CN113265434A

CN113265434A - Method for synthesizing UDP-galactose and galactosyl compound

Info

Publication number: CN113265434A
Application number: CN202110560931.7A
Authority: CN
Inventors: 高仁钧; 李雅静; 邓林; 解桂秋
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2021-05-19
Filing date: 2021-05-19
Publication date: 2021-08-17
Anticipated expiration: 2041-05-19
Also published as: CN113265434B

Abstract

A method for synthesizing UDP-galactose and a method for synthesizing galactosyl compound, belonging to the technical field of biological engineering. The method for catalyzing UTP, ATP and D-galactose to generate UDP-galactose by using the thermophilic enzyme method in two steps comprises the following two steps: using D-galactose and ATP as substrates, and using thermophilic galactokinase TTHA0595 to catalyze and synthesize 1-P-Gal (1-phosphate-galactose); (ii) catalytic synthesis of UDP-galactose using thermophilic UDP-glucose pyrophosphorylase TTE0732 using 1-P-Gal and UTP as substrates. The UDP-galactose synthesized by the invention is used as glycosyl donor, and thermophilic galactose transferase TON-1857 is utilized to further catalyze substrate compounds of vanillyl alcohol, p-nitrophenol or silybin to synthesize galactosyl compounds, thereby constructing the method for synthesizing the galactosyl compounds by a thermophilic enzyme method.

Description

Method for synthesizing UDP-galactose and galactosyl compound

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a method for synthesizing UDP-galactose and a galactosyl compound.

Background

Glycoconjugates are compounds formed by covalent bonding of a sugar to a small molecule compound and biomolecules such as proteins, lipids, and nucleic acids. Some of the small molecule glycoconjugates have important application values and become hot spots of current researches, such as glucoside, glycosylation products of small molecule drugs, glycosylation products of pigments and spices, prebiotics and the like. Glycosides are compounds formed by replacement of a hydrogen on the hemiacetal hydroxyl group of a sugar with a ligand, which in turn loses one molecule of water or other small molecule compound. Galactosides are attractive candidates for prodrug design and synthesis, and galactoside prodrugs have good solubility, low toxicity, and strong targeting ability compared to the starting active drug material. Galactoside prodrugs have been increasingly used for applications in liver disease and targeted tumor therapy.

Current methods of small molecule glycosylation include biological and chemical methods. The biggest difficulty in the chemical method for synthesizing glucoside is the protection and deprotection of polyhydroxy group and the complex reaction process. For example, patent CN105237590B provides a one-pot chemical synthesis method of α -glycosyl compound, which uses TMS (trimethylsilyl) protected glycosyl iodine as sugar donor, monohydroxy TMS sugar as sugar acceptor, organic reagent as solvent, and under the action of specific catalyst and phase transfer catalyst, stirs for 12h at room temperature to synthesize α -glycosidic bond oligosaccharide or glycoside. The reaction time is long and the hydroxyl group needs to be protected. The biological methods include microbial fermentation and enzymatic synthesis, and the fermentation method includes a de novo synthesis method and a biotransformation method, and the de novo synthesis method has low industrialization potential due to the low effective concentration. Enzymatic synthesis of glycocomplexes may utilize glycoside hydrolases (glycosidases) and glycosyltransferases. Glycosidases mostly catalyze the hydrolysis of glycosyl groups, and have the activity of transglycosylation, and the glycosidase can catalyze the glycosylation of natural drugs to improve the drug effect of the drugs, such as the enzymatic conversion of ginsenoside. Glycosidation reaction catalyzed by glycosidase is mainly focused on glycosylation of primary alcohol, and research reports aiming at tertiary alcohol or phenolic hydroxyl are less; since the main activity of glycosidases is hydrolysis, conversion rates are not generally high. And glycosyltransferase can catalyze glycosylation of the substrate with high efficiency. Glycosyltransferases are highly efficient in catalysis, but have high substrate requirements, and usually, only one glycoside substrate can be catalyzed by one glycosyltransferase, and glycosyltransferases also have selectivity for reactive groups at different positions in the substrate. Meanwhile, glycosyltransferases can often be modified only by glycosylation using a glycosyl donor such as Uridine Diphosphate (UDP) glycoside. For example, patent CN110156855A provides a method for preparing glycosylated flavonoid compounds with UDP-sugar as glycosyl donor using glycosidase and glycosyltransferase. However, UDP glycoside has few sources and high artificial synthesis price, so that large-scale industrial production of UDP glycoside and the compound to be modified by one-step glycosyltransferase catalysis cannot be realized.

The synthesis of UDP glycoside is realized by catalyzing UTP (uridine triphosphate), ATP (adenosine triphosphate) and monosaccharide to react by a fermentation method or an enzyme method. For example, patent nos. CN1477204A, CN1550554A and CN1572879A provide methods for preparing sugar nucleotides and complex carbohydrates by using microbial culture solution or processed product of the culture solution as enzyme source, and the used microorganisms are mainly yeasts and corynebacterium, but the reaction system components are complex and the reaction time is long. No other Chinese patent for synthesizing UDP glycoside is found.

In enzymatic reactions, low solubility of enzymes and substrates is one of the key factors limiting the progress of the reaction. To increase the reaction rate, the temperature is usually selected to be elevated to increase the solubility of the enzyme and substrate. However, the normal temperature enzyme is easy to inactivate at high temperature and has poor thermal stability, so that the reaction process is influenced, and the thermophilic enzyme can overcome the limiting factors.

The invention takes ATP, UTP and D-galactose with lower price as substrates, and uses thermophilic galactokinase and thermophilic UDP-glucose pyrophosphatase to catalyze and synthesize UDP-galactose (the sale price in the current market is about 3500 yuan/100 mg), thereby effectively reducing the production cost. Furthermore, the galactosyl group in UDP-galactose can be transferred to a small molecular compound by adding a proper thermophilic galactosyltransferase into the reaction system, and a glycosyl modified galactosyl compound can be directly obtained. At present, no patent is seen for the synthesis of galactosyl compounds by the thermophilic enzyme method.

Disclosure of Invention

The invention provides a method for catalyzing UTP, ATP and galactose to generate UDP-galactose by using a thermophilic enzyme method two-step reaction. The thermophilic enzyme used in the method is thermophilic galactokinase TTHA0595 screened from thermophilic bacteria Thermus thermophilus HB8 and thermophilic UDP-glucose pyrophosphorylase TTE0732 screened from thermophilic bacteria Caldanarobacter subcorereus in the laboratory, and the nucleotide sequences are respectively SEQ ID No.1 and SEQ ID No. 2.

The production method of the two kinds of thermophilic enzymes is to construct escherichia coli expression bacteria by using a DNA recombination technology and then to induce enzyme protein expression by using an inducer IPTG (isopropyl thiogalactoside). First, the thermophilic galactokinase TTHA0595 gene sequence (1044bp, code 347aa, SEQ ID No.1) from the thermophilic bacterium Thermus thermophilus HB8 was obtained by NCBI GenBank search, and the thermophilic UDP-glucose pyrophosphorylase TTE0732 gene sequence (909bp, code 302aa, SEQ ID No.2) was searched from the thermophilic bacterium Caldanoebacter subcorereus. Primers are designed according to nucleotide sequences SEQ ID No.1 and SEQ ID No.2 of the two enzymes, a PCR method is utilized to amplify enzyme genes, the enzyme genes are connected with an escherichia coli expression vector pET28a to construct recombinant plasmids, and escherichia coli expression host bacteria Transetta (DE3) competent cells are respectively transformed to construct recombinase expression bacteria. The constructed recombinant enzyme expression strain is induced by an inducer IPTG (isopropyl thiogalactoside) to express thermophilic galactokinase and thermophilic UDP-glucose pyrophosphorylase. The expression product is soluble protein in cells, and thermophilic galactokinase and thermophilic UDP-glucose pyrophosphorylase are obtained by separating and purifying the soluble protein through cell ultrasonic disruption, heating inactivation and Ni-NTA affinity chromatography.

The method for catalyzing UTP, ATP and D-galactose to generate UDP-galactose by using the thermophilic enzyme method in two steps comprises the following two steps: using D-galactose and ATP as substrates, and using thermophilic galactokinase TTHA0595 to catalyze and synthesize 1-P-Gal (1-phosphate-galactose); (ii) catalytic synthesis of UDP-galactose using thermophilic UDP-glucose pyrophosphorylase TTE0732 using 1-P-Gal and UTP as substrates.

The specific reaction in step (i) is as follows: the reaction buffer solution is 20mM CAPS (3-cyclohexylaminopropanesulfonic acid) aqueous solution (pH 8.0-10.0), substrates D-galactose and ATP are sequentially added until the final concentration is 100-200 mM, and MgCl with the final concentration of 5mM is added₂Reacting at 40-60 ℃ for 3-8 min, then adding thermophilic galactokinase TTHA0595 with the final concentration of 0.3-0.6 mg/mL, and oscillating at 40-60 ℃ at 120-180 r/min for 60-80 min to obtain 1-P-Gal;

the specific reaction of step (ii) is: adding a 20mM CAPS aqueous solution (pH 8.0-10.0) as a reaction buffer solution to the reaction solution obtained in the step (i), sequentially adding substrates 1-P-Gal and UTP to a final concentration of 100-200 mM, and adding MgCl to a final concentration of 5mM₂Reacting at 40-60 ℃ for 3-8 min, adding thermophilic UDP-glucose pyrophosphorylase TTE0732 with the final concentration of 0.3-0.6 mg/mL, and oscillating at 40-60 ℃ at 120-180 r/min for 4-6 h to obtain UDP-galactose.

The UDP-galactose synthesized by the invention is used as glycosyl donor, and thermophilic galactose transferase TON-1857 is utilized to further catalyze the substrate compound to synthesize the galactosyl compound, thus constructing the method for synthesizing the galactosyl compound by the thermophilic enzyme method. Thermophilic galactosyltransferase TON _1857 used in the method for synthesizing galactosyl compounds by thermophilic enzyme method is derived from thermophilic bacteria Thermococcus ornurineus, and is produced by constructing Escherichia coli expression bacteria by fermentation by using genetic engineering DNA recombination technology, wherein the nucleotide sequence of the Escherichia coli expression bacteria is shown in SEQ ID NO. 3. The method for synthesizing galactosyl compounds by using the thermophilic enzyme method disclosed by the invention realizes glycosylation modification of vanillyl alcohol, p-nitrophenol and silybin.

The reaction conditions of the raw material compounds of vanillyl alcohol, p-nitrophenol and silybin for modification in the synthesis of galactosyl compounds by the thermophilic enzyme method are as follows: the reaction buffer solution is 20mM CAPS aqueous solution (pH 8.0-10.0), and substrates UDP-galactose and vanillyl alcohol or p-nitrophenol or silybin are sequentially added to the reaction buffer solution to obtain the final concentration5 to 100mM each, and adding MgCl at a final concentration of 5mM₂Reacting at 40-60 ℃ for 3-8 min, adding thermophilic galactosyltransferase TON _1857 with final concentration of 0.3-0.6 mg/mL, and oscillating at the rotation speed of 120-180 rpm for 4-6 h at 40-60 ℃ to obtain galactosyl compound.

The thermophilic enzymes used in the invention are all prepared by DNA recombination technology, and the sequence of the coding gene is obtained by inquiring GenBank database. The target gene is amplified by utilizing the PCR technology, and is recombined with the common expression vector of the escherichia coli (such as pET28a), and the escherichia coli expression strain (such as BL21(DE3)) is transformed to construct a recombinant expression strain.

Drawings

FIG. 1: thin layer chromatography detection of 1-P-Gal; d-galactose is a standard substance, and compared with an experimental group, a control group only does not add thermophilic galactokinase TTHA0595, and the result shows that D-galactose and ATP in the experimental group are catalyzed by thermophilic galactokinase TTHA0595 to synthesize a 1-P-Gal product;

FIG. 2: the thermophilic galactokinase TTHA0595 catalyzes and synthesizes a reaction time process curve of 1-P-Gal, the abscissa is reaction time (min), the ordinate is conversion rate (%) of a substrate, and the reaction reaches equilibrium after 80 min;

FIG. 3: MS detection result curve of 1-P-Gal, arrow indicates 1-P-Gal product peak; indicating that the reaction product is 1-P-Gal;

FIG. 4: 1H-NMR results (1H NMR (300MHz, Deuterium Oxide) δ 5.45(dd, J ═ 7.3,3.6Hz,1H),4.15 to 4.05(m,1H),3.95(dd, J ═ 3.4,1.2Hz,1H),3.85(dd, J ═ 10.3,3.3Hz,1H),3.76 to 3.65(m, 3H)) of 1-P-Gal indicate that 1-P-Gal is obtained;

FIG. 5: thin layer chromatography detection of UDP-galactose; wherein 1 is a D-galactose standard substance; 2 is 1-P-galactose; 3 is an experimental group; the results show that UDP-galactose products are generated in the experimental group.

FIG. 6: MS detection of UDP-Gal as a curve, arrow indicates that UDP-galactose binds to 1 Na⁺Molecular weight peak of (a); indicating that the reaction product is UDP-Gal;

FIG. 7: 1H-NMR detection of UDP-Gal (1H NMR (300MHz, Deuterium Oxide) δ 8.19(s,1H), 8.16-8.01 (m,2H),6.00(d, J ═ 6.1Hz,1H),4.74(dd, J ═ 6.1,5.3Hz,1H),4.40(ddd, J ═ 5.2,3.5,0.5Hz,1H),4.25(q, J ═ 3.4Hz,1H), 4.00-3.40 (m, 4H)); indicating that UDP-Gal is obtained;

FIG. 8: the thin-layer chromatography detection map of different substrate glycosylation products catalyzed by a thermophilic enzyme method is shown, wherein 1 is a vanillyl alcohol control group, 2 is a vanillyl alcohol experimental group, 3 is a p-nitrophenol control group, 4 is a p-nitrophenol experimental group, 5 is a silybin control group, and 6 is a silybin experimental group; in the figure, white triangles show the substrate and black triangles show the product. The control group was identical to the experimental group except that thermophilic galactosyltransferase TON _1857 was not added.

Detailed Description

Example 1: the construction of engineering bacteria TTHA0595, TTE0732 and TON _1857 and the expression and purification of protein comprise the following steps:

amplification of TTHA0595, TTE0732 and TON _1857 genes

The primer sequences for amplification of TTHA0595, TTE0732 and TON _1857 genes were as follows:

(1) thermophilic galactokinase TTHA 0595:

an upstream primer: ATGAATCATATGATGGGCTTCCAAGAGGTTTAC, restriction enzyme Nde I recognition site on the horizontal line;

a downstream primer: AATCCCGAATTCTTAGAGGACCTTGAGG, the horizontal line is the recognition site of restriction enzyme EcoRI;

(2) thermophilic UDP-glucose pyrophosphorylase TTE 0732:

an upstream primer: AGCGGAAGAGGGGAAAGCATATGAAAATAA, wherein the horizontal line is a recognition site of restriction enzyme Nde I;

a downstream primer: CGCCGCCCTACTCTGAATTCTTACACATCT, the horizontal line is the recognition site of restriction enzyme EcoRI;

(3) thermophilic galactosyltransferase TON _ 1857:

an upstream primer: GGGGCGATAGACATATGAAAGTGGC-3' with restriction enzyme Nde I recognition site in the horizontal line;

a downstream primer: CGCGGATCCATGTAACCTCACCCTAT, the horizontal line is the recognition site of the restriction enzyme BamHI.

Table 1: PCR reaction system

Composition (I)	Volume (μ L)
		pfu 10×Buffer	10
Genomic DNA	1
		dNTPs	10
Upstream primer	1
		Downstream primer	1
pfu	2
		Double distilled water	75

And (3) PCR reaction conditions: 94 ℃ for 3 min; 94 ℃, 30s, 55-65 ℃, 30s, 72 ℃, 1min, and 30 cycles; 72 ℃ for 10 min; and preserving at 4 ℃.

2. Construction of recombinant expression bacteria and expression of enzyme protein

The thermophilic galactokinase TTHA0595 and thermophilic UDP-glucose pyrophosphorylase TTE0732PCR products are respectively cut by restriction enzymes NdeI and EcoR I, thermophilic galactosyltransferase TON _1857 were digested with the restriction enzymes NdeI and BamHI. Enzyme digestion system: 10 Xbuffer 5. mu.L, PCR product 25. mu.L, two restriction enzymes 1.5. mu.L each, sterile water 15. mu.L, mix well and cut at 37 ℃ for 6 h. mu.L of the digested product was mixed with 3. mu.L of vector fragment of pET28a and 1. mu.L of 10 XT₄DNA buffer and 1. mu. L T₄The DNA Ligase was mixed and ligated overnight at 16 ℃. mu.L of the ligation mixture was used to transform 100. mu.L of E.coli competent cell DH 5. alpha. and recombinant plasmids were selected. Transforming the recombinant plasmid into Escherichia coli competent cell BL21(DE3), and culturing to OD₆₀₀When the concentration is 0.6-1.0, 0.5mM IPTG is added to the mixture and the mixture is subjected to shaking culture at 25 ℃ overnight to induce the expression of the target protein.

The methods of plasmid extraction, E.coli competent cell preparation and vector transformation were referred to "molecular cloning protocols" (third edition, scientific Press, 2002).

Example 2: preparation of UDP-galactose

The synthesis of UDP-galactose comprises two steps of reactions, and the specific process is as follows:

the first step of reaction: thermophilic galactokinase TTHA0595 catalyzed synthesis of 1-P-Gal

Galactokinase uses a molecule of ATP (adenosine triphosphate) as a phosphate group donor to catalyze D-galactose to generate 1-P-Gal and ADP (adenosine diphosphate), and the reaction system is shown in Table 2. The reaction buffer was 20mM CAPS (3-cyclohexylaminopropanesulfonic acid) aqueous solution (pH 8.0), substrates D-galactose and ATP were sequentially added to a final concentration of 150mM, and MgCl was added₂Keeping the temperature at 50 ℃ for 5min until the final concentration is 5mM, adding TTHA0595 to the final concentration of 0.4mg/mL, and reacting at 50 ℃ for 0-120 min with shaking at 150 rpm (FIG. 2). The experimental result shows that the reaction reaches equilibrium within 80min, and the product amount reaches over 90% of the maximum amount within 60-80 min, so the optimized reaction time is 60-80 min.

Table 2: TTHA0595 catalytic reaction system raw material dosage table

After the reaction is finished, the reaction is stopped in boiling water bath for 1min, and the reaction solution is centrifuged at 12000rpm for 3min to collect supernatant. Detection of 1-P-Gal was carried out by Thin Layer Chromatography (TLC) and capillary electrophoresis. The thin layer chromatography detection method comprises the following steps: taking the supernatant, spotting on a TLC silica gel plate using a spotting capillary, after drying, treating with acetonitrile: methanol: water 10: 11: 4 (volume ratio), performing chromatography with the chromatographic solution without immersing the sample point, drying the layer with a blower slightly after finishing spreading, spraying and dyeing with a dyeing agent, drying again, heating in an oven at 80 deg.C for 8min, and observing the result (figure 1). The coloring agent is prepared by dissolving 2.56g/L alpha-naphthol in ethanol: heating at 100 deg.C for 5min in a 90:10(v/v) solution of sulfuric acid. Capillary Electrophoresis (CE) is a P/ACE MDQ Capillary Electrophoresis detection system from Beckman-coulter, equipped with a detector using Bare Fused Silica Capillary (Bare Fused Silica Capillary) and a diode array (PDA). The sample injection buffer solution is 25mM sodium borate buffer solution with pH of 9.8, the cleaning buffer solution is 0.1M NaOH, the capillary is 60cm long, the electrophoresis voltage is 25KV, the cathode is used for sample injection, and the sample injection is carried out for 3s under the sample injection condition of 0.3 Psi. The decrease of ATP and the generation of ADP were detected under UV at 254nm, and the reaction was quantitatively analyzed by integration of the peak area.

1-P-Gal separation and purification: and (3) carrying out reaction of a 300mL system, wherein the composition of the reaction system is shown in Table 1, boiling the reaction solution for 1min after the reaction is finished, centrifuging at 12000rpm for 3min, collecting supernatant, and freeze-drying to obtain concentrated solution. Slowly adding the concentrated solution into a silica gel column, adding an eluent (acetonitrile: methanol ═ 3:1) to elute 1-P-Gal after a sample enters the column material, collecting the eluent, and carrying out rotary evaporation at 35 ℃ to obtain a product 1-P-Gal. 1-P-Gal was identified by MS and NMR.

The second step of reaction: catalytic synthesis of UDP-galactose by thermophilic UDP-glucose pyrophosphorylase TTE0732

UDP-glucose pyrophosphorylase catalyzes 1-P-Gal and UTP to produce UDP-galactose and PPi (inorganic pyrophosphate), and the reaction system is shown in Table 3.

Table 3: raw material dosage for catalytically synthesizing UDP-galactose by TTE0732

The reaction buffer was 20mM aqueous CAPS solution (pH 9.0), and 1-P-Gal, UTP and MgCl were added in this order to a final concentration of 150mM₂After mixing, the mixture was incubated at 50 ℃ for 5min, and then thermophilic UDP-glucose pyrophosphorylase TTE0732 was added thereto at a final concentration of 0.4mg/mL, followed by shaking reaction at 50 ℃ at 150 rpm for 5 hours. After the reaction was completed, the reaction was terminated by boiling water bath for 1min, and centrifuged at 12000rpm for 3min, and the supernatant was directly examined by Thin Layer Chromatography (TLC) (FIG. 3), or filtered with a 0.22 μm water membrane for High Performance Liquid Chromatography (HPLC) to examine the formation of UDP-galactose as a product.

HPLC uses a WATERS liquid detection system, an ACCHROM Unit 5. mu. m C18 column (250nm х 4.6.6 nm) and an ultraviolet detector to monitor compounds bearing nucleotide base chromophores at 254nm wavelength. Identification of UDP-galactose molecules uses MS and NMR.

Example 3: synthesis of galactosyl compound by thermophilic enzyme method

Example 3 the glycosylation modification of the compounds vanillin, p-nitrophenol and silibinin was achieved by using the UDP-galactose synthesized in example 2 as a galactosyl donor and using the thermophilic galactosyltransferase TON _1857 to catalyze the transglycosylation reaction, the reaction system is shown in Table 4.

Table 4: table of raw materials for the catalytic synthesis of galactosyl compounds by TON 1857

The reaction buffer was 20mM aqueous CAPS solution (pH 9.0), and UDP-galactose and MgCl were added in this order to a final concentration of 5mM₂Mixing with vanillin or p-nitrophenol or silibinin, keeping the temperature at 50 deg.C for 5min, sequentially adding thermophilic galactosyltransferase TON _1857 with final concentration of 0.4mg/mL, and oscillating at 50 deg.C at 150 rpm for 5 h.

After the reaction, the reaction was terminated by boiling in a boiling water bath for 1min, followed by centrifugation at 12000rpm for 3min to collect the supernatant, and the formation of the product was detected by thin layer chromatography (FIG. 4). Thin layer chromatography detection method reference example 2.

<110> Jilin university

<120> a method for synthesizing UDP-galactose and galactosyl compound

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1044

<212> DNA

<213> Thermus thermophilus

<221> CDS

<222> (1)..(1044)

<400> 1

atg ggc ttc caa gag gtt tac ggc gtc ctg ccc cag gcc agc gcc cag 48

Met Gly Phe Gln Glu Val Tyr Gly Val Leu Pro Gln Ala Ser Ala Gln

1 5 10 15

gcc ccc ggc cgg gtg aac ctc ctg ggg gag cac acg gac tac cag gaa 96

Ala Pro Gly Arg Val Asn Leu Leu Gly Glu His Thr Asp Tyr Gln Glu

20 25 30

ggc tac gtc ctc ccc acc ccg gtc ccc tac ttc acc cgg gtg gag gcc 144

Gly Tyr Val Leu Pro Thr Pro Val Pro Tyr Phe Thr Arg Val Glu Ala

35 40 45

gcc ccc ctc gag ggg gcg gtg gag gcc ttc agc gag aac ctg ggg gag 192

Ala Pro Leu Glu Gly Ala Val Glu Ala Phe Ser Glu Asn Leu Gly Glu

50 55 60

ctc cgg gcc cgc ccc ctc tcc tcc ccg ccc caa ggg gac ttc ctg gac 240

Leu Arg Ala Arg Pro Leu Ser Ser Pro Pro Gln Gly Asp Phe Leu Asp

65 70 75 80

tac ctc ctc ggg gtg gtc cgg gcc ctc cgg gag gcc ggg cac ggg gtg 288

Tyr Leu Leu Gly Val Val Arg Ala Leu Arg Glu Ala Gly His Gly Val

85 90 95

gaa ggg gcc cgg ttc tac gtc cgc agc gac ctc ccc atg ggg gcg ggg 336

Glu Gly Ala Arg Phe Tyr Val Arg Ser Asp Leu Pro Met Gly Ala Gly

100 105 110

ctt tcc agc tcc gcc gcc ctc gag gtg gcg gcc ctc agg gcc ctc cgc 384

Leu Ser Ser Ser Ala Ala Leu Glu Val Ala Ala Leu Arg Ala Leu Arg

115 120 125

acc ctc tac cgc ctc ccc ctc tcc gac ctg gag gtg gcc cgc ctc gcc 432

Thr Leu Tyr Arg Leu Pro Leu Ser Asp Leu Glu Val Ala Arg Leu Ala

130 135 140

cag aag gcg gag gtg gag tac gtg ggg gtc cgg tgc ggg atc atg gac 480

Gln Lys Ala Glu Val Glu Tyr Val Gly Val Arg Cys Gly Ile Met Asp

145 150 155 160

cag atg gcg gcg agc ctg ggc cag ccg ggc cag gcc ctc ttc ctg gac 528

Gln Met Ala Ala Ser Leu Gly Gln Pro Gly Gln Ala Leu Phe Leu Asp

165 170 175

acc cga acc ctg gcc tac gag aac ctt ccc ctt ccc ccg ggg gtg cgg 576

Thr Arg Thr Leu Ala Tyr Glu Asn Leu Pro Leu Pro Pro Gly Val Arg

180 185 190

gtg gcc gtc ctg gac ctc ggg ctt ggg cgc cgg ctg gcg gag gcc ggg 624

Val Ala Val Leu Asp Leu Gly Leu Gly Arg Arg Leu Ala Glu Ala Gly

195 200 205

tac aac cag cgc cgc cag gag gcg gag gag gcg gcc aag agg ctc ggg 672

Tyr Asn Gln Arg Arg Gln Glu Ala Glu Glu Ala Ala Lys Arg Leu Gly

210 215 220

gtg cgc tcc ctt agg gac gtg gcc gac ctc tgc ctg gtg gaa agc ctc 720

Val Arg Ser Leu Arg Asp Val Ala Asp Leu Cys Leu Val Glu Ser Leu

225 230 235 240

cct tcg ccc ctg gac cgg cgg gcc cgg cac gtg gtg agc gag aac ctt 768

Pro Ser Pro Leu Asp Arg Arg Ala Arg His Val Val Ser Glu Asn Leu

245 250 255

agg gtc ctt cgg ggg gtg gag gcc cta agg cgg ggg gac gcc cgg gcc 816

Arg Val Leu Arg Gly Val Glu Ala Leu Arg Arg Gly Asp Ala Arg Ala

260 265 270

ttc ggg gag ctc atg acc gca agc cac cgc tcc ctg gcc cag gac tac 864

Phe Gly Glu Leu Met Thr Ala Ser His Arg Ser Leu Ala Gln Asp Tyr

275 280 285

gag gtg agc ctc ccc gag ctg gac ctc ttg gtg gag gag gcc ctg aag 912

Glu Val Ser Leu Pro Glu Leu Asp Leu Leu Val Glu Glu Ala Leu Lys

290 295 300

gcc ggg gcc tac ggg gcc aag ctc acg ggg gca ggc ttc ggc ggg gcc 960

Ala Gly Ala Tyr Gly Ala Lys Leu Thr Gly Ala Gly Phe Gly Gly Ala

305 310 315 320

gtg gtg gcc ctg gtg gcc gaa agc cgc ttc ccc gcc ttc agg gag gcc 1008

Val Val Ala Leu Val Ala Glu Ser Arg Phe Pro Ala Phe Arg Glu Ala

325 330 335

ctg gcc cgg cgc ttc ccc gac ctc aag gtc ctc taa 1044

Leu Ala Arg Arg Phe Pro Asp Leu Lys Val Leu

340 345

<210> 2

<211> 909

<212> DNA

<213> Caldanaerobacter subterraneus

<221> CDS

<222> (1)..(909)

<400> 2

atg aaa ata aag aaa gcg ata att cca gca gcg ggc ctt ggt acc agg 48

Met Lys Ile Lys Lys Ala Ile Ile Pro Ala Ala Gly Leu Gly Thr Arg

1 5 10 15

ttt tta cct gct acc aag gct cag cct aag gaa atg ctt cca att gta 96

Phe Leu Pro Ala Thr Lys Ala Gln Pro Lys Glu Met Leu Pro Ile Val

20 25 30

gac aag cct act ata cag tac ata gtg gaa gaa gcg gta cag tca gga 144

Asp Lys Pro Thr Ile Gln Tyr Ile Val Glu Glu Ala Val Gln Ser Gly

35 40 45

ata gag gat att ctt ata ata act gga agg aac aaa aga gcc ata gaa 192

Ile Glu Asp Ile Leu Ile Ile Thr Gly Arg Asn Lys Arg Ala Ile Glu

50 55 60

gat cat ttt gac aaa tct gta gaa ttg gag cta gaa tta aag aaa aag 240

Asp His Phe Asp Lys Ser Val Glu Leu Glu Leu Glu Leu Lys Lys Lys

65 70 75 80

aat cag gaa agt tta cta agc ctt gta gaa gat att agc aat atg gta 288

Asn Gln Glu Ser Leu Leu Ser Leu Val Glu Asp Ile Ser Asn Met Val

85 90 95

aat att cac tat ata aga caa aaa gaa cct aaa ggc ttg ggg cat gcc 336

Asn Ile His Tyr Ile Arg Gln Lys Glu Pro Lys Gly Leu Gly His Ala

100 105 110

att tac tgt gct aaa tct ttt gtt ggc aat gag cct ttc gca gtg ctt 384

Ile Tyr Cys Ala Lys Ser Phe Val Gly Asn Glu Pro Phe Ala Val Leu

115 120 125

tta gga gat gac gtg gtg gat gct gaa gta cct gtt tta aag cag atg 432

Leu Gly Asp Asp Val Val Asp Ala Glu Val Pro Val Leu Lys Gln Met

130 135 140

ata gag cag ttt gag agg tat aat tgc acc ata att gga gtg cag gaa 480

Ile Glu Gln Phe Glu Arg Tyr Asn Cys Thr Ile Ile Gly Val Gln Glu

145 150 155 160

gtg cct gaa gag gat gta cat aaa tat gga att gta agc ggt act ttt 528

Val Pro Glu Glu Asp Val His Lys Tyr Gly Ile Val Ser Gly Thr Phe

165 170 175

att gag gat agg cta tat aaa gtc aat gat ttg ata gaa aag cca agg 576

Ile Glu Asp Arg Leu Tyr Lys Val Asn Asp Leu Ile Glu Lys Pro Arg

180 185 190

aga gag gaa gca cct tct aat ata gct att ttg gga agg tat ata att 624

Arg Glu Glu Ala Pro Ser Asn Ile Ala Ile Leu Gly Arg Tyr Ile Ile

195 200 205

aca ccg cga ata ttt gag att ttg gaa cat acg cct cct gga aga gga 672

Thr Pro Arg Ile Phe Glu Ile Leu Glu His Thr Pro Pro Gly Arg Gly

210 215 220

gga gaa ata caa ttg aca gac gct tta aaa act ctt tta aat tat gag 720

Gly Glu Ile Gln Leu Thr Asp Ala Leu Lys Thr Leu Leu Asn Tyr Glu

225 230 235 240

gcc att tac gcc tat aat ttt ata ggc aaa agg tat gat gtg ggg gat 768

Ala Ile Tyr Ala Tyr Asn Phe Ile Gly Lys Arg Tyr Asp Val Gly Asp

245 250 255

aaa ctg ggc tat ctc atg gcg act gtg gaa tat gct ttg aaa agg gaa 816

Lys Leu Gly Tyr Leu Met Ala Thr Val Glu Tyr Ala Leu Lys Arg Glu

260 265 270

gat ttg aga gag cct ttt aaa agg tat ttg ata aca att gtc cag gat 864

Asp Leu Arg Glu Pro Phe Lys Arg Tyr Leu Ile Thr Ile Val Gln Asp

275 280 285

tta ctt ggt atg gaa gaa gcc gca gtg act gaa aga gat gtg taa 909

Leu Leu Gly Met Glu Glu Ala Ala Val Thr Glu Arg Asp Val

290 295 300

<210> 3

<211> 1176

<212> DNA

<213> Thermococcus onnurineus

<221> CDS

<222> (1)..(1176)

<400> 3

atg aaa gtg gca ata atc tgc ttc gat ttc aag gag tca aac ctc aga 48

Met Lys Val Ala Ile Ile Cys Phe Asp Phe Lys Glu Ser Asn Leu Arg

1 5 10 15

aag caa ccc tgg aga tat gtg tat gaa att gca aag ggg ctt aaa tcc 96

Lys Gln Pro Trp Arg Tyr Val Tyr Glu Ile Ala Lys Gly Leu Lys Ser

20 25 30

aat gga cat gaa gtt ttc ata gtc act aat tcg aac aat gag aca gat 144

Asn Gly His Glu Val Phe Ile Val Thr Asn Ser Asn Asn Glu Thr Asp

35 40 45

atc gcc gga ata cga gtt ttt ggt gtc ggc aaa ttg ttc att cct cta 192

Ile Ala Gly Ile Arg Val Phe Gly Val Gly Lys Leu Phe Ile Pro Leu

50 55 60

aaa gga gaa tca aaa gaa gtc cta gag gtt tta gac agg gaa aat ccc 240

Lys Gly Glu Ser Lys Glu Val Leu Glu Val Leu Asp Arg Glu Asn Pro

65 70 75 80

gac agg ata atc atg ctc tta ggg ctg aca agc ttc ctc aga act cac 288

Asp Arg Ile Ile Met Leu Leu Gly Leu Thr Ser Phe Leu Arg Thr His

85 90 95

ttt gag atc aaa cag cca gtc ata ggc gtt ctc aca agc cca gta tac 336

Phe Glu Ile Lys Gln Pro Val Ile Gly Val Leu Thr Ser Pro Val Tyr

100 105 110

tca ttg ggg gag ctg ata aga aac gtc ggg att aga gac tcg ata gct 384

Ser Leu Gly Glu Leu Ile Arg Asn Val Gly Ile Arg Asp Ser Ile Ala

115 120 125

tat cgc aga tac aca gtc att cac atc ata aac tcg ctt gta cct agc 432

Tyr Arg Arg Tyr Thr Val Ile His Ile Ile Asn Ser Leu Val Pro Ser

130 135 140

ttt ctc gtg aga aaa tgg tcg cag aaa ttt gaa tat ata atc gtt ctg 480

Phe Leu Val Arg Lys Trp Ser Gln Lys Phe Glu Tyr Ile Ile Val Leu

145 150 155 160

agt caa cgt aac cgg gag aga cta atc aaa aaa gga gtt cca gcg gat 528

Ser Gln Arg Asn Arg Glu Arg Leu Ile Lys Lys Gly Val Pro Ala Asp

165 170 175

aag gtt att gta ata cct cca gga ata gat gaa gag ttc cta gag ctt 576

Lys Val Ile Val Ile Pro Pro Gly Ile Asp Glu Glu Phe Leu Glu Leu

180 185 190

cct gaa cga gaa aca att gag cgc att agg tct gaa atc agt cca gat 624

Pro Glu Arg Glu Thr Ile Glu Arg Ile Arg Ser Glu Ile Ser Pro Asp

195 200 205

gga gct cct gtc gtg atg tac tac act tcc ccg tta acc tta agg gga 672

Gly Ala Pro Val Val Met Tyr Tyr Thr Ser Pro Leu Thr Leu Arg Gly

210 215 220

acg gat acg cta gtt agg gct ttg ccc cat att cta aaa gaa aaa gaa 720

Thr Asp Thr Leu Val Arg Ala Leu Pro His Ile Leu Lys Glu Lys Glu

225 230 235 240

gtt aaa ctg ttg att ctt tcc aga ccc gat tac agg agt gtc cta aaa 768

Val Lys Leu Leu Ile Leu Ser Arg Pro Asp Tyr Arg Ser Val Leu Lys

245 250 255

gag gaa cag aag ctc aga aag ctg gca gaa aag ctg aac gtg aga aaa 816

Glu Glu Gln Lys Leu Arg Lys Leu Ala Glu Lys Leu Asn Val Arg Lys

260 265 270

aat ctc gtg ata att tca aaa cat ctg cca ctc gag gac gtc aaa gcg 864

Asn Leu Val Ile Ile Ser Lys His Leu Pro Leu Glu Asp Val Lys Ala

275 280 285

tac gta agt tcg gct gat gtg gtg gtg ctt ccg ttt aaa ctt gtg ctt 912

Tyr Val Ser Ser Ala Asp Val Val Val Leu Pro Phe Lys Leu Val Leu

290 295 300

tct gat gtc ccg ctg agt ata tta gaa gca atg gct cta gga aaa gtt 960

Ser Asp Val Pro Leu Ser Ile Leu Glu Ala Met Ala Leu Gly Lys Val

305 310 315 320

gtc atc ggt act gat gtt gat gga att cca gag ata ctg aaa gac aaa 1008

Val Ile Gly Thr Asp Val Asp Gly Ile Pro Glu Ile Leu Lys Asp Lys

325 330 335

gga ctc ata gtc agg ccg aat aac ccc aaa gag ttg gcc aac gct gtg 1056

Gly Leu Ile Val Arg Pro Asn Asn Pro Lys Glu Leu Ala Asn Ala Val

340 345 350

tta tta gta ttg gaa gat aag aag cta aaa tat gaa cta gaa acg gca 1104

Leu Leu Val Leu Glu Asp Lys Lys Leu Lys Tyr Glu Leu Glu Thr Ala

355 360 365

gcc aag gaa tac gtt aat cag tgg aga aga tgg aat gac gtt gtg gag 1152

Ala Lys Glu Tyr Val Asn Gln Trp Arg Arg Trp Asn Asp Val Val Glu

370 375 380

gag ttt tta aag ctg ata ggg tga 1176

Glu Phe Leu Lys Leu Ile Gly

385 390

Claims

1. A method for synthesizing UDP-galactose comprises the following steps:

reaction buffer solution is 20mM, CAPS aqueous solution with pH of 8.0-10.0, substrates D-galactose and ATP are sequentially added until the final concentration is 100-200 mM, and MgCl with the final concentration of 5mM is added₂Reacting at 40-60 ℃ for 3-8 min, then adding thermophilic galactokinase TTHA0595 with the final concentration of 0.3-0.6 mg/mL, and oscillating at 40-60 ℃ at 120-180 r/min for 60-80 min to obtain 1-P-Gal;

(ii) a CAPS aqueous solution having a reaction buffer of 20mM and a pH of 8.0 to 10.0, sequentially adding the substrates 1-P-Gal and UTP obtained in step (i) to a final concentration of 100 to 200mM, and further adding MgCl to a final concentration of 5mM₂Reacting at 40-60 ℃ for 3-8 min, and then adding the mixture to a final concentration of 0.3-0.6 mg/mLThe thermophilic UDP-glucose pyrophosphorylase TTE0732 is subjected to oscillation reaction for 4-6 hours at the temperature of 40-60 ℃ at the speed of 120-180 r/min to obtain UDP-galactose.

2. The method of synthesizing UDP-galactose of claim 1, wherein: obtaining a thermophilic galactokinase TTHA0595 gene sequence from thermophilic bacteria Thermus thermophilus HB8 through NCBI GenBank search, and searching a thermophilic UDP-glucose pyrophosphorylase TTE0732 gene sequence from thermophilic bacteria Caldanaaerobacter subcorereus; designing primers according to the nucleotide sequences SEQ ID No.1 and SEQ ID No.2 of the two enzymes, amplifying enzyme genes by using a PCR method, connecting the amplified enzyme genes with an escherichia coli expression vector pET28a to construct recombinant plasmids, and respectively transforming escherichia coli expression host bacteria Transetta (DE3) competent cells to construct recombinase expression bacteria; then, a recombinase expression strain constructed by induction of an inducer IPTG is used for expressing thermophilic galactokinase and thermophilic UDP-glucose pyrophosphorylase, and the thermophilic galactokinase TTHA0595 and the thermophilic UDP-glucose pyrophosphorylase TTE0732 are obtained by separation and purification through cell ultrasonic disruption, heating inactivation and Ni-NTA affinity chromatography.

3. A method for the synthesis of galactosyl compounds characterized by: a CAPS aqueous solution having a reaction buffer of 20mM and a pH of 8.0 to 10.0, the substrate UDP-galactose according to claim 1 or 2 and a raw material to be modified are sequentially added to a final concentration of 5 to 100mM, and MgCl is added to a final concentration of 5mM₂Reacting at 40-60 ℃ for 3-8 min, adding thermophilic galactosyltransferase TON _1857 with the final concentration of 0.3-0.6 mg/mL, and oscillating and reacting at 40-60 ℃ at 120-180 r/min for 4-6 h to obtain a galactosyl compound; the raw material to be modified is vanillin, p-nitrophenol or silibinin.