CN113265434B

CN113265434B - Method for synthesizing UDP-galactose and method for synthesizing galactosyl compound

Info

Publication number: CN113265434B
Application number: CN202110560931.7A
Authority: CN
Inventors: 高仁钧; 李雅静; 邓林; 解桂秋
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-05-19
Filing date: 2021-05-19
Publication date: 2023-05-02
Anticipated expiration: 2041-05-19
Also published as: CN113265434A

Abstract

A method for synthesizing UDP-galactose and a method for synthesizing galactosyl compound belong to the technical field of bioengineering. The method for catalyzing UTP, ATP and D-galactose to generate UDP-galactose by using the thermophilic enzyme method in two steps comprises the following two steps: catalyzing and synthesizing 1-P-Gal (1-phosphoric acid-galactose) by using D-galactose and ATP as substrates and using thermophilic galactokinase TTHA 0595; (ii) catalytic synthesis of UDP-galactose using thermophilic UDP-glucose pyrophosphorylase TTE0732 with 1-P-Gal and UTP as substrates. The UDP-galactose synthesized by the invention is used as a glycosyl donor, and the thermophilic galactose transferase TON_1857 is utilized to further catalyze a substrate compound of vanillyl alcohol, p-nitrophenol or silybin to synthesize the galactose-based compound, so that a method for synthesizing the galactose-based compound by a thermophilic enzymatic method is constructed.

Description

Method for synthesizing UDP-galactose and method for synthesizing galactosyl compound

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a method for synthesizing UDP-galactose and a galactosyl compound.

Background

The sugar complex is a compound formed by covalent bonding of sugar and biomolecules such as small molecule compounds, proteins, lipids, and nucleic acids. Some of the small molecule sugar complexes have important application value and become hot spots of current researches, such as glycoside, glycosylation products of small molecule drugs, glycosylation products of pigments and fragrances, prebiotics and the like. Glycosides are compounds formed by the replacement of a hydrogen on a hemiacetal hydroxyl group of a sugar with a ligand, thereby losing one molecule of water or other small molecule compound. Galactosides are attractive candidate molecules in prodrug design and synthesis, and have good solubility, low toxicity, and high targeting ability compared to the starting active drug material. Prodrugs of galactosides have been increasingly used in liver disease and targeted tumor therapy applications.

Current methods of small molecule glycosylation include biological and chemical methods. The biggest difficulty in synthesizing glycoside by chemical method is protection and deprotection of polyhydroxy, and the reaction process is complex. For example, patent CN105237590B provides a method for synthesizing an α -glycosyl compound by a one-pot method, in which TMS (trimethylsilyl) protected glycosyl iodide is used as a sugar donor, monohydroxy TMS sugar is used as a sugar acceptor, an organic reagent is used as a solvent, and the mixture is stirred at room temperature for 12 hours under the action of a specific catalyst and a phase transfer catalyst to synthesize an α -glycosidic oligosaccharide or a sugar conjugate. The reaction time is long and the hydroxyl group needs to be protected. Biological processes include microbial fermentation and enzymatic synthesis, fermentation processes include de novo synthesis, which results in lower industrialization potential due to too low effective concentrations, and bioconversion processes. Enzymatic synthesis of sugar complexes can utilize glycoside hydrolases (glycosidases) and glycosyltransferases. The glycosidase is used for catalyzing the hydrolysis of glycosyl, has activity of transglycosylation, and can be used for catalyzing the glycosylation of natural medicines to improve the medicine effect, such as enzymatic conversion of ginsenoside. Glycosidase-catalyzed glycosidation reactions are mainly focused on glycosylation of primary alcohols, with less reports on studies of tertiary alcohols or phenolic hydroxyl groups; because the primary activity of glycosidases is hydrolysis, conversion is generally not high. Whereas glycosyltransferases are able to efficiently catalyze the glycosylation of such substrates. Glycosyltransferases are efficient in catalysis, but have high requirements on substrates, usually only one glycoside substrate can be catalyzed by one glycosyltransferase, and glycosyltransferases are selective for reactive groups at different positions in the substrate. Meanwhile, many glycosyltransferases can only be modified by glycosylation using a glycosyl donor such as Uridine Diphosphate (UDP) glycoside. As in patent CN110156855a, a method for preparing glycosylated flavonoids using glycosidases and glycosyltransferases with UDP-sugar as glycosyl donor is provided. However, UDP glycosides are scarce in sources and expensive in manual synthesis, and thus cannot be produced industrially on a large scale by one-step glycosyltransferase catalysis of UDP glycosides and compounds to be modified.

The synthesis of UDP glycoside is produced by fermenting or enzymatically catalyzing UTP (uridine triphosphate), ATP (adenine nucleoside triphosphate) and monosaccharide. For example, patent CN1477204A, CN1550554a and CN1572879a provide a method for preparing sugar nucleotides and complex carbohydrates, which uses a microorganism culture solution or a processed product of the culture solution as an enzyme source to prepare sugar nucleotides and complex carbohydrates, and uses microorganisms mainly including saccharomycetes, corynebacteria and the like, but the components of a reaction system are complex, and the reaction time is long. No other Chinese patent for synthesizing UDP glycoside is known.

In enzymatic reactions, low solubility of the enzyme and substrate is one of the key factors limiting the progress of the reaction. To increase the reaction rate, elevated temperatures are typically chosen to increase the solubility of the enzyme and substrate. However, the enzyme at normal temperature is easy to deactivate at high temperature and has poor thermal stability, so that the reaction process is affected, and the thermophilic enzyme can overcome the limiting factors.

The invention takes ATP, UTP and D-galactose with lower price as substrates, and uses thermophilic galactokinase and thermophilic UDP-glucose pyrophosphatase to catalyze and synthesize UDP-galactose (the selling price in the current market is about 3500 yuan/100 mg), thereby effectively reducing the production cost. Furthermore, the galactosyl in UDP-galactose can be transferred to a small molecular compound by adding a proper thermophilic galactosyl transferase into the reaction system, and the glycosyl modified galactosyl compound can be directly obtained. At present, no patent for synthesizing galactosyl compounds by a thermophilic enzyme method is found.

Disclosure of Invention

The invention provides a method for catalyzing UTP, ATP and galactose to generate UDP-galactose by using a thermophilic enzyme method two-step reaction. The thermophilic enzymes used in the method of the invention are thermophilic galactokinase TTHA0595 screened from thermophilic bacteria Thermus thermophilus HB and thermophilic UDP-glucose pyrophosphorylase TTE0732 screened from thermophilic bacteria Caldanaerobacter subterraneus in the laboratory, and the nucleotide sequences of the thermophilic galactokinase TTHA0595 and the thermophilic UDP-glucose pyrophosphorylase TTE0732 are SEQ ID No.1 and SEQ ID No.2 respectively.

The production method of the two thermophilic enzymes is to construct escherichia coli expression bacteria by using a DNA recombination technology, and then to induce the expression of enzyme protein by using an inducer IPTG (isopropyl thiogalactoside). First, a thermophilic galactokinase TTHA0595 gene sequence (1044 bp, code 347aa,SEQ ID No.1) from thermophilic bacterium Thermus thermophilus HB was obtained by NCBI GenBank search, and a thermophilic UDP-glucose pyrophosphorylase TTE0732 gene sequence (909 bp, code 302aa,SEQ ID No.2) was obtained from thermophilic bacterium Caldanaerobacter subterraneus. Primers are designed according to nucleotide sequences SEQ ID No.1 and SEQ ID No.2 of the two enzymes, enzyme genes are amplified by a PCR method, and are connected with an escherichia coli expression vector pET28a to construct recombinant plasmids, and escherichia coli expression host bacteria Transetta (DE 3) competent cells are respectively transformed to construct recombinant enzyme expression bacteria. The recombinant enzyme expression bacteria constructed by induction of inducer IPTG (isopropyl thiogalactoside) are used for expressing thermophilic galactokinase and thermophilic UDP-glucose pyrophosphorylase. The expression product is soluble protein in cells, and the thermophilic galactokinase and the thermophilic UDP-glucose pyrophosphorylase are obtained by separating and purifying through cell ultrasonic disruption, heating inactivation and Ni-NTA affinity chromatography.

The method for catalyzing UTP, ATP and D-galactose to generate UDP-galactose by using the thermophilic enzyme method in two steps comprises the following two steps: using D-galactose and ATP as substrates, and using thermophilic galactokinase TTHA0595 to catalyze and synthesize Gal-1-P (1-phosphate-galactose); (ii) the catalytic synthesis of UDP-galactose using the thermophilic UDP-glucose pyrophosphorylase TTE0732 with Gal-1-P and UTP as substrates.

The specific reaction of step (i) is: the reaction buffer is 20mM CAPS (3-cyclohexylaminopropanesulfonic acid) water solution (pH 8.0-10.0), the substrate D-galactose and ATP are sequentially added to a final concentration of 100-200 mM, and MgCl with a final concentration of 5mM is further added ₂ Reacting for 3-8 min at 40-60 ℃, then adding thermophilic galactokinase TTHA0595 with the final concentration of 0.3-0.6 mg/mL, and then oscillating for reacting for 60-80 min at 120-180 r/min at 40-60 ℃ to obtain Gal-1-P;

the specific reaction of step (ii) is: adding 20mM CAPS water solution (pH 8.0-10.0) of reaction buffer solution into the reaction solution obtained in the step (i), sequentially adding substrates Gal-1-P and UTP to a final concentration of 100-200 mM, and then adding MgCl to a final concentration of 5mM ₂ Reacting for 3-8 min at 40-60 ℃, then adding thermophilic UDP-glucose pyrophosphoric acid with the final concentration of 0.3-0.6 mg/mLAnd (3) carrying out oscillation reaction on the enzyme TTE0732 at the temperature of 40-60 ℃ at the speed of 120-180 r/min for 4-6 h to obtain UDP-galactose.

The UDP-galactose synthesized by the invention is used as a glycosyl donor, and the thermophilic galactose transferase TON_1857 is utilized to further catalyze a substrate compound to synthesize a galactosyl compound, so that a method for synthesizing the galactosyl compound by a thermophilic enzyme method is constructed. The thermophilic galactosyltransferase TON_1857 used in the method for synthesizing the galactosyl compound by the thermophilic enzymatic method is derived from thermophilic bacteria Thermococcus onnurineus, and is produced by constructing escherichia coli expression bacteria by fermentation by utilizing a genetic engineering DNA recombination technology, and the nucleotide sequence of the thermophilic galactosyltransferase TON_1857 is shown as SEQ ID NO. 3. The method for synthesizing the galactosyl compound by utilizing the thermophilic enzymatic method constructed by the invention realizes glycosylation modification of the vanillyl alcohol, the p-nitrophenol and the silybin.

The reaction conditions of the modification raw material compounds of vanillyl alcohol, p-nitrophenol and silybin in the thermophilic enzymatic synthesis of the galactosyl compound are as follows: the reaction buffer is 20mM CAPS water solution (pH 8.0-10.0), the final concentration of the substrate UDP-galactose and vanillyl alcohol or p-nitrophenol or silybin is 5-100 mM, and MgCl with the final concentration of 5mM is added ₂ After reacting for 3-8 min at 40-60 ℃, adding thermophilic galactosyltransferase TON_1857 with the final concentration of 0.3-0.6 mg/mL, and oscillating at the temperature of 40-60 ℃ for 4-6 h at the rotation speed of 120-180 r/min to obtain the galactosyl compound.

The thermophilic enzymes used in the invention are all prepared by a DNA recombination technology, and the sequence of the coding gene is obtained by inquiring a GenBank database. Amplifying target genes by using a PCR technology, recombining the target genes with a common expression vector of escherichia coli (such as pET28 a), and transforming escherichia coli expression bacteria (such as BL21 (DE 3)), so as to construct recombinant expression bacteria.

Drawings

Fig. 1: thin layer chromatography detection pattern of Gal-1-P; the comparison of the control group with the experimental group is that thermophilic galactokinase TTHA0595 is not added, and the result shows that the Gal-1-P product is synthesized by the catalysis of thermophilic galactokinase TTHA0595 by the D-galactose and ATP in the experimental group;

fig. 2: the reaction time progress curve of the thermophilic galactokinase TTHA0595 for catalyzing and synthesizing Gal-1-P is characterized in that the abscissa is the reaction time (min), the ordinate is the conversion rate (%) of the substrate, and the reaction reaches equilibrium for 80 min;

fig. 3: MS detection result curve of Gal-1-P, arrow indicates Gal-1-P product peak; the reaction product is Gal-1-P;

fig. 4: 1H-NMR results of Gal-1-P (1H NMR (300MHz,Deuterium Oxide) δ5.45 (dd, J=7.3, 3.6Hz, 1H), 4.15-4.05 (m, 1H), 3.95 (dd, J=3.4, 1.2Hz, 1H), 3.85 (dd, J=10.3, 3.3Hz, 1H), 3.76-3.65 (m, 3H)), indicated that Gal-1-P was obtained;

fig. 5: thin layer chromatography detection of UDP-galactose; wherein 1 is a D-galactose standard; 2 is 1-P-galactose; 3 is an experimental group; the results showed that UDP-galactose product was formed in the experimental group.

Fig. 6: MS detection result curve of UDP-Gal, arrow indicates UDP-galactose combined with 1 Na ⁺ Molecular weight peaks of (2); the reaction product is UDP-Gal;

fig. 7: 1H-NMR detection of UDP-Gal (1H NMR (300MHz,Deuterium Oxide) δ8.19 (s, 1H), 8.16-8.01 (m, 2H), 6.00 (d, J=6.1 Hz, 1H), 4.74 (dd, J=6.1, 5.3Hz, 1H), 4.40 (ddd, J=5.2, 3.5,0.5Hz, 1H), 4.25 (q, J=3.4 Hz, 1H), 4.00-3.40 (m, 4H)); indicating that UDP-Gal is obtained;

fig. 8: a thin layer chromatography detection chart of the glycosylated products of different substrates catalyzed by a thermophilic enzyme method, wherein 1 is a vanillyl alcohol control group, 2 is a vanillyl alcohol experimental group, 3 is a p-nitrophenol control group, 4 is a p-nitrophenol experimental group, 5 is a silybin control group, and 6 is a silybin experimental group; in the figure, white triangles show substrates and black triangles show products. The control group was identical to the experimental group except that the thermophilic galactosyltransferase TON_1857 was not added.

Detailed Description

Example 1: construction of TTHA0595, TTE0732 and TON_1857 engineering bacteria and expression and purification of protein, comprising the following steps:

amplification of TTHA0595, TTE0732 and TON_1857 genes

Primer sequences for TTHA0595, TTE0732 and TON_1857 gene amplification were as follows:

(1) Thermophilic galactokinase TTHA0595:

an upstream primer: ATGAATCATATGATGGGCTTCCAAGAGGTTTAC, restriction enzyme NdeI recognition site is located on the horizontal line;

a downstream primer: AATCCGAATTCTTAGAGGACCTTGAGG, restriction enzyme EcoRI recognition sites are located along the horizontal line;

(2) Thermophilic UDP-glucose pyrophosphorylase TTE0732:

an upstream primer: AGCGGAAGAGGGGAAAGCATATGAAAATAA, restriction enzyme ndei recognition site at the horizontal line;

a downstream primer: CGCCGCCCTACTCTGAATTCTTACACATCT, restriction enzyme EcoRI recognition sites are located along the horizontal line;

(3) Thermophilic galactosyltransferase ton_1857:

an upstream primer: GGGGCGATAGACATATGAAAGTGGC-3', restriction enzyme NdeI recognition site at the horizontal line;

a downstream primer: CGC (common gateway control)GGATCCATGTAACCTCACCCTAT, the restriction enzyme BamHI recognition site is located along the horizontal line.

Table 1: PCR reaction system

Composition of the components	Volume (mu L)
		pfu 10×Buffer	10
Genomic DNA	1
		dNTPs	10
Upstream primer	1
		Downstream primer	1
pfu	2
		Double distilled water	75

PCR reaction conditions: 94 ℃ for 3min;94 ℃,30s,55-65 ℃,30s,72 ℃,1min,30 cycles; 72 ℃ for 10min;4 ℃, and preserving.

2. Construction of recombinant expression bacterium and expression of enzyme protein

The thermophilic galactokinase TTHA0595 and thermophilic UDP-glucose pyrophosphorylase TTE0732PCR products were digested with restriction enzymes NdeI and EcoRI, respectively, and the thermophilic galactosyltransferase TON_1857 was digested with restriction enzymes NdeI and BamHI. And (3) enzyme cutting system: 10 Xbuffer 5. Mu.L, 25. Mu.L of PCR product, 1.5. Mu.L of each of two restriction enzymes, 15. Mu.L of sterile water, and then, after mixing, the mixture was digested at 37℃for 6 hours. mu.L of the digested product was digested with 3. Mu.L of pET28a vector fragment, 1. Mu.L of 10 XT ₄ DNA buffer and 1. Mu. L T ₄ DNA Ligase was mixed and ligated overnight at 16 ℃. mu.L of the ligation mixture was transformed into 100. Mu.L of E.coli competent cells DH 5. Alpha. And the recombinant plasmid was selected. Transforming the recombinant plasmid into competent E.coli cell BL21 (DE 3) and culturing to OD ₆₀₀ 0.6-1.0 mM IPTG was added and cultured overnight at 25℃with shaking to induce the expression of the target protein.

Plasmid extraction, E.coli competent cell preparation and vector transformation methods were described in "molecular cloning Experimental guidelines" (third edition, science Press, 2002).

Example 2: preparation of UDP-galactose

The synthesis of UDP-galactose comprises two steps of reactions, and the specific process is as follows:

the first step of reaction: thermophilic galactokinase TTHA0595 catalyzes the synthesis of Gal-1-P

The galactokinase catalyzes D-galactose to produce Gal-1-P and ADP (adenine nucleoside diphosphate) by using one molecule of ATP (adenine nucleoside triphosphate) as a phosphate group donor, and the reaction system is shown in Table 2. The reaction buffer was 20mM CAPS (3-cyclohexylaminopropanesulfonic acid) in water (pH 8.0), and the substrate D-galactose and ATP were added sequentially to a final concentration of 150mM, followed by MgCl ₂ The mixture was incubated at 50℃for 5min at a final concentration of 5mM, and the thermophilic galactokinase TTHA0595 was added to a final concentration of 0.4mg/mL, and the mixture was reacted at 50℃for 0 to 120min with shaking at 150 rpm (FIG. 2). Experimental results show that the reaction reaches equilibrium in 80min, and the product amount reaches more than 90% of the maximum amount in 60-80 min, so that the optimized reaction time is 60-80 min.

Table 2: TTHA0595 catalytic reaction system raw material consumption scale

After the completion of the reaction, the reaction was terminated by boiling water bath for 1min, and the reaction mixture was centrifuged at 12000rpm for 3min to collect the supernatant. Gal-1-P was detected by Thin Layer Chromatography (TLC) and capillary electrophoresis. The thin layer chromatography detection method comprises the following steps: the supernatant was taken and spotted onto TLC silica gel plates using spotted capillaries and after it was dried, acetonitrile was used: methanol: water = 10:11:4 (volume ratio), the chromatographic layer spreading agent is subjected to chromatography, chromatographic liquid does not submerge the sample application point, when the spreading is finished, a blower is used for lightly drying, a coloring agent is sprayed for dyeing, drying is carried out again, and the sample is placed in an oven at 80 ℃ for heating for 8min, so that the result is observed (figure 1). The preparation of the coloring agent is that 2.56g/L alpha-naphthol is dissolved in ethanol: sulfuric acid = 90:10 (v/v) solution, heated at 100 ℃ for 5min. Capillary electrophoresis (Capillary Electrophoresis, CE) is a Beckman-coulter P/ACE MDQ capillary electrophoresis detection system equipped with a detector using bare fused silica capillary (Bare Fused Silica Capillary) and a diode array (PDA). The sample introduction buffer solution is 25mM sodium borate buffer solution with pH of 9.8, the cleaning buffer solution is 0.1M NaOH, the capillary tube length is 60cm, the electrophoresis voltage is 25KV, the cathode sample is introduced, and the sample introduction condition is that the sample introduction pressure is 0.3Psi for 3s. The decrease in ATP and the formation of ADP were detected under 254nm ultraviolet conditions, and the reaction was quantitatively analyzed by integration of peak areas.

Isolation and purification of Gal-1-P: and (3) carrying out a reaction of 300mL system, wherein the composition of the reaction system is shown in Table 1, boiling the reaction liquid for 1min after the reaction is finished, centrifuging at 12000rpm for 3min, collecting supernatant, and freeze-drying to obtain concentrated solution. Slowly adding the concentrated solution into a silica gel column, adding an eluent (acetonitrile: methanol=3:1) to elute Gal-1-P after the sample enters the column material, collecting the eluent, and performing rotary evaporation at 35 ℃ to obtain a product Gal-1-P. Gal-1-P was identified by MS and NMR.

And the second step of reaction: synthesis of UDP-galactose by thermophilic UDP-glucose pyrophosphorylase TTE0732

UDP-glucose pyrophosphorylase catalyzed Gal-1-P and UTP to produce UDP-galactose and PPi (inorganic pyrophosphoric acid), the reaction system is shown in Table 3.

Table 3: raw material consumption for TTE0732 catalytic synthesis of UDP-galactose

The reaction buffer was 20mM CAPS in water (pH 9.0), and Gal-1-P, UTP and MgCl were added in this order to a final concentration of 150mM ₂ After mixing, the mixture was incubated at 50℃for 5min, and thermophilic UDP-glucose pyrophosphorylase TTE0732 was added at a final concentration of 0.4mg/mL, and reacted at 50℃for 5h with shaking at 150 rpm. After the reaction was completed, the reaction was terminated by boiling water bath for 1min, and centrifuged at 12000rpm for 3min, and the supernatant was directly detected by Thin Layer Chromatography (TLC) (FIG. 3), or the supernatant was filtered with a 0.22 μm water film for detecting the production of UDP-galactose as a product by High Performance Liquid Chromatography (HPLC).

HPLC uses a liquid phase detection system of WATERS, ACCHROM Unit 5 μm C chromatography column (250 nm х 4.6.6 nm) and UV detector to monitor compounds with nucleotide base chromophores at 254nm wavelength. Identification of UDP-galactose molecules uses MS and NMR.

Example 3: thermophilic enzymatic synthesis of galactosyl compounds

Example 3 the glycosylation modification of the compounds vanillyl alcohol, p-nitrophenol and silybin was achieved using the UDP-galactose synthesized in example 2 as galactosyl donor and the thermophilic galactosyltransferase TON_1857 to catalyze the transglycosylation reaction, the reaction system being shown in Table 4.

Table 4: reaction raw material table for catalytic synthesis of galactosyl compound by TON_1857

The reaction buffer was 20mM CAPS in water (pH 9.0), and UDP-galactose and MgCl were added in this order to a final concentration of 5mM ₂ And vanillyl alcohol or p-nitrophenol or silybin, mixing, maintaining at 50deg.C for 5min, sequentially adding thermophilic galactosyltransferase TON_1857 with final concentration of 0.4mg/mL, and oscillating at 50deg.C at 150 rpm for 5 hr.

After the completion of the reaction, the reaction was terminated by boiling in a boiling water bath for 1min, and the supernatant was collected by centrifugation at 12000rpm for 3min, and the production of the product was detected by a thin layer chromatography method (FIG. 8). The thin layer chromatography detection method is described in example 2.

<110> Jilin university

<120> a method for synthesizing UDP-galactose and a galactosyl compound

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1044

<212> DNA

<213> Thermus thermophilus

<221> CDS

<222> (1)..(1044)

<400> 1

atg ggc ttc caa gag gtt tac ggc gtc ctg ccc cag gcc agc gcc cag 48

Met Gly Phe Gln Glu Val Tyr Gly Val Leu Pro Gln Ala Ser Ala Gln

1 5 10 15

gcc ccc ggc cgg gtg aac ctc ctg ggg gag cac acg gac tac cag gaa 96

Ala Pro Gly Arg Val Asn Leu Leu Gly Glu His Thr Asp Tyr Gln Glu

20 25 30

ggc tac gtc ctc ccc acc ccg gtc ccc tac ttc acc cgg gtg gag gcc 144

Gly Tyr Val Leu Pro Thr Pro Val Pro Tyr Phe Thr Arg Val Glu Ala

35 40 45

gcc ccc ctc gag ggg gcg gtg gag gcc ttc agc gag aac ctg ggg gag 192

Ala Pro Leu Glu Gly Ala Val Glu Ala Phe Ser Glu Asn Leu Gly Glu

50 55 60

ctc cgg gcc cgc ccc ctc tcc tcc ccg ccc caa ggg gac ttc ctg gac 240

Leu Arg Ala Arg Pro Leu Ser Ser Pro Pro Gln Gly Asp Phe Leu Asp

65 70 75 80

tac ctc ctc ggg gtg gtc cgg gcc ctc cgg gag gcc ggg cac ggg gtg 288

Tyr Leu Leu Gly Val Val Arg Ala Leu Arg Glu Ala Gly His Gly Val

85 90 95

gaa ggg gcc cgg ttc tac gtc cgc agc gac ctc ccc atg ggg gcg ggg 336

Glu Gly Ala Arg Phe Tyr Val Arg Ser Asp Leu Pro Met Gly Ala Gly

100 105 110

ctt tcc agc tcc gcc gcc ctc gag gtg gcg gcc ctc agg gcc ctc cgc 384

Leu Ser Ser Ser Ala Ala Leu Glu Val Ala Ala Leu Arg Ala Leu Arg

115 120 125

acc ctc tac cgc ctc ccc ctc tcc gac ctg gag gtg gcc cgc ctc gcc 432

Thr Leu Tyr Arg Leu Pro Leu Ser Asp Leu Glu Val Ala Arg Leu Ala

130 135 140

cag aag gcg gag gtg gag tac gtg ggg gtc cgg tgc ggg atc atg gac 480

Gln Lys Ala Glu Val Glu Tyr Val Gly Val Arg Cys Gly Ile Met Asp

145 150 155 160

cag atg gcg gcg agc ctg ggc cag ccg ggc cag gcc ctc ttc ctg gac 528

Gln Met Ala Ala Ser Leu Gly Gln Pro Gly Gln Ala Leu Phe Leu Asp

165 170 175

acc cga acc ctg gcc tac gag aac ctt ccc ctt ccc ccg ggg gtg cgg 576

Thr Arg Thr Leu Ala Tyr Glu Asn Leu Pro Leu Pro Pro Gly Val Arg

180 185 190

gtg gcc gtc ctg gac ctc ggg ctt ggg cgc cgg ctg gcg gag gcc ggg 624

Val Ala Val Leu Asp Leu Gly Leu Gly Arg Arg Leu Ala Glu Ala Gly

195 200 205

tac aac cag cgc cgc cag gag gcg gag gag gcg gcc aag agg ctc ggg 672

Tyr Asn Gln Arg Arg Gln Glu Ala Glu Glu Ala Ala Lys Arg Leu Gly

210 215 220

gtg cgc tcc ctt agg gac gtg gcc gac ctc tgc ctg gtg gaa agc ctc 720

Val Arg Ser Leu Arg Asp Val Ala Asp Leu Cys Leu Val Glu Ser Leu

225 230 235 240

cct tcg ccc ctg gac cgg cgg gcc cgg cac gtg gtg agc gag aac ctt 768

Pro Ser Pro Leu Asp Arg Arg Ala Arg His Val Val Ser Glu Asn Leu

245 250 255

agg gtc ctt cgg ggg gtg gag gcc cta agg cgg ggg gac gcc cgg gcc 816

Arg Val Leu Arg Gly Val Glu Ala Leu Arg Arg Gly Asp Ala Arg Ala

260 265 270

ttc ggg gag ctc atg acc gca agc cac cgc tcc ctg gcc cag gac tac 864

Phe Gly Glu Leu Met Thr Ala Ser His Arg Ser Leu Ala Gln Asp Tyr

275 280 285

gag gtg agc ctc ccc gag ctg gac ctc ttg gtg gag gag gcc ctg aag 912

Glu Val Ser Leu Pro Glu Leu Asp Leu Leu Val Glu Glu Ala Leu Lys

290 295 300

gcc ggg gcc tac ggg gcc aag ctc acg ggg gca ggc ttc ggc ggg gcc 960

Ala Gly Ala Tyr Gly Ala Lys Leu Thr Gly Ala Gly Phe Gly Gly Ala

305 310 315 320

gtg gtg gcc ctg gtg gcc gaa agc cgc ttc ccc gcc ttc agg gag gcc 1008

Val Val Ala Leu Val Ala Glu Ser Arg Phe Pro Ala Phe Arg Glu Ala

325 330 335

ctg gcc cgg cgc ttc ccc gac ctc aag gtc ctc taa 1044

Leu Ala Arg Arg Phe Pro Asp Leu Lys Val Leu

340 345

<210> 2

<211> 909

<212> DNA

<213> Caldanaerobacter subterraneus

<221> CDS

<222> (1)..(909)

<400> 2

atg aaa ata aag aaa gcg ata att cca gca gcg ggc ctt ggt acc agg 48

Met Lys Ile Lys Lys Ala Ile Ile Pro Ala Ala Gly Leu Gly Thr Arg

1 5 10 15

ttt tta cct gct acc aag gct cag cct aag gaa atg ctt cca att gta 96

Phe Leu Pro Ala Thr Lys Ala Gln Pro Lys Glu Met Leu Pro Ile Val

20 25 30

gac aag cct act ata cag tac ata gtg gaa gaa gcg gta cag tca gga 144

Asp Lys Pro Thr Ile Gln Tyr Ile Val Glu Glu Ala Val Gln Ser Gly

35 40 45

ata gag gat att ctt ata ata act gga agg aac aaa aga gcc ata gaa 192

Ile Glu Asp Ile Leu Ile Ile Thr Gly Arg Asn Lys Arg Ala Ile Glu

50 55 60

gat cat ttt gac aaa tct gta gaa ttg gag cta gaa tta aag aaa aag 240

Asp His Phe Asp Lys Ser Val Glu Leu Glu Leu Glu Leu Lys Lys Lys

65 70 75 80

aat cag gaa agt tta cta agc ctt gta gaa gat att agc aat atg gta 288

Asn Gln Glu Ser Leu Leu Ser Leu Val Glu Asp Ile Ser Asn Met Val

85 90 95

aat att cac tat ata aga caa aaa gaa cct aaa ggc ttg ggg cat gcc 336

Asn Ile His Tyr Ile Arg Gln Lys Glu Pro Lys Gly Leu Gly His Ala

100 105 110

att tac tgt gct aaa tct ttt gtt ggc aat gag cct ttc gca gtg ctt 384

Ile Tyr Cys Ala Lys Ser Phe Val Gly Asn Glu Pro Phe Ala Val Leu

115 120 125

tta gga gat gac gtg gtg gat gct gaa gta cct gtt tta aag cag atg 432

Leu Gly Asp Asp Val Val Asp Ala Glu Val Pro Val Leu Lys Gln Met

130 135 140

ata gag cag ttt gag agg tat aat tgc acc ata att gga gtg cag gaa 480

Ile Glu Gln Phe Glu Arg Tyr Asn Cys Thr Ile Ile Gly Val Gln Glu

145 150 155 160

gtg cct gaa gag gat gta cat aaa tat gga att gta agc ggt act ttt 528

Val Pro Glu Glu Asp Val His Lys Tyr Gly Ile Val Ser Gly Thr Phe

165 170 175

att gag gat agg cta tat aaa gtc aat gat ttg ata gaa aag cca agg 576

Ile Glu Asp Arg Leu Tyr Lys Val Asn Asp Leu Ile Glu Lys Pro Arg

180 185 190

aga gag gaa gca cct tct aat ata gct att ttg gga agg tat ata att 624

Arg Glu Glu Ala Pro Ser Asn Ile Ala Ile Leu Gly Arg Tyr Ile Ile

195 200 205

aca ccg cga ata ttt gag att ttg gaa cat acg cct cct gga aga gga 672

Thr Pro Arg Ile Phe Glu Ile Leu Glu His Thr Pro Pro Gly Arg Gly

210 215 220

gga gaa ata caa ttg aca gac gct tta aaa act ctt tta aat tat gag 720

Gly Glu Ile Gln Leu Thr Asp Ala Leu Lys Thr Leu Leu Asn Tyr Glu

225 230 235 240

gcc att tac gcc tat aat ttt ata ggc aaa agg tat gat gtg ggg gat 768

Ala Ile Tyr Ala Tyr Asn Phe Ile Gly Lys Arg Tyr Asp Val Gly Asp

245 250 255

aaa ctg ggc tat ctc atg gcg act gtg gaa tat gct ttg aaa agg gaa 816

Lys Leu Gly Tyr Leu Met Ala Thr Val Glu Tyr Ala Leu Lys Arg Glu

260 265 270

gat ttg aga gag cct ttt aaa agg tat ttg ata aca att gtc cag gat 864

Asp Leu Arg Glu Pro Phe Lys Arg Tyr Leu Ile Thr Ile Val Gln Asp

275 280 285

tta ctt ggt atg gaa gaa gcc gca gtg act gaa aga gat gtg taa 909

Leu Leu Gly Met Glu Glu Ala Ala Val Thr Glu Arg Asp Val

290 295 300

<210> 3

<211> 1176

<212> DNA

<213> Thermococcus onnurineus

<221> CDS

<222> (1)..(1176)

<400> 3

atg aaa gtg gca ata atc tgc ttc gat ttc aag gag tca aac ctc aga 48

Met Lys Val Ala Ile Ile Cys Phe Asp Phe Lys Glu Ser Asn Leu Arg

1 5 10 15

aag caa ccc tgg aga tat gtg tat gaa att gca aag ggg ctt aaa tcc 96

Lys Gln Pro Trp Arg Tyr Val Tyr Glu Ile Ala Lys Gly Leu Lys Ser

20 25 30

aat gga cat gaa gtt ttc ata gtc act aat tcg aac aat gag aca gat 144

Asn Gly His Glu Val Phe Ile Val Thr Asn Ser Asn Asn Glu Thr Asp

35 40 45

atc gcc gga ata cga gtt ttt ggt gtc ggc aaa ttg ttc att cct cta 192

Ile Ala Gly Ile Arg Val Phe Gly Val Gly Lys Leu Phe Ile Pro Leu

50 55 60

aaa gga gaa tca aaa gaa gtc cta gag gtt tta gac agg gaa aat ccc 240

Lys Gly Glu Ser Lys Glu Val Leu Glu Val Leu Asp Arg Glu Asn Pro

65 70 75 80

gac agg ata atc atg ctc tta ggg ctg aca agc ttc ctc aga act cac 288

Asp Arg Ile Ile Met Leu Leu Gly Leu Thr Ser Phe Leu Arg Thr His

85 90 95

ttt gag atc aaa cag cca gtc ata ggc gtt ctc aca agc cca gta tac 336

Phe Glu Ile Lys Gln Pro Val Ile Gly Val Leu Thr Ser Pro Val Tyr

100 105 110

tca ttg ggg gag ctg ata aga aac gtc ggg att aga gac tcg ata gct 384

Ser Leu Gly Glu Leu Ile Arg Asn Val Gly Ile Arg Asp Ser Ile Ala

115 120 125

tat cgc aga tac aca gtc att cac atc ata aac tcg ctt gta cct agc 432

Tyr Arg Arg Tyr Thr Val Ile His Ile Ile Asn Ser Leu Val Pro Ser

130 135 140

ttt ctc gtg aga aaa tgg tcg cag aaa ttt gaa tat ata atc gtt ctg 480

Phe Leu Val Arg Lys Trp Ser Gln Lys Phe Glu Tyr Ile Ile Val Leu

145 150 155 160

agt caa cgt aac cgg gag aga cta atc aaa aaa gga gtt cca gcg gat 528

Ser Gln Arg Asn Arg Glu Arg Leu Ile Lys Lys Gly Val Pro Ala Asp

165 170 175

aag gtt att gta ata cct cca gga ata gat gaa gag ttc cta gag ctt 576

Lys Val Ile Val Ile Pro Pro Gly Ile Asp Glu Glu Phe Leu Glu Leu

180 185 190

cct gaa cga gaa aca att gag cgc att agg tct gaa atc agt cca gat 624

Pro Glu Arg Glu Thr Ile Glu Arg Ile Arg Ser Glu Ile Ser Pro Asp

195 200 205

gga gct cct gtc gtg atg tac tac act tcc ccg tta acc tta agg gga 672

Gly Ala Pro Val Val Met Tyr Tyr Thr Ser Pro Leu Thr Leu Arg Gly

210 215 220

acg gat acg cta gtt agg gct ttg ccc cat att cta aaa gaa aaa gaa 720

Thr Asp Thr Leu Val Arg Ala Leu Pro His Ile Leu Lys Glu Lys Glu

225 230 235 240

gtt aaa ctg ttg att ctt tcc aga ccc gat tac agg agt gtc cta aaa 768

Val Lys Leu Leu Ile Leu Ser Arg Pro Asp Tyr Arg Ser Val Leu Lys

245 250 255

gag gaa cag aag ctc aga aag ctg gca gaa aag ctg aac gtg aga aaa 816

Glu Glu Gln Lys Leu Arg Lys Leu Ala Glu Lys Leu Asn Val Arg Lys

260 265 270

aat ctc gtg ata att tca aaa cat ctg cca ctc gag gac gtc aaa gcg 864

Asn Leu Val Ile Ile Ser Lys His Leu Pro Leu Glu Asp Val Lys Ala

275 280 285

tac gta agt tcg gct gat gtg gtg gtg ctt ccg ttt aaa ctt gtg ctt 912

Tyr Val Ser Ser Ala Asp Val Val Val Leu Pro Phe Lys Leu Val Leu

290 295 300

tct gat gtc ccg ctg agt ata tta gaa gca atg gct cta gga aaa gtt 960

Ser Asp Val Pro Leu Ser Ile Leu Glu Ala Met Ala Leu Gly Lys Val

305 310 315 320

gtc atc ggt act gat gtt gat gga att cca gag ata ctg aaa gac aaa 1008

Val Ile Gly Thr Asp Val Asp Gly Ile Pro Glu Ile Leu Lys Asp Lys

325 330 335

gga ctc ata gtc agg ccg aat aac ccc aaa gag ttg gcc aac gct gtg 1056

Gly Leu Ile Val Arg Pro Asn Asn Pro Lys Glu Leu Ala Asn Ala Val

340 345 350

tta tta gta ttg gaa gat aag aag cta aaa tat gaa cta gaa acg gca 1104

Leu Leu Val Leu Glu Asp Lys Lys Leu Lys Tyr Glu Leu Glu Thr Ala

355 360 365

gcc aag gaa tac gtt aat cag tgg aga aga tgg aat gac gtt gtg gag 1152

Ala Lys Glu Tyr Val Asn Gln Trp Arg Arg Trp Asn Asp Val Val Glu

370 375 380

gag ttt tta aag ctg ata ggg tga 1176

Glu Phe Leu Lys Leu Ile Gly

385 390

Claims

1. A method for synthesizing UDP-galactose comprises the following steps:

CAPS aqueous solution of 20mM pH 8.0-10.0 reaction buffer, sequentially adding substrate D-galactose and ATP to a final concentration of 100-200 mM, and then adding MgCl to a final concentration of 5-5 mM ₂ Reacting for 3-8 min at 40-60 ℃, then adding thermophilic galactokinase TTHA0595 with the final concentration of 0.3-0.6 mg/mL, wherein the nucleotide sequence is SEQ ID No.1, and then oscillating for reacting for 60-80 min at 120-180 r/min at 40-60 ℃ to obtain Gal-1-P;

(ii) CAPS aqueous solution of 20mM pH 8.0-10.0 in the reaction buffer, sequentially adding the substrates Gal-1-P and UTP obtained in the step (i) to a final concentration of 100-200 mM, and then adding MgCl of 5-5 mM ₂ Reacting for 3-8 min at 40-60 ℃, then adding thermophilic UDP-glucose pyrophosphorylase TTE0732 with the final concentration of 0.3-0.6 mg/mL, and carrying out oscillating reaction for 4-6 h at 120-180 r/min at 40-60 ℃ to obtain UDP-galactose, wherein the nucleotide sequence of the thermophilic UDP-glucose pyrophosphorylase TTE0732 is SEQ ID No.2.

2. The method for synthesizing UDP-galactose of claim 1, wherein: obtaining from thermophilic bacteria by NCBI GenBank searchThermus thermophilus HB8Is derived from thermophilic bacteriumCaldanaerobacter subterraneusThe gene sequence of thermophilic UDP-glucose pyrophosphorylase TTE0732 is searched; then designing primers according to nucleotide sequences SEQ ID No.1 and SEQ ID No.2 of the two enzymes, amplifying enzyme genes by using a PCR method, connecting the enzyme genes with an escherichia coli expression vector pET28a to construct recombinant plasmids, and respectively converting escherichia coli expression host bacteriaTransetta（DE3）Constructing recombinant enzyme expression bacteria by competent cells; then utilizing inducer IPTG to induce and construct recombinant enzyme expression bacteria expressionThermophilic galactokinase TTHA0595 and thermophilic UDP-glucose pyrophosphorylase TTE0732 are obtained by separating and purifying thermophilic galactokinase and thermophilic UDP-glucose pyrophosphorylase through cell ultrasonic disruption, heating inactivation and Ni-NTA affinity chromatography.

3. A method for synthesizing a galactosyl compound, characterized by: the reaction buffer is CAPS water solution with 20mM and pH of 8.0-10.0, UDP-galactose as described in claim 1 or 2 and raw materials to be modified are sequentially added to a final concentration of 5-100 mM, and MgCl with a final concentration of 5-mM is further added ₂ After reacting for 3-8 min at 40-60 ℃, adding thermophilic galactosyltransferase TON_1857 with the final concentration of 0.3-0.6 mg/mL, wherein the nucleotide sequence is SEQ ID No.3, and oscillating at 120-180 r/min for reacting for 4-6 h at 40-60 ℃ to obtain a galactosyl compound; the raw material to be modified is vanillyl alcohol, p-nitrophenol or silybin.