally producing ascomycin.

Preferably, the genetically engineered bacterium is an engineered bacterium integrating the fkbS gene in the genome of the naturally ascomycin-producing streptomyces hygroscopicus; the site of integration is preferably an attB site, more preferably a Φ C31 attB site.

Preferably, the genetically engineered bacterium is an engineered bacterium comprising a recombinant expression vector containing the fkbS gene.

Preferably, the naturally ascomycin-producing S.hygroscopicus contains one, two or three copies of the fkbS gene.

Preferably, the naturally ascomycin producing S.hygroscopicus is S.hygroscopicus ATCC 14891.

In order to solve the above technical problems, a sixth aspect of the present invention provides a method for preparing a genetically engineered bacterium according to the fifth aspect of the present invention, comprising culturing a transformant according to the third aspect of the present invention in a conjugal culture with a naturally ascomycin-producing Streptomyces hygroscopicus, and selecting a conjugant.

Preferably, the conjugation culture is in MS culture medium, and the culture temperature is 28 ℃.

In order to solve the above technical problems, the seventh aspect of the present invention provides a method for preparing ascomycin, which comprises fermenting the genetically engineered bacterium according to the fifth aspect of the present invention to obtain ascomycin from the fermentation broth.

Preferably, the fermentation medium of the fermentation comprises the following components: 6% of glycerol, 2% of yeast extract, 2% of soybean cake powder, 0.02% of potassium dihydrogen phosphate and trace elements; the percentage is the mass volume percentage (g/ml) of each component in the fermentation medium;

more preferably:

the fermentation medium of the fermentation further comprises 0.05-0.5% crotonic acid, such as 0.1%, 0.15% or 0.2% crotonic acid;

and/or the trace elements comprise the following components: FeSO₄·7H₂O 0.001％、ZnSO₄·7H₂O0.001％、CuSO₄·5H₂0.00001 percent of O, wherein the percentage is the mass volume percentage (g/ml) of each component in the fermentation medium;

and/or the pH value of the fermentation medium for fermentation is 6.5 +/-2;

and/or the fermentation temperature is 25-30 ℃, preferably 28 ℃;

and/or the culture time of the fermentation is 6-10 days, preferably 8 days;

and/or the culture rotating speed of the fermentation is 180-250 rpm, preferably 200 rpm.

Preferably, the method for preparing the ascomycin further comprises the steps of inoculating the genetically engineered bacteria into a seed culture medium for seed culture, and then transferring the obtained culture to a fermentation culture medium;

more preferably, the culture temperature of the seed culture medium is 25-30 ℃, and preferably 28 ℃; and/or the time of seed culture is 1-2 days; and/or the rotation speed of the seed culture is 180-250 rpm, preferably 200 rpm; and/or the inoculation amount of the transfer is 5-20%, preferably 10%.

In order to solve the above technical problems, an eighth aspect of the present invention provides the use of the genetically engineered bacterium according to the fifth aspect of the present invention in the preparation of an ascomycin.

In order to solve the above technical problems, a ninth aspect of the present invention provides the use of the fkbS gene according to the first aspect of the present invention for regulating the production of ascomycin or for synthesizing ethylmalonyl-CoA.

Preferably, the regulation of the yield of the ascomycin is to improve the yield of the ascomycin.

In addition, the invention also provides a degenerate primer pair, wherein the nucleotide sequence of the degenerate primer pair is shown as SEQ ID NO.4(5 '-RTGNNNGANATHHTNNNNGCN-3' (R ═ A, G; H ═ A, T, C; N ═ A, T, C, G)) and SEQ ID NO.5 (5'-TCACCGCACCCCCTCGG-3').

In addition, the invention also provides a kit containing the degenerate primer pair.

In addition, the invention also provides a fermentation medium, which comprises the following components: 6% of glycerol, 2% of yeast extract, 2% of soybean cake powder, 0.02% of monopotassium phosphate, trace elements and 0.05-0.5% of crotonic acid; the percentage is the mass volume percentage (g/ml) of each component in the culture medium.

Preferably, the pH value of the fermentation medium is 6.5 +/-2.

Preferably, the trace elements include the following components: FeSO₄·7H₂O 0.001％、ZnSO₄·7H₂O0.001％、CuSO₄·5H₂And O, 0.00001%, wherein the percentage is the mass volume percentage (g/ml) of each component in the fermentation medium.

Preferably, the crotonic acid is present in an amount of 0.05 to 0.2%, for example 0.1% or 0.15%.

Preferably, the fermentation temperature is 25-30 ℃, and preferably 28 ℃; and/or the culture time of the fermentation is 6-10 days, preferably 8 days; and/or the culture rotating speed of the fermentation is 180-250 rpm, preferably 200 rpm.

In addition, the invention also provides the application of the fermentation medium in culturing the genetically engineered bacterium according to the first aspect of the invention.

In addition, the invention also provides application of crotonic acid in improving yield of ascomycin.

In the present invention, the crotonic acid is a conventional crotonic acid in the art, and is generally an unsaturated fatty acid, and has a double bond and a carboxyl group in a molecule, and has both cis-isomer and trans-isomer.

Sequences and mutants having more than 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology to the FkbS sequence of the present invention are intended to fall within the scope of the present invention.

In the present invention, overexpression generally refers to an organism in which a sequence of a target gene and a backbone plasmid are constructed into a plasmid vector, and a large amount of the gene product is accumulated by means of conjugative transfer, transformation, or the like. The role of gene overexpression is mainly related to the function of the protein encoded by the gene itself. Generally, overexpression will result in increased levels of the protein, which, if overexpressed in bacteria, will facilitate mass production.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows:

according to the invention, the endogenous crotonyl-CoA reductase gene fkbS is overexpressed in streptomyces hygroscopicus naturally producing ascomycin, so that the yield of ascomycin is improved, and the impurity FK523 is reduced. In a preferred embodiment of the invention, in the ascomycin high-yield strain constructed by using the streptomyces hygroscopicus ATCC14891, the yield of ascomycin is above 1543.3mg/L, the highest yield can reach 2363.6mg/L, and the yield is improved by more than 89.64 percent compared with that of an original strain ATCC14891 (the yield of ascomycin of the original strain ATCC14891 is only 813.8 mg/L); the impurity ratio of FK523/FK520 can reach below 7.1%. The ascomycin produced by using the genetic engineering bacteria has lower cost and is suitable for industrial production.

Drawings

Fig. 1 is a structural diagram of FK523 and FK 520.

FIG. 2 is a liquid phase assay of FK520 in example 1.

FIG. 3 is a map of plasmid pSET-dCas 9-fkbS.

FIG. 4 is an electrophoretogram obtained by amplification from the genome of S.hygroscopicus using degenerate primers fkbS-J-F-1/fkbS-J-R in example 3; wherein M is a 1kb gene ruler; lane 1 is a graph showing the results of PCR products amplified with degenerate primers fkbS-J-F-1/fkbS-J-R.

FIG. 5 is an electrophoretogram obtained by amplification from the genome of Streptomyces hygroscopicus using degenerate primers fkbS-J-F-2/fkbS-J-R and fkbS-J-F-3/fkbS-J-R, respectively, in example 3, wherein M is a 1kb gene miller; lane 1 is a graph showing the results of PCR products amplified with degenerate primers fkbS-J-F-2/fkbS-J-R; lane 2 is a graph showing the results of PCR products amplified with degenerate primers fkbS-J-F-3/fkbS-J-R.

FIG. 6 shows the results of the sequencing in example 3.

FIG. 7 is a map of plasmid pSET-fkbS.

FIG. 8 is a map of plasmid pSET-2 fkbS.

FIG. 9 is a map of plasmid pSET-3 fkbS.

FIG. 10 is a map of plasmid pSET-ccr.

FIG. 11 is a map of the pSET-A2BE plasmid.

FIG. 12 is a map of the pSET-acc plasmid.

Detailed Description

The present invention is further illustrated by the following examples, which are intended to be purely exemplary and are not intended to limit the invention, and therefore should not be interpreted as limiting the scope of the examples described. The invention also includes all the numerous variations or modifications not exemplified herein. In particular, the sequence and the mutant having more than 80% homology with the FkbS sequence in the present invention should fall within the scope of the present invention.

The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

The strains, plasmids, reagents and instruments used in the invention:

the present invention relates to actinomycetes s.hygroscopicus var.ascomyces ATCC14891 purchased from american type culture collection bank (ATCC). pSET-152 used to construct the multi-expression plasmid was purchased from TaKaRa. The genome of the model bacterium Streptomyces coelicolor used as a template for PCR was a laboratory preservation (NCBI Access Number: AL 645882.2). Escherichia coli ET12567 for conjugation transfer was purchased from TaKaRa. The CRISPR/dCas9 system for fkbS functional validation is from Biotechnology Journal,2018: 1800121.

The DNA gel recovery and purification kit and the plasmid extraction kit used in the invention are purchased from the company of Biotechnology engineering (Shanghai), all restriction enzymes and DNA polymerases are purchased from Takara, the homologous recombination kit is purchased from Vazyme, crotonic acid is purchased from the company of national drug group chemical reagents, acetonitrile is purchased from the company of Amethyl Chemicals, and other conventional reagents are all domestic analytical pure or imported subpackages.

The constant temperature fermentation shaker used in the present invention was obtained from Shanghai Chu instruments Co., Ltd, and the model 1200 high performance liquid chromatograph was obtained from Agilent Technologies Co., Ltd.

The culture medium used in the present invention:

MS culture medium:

20g/L of mannitol, 20g/L of soybean cake powder and 20g/L of agar; sterilizing at 121 deg.C for 30 min.

2. Seed culture medium:

8g/L of corn steep liquor, 10g/L of glucose, 3g/L of cottonseed cake powder, 1g/L of monopotassium phosphate and pH 7.0; sterilizing at 121 deg.C for 30 min.

3. Fermentation medium:

60g/L of glycerin and 20g of yeast extractL, soybean cake powder 20g/L, potassium dihydrogen phosphate 0.2g/L, and trace elements (FeSO)₄·7H₂O,0.01g/L ZnSO₄·7H₂O,0.01g/L CuSO₄·5H₂O,0.0001g/L), pH 6.5; sterilizing at 121 deg.C for 30 min.

Example 1

The original strain S.hygroscopicus ATCC14891 producing ascomycin was inoculated into a 250ml shake flask containing 20ml of the above seed medium and grown for 2 days at 28 ℃ and 200 rpm. Then transferring the seed liquid with the inoculation amount of 10% into a 250ml shake flask filled with 25ml of the fermentation medium for fermentation culture, wherein the temperature is 28 ℃, the rpm is 200, and the fermentation period is 8 days. The yield of ascomycin in the fermentation broth was 813.8mg/L and the impurity ratio FK523/FK520 was 10.8% as determined by HPLC liquid phase method (see figure 2 for results) (calculation method of ascomycin is determined by quantitative method conventional in the art-internal standard method, specifically refer to AMB Express,2019,9(1):25 FK523/FK520 obtained by comparing peak areas of the two, etc.).

The sampling treatment method of the sample after the shake flask fermentation specifically comprises the following steps: adding acetone with 4 times volume into 300 μ l of the fermentation liquid after shake flask fermentation culture, performing ultrasonic treatment for 20min, centrifuging at 12000rpm for 3min, and collecting supernatant for HPLC analysis. The specific conditions of the HPLC liquid phase method are as follows:

liquid phase column: agilent C18,3.5um,4.6mm x 150 mm;

column temperature: 60 ℃;

detection wavelength: 205 nm;

flow rate: 2.0 ml/min;

a, mobile phase: 10% aqueous acetonitrile solution (0.01% acetic acid added)

B, mobile phase: acetonitrile (with 0.01% acetic acid)

The gradient conditions are shown in table 1.

TABLE 1

Example 2 use of CRISPR/dCas9 to study the role of crotonyl-CoA reductase in ascomycin FK520 biosynthesis

According to the reported partial gene sequence of crotonyl-CoA reductase coding gene fkbS (namely the nucleotide sequence of 460bp, NCBI access No: AF235504.1), designing corresponding sgRNA:

5'-gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt tttgag-3' (SEQ ID NO:3), inserted into the SpeI/EcoRI cleavage site of the pSET-dCas9 plasmid (Biotechnology Journal,2018:1800121, see methods and materials section for details), under the control of the promoter j223119 to construct the plasmid pSET-dCas9-fkbS (see FIG. 3). The dCas9 gene of pSET-dCas9-fkbS is expressed by the erythromycin resistance gene promoter Perm. The plasmid pSET-dCas9-fkbS was introduced into E.coli ET12567, and then introduced into a strain ATCC14891, which is a producer of FK520 (ascomycin) by means of conjugative transfer, to construct an engineered strain SFK-DfkbS. With reference to the culture method and the liquid phase detection method in example 1, the yield of ascomycin in the engineered strain SFK-DfkbS was found to be only 247.3 mg/L. It can be seen that by inhibiting the transcription of the partial fkbS sequence (460bp), the transcription of the full-length DNA is inhibited, so that fkbS cannot be completely transcribed, and thus has no catalytic function.

Example 3 amplification and sequencing of the fkbS Gene sequence Using degenerate primers

Conservative analysis of the amino acid sequences of crotonyl-CoA reductase (S. coelicofellavus (NCBI access No: WP-007387963.1), S. coelicolor (NCBI access No: NP-630556.1), S. mirabilis (NCBI access No: WP-037706421.1), S. griseofusas (NCBI access No: WP-037654730.1), S. Venezuela (NCBI access No: AGX26728.1), S.tsuubensis (NCBI access No: EI F93549.1), S.lasialensis (NCBI access No: WP-137304740.1), S.NBRC 110611(NCBI access No: WP-066930901.1), S.rapamycinics (NCBI access No: WP-020866310.1)) of various Streptomyces genes, upstream primers of the fkbS gene (NCBI access No: WP-J-F-020866310.1) were designed by degenerate analysis of the upstream primers of the FfkbS gene (S-J-F-1-NO): 5 '-RTGNNNGANATHHTNNNNGCN-3' (R ═ A, G; H ═ A, T, C; N ═ A, T, C, G), while upstream degenerate primers for other fkbS genes were also designed, such as fkbS-J-F-2(SEQ ID NO: 5): 5 '-RTGNNNGANATHHTNNNN-3'; fkbS-J-F-3(SEQ ID NO: 6): 5 '-RTGNNNGANATHHTNNNNGCNRTN-3' (R ═ A, G; H ═ A, T, C; N ═ A, T, C, G). And designing a downstream primer fkbS-J-R (SEQ ID NO:7) with respect to the known downstream sequence of the fkbS gene (position 1346-1362 of SEQ ID NO: 1): 5'-TCACCGCACCCCCTCGG-3' (the company synthesizing the primers was Shanghai Jili Biotechnology Co., Ltd.). Cloning a target fragment from the genome of Streptomyces hygroscopicus ATCC14891 by using fkbS-J-F-1/fkbS-J-R, wherein the running gel electrophoresis result is shown in FIG. 4, and the visible band is proper in size and clear; the results of gel-running electrophoresis after cloning from the genome of Streptomyces hygroscopicus ATCC14891 using fkbS-J-F-2/fkbS-J-R and fkbS-J-F-3/fkbS-J-R are shown in FIG. 5, and it can be seen that the target fragment with a proper size and a clear band was not amplified using these 2 pairs of primers. The PCR conditions for the gene fkbS were as follows: using 1. mu.g of Streptomyces ATCC14891 genomic DNA as template, 20. mu. mol/L of the upstream and downstream primers fkbS-J-F-1/fkbS-J-R were added, using PrimeSTAR GXL DNA Polymerase, under the following cycling conditions: 5min at 98 ℃; (68 ℃ C. 1 min.) 30 times; 68 ℃ for 10 min. An electrophoresis band of about 1.4kb was separated by agarose gel electrophoresis (gel concentration 1%, 120V, 20min), and the objective fragment was recovered using a gel recovery kit. The target fragment was ligated to pMD18-T vector after the addition of A-tail by rTaq enzyme, transformed into large intestine competent DH 5. alpha. at 37 ℃ and cultured overnight, and then a single colony was selected and sent for sequencing (Shanghai Jigli Biotechnology Co., Ltd.), with the sequencing results shown in FIG. 6, Table 2 and Table 3. The sequence was completely identical to the reported downstream sequence (460bp) of the fkbS gene by alignment.

TABLE 2

TABLE 3

Example 4 overexpression of the fkbS Gene in the ascomycin-producing Strain ATCC14891

The fkbS gene encoding crotonyl-CoA reductase was amplified from the genome of S.hygroscopicus ATCC14891 using the following primers fkbS-F/fkbS-R (designed according to the fkbS gene sequence obtained in example 3), inserted into the NdeI/AscI site of the pSET-152 plasmid by homologous recombination (using a homologous recombination kit), under the control of the erythromycin resistance gene promoter Perm, to construct an over-expressed plasmid pSET-fkbS (see FIG. 7). A fragment containing the erythromycin resistance gene promoter Perm and the fkbS gene was amplified from pSET-fkbS using the primer fkbS-F-2/fkbS-R-2, and inserted into the AscI/NotI site of the pSET-fkbS plasmid by enzymatic ligation to construct a recombinant plasmid pSET-2fkbS (see FIG. 8). A fragment containing the erythromycin resistance gene promoter Perm and the fkbS gene was amplified from pSET-fkbS using the primer fkbS-F-3/fkbS-R-3, and inserted into the NotI/EcoR V site of the pSET-2fkbS plasmid by enzymatic ligation to construct a recombinant plasmid pSET-3fkbS (see FIG. 9). The promotion effect of different copy numbers of the fkbS gene on the synthesis of ascomycin was examined by the purpose of sequentially constructing different plasmids, and pSET-fkbS, pSET-2fkbS and pSET-3fkbS were added by 1, 2 and 3 copies, respectively, in ATCC 14891.

The primer sequences used were as follows:

fkbS-F：

5’-AACCACTCCACAGGAGGACCCATATGATGCGTGACATTCTTCAGGCGT-3’(SEQ ID NO:8)

fkbS-R：

5’-TGGAAAGACGACAAAACTTTGGCGCGCCTCACCGCACCCCCTCGG-3’(SEQ ID NO:9)

fkbS-F-2：5’-AAAAGGCGCGCCGGTACCAGCCCGACCCGAG-3’(SEQ ID NO:10)

fkbS-R-2：5’-AAAAGCGGCCGCTCACCGCACCCCCTCGG-3’(SEQ ID NO:11)

fkbS-F-3：5’-AAAAGCGGCCGCGGTACCAGCCCGACCCGAG-3’(SEQ ID NO:12)

fkbS-R-3：5’-AAAAGATATCTCACCGCACCCCCTCGG-3’(SEQ ID NO:13)

the above pSET-fkbS, pSET-2fkbS and pSET-3fkbS were transformed into ET12567 competent cells, respectively, and then the 3 overexpression plasmids were integrated into the site of Φ C31 attB of ATCC14891 by conjugative transfer, respectively, and cultured in MS medium supplemented with nalidixic acid and apramycin at a temperature of 28 ℃ to obtain a zygote. The obtained zygote was inoculated on an MB plate to which apramycin was added, and subcultured at 28 ℃ to obtain fkbS gene overexpression strains SFK-OfkbS, SFK-OfkbS-2, and SFK-OfkbS-3. The 3 engineered bacteria were subjected to shake flask fermentation experiments under the conditions described in example 1. The results showed that the production of ascomycin in SFK-OfkbS was 1917.5mg/L, the impurity ratio FK523/FK520 was 6.3%; the yield of SFK-OfkbS-2 ascomycin is 1649.5mg/L, and the impurity ratio FK523/FK520 is 6.6%; the yield of SFK-OfkbS-3 ascomycin was 1543.3mg/L, and the impurity ratio FK523/FK520 was 7.1%.

From the above results, it can be seen that the increase in copy number of fkbS in ATCC14891 is not the more excellent, i.e., the function of crotonyl-CoA reductase is not the more excellent, and that when the copy number of fkbS is increased in ATCC14891, the promoting effect on ascomycin is the best, and the impurity ratio is the lowest; further increasing the copy number of fkbS, the yield decreased, indicating that more fkbS copies inhibited ascomycin accumulation.

Example 5 Effect of crotonic acid addition on the promotion of Ascomycin Synthesis in SFK-OfkbS

In order to examine the effect of exogenously added crotonic acid on ascomycin biosynthesis, 0.5g/L to 5.0g/L crotonic acid was added to the SFK-OfkbS fermentation medium and analyzed by the culture conditions and liquid phase assay described in example 1. The results showed that when the amount of crotonic acid added was 1.0g/L, the yield of ascomycin was increased to 2363.6mg/L, with 5.3% impurities; while the original strain ATCC14891 was fermented in the same 1.0g/L fermentation medium, the yield of ascomycin and the content of impurity FK523 were not significantly changed.

The results of the fermentation of SFK-OfkbS in the fermentation media with different crotonic acid additions are shown in Table 4.

TABLE 4

Comparative example 1 overexpression of exogenous Croton reductase Gene ccr in Ascomycin-producing Strain ATCC14891

The ccr gene (NCBI Access Number: NP-630556.1) encoding crotonyl-CoA reductase was amplified from the genome (NCBI Access Number: AL645882.2) of the model strain Streptomyces coelicolor using the primers ccr-F/ccr-R, and this fragment was then integrated by homologous recombination into the NdeI/AscI site of the pSET-152 plasmid, which was placed under the control of the erythromycin resistance gene promoter Perm, to construct the overexpression plasmid pSET-ccr (see FIG. 10).

The primer sequences used were as follows:

ccr-F：

5’-AACCACTCCACAGGAGGACCCATATGGTGACCGTGAAGGACATCCTG-3’(SEQ ID NO:14)

ccr-R：

5’-TGGAAAGACGACAAAACTTTGGCGCGCCTCAGATGTTCCGGAAGCGG T-3’(SEQ ID NO:15)

after ET12567 competent cells were transformed with pSET-ccr, they were introduced into ATCC14891 by conjugative transfer, incorporated into the Φ C31 attB site of ATCC14891, and cultured at 28 ℃ in MS medium supplemented with nalidixic acid and apramycin to obtain a zygote. The obtained zygote was inoculated on an MB plate to which apramycin was added, and subcultured at 28 ℃ to obtain an engineering strain SFK-OccrC. The production of ascomycin in SFK-OccrC was determined by the same fermentation and HPLC detection methods as in example 1. The results show that: the yield of ascomycin in SFK-OccrC was 950.3mg/L, and the impurity ratio FK523/FK520 was 9.5%. The effect of over-expressing ccr gene in increasing the yield of ascomycin and reducing impurities is far inferior to that of over-expressing fkbS gene.

Comparative example 2 comparison of Effect when other endogenous and exogenous genes were overexpressed

(1) The original strain S.hygroscopicus ATCC14891 producing ascomycin was inoculated into a 250ml shake flask containing 20ml of the above seed medium and grown for 2 days at 28 ℃ and 200 rpm. Then transferring the seed liquid with 10% inoculation amount (volume ratio) into a 250ml shake flask filled with 25ml of the fermentation medium for fermentation culture, wherein the temperature is 28 ℃, the rpm is 200, and the fermentation period is 8 days. Diluting 300 μ l of the obtained fermentation liquid with acetone 5 times, performing ultrasonic treatment for 20min, centrifuging at 12000rpm for 3min, collecting supernatant, filtering with 0.22 μm filter membrane, and performing HPLC analysis. Conditions of HPLC: the chromatographic column is Hypersil BDS C18,5um,4.6mm x 150 mm; the mobile phase is water: acetonitrile 35: 65 (v/v); the column temperature was 55 ℃; the detection wavelength is 210 nm; the flow rate was 1.0 ml/min. The yield of ascomycin in the fermentation broth is 813.8mg/L measured by an HPLC liquid phase method (the calculation method of ascomycin is determined by a quantitative method conventional in the field, namely an internal standard method, and specifically, reference can be made to AMB Express,2019,9(1): 25).

(2) Overexpression of the exogenous acetyl-CoA carboxylase Gene acc in ascomycin-producing bacteria

The desired fragment accA2BE (comprising the gene accA2 encoding acetyl-CoA carboxylase (GeneID:1100362, NCBI accession number to the corresponding amino acid sequence NP-629074.1), accB (GeneID:1100975, NCBI accession number to the corresponding amino acid sequence NP-629669.1) and accE (GeneID:1100976, NCBI accession number to the corresponding amino acid sequence NP-629670.1)) was amplified from plasmid PLC1-A2BE using primers A2BE-F/A2BE-R under the following PCR conditions: using plasmid PLC1-A2BE as template, 20. mu. mol/L of upstream and downstream primers A2BE-F/A2BE-R were added, using PrimeSTAR GXL DNA Polymerase, under the following cycling conditions: 5min at 98 ℃; (68 ℃ C. 4 min.) 30 times; 68 ℃ for 10 min. And recovering the target fragment by using a gel recovery kit. Then, the desired fragment accA2BE was inserted into the NdeI/AscI site of the plasmid pSET-152 by means of homologous recombination (using a homologous recombination kit), thereby constructing a combined overexpression plasmid pSET-A2BE (see FIG. 11).

The primer sequences used were as follows:

A2BE-F：

5’-AACCACTCCACAGGAGGACCCATATGGTGCGCAAGGTGCTCATCG-3’(SEQ ID NO:16)

A2BE-R：

5’-TGGAAAGACGACAAAACTTTGGCGCGCCTCAGCGCCAGCTGTGCG-3’(SEQ ID NO:17)

the resulting plasmid pSET-A2BE was transformed into ET12567 competent cells, and then introduced into the Φ C31 attB site of ATCC14891 by a conventional conjugative transfer method, and cultured in MS medium supplemented with nalidixic acid and apramycin at a temperature of 28 ℃ to obtain a zygote. The resulting zygotes were inoculated on MS plates supplemented with apramycin and subcultured at 28 ℃ to give the genes accA2, accB and accE overexpressing strain FK-OA2 BE. FK-OA2BE was subjected to fermentation culture in accordance with the culture method in the comparative example (1), and the yield of ascomycin in FK-OA2BE was 2320.1mg/L as measured by HPLC liquid phase, which was 185.1% higher than that of the original strain ATCC 14891.

(2) Overexpression of the endogenous acetyl-CoA carboxylase Gene acc in an ascomycin producing Strain

The gene acc encoding acetyl-CoA carboxylase (sequence shown in SEQ ID NO:18 in the sequence Listing) was amplified from the genome of Streptomyces hygroscopicus ATCC14891 using the primer acc-F/acc-R. The PCR conditions were: using the S.hygroscopicus ATCC14891 genome as template, 20. mu. mol/L of the upstream and downstream primers acc-F/acc-R were added, using PrimeSTAR GXL DNA Polymerase, under the following cycling conditions: 5min at 98 ℃; (68 ℃ C. 2 min.) 30 times; 68 ℃ for 10 min. And recovering the target fragment by using a gel recovery kit. Then, the objective fragment acc was inserted into the NdeI/AscI site of the plasmid pSET-152 by means of homologous recombination, thereby constructing an overexpression plasmid pSET-acc (see FIG. 12).

The primer sequences used were as follows:

acc-F：

5’-aaccactccacaggaggacccatatgATGACCGGAACGAACTCACCC-3’(SEQ ID NO:19)

acc-R：

5’-tggaaagacgacaaaactttggcgcgccTCAACGGGGTAGCCCGATG-3’(SEQID NO:20)

after the overexpression plasmid pSET-acc was transformed into ET12567 competent cells, it was introduced into the Φ C31 attB site of ATCC14891 by conjugative transfer, and cultured at 28 ℃ in MS medium supplemented with nalidixic acid and apramycin to obtain a zygote. Inoculating the obtained zygote on an MS plate added with apramycin, and carrying out subculture at 28 ℃ to obtain the engineering strain FK-Oacc. When fermentation was carried out under the same culture conditions as in the section (1) of this comparative example and examined, it was revealed that the production of FK520 reached 853.1mg/L in the combination-overexpressed strain FK-Oacc, which was not significantly improved as compared with the original strain ATCC 14891.

From the above results, it is seen that unpredictability in the biological field is not necessarily superior to the case of overexpressing an endogenous gene in a strain, but rather superior to overexpressing an exogenous gene of the same type.

SEQUENCE LISTING

<110> Shanghai institute for pharmaceutical industry, general institute for pharmaceutical industry of China

<120> fkbS gene, genetically engineered bacterium containing the same, and preparation method and application thereof

<130> P19012984C

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 1359

<212> DNA

<213> Streptomyces hygroscopicus

<400> 1

atgcgtgaca ttcttcaggc gttggagtcc ggcgacgcag gagagggtga tttccggaac 60

ttaaagattc ctgagaatta ccggggagcc gtggtactcg ctgacgagat acacatgttc 120

gaaggtctgc ggacccatga gaagcacccc gataaatcgc tgcacgtgcg cgatgtgccg 180

actcccgagc cggcccccgg cgaggtgctc gtcgccgtgc tcgccagcgc gatcaactac 240

aacaccgtat ggagcgcgct cttcgagccg atccccacgt ttcacttcct cgctcggtac 300

gggcggaccg gcgccgcggc caagcggcac gacctgccct atcacgtggt cgggtccgat 360

ctggccggtg tcgtcctgcg caccggcgac ggcgtggtgg actggaagcc cggcgaccgc 420

gtcgtcgcgc actgtctcag cgtcgacctg cacacgcccc acggtcacga cgacgcgatg 480

ctcgaccccg agcagcggat atggggcttc gagacgaact tcggcggcct cgccgagatc 540

gccctggtca aggcgaacca gttgatgccg aagcccgcgc acctgacctg ggaggaggcg 600

gccggctccg ggctggtgaa ctcgaccgcc taccggcagc tggtgtcccg gaacggcgcc 660

cggatgaagc agggcgacgt cgtcctgatc tggggagccg ggggcgggct cggttcgtac 720

gccacccagc tcgtcctcaa cggcggtggc atcccggtct gcgtcgtctc ggacgagcgc 780

aaggccgacc tggtccgcgc ccagggcgcg gagctggtca tcaaccgggc cgcggagggg 840

taccgcttct ggaccgacga cgaccggcag gatcccagcg agtggaagcg cttcggcaag 900

cggatccggg agctgaccgg cggtgacgat cccgacatcg tgttcgagca cccggggcgc 960

gcgacgttcg gcgcgagtgt ctacgtgaca cgtcggggtg gcacgatcgt cacctgcgcg 1020

tcaacctcgg gatacgagca cgcctttgac aatcggtacc tgtggatgtc cgtgaagcgg 1080

atcatcggta cccacttcgc gaactatcgt gaggcgtggg aggcgaaccg cctgatctgc 1140

aaggggatgg tgcacccgac gctgtcggtg acctacccgc tcgacgacgt cgggtcggcg 1200

gtgcgcgatg tgcatcgcaa tgtgcacaac ggcaaagtcg gcgtcctctg tctggcgccg 1260

gaggagggat ggggcgtgac cgacccggag atgcgggaga agcacttggc cgagatcacc 1320

cggttccggg ctccccaggt cgcggccgag ggggtgcgg 1359

<210> 2

<211> 453

<212> PRT

<213> Streptomyces hygroscopicus

<400> 2

Met Arg Asp Ile Leu Gln Ala Leu Glu Ser Gly Asp Ala Gly Glu Gly

1 5 10 15

Asp Phe Arg Asn Leu Lys Ile Pro Glu Asn Tyr Arg Gly Ala Val Val

20 25 30

Leu Ala Asp Glu Ile His Met Phe Glu Gly Leu Arg Thr His Glu Lys

35 40 45

His Pro Asp Lys Ser Leu His Val Arg Asp Val Pro Thr Pro Glu Pro

50 55 60

Ala Pro Gly Glu Val Leu Val Ala Val Leu Ala Ser Ala Ile Asn Tyr

65 70 75 80

Asn Thr Val Trp Ser Ala Leu Phe Glu Pro Ile Pro Thr Phe His Phe

85 90 95

Leu Ala Arg Tyr Gly Arg Thr Gly Ala Ala Ala Lys Arg His Asp Leu

100 105 110

Pro Tyr His Val Val Gly Ser Asp Leu Ala Gly Val Val Leu Arg Thr

115 120 125

Gly Asp Gly Val Val Asp Trp Lys Pro Gly Asp Arg Val Val Ala His

130 135 140

Cys Leu Ser Val Asp Leu His Thr Pro His Gly His Asp Asp Ala Met

145 150 155 160

Leu Asp Pro Glu Gln Arg Ile Trp Gly Phe Glu Thr Asn Phe Gly Gly

165 170 175

Leu Ala Glu Ile Ala Leu Val Lys Ala Asn Gln Leu Met Pro Lys Pro

180 185 190

Ala His Leu Thr Trp Glu Glu Ala Ala Gly Ser Gly Leu Val Asn Ser

195 200 205

Thr Ala Tyr Arg Gln Leu Val Ser Arg Asn Gly Ala Arg Met Lys Gln

210 215 220

Gly Asp Val Val Leu Ile Trp Gly Ala Gly Gly Gly Leu Gly Ser Tyr

225 230 235 240

Ala Thr Gln Leu Val Leu Asn Gly Gly Gly Ile Pro Val Cys Val Val

245 250 255

Ser Asp Glu Arg Lys Ala Asp Leu Val Arg Ala Gln Gly Ala Glu Leu

260 265 270

Val Ile Asn Arg Ala Ala Glu Gly Tyr Arg Phe Trp Thr Asp Asp Asp

275 280 285

Arg Gln Asp Pro Ser Glu Trp Lys Arg Phe Gly Lys Arg Ile Arg Glu

290 295 300

Leu Thr Gly Gly Asp Asp Pro Asp Ile Val Phe Glu His Pro Gly Arg

305 310 315 320

Ala Thr Phe Gly Ala Ser Val Tyr Val Thr Arg Arg Gly Gly Thr Ile

325 330 335

Val Thr Cys Ala Ser Thr Ser Gly Tyr Glu His Ala Phe Asp Asn Arg

340 345 350

Tyr Leu Trp Met Ser Val Lys Arg Ile Ile Gly Thr His Phe Ala Asn

355 360 365

Tyr Arg Glu Ala Trp Glu Ala Asn Arg Leu Ile Cys Lys Gly Met Val

370 375 380

His Pro Thr Leu Ser Val Thr Tyr Pro Leu Asp Asp Val Gly Ser Ala

385 390 395 400

Val Arg Asp Val His Arg Asn Val His Asn Gly Lys Val Gly Val Leu

405 410 415

Cys Leu Ala Pro Glu Glu Gly Trp Gly Val Thr Asp Pro Glu Met Arg

420 425 430

Glu Lys His Leu Ala Glu Ile Thr Arg Phe Arg Ala Pro Gln Val Ala

435 440 445

Ala Glu Gly Val Arg

450

<210> 3

<211> 86

<212> DNA

<213> Artificial Sequence

<220>

<223> sgRNA

<400> 3

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tttgag 86

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-J-F-1

<220>

<221> misc_feature

<222> (1)..(1)

<223> r is a, or g

<220>

<221> misc_feature

<222> (4)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (12)..(13)

<223> h is a, c, or t

<220>

<221> misc_feature

<222> (15)..(18)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<400> 4

rtgnnngana thhtnnnngc n 21

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-J-F-2

<220>

<221> misc_feature

<222> (1)..(1)

<223> r is a, or g

<220>

<221> misc_feature

<222> (4)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (12)..(13)

<223> h is a, c, or t

<220>

<221> misc_feature

<222> (15)..(18)

<223> n is a, c, g, or t

<400> 5

rtgnnngana thhtnnnn 18

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-J-F-3

<220>

<221> misc_feature

<222> (1)..(1)

<223> r is a, or g

<220>

<221> misc_feature

<222> (4)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (12)..(13)

<223> h is a, c, or t

<220>

<221> misc_feature

<222> (15)..(18)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (22)..(22)

<223> r is a, or g

<220>

<221> misc_feature

<222> (24)..(24)

<223> n is a, c, g, or t

<400> 6

rtgnnngana thhtnnnngc nrtn 24

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-J-R

<400> 7

tcaccgcacc ccctcgg 17

<210> 8

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-F

<400> 8

aaccactcca caggaggacc catatgatgc gtgacattct tcaggcgt 48

<210> 9

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-R

<400> 9

tggaaagacg acaaaacttt ggcgcgcctc accgcacccc ctcgg 45

<210> 10

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-F-2

<400> 10

aaaaggcgcg ccggtaccag cccgacccga g 31

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-R-2

<400> 11

aaaagcggcc gctcaccgca ccccctcgg 29

<210> 12

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-F-3

<400> 12

aaaagcggcc gcggtaccag cccgacccga g 31

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> fkbS-R-3

<400> 13

aaaagatatc tcaccgcacc ccctcgg 27

<210> 14

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> ccr-F

<400> 14

aaccactcca caggaggacc catatggtga ccgtgaagga catcctg 47

<210> 15

<211> 48

<212> DNA

<213> Artificial Sequence

<220>

<223> ccr-R

<400> 15

tggaaagacg acaaaacttt ggcgcgcctc agatgttccg gaagcggt 48

<210> 16

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> A2BE-F

<400> 16

aaccactcca caggaggacc catatggtgc gcaaggtgct catcg 45

<210> 17

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> A2BE-R

<400> 17

tggaaagacg acaaaacttt ggcgcgcctc agcgccagct gtgcg 45

<210> 18

<211> 2226

<212> DNA

<213> Streptomyces coelicolor

<400> 18

atgaccggaa cgaactcacc ccgcgtctcc cgcgcctccc gcctctcccg cgcctcggcc 60

cgtgagctga tcgaggccgt cgtcgacccc ggcagctggt acggctggga cgagccggtg 120

gagatcacta cggaggaccc cgactaccgg gccgacctgg agcgggctcg ggagcgcacc 180

gggctggacg agtcggtcat caccggtgag gggcgtatcg aggggcgccg ggtggcgctg 240

gtcgcctgcg agttccgctt cctggccggt tcgataggcg tcgccgcggg ggagcggctg 300

gtacgggccg tggagcgggc cacggcggag cgactgccgc tgctggcgac accggcgtcg 360

ggcgggaccc ggatgcagga gggtacggtc gcgttccttc agatggtgaa ggtggccgcg 420

gcgatcacgg accacaaggc ggcgggcctg ccgtacctcg tgcacctccg ccaccccacg 480

accggcggcg tcctcgcctc ctggggctcc ctcggccacg tcaccgccgc cgagccgggc 540

gccctcatcg gcttcatggg cccgcgggtg cacgaggccc tgtacgggga ggagttcccg 600

cccggtgtgc agaacgccga gaacctgatg caccacggcc tgatcgacgc ggtcctcccg 660

ctgagccgcc tgtcgggcgt ggcggcacgc gtgctgaggg ttctctgcgc gggcgacgcc 720

gcgaccggcc acgccacggg tgcggagacc ggggcgcccc cgccctccgc ctccacctcc 780

ggcgccgggc cggaggcgga ggcgctcggg cgaggtgcgg acaccgcggc cgggcccgcc 840

ccgacggcgg gtgcggcact cgcccccgac cagccgaggg acgcaggcgg ggtctccacc 900

gggcccgcgc ccggcacacc gggtgacgcg cctggcggga cgccggggcg acgtggggat 960

gtcgcggccg ggggtggccc gacggtcgcg cgtggcgccg agcgggacgc gagtggtgcc 1020

gatgctgcgg aggcggggtc ggcggccccg acgtcggccc cgccttccgg cgctctgccc 1080

ggggcgggag cgggcggtcg acgtgggggt tcgtcggccg ggggtggccc gacggtcgcg 1140

cgtggcgccg agcgggacgc gagtggtgcc gatgccgtgg aggcggggtc ggcggccccg 1200

acgtcggccc cgccttccgg cgctctgccc agggcgggag cgggcggtcg gcgtggggat 1260

gtcgcggccg ggggcgccgg gggcgtgggg cccgcgcacg atcaggccgg ggtcactgcc 1320

ttcgccgggg cgggaggggg cggcggggta cccgacgacg cagaggtggg ggcggcggtg 1380

ccgtccgccg aggagtcgat ccgggcgtcg cggcgggccg aacggcccgg tttgcgggat 1440

ctgctgcggg tcgccgccga ggatgtgagc ccgctcagcg gcacgggggc cggcgagcac 1500

gatcccgggt tgttgctggc gctcgcccgc gtcgggggga cgccctgcgt cgtcctcggc 1560

cacaaccggc gcagtgcccg taagggcgac acggccgacg ggccggggga ggggcaggcg 1620

ctggggccgg cggggttgcg gaccgcgcgg cgcgggatgc ggatcgccgc cgagctcggg 1680

ctgccgctgc tcaccgtcat cgacaccgcg ggcgccgcgc tcagccgcga ggccgaggag 1740

ggcgggctcg ccggggagat agcgcggtgc ctcgccgaca tggtgaccct gcccgcgccc 1800

accctctgcc tgctgctcgg ccagggcgcc ggtggcgccg cgctcgcgct gctgcccgcc 1860

gaccgggtcg tcgcggcgcg ccacgcctgg ctgtcgccgc tgccgccgga gggcgcctcc 1920

gcgatcctcc accgcaccac ggagcgggcg tacgaggtcg ccgcccgcca gggcgtacgc 1980

tccgccgacc tcctcgccca gggcatcgtc gaccggatcg tggaggagga cggggagacg 2040

gaccgggaca ccgcccggac ccctgacgct tcccgggccg gggacgcttc ccgcaccgcc 2100

gacgccttcc tcggccgcct cggccgtctc ctgggcgacg aactcgccgc gctgcgcgcc 2160

caggacccgg acgagcggct cgctgcgcgc cgcgtccgcc agcgcggcat cgggctaccc 2220

cgttga 2226

<210> 19

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> acc-F

<400> 19

aaccactcca caggaggacc catatgatga ccggaacgaa ctcaccc 47

<210> 20

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> acc-R

<400> 20

tggaaagacg acaaaacttt ggcgcgcctc aacggggtag cccgatg 47

Claims

1. An fkbS gene, wherein an amino acid sequence encoded by the fkbS gene is represented by SEQ ID No. 2; preferably, the nucleotide sequence of the fkbS gene is shown in SEQ ID No. 1.

2. A recombinant expression vector comprising the fkbS gene of claim 1; preferably, the skeleton of the recombinant expression vector is a plasmid containing a strong promoter; more preferably, the skeleton of the recombinant expression vector is a plasmid containing an erythromycin resistance gene promoter, a streptomycete promoter or a thiostrepton inducible promoter; more preferably still, the backbone of the recombinant expression vector is a plasmid comprising Perm, kasOp or tipAp, preferably plasmid pSET-152.

3. A transformant obtained by introducing the fkbS gene according to claim 1 or the recombinant expression vector according to claim 2 into a host;

preferably, the host is escherichia coli; preferably E.coli ET 12567.

4. An FKBS protein, the amino acid sequence of which is shown in SEQ ID No. 2.

5. A genetically engineered bacterium for producing ascomycin, which is an engineered bacterium for over-expressing the fkbS gene of claim 1 in Streptomyces hygroscopicus (Streptomyces hygroscopicus) naturally producing ascomycin;

preferably, the genetically engineered bacterium is an engineered bacterium integrating the fkbS gene in the genome of the naturally ascomycin-producing streptomyces hygroscopicus, or the genetically engineered bacterium is an engineered bacterium comprising a recombinant expression vector containing the fkbS gene; wherein the site of integration is preferably an attB site, more preferably a Φ C31 attB site;

and/or the naturally ascomycin-producing S.hygroscopicus contains one, two or three copies of the fkbS gene;

and/or, the naturally ascomycin-producing Streptomyces hygroscopicus is Streptomyces hygroscopicus ATCC 14891.

6. A method for preparing the genetically engineered bacterium of claim 5, comprising culturing the transformant of claim 3 in conjugal form with naturally occurring Streptomyces hygroscopicus producing ascomycin, and selecting the conjugant;

preferably, the naturally ascomycin-producing streptomyces hygroscopicus is streptomyces hygroscopicus ATCC 14891; and/or, the joint culture is the culture in MS culture medium, and the culture temperature is 28 ℃.

7. A method for preparing ascomycin, which comprises fermenting the genetically engineered bacterium of claim 5 to obtain ascomycin from the fermentation broth;

more preferably, the fermentation medium of the fermentation further comprises 0.05-0.5% crotonic acid, such as 0.1%, 0.15% or 0.2% crotonic acid;

and/or the pH value of the fermentation medium for fermentation is 6.5 +/-2;

and/or the fermentation temperature is 25-30 ℃, preferably 28 ℃;

and/or the culture time of the fermentation is 6-10 days, preferably 8 days;

8. The method for preparing ascomycin according to claim 7, further comprising inoculating the genetically engineered bacterium in a seed culture medium for seed culture, and then transferring the culture to a fermentation medium; preferably, the first and second liquid crystal films are made of a polymer,

the culture temperature of the seed culture medium is 25-30 ℃, and preferably 28 ℃; and/or the time of seed culture is 1-2 days; and/or the rotation speed of the seed culture is 180-250 rpm, preferably 200 rpm; and/or the inoculation amount of the transfer is 5-20%, preferably 10%.

9. Use of the genetically engineered bacterium of claim 5 in the preparation of an ascomycin.

10. Use of the fkbS gene of claim 1 in regulating the production of ascomycin or in the synthesis of ethylmalonyl-CoA; preferably, the regulation of the yield of the ascomycin is to improve the yield of the ascomycin.