CN112852847A - Recombinant saccharomyces cerevisiae strain and construction method and application thereof - Google Patents

Abstract

The invention discloses a recombinant saccharomyces cerevisiae strain and a construction method and application thereof, belonging to the technical field of biological fermentation. Wherein the amino acid sequence of the alpha-farnesene synthetase FSCS is shown by SEQ ID No. 1. The invention constructs a recombinant expression vector containing the gene and establishes a method for biologically synthesizing farnesene. The invention performs functional characterization on terpene synthetase which is not reported explicitly before, performs preliminary study on enzymology properties, changes fermentation conditions under the guidance of the enzymology properties, realizes the biosynthesis of farnesene in saccharomyces cerevisiae, has better expression effect compared with the reported apple-derived farnesene synthetase, and is beneficial to guiding the efficient production of farnesene in microorganisms.

Description

Recombinant saccharomyces cerevisiae strain and construction method and application thereof

Technical Field

The invention belongs to the technical field of biological fermentation, and particularly relates to a recombinant saccharomyces cerevisiae strain and a construction method and application thereof.

Background

alpha-Farnesene (Farnesene) has the chemical name of 3,7, 11-trimethyl-1, 3,6, 10-dodecatetraene, the molecular formula of C15H24, the molecular formula of the alpha-Farnesene is composed of three isoprene units, and the relative molecular weight of the alpha-Farnesene is 204. Farnesene belongs to a sesquiterpene compound, is insoluble in water, and is miscible with organic solvents such as dodecane, ethyl acetate, n-hexane and the like. There are two optical isomers of farnesene in nature, alpha-farnesene and beta-farnesene. Farnesene is related to the occurrence of apple tiger skin disease, is also a pheromone, can induce insects to prey on aphids and the like, and has wide research value in the aspect of plant defense. In addition, the farnesene can be used as a substitute of high-efficiency fuel, and has application prospects in the field of perfumes.

Farnesene is present in leaves and fruits of various plants and is present in an extremely low amount in nature. At present, farnesene is mainly obtained by a raw material extraction method, a chemical synthesis method and a microbial synthesis method, and the raw material extraction method has poor stability and is greatly influenced by seasonal changes; the chemical synthesis method has complex means, high toxicity and high cost. With the rapid development of synthetic biology and metabolic engineering technology in recent years, the construction of microbial cell factories becomes an effective means for the efficient synthesis of terpenoids.

The microbial cell synthesis of farnesene needs to introduce exogenous farnesene synthetase, and farnesene is generated by catalyzing substrate farnesyl pyrophosphate. At present, the synthesis of farnesene in microorganisms mainly regulates and controls key sites in a farnesene synthesis pathway by means of metabolic engineering, and precursor substance supply is enhanced, so that the farnesene yield is improved. Farnesene synthetase is used as a key enzyme in a farnesene synthesis pathway and plays an important role in the synthesis of farnesene. Therefore, the selection of farnesene synthetase with high expression efficiency has important significance for the efficient production of farnesene in microorganisms.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides a sweet orange-derived terpene synthetase FSCS, and the amino acid sequence homology alignment of the sweet orange-derived terpene synthetase FSCS and an apple-derived farnesene synthetase FSAP is carried out through BLAST, and the sequence similarity of the two is found to be 56.36%. Wherein, the FSAP amino acid sequence is shown by SEQ ID No.3, and the nucleotide sequence is shown by SEQ ID No. 4. The invention performs functional characterization and enzymology property research on orange-derived terpene synthetase FSCS, provides application of FSCS in synthesizing farnesene by saccharomyces cerevisiae, and researches the influence of different fermentation conditions on farnesene synthesis under the guidance of enzymology property. The alpha-farnesene produced by the alpha-farnesene synthetase FSCS obtained by the invention has high yield and better enzyme activity.

The technical scheme of the invention is as follows:

an alpha-farnesene synthetase FSCS gene, wherein the amino acid sequence of the alpha-farnesene synthetase FSCS gene is shown in SEQ ID No. 1.

Further, the nucleotide sequence of the alpha-farnesene synthetase FSCS gene obtained by coding is shown as SEQ ID No. 2.

An expression vector, the alpha-farnesene synthetase FSCS gene.

A recombinant Saccharomyces cerevisiae strain comprising the alpha-farnesene synthase FSCS gene.

A preparation method of a recombinant saccharomyces cerevisiae strain comprises the following steps: cloning an alpha-farnesene synthetase FSCS gene with a nucleotide sequence shown as SEQ ID No.2 into an expression vector to obtain a recombinant expression vector plasmid Ts gal80-xtpfscs, and transforming the recombinant plasmid into host cell saccharomyces cerevisiae.

The application of the recombinant saccharomyces cerevisiae strain in the fermentation production of alpha-farnesene in saccharomyces cerevisiae is provided.

Further, the fermentation medium for producing alpha-farnesene is as follows: 10g/L yeast powder, 20g/L peptone, 30g/L glucose and 10% (V/V) dodecane, wherein the fermentation conditions are as follows: the fermentation time in the logarithmic growth phase of the thalli is 24-30h, the temperature is 30 ℃, and the subsequent fermentation is carried out when the glucose is completely consumed and the temperature is 20 ℃; the fermentation time is 24-96 h.

Further, Mg is added into the fermentation medium²⁺And/or K⁺。

Further, Mg is contained in the medium²⁺The final concentration is 10.0-80.0 mmol/L.

Further, K in the medium⁺The final concentration is 10.0-50.0 mmol/L.

The invention takes the gene GAL80 as an integration site to construct PTDH3-Fscs-T in vitro_TPI1The expression cassette is used for carrying out saccharomyces cerevisiae WH4 chromosome integration through a cre-loxp system, carrying out two-phase extraction fermentation by taking glucose as a carbon source, and detecting farnesene generation through gas mass spectrometry and liquid chromatography.

The beneficial technical effects of the invention are as follows:

the invention performs functional characterization on orange-derived terpene synthetase FSCS which is not reported clearly, constructs a recombinant expression vector containing the gene, performs enzymology property research, applies the enzymology property to the recombinant saccharomyces cerevisiae fermentation for producing alpha-farnesene, and further improves the yield of the alpha-farnesene through the change of the fermentation condition. The action effect of the alpha-farnesene synthetase is superior to that of apple-derived farnesene synthetase FSAP reported previously, the farnesene can be synthesized in microbial cells, the production cost is effectively reduced, and the efficient production of farnesene is facilitated.

Drawings

FIG. 1 shows the alignment of the FSCS and FSAP amino acid sequences according to the present invention.

FIG. 2 is a map of the Saccharomyces cerevisiae integrated expression plasmid Ts gal 80-xtpfscs.

FIG. 3 is a liquid chromatogram of the fermentation broth of the strain WH4-Fscs and WH4-Fsap and farnesene standard substance. Wherein a is a liquid chromatogram of a farnesene standard substance; a liquid chromatogram of WH4-Fscs fermentation broth; and c, performing liquid chromatogram of WH4-Fsap fermentation broth.

FIG. 4 is a GC-MS mass spectrum of farnesene.

FIG. 5 shows the results of fermentation assays of WH4-Fscs comparing to the original conditions after changing the fermentation conditions according to the present invention. Wherein, a is a WH4-Fscs farnesene detection result under the condition of the most suitable metal ions; and b, detecting results of WH4-Fscs farnesene under the optimal temperature condition.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings and examples.

The saccharomyces cerevisiae strain WH4, escherichia coli e.coli JM109, vector pET28a used in the examples were from the laboratory; the plasmids Ts-XTP/JM109, Ts-GAL80, Ts-xkx-PTDH3-Fscs-TTPI1, Ts GAL80-xtpfscs, competent cells, primers and reagents and the like used can be obtained commercially or by conventional means well known to those skilled in the art.

Among them, restriction enzyme SalI was purchased from Thermo Scientific, cat #: FD0644

Restriction enzyme BamH I was purchased from Thermo Scientific, cat #: FD0054

Restriction enzyme Xba I was purchased from Thermo Scientific, cat #: FD0684

Restriction enzyme Nco I was purchased from Thermo Scientific, cat #: FD0574

Restriction enzyme Dpn i was purchased from Thermo Scientific, cat #: FD1703

T4 DNA ligase was purchased from Thermo Scientific, cat #: EL0011

The primers were synthesized from: jinzhi Biotechnology Ltd.

The composition of the SOB medium is as follows: 5g/L yeast powder, 20g/L peptone, 0.5g/L sodium chloride, 0.186g/L potassium chloride, 2.207g/L magnesium chloride hexahydrate and the balance of water, and sterilizing at the pressure of 0.1Mpa and the temperature of 121 ℃ for 20 min.

The TB medium consists of: 5g/L of glycerol, 12g/L of peptone, 24g/L of yeast powder and 12.5g/L K₂HPO₄，2.31g/L KH₂PO₄。

YPD medium composition was: 10g/L yeast powder, 20g/L glucose, 20g/L peptone and the balance water, and sterilizing at the pressure of 0.1Mpa and the temperature of 115 ℃ for 20 min.

The fermentation medium comprises the following components: 10g/L yeast powder, 20g/L peptone, 10% (V/V) dodecane, autoclaved at 115 ℃ and added with glucose with a final concentration of 30 g/L.

And (3) fermenting and culturing conditions of escherichia coli: transferring the seed solution to 50mL fermentation medium according to the inoculation amount of 3% of volume fraction, adding kanamycin with the final concentration of 30 mug/mL, carrying out shake culture at 37 ℃ and 200rpm until the OD600 is 0.6-0.8, adding IPTG with the final concentration of 0.5mmol/L for induction, and carrying out shake culture at 18 ℃ and 200rpm for 22 h.

The fermentation culture conditions of the saccharomyces cerevisiae are as follows: inoculating the seed solution to 30mL fermentation medium according to the inoculum size of 2% by volume fraction, adding 30g/L glucose solution and 10% dodecane by volume fraction, and shake-culturing at 30 ℃ and 200rpm for 72 h.

Example 1 obtaining of farnesene synthase Gene FSCS

Carrying out amino acid sequence homology comparison on apple-derived farnesene synthetase genes (NCBI accession number: 103446592) through BLAST to obtain orange-derived terpene synthetase genes Fscs (NCBI accession number: LOC102618658) with 56.36% of amino acid sequence similarity, respectively adding SalI and BamHI enzyme cutting sites at the 5 'end and the 3' end, carrying out codon optimization by combining the preference of saccharomyces cerevisiae to codons, and carrying out gene synthesis to pUC57-Fscs, wherein the nucleotide sequence of the genes is shown as SEQ ID No. 2. The amino acid sequence of farnesene synthetase obtained by the gene coding is shown in SEQ ID No. 1.

EXAMPLE 2 construction of recombinant expression plasmid pET28a-Fscs

Coli codon preference was optimized and gene synthesized into pUC57-Fscs, and restriction sites BamHI and SalI were added to both ends. The plasmid was extracted, digested simultaneously with BamHI and SalI and recovered, and the vector pET28a was digested simultaneously with SalI and BamHI and linearized. The enzyme cutting system is as follows: mu.L of 10 Xfast Digest Buffer, 2. mu.L each of SalI and BamHI endonuclease, and 68. mu.L of plasmid pUC 57-Fscs. The prepared system is reacted for 2 hours at 37 ℃, and the target fragment is recovered.

Connecting the gene fragment and the vector for 12h at the temperature of 16 ℃, wherein the reaction system is as follows: 1. mu. L T4 DNA ligase buffer, 1. mu. L T4 DNA ligase, 6. mu.L of the desired fragment, 2. mu.L of the vector fragment. Transferring the ligation product into escherichia coli DE3 competence, coating a kanamycin-resistant plate, culturing for 10-12 h in a constant-temperature oven at 37 ℃, selecting transformants, extracting plasmid double enzyme digestion, verifying and sequencing.

EXAMPLE 3 construction of recombinant expression plasmid Ts gal80-xtpfscs

(1) Construction of recombinant expression vector particles Ts gal80-xtpfscs

Carrying out strain activation on farnesene synthetase pUC57-Fscs obtained by gene synthesis and extracting plasmids, carrying out double enzyme digestion on the plasmids by using endonucleases SalI and BamHI, wherein the reaction system is as follows: mu.L of 10 Xfast Digest Buffer, 4. mu.L each of SalI and BamHI endonuclease, and 64. mu.L of pUC57-Fscs plasmid. The prepared system reacts for 2.5h at the temperature of 37 ℃, and the target gene fragment Fscs is recovered.

Activating Ts-XTP/JM109 strain, extracting plasmid, taking the plasmid as a template, taking XTP-Sal I-7 and XTP-BamH I-8 as primers, and carrying out reverse PCR by using high-fidelity DNA polymerase to prepare a vector, wherein the PCR process comprises the following steps: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 5min for 20s, with 30 cycles. The PCR product was purified, and then the product was digested with Dpn I, Sal I and BamH I in this order and purified to be used.

Connecting the target gene segment with a vector, wherein the reaction system is as follows: mu.L of 10 XT 4 DNA ligase buffer, 0.5. mu. L T4 DNA ligase, 1. mu.L of vector fragment, 3. mu.L of target gene fragment, 4.5. mu.L of ultrapure water were ligated overnight at 16 ℃. Transforming the connected product into escherichia coli JM109 competence, screening a correct transformant by colony PCR and carrying out double enzyme digestion verification to obtain a recombinant expression vector Ts-xkx-P_TDH3-Fscs-T_TPI1。

(2) Construction of recombinant expression plasmid Ts gal80-xtpfscs

Extraction of plasmid Ts-xkx-P_TDH3-Fscs-T_TPI1After single digestion with endonuclease Xba I, the target fragment is recovered by gel electrophoresis.

The strain was activated and the plasmid Ts-GAL80 was extracted, and reverse PCR was performed using it as a template and GAL80-Xba I-3 and GAL80-Xba I-4 as primers to prepare a vector for linearization. The PCR process is as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 4min, with 30 cycles. The PCR product was digested with Dpn I and Xba I, respectively, and purified with a purification kit.

The target fragment obtained by recovering the gel was ligated to the vector in the same manner as in example 2 at 16 ℃ for 6-12 hours.

The primer sequence is as follows:

XTP-Sal I-7：ACGCGTCGACTTTGTTTGTTTATGTGTGTTTATTC

XTP-BamH I-8：CGCGGATCCGCGGATTAATATAATTATATAAAAATAT

GAL80-XbaⅠ-3：CATGTCTAGA AAGCATCTTGCCCTGTGCT

GAL80-XbaⅠ-4：CATGTCTAGAGACGGGAGTGGAAAGAACG

example 4 construction of recombinant Saccharomyces cerevisiae Strain and biosynthesis of farnesene

(1) Construction of recombinant Saccharomyces cerevisiae strains

The resulting integration box plasmid Ts gal80-xtpfscs was digested with endonuclease Nco I in the following reaction scheme: mu.L of 10 Xquick Cut Buffer, 2. mu.L of Nco I endonuclease, 52. mu.L of plasmid, reacted at 37 ℃ for 3 hours, and the recombinant strain WH4-Fscs was constructed by the Saccharomyces cerevisiae lithium acetate transformation method.

And (3) streaking an activated strain WH4, selecting a single colony, inoculating the single colony to a YPD liquid culture medium, and carrying out shake culture at the constant temperature of 30 ℃ and 200rpm for 24-28 h. 1mL of the seed solution was aspirated and inoculated into 50mL of YPD medium, and cultured at 30 ℃ for 4-6 h until OD600 became 0.6. And (3) freezing the bacterial liquid for about 30min, collecting the thalli in a 5mL centrifuge tube, centrifuging for 5min, removing supernatant, and adding 1mL of water for washing. The washed liquid was transferred to a 1.5mL EP tube and centrifuged at 8000rpm for 1 min. The supernatant was discarded, 200. mu.L of 0.1M lithium acetate was added, and the mixture was centrifuged at 8000rpm for 1 minute. The supernatant was aspirated off, and 240. mu.L of PEG 3350, 40. mu.L of 1M lithium acetate, 50. mu.L of salmon sperm, and 50. mu.L of plasmid solution were added to the supernatant in this order. Blowing and sucking, mixing, and placing in a 30 deg.C oven for 30 min. The mixture was immediately ice-cooled for 5min after heat shock of a metal bath at 42 ℃ for 25min, and centrifuged at 8000rpm for 1 min. And (3) sucking a supernatant, adding 1mL of YPD medium, shaking the YPD medium at a constant temperature of 30 ℃ and 200rpm, culturing for 1-2 h, coating a plate, adding G418 resistance, and removing false positive colonies. Correct transformants were selected, the genome extracted and verified by genomic PCR using Fscs-D and GAL80-Fscs-u as primers. The PCR process is as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 30s, with 30 cycles.

(2) Detection of farnesene by shake-flask fermentation of recombinant strain WH4-Fscs

Selecting a recombinant strain WH4-Fscs single colony, inoculating the single colony in a YPD culture medium, carrying out shake culture at 30 ℃ and 200rpm for about 24-30h, then transferring the single colony into 30mL of fermentation culture medium according to the inoculum size of 2%, adding dodecane with the final concentration of 10% (v/v) for preventing volatilization of farnesene in the fermentation process, then placing the fermentation culture medium in a shake bed at 30 ℃ and 200rpm for 72h, and synthesizing farnesene.

And (3) detecting the generation of farnesene after 24 hours of fermentation, taking an upper layer organic phase, centrifuging at 12000rpm for 10-15min, and performing HPLC liquid phase detection.

GC-MS detection conditions: SH-Rtx-5MS (30 m.times.0.32 mm.times.0.25 μm) column, flow rate 1mL/min, ionization mode EI. The injection port temperature was 260 deg.C, the initial temperature was 80 deg.C, the temperature was increased to 180 deg.C at 5 deg.C/min, and then increased to 280 deg.C at 25 deg.C/min. The scanning mass range is 35-800 amu.

HPLC detection conditions: chromatography column (Diamonsil Plus 5. mu. m C18,250, 250X 4.6mm), volume fraction of 70% methanol, volume fraction of 30% acetonitrile as mobile phase, flow rate of 1mL/min, detection wavelength of 210nm, column temperature of 40 ℃. Preparing farnesene standard substances with different concentrations, determining the peak-out time and making a peak area-concentration standard curve. The test results are shown in fig. 3 and 4.

The primer sequence is as follows:

Fscs-D：AGCACAAAGCGGTAGCGTAA；

GAL80-Fscs-u：ATGGGTATGGCTTGGG。

comparative example 1: recombinant strain WH4-Fscs and strain WH4-Fsap generate farnesene comparison.

The experimental conditions were the same as those described in example 4, except that the strain was different.

The test results show that: fermenting for 72h at 30 ℃ and 200rpm, and detecting the yield of WH4-Fscs farnesene to be 128.8mg/L by a liquid phase; under the same fermentation conditions, the yield of WH4-Fsap farnesene is 15.2 mg/L. Therefore, the efficiency of the recombinant strain WH4-Fscs prepared by the invention for producing farnesene is higher than that of the strain WH4-Fsap for producing farnesene.

Example 5FSCS in vitro enzymatic Properties

(1) Exploration of optimum metal ion conditions of FSCS (free radical polymerization)

And (3) performing enzymological property detection by using a pure enzyme solution, taking FPP as a substrate, taking a sodium phosphate solution with the pH value of 7.4 as a buffer solution, and adding DTT with the final concentration of 5mmol/L and the volume fraction of 10% of glycerol. Respectively adding Mg with the final concentration of 10.0-80.0 mmol/L into the reaction system²⁺，10.0～50.0mmol/L K⁺，2.0～10.0mmol/L Mn²⁺And 50mmol/L EDTA was added as a control. And covering the dodecane extraction product above the reaction system, taking an upper organic phase after the reaction is finished, centrifuging for 10-15min under the condition of 10000rpm, and detecting the product.

And (3) test results: addition of Mg alone²⁺When farnesene production was detected, at 30mmol/L Mg²⁺The highest product concentration under the conditions. No product formation was detected with 50mmol/L EDTA control. At 30mmol/L Mg²⁺On the basis of the concentration, adding K with different concentrations⁺And detecting the generation of the product. K⁺Has obvious promotion effect on the product generation, 40mmol/L K⁺The concentration of the product under the condition reaches the maximum of 3.86 mg/L. Then at 30mmol/L Mg²⁺、40mmol/L K⁺Adding Mn with different concentrations on the basis²⁺Without significant promotion effect on product formation, and higher concentration of Mn²⁺Has slight inhibition effect on the product generation. The optimum metal ion conditions of FSCS are as follows: 30mmol/L Mg²⁺、40mmol/L K⁺。

(2) Effect of FSCS enzyme activity under different temperature conditions:

20mmol/L of pH 7.4 sodium phosphate solution was used as buffer, and 5mmol/L DTT, 10% volume fraction glycerol, was added. Adding 100-200 mu g of pure enzyme and 30 mu mol/L of FPP into the reaction system, covering 300 mu L of dodecane, sealing, reacting for 1h at 15-45 ℃ respectively, and detecting the product.

The test result shows that the concentration of the farnesene is the highest under the condition that the temperature is 20 ℃, and the product farnesene can not be basically detected at the temperature of more than 45 ℃.

Example 6 application of different fermentation conditions in production of farnesene by recombinant Saccharomyces cerevisiae

According to the in vitro enzymatic characterization study of example 5, the optimum metal ion condition of FSCS was investigated, which was 30mmol/L Mg²⁺,40mmol/L K⁺。

(1) The application of the optimum metal ion condition in the production of farnesene by recombinant saccharomyces cerevisiae comprises the following steps: and (3) fermenting for 72h at the temperature of 30 ℃ by taking no exogenous metal ions as a reference, and detecting the concentration of farnesene. Under the condition of adding metal ions, the concentration of farnesene produced by WH4-Fscs is improved by 30 percent compared with the prior art, and reaches 43.76 mg/L. The test results are shown in FIG. 5 (a).

(2) The application of the optimum temperature condition in the production of farnesene by recombinant saccharomyces cerevisiae comprises the following steps: the optimum temperature condition of FSCS is 20 deg.C, the temperature condition of 30 deg.C is used as control group, the experimental group and the control group are both fermented at 30 deg.C for 24h, and the temperature is adjusted after glucose is basically consumed. And (4) carrying out subsequent fermentation for 72h, and sampling at 24h, 48h, 60h, 72h and 96h in the fermentation process respectively, and detecting the farnesene generation and the thallus growth conditions. The farnesene yield is maintained at a higher level at the early stage of fermentation at 30 ℃, and is more stable at the later stage of fermentation at 20 ℃. The test results are shown in FIG. 5 (b).

(3) Simultaneously, under the condition of the most suitable metal ions, 30mmol/L Mg²⁺,40mmol/L K⁺And the yield of the farnesene reaches 128.8mg/L after 96h by fermenting recombinant saccharomyces cerevisiae WH4-Fscs at the optimum temperature of 20 ℃.

The invention has been described in an illustrative manner, and it is to be understood that any simple variations, modifications or other equivalent changes which can be made by one skilled in the art without departing from the spirit of the invention fall within the scope of the invention.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> recombinant saccharomyces cerevisiae strain and construction method and application thereof

<130> 4

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 573

<212> PRT

<213> Artificial Synthesis

<400> 1

Met Glu Gln Gly Lys Gln Leu Gly His Gln Lys Gln Leu Val Leu Ser

1 5 10 15

Cys Gln Met Asn Ser Lys Ala Cys Asn Val Ile Pro Pro Arg Gln Ser

20 25 30

Ala Asn Tyr Lys Pro Asn Ile Trp Lys Tyr Asp Phe Ile Gln Ser Leu

35 40 45

His Ser Lys Tyr Lys Glu Glu Gly Tyr Arg Ser Arg Ala Glu Lys Leu

50 55 60

Lys Asn Asp Val Lys Gln Met Phe Leu Glu Ala Ala Asp Leu Leu Ala

65 70 75 80

Lys Leu Glu Leu Ile Asp Arg Ile Cys Lys Leu Gly Leu Ser Tyr Leu

85 90 95

Phe Glu Glu Lys Ile Arg Glu Val Leu Val Asp Thr Val Ala Phe Leu

100 105 110

Lys Asn Asp Thr Gly Cys Leu Gln Val Lys Asp Leu Tyr Ala Thr Ala

115 120 125

Leu Cys Phe Lys Leu Leu Arg Gln His Gly Tyr Glu Ile Ser Gln Asp

130 135 140

Val Phe Leu Asp Phe Met Asp Glu Thr Gly Thr Thr Phe Ser Thr Ser

145 150 155 160

Lys Cys Thr Asp Ile Lys Gly Leu Ile Glu Leu Cys Glu Ala Ser Gln

165 170 175

Leu Ala Leu Glu Gly Glu Ser Ile Leu Asp Glu Ala Lys Val Phe Ser

180 185 190

Gly Gly Thr Leu Lys Gly Ile Tyr Ser Ser Leu Asn Thr Asp Leu Ala

195 200 205

Gln Thr Val Ala Arg Val Leu Glu Leu Pro Ser His Trp Arg Val Pro

210 215 220

Trp Tyr Glu Val Arg Trp Gln Ile Asn Ser Tyr Glu Lys Glu Lys His

225 230 235 240

Met Asn Thr Ile Leu Leu Glu Leu Ala Lys Leu Asn Phe Asn Ile Val

245 250 255

Gln Ala Thr Leu Gln Asn Asp Leu Arg Glu Leu Ser Arg Trp Trp Lys

260 265 270

Asn Leu Gly Leu Ile Glu Asn Leu Asn Phe Ser Arg Asp Arg Leu Val

275 280 285

Glu Cys Phe Leu Cys Ala Val Gly Leu Val Tyr Glu Pro Asn Cys Ser

290 295 300

Cys Phe Arg Lys Trp Leu Thr Lys Val Ile Ile Phe Ile Leu Val Ile

305 310 315 320

Asp Asp Ile Tyr Asp Ile Tyr Gly Ser Leu Glu Glu Leu Glu His Phe

325 330 335

Thr Ser Ala Val Glu Arg Trp Asp Phe Lys Glu Ile Gln Arg Leu Pro

340 345 350

Glu Cys Met Lys Leu Cys Phe Lys Ala Leu Tyr Asp Thr Thr Asn Glu

355 360 365

Met Ala Tyr Glu Ile Gly Arg Arg Asn Thr Trp Lys Arg Val Leu Pro

370 375 380

His Leu Lys Lys Glu Trp Ser Asp Phe Cys Lys Ser Leu Leu Val Glu

385 390 395 400

Ala Lys Trp Gln Lys Arg Gly His Thr Pro Cys Leu Gln Glu Tyr Leu

405 410 415

Ser Asn Ala Trp Ile Ser Ser Ser Gly Thr Val Leu Ser Val Tyr Ser

420 425 430

Phe Phe Gly Ile Met Lys Glu Ala Thr Glu Glu Thr Ala Gly Phe Leu

435 440 445

Lys Leu Asn Gln Asp Leu Val Tyr Asn Ser Ser Leu Ile Ile Arg Leu

450 455 460

Cys Asn Asp Leu Gly Thr Ser Ser Ala Glu Leu Glu Arg Gly Asp Val

465 470 475 480

Ala Ser Ser Ile Leu Cys Cys Met Thr Glu Met Asn Ile Ser Glu Glu

485 490 495

Ile Ala Arg Asn Tyr Ile Lys Gly Met Ile Ser Lys Thr Trp Thr Lys

500 505 510

Ile Asn Gly Gln Cys Phe Thr Gln Ser Pro Leu Leu Gln Ser Phe Ile

515 520 525

His Ile Thr Thr Asn Phe Ala Arg Val Val His Ser Leu Tyr Gln Tyr

530 535 540

Gly Asp Gly Phe Gly Val Gln Asp Gly Asp Thr Lys Lys Gln Ile Leu

545 550 555 560

Ser Leu Leu Ile Glu Pro Met Pro Pro Ser Pro Phe Ser

565 570

<210> 2

<211> 1722

<212> DNA

<213> Artificial Synthesis

<400> 2

atggagcaag gtaaacaatt gggtcaccag aagcagcttg tccttagctg ccaaatgaac 60

agcaaggctt gtaacgttat cccaccaagg cagagcgcta actataaacc taatatttgg 120

aaatatgatt tcatccaatc tcttcatagc aaatataaag aggagggata tagaagcaga 180

gcagagaagc ttaaaaatga tgtcaagcag atgtttttgg aagctgcaga ccttttggct 240

aagttggagc ttattgacag aatctgtaaa ttgggtctta gctacctttt tgaagagaaa 300

attagggagg tccttgtcga taccgtcgca ttccttaaga acgacaccgg atgccttcaa 360

gttaaggacc tttacgctac cgctttgtgc ttcaagcttt tgaggcagca cggatacgag 420

atcagccaag atgtcttctt ggattttatg gatgaaaccg gaaccacctt cagcaccagc 480

aagtgcaccg acatcaaagg acttatcgag ttgtgtgagg caagccaact tgcattggag 540

ggtgaaagca tcttggacga ggctaaggtc ttcagcggag gaaccttgaa gggtatttac 600

agcagcttga ataccgattt ggctcagacc gttgctaggg tcttggaact tcctagccat 660

tggagggttc cttggtatga ggtcagatgg cagatcaaca gctatgagaa ggagaaacat 720

atgaacacca ttcttttgga attggctaaa ttgaatttta acatcgtcca agctaccttg 780

caaaacgact tgagggagct ttctaggtgg tggaagaacc ttggtcttat cgaaaacttg 840

aacttttcta gggatagatt ggtcgaatgt ttcctttgcg ctgtcggact tgtctacgag 900

cctaactgta gctgctttag aaaatggttg actaaagtta ttattttcat cttggttatc 960

gacgatattt acgatatcta cggaagcttg gaggaacttg aacacttcac cagcgcagtt 1020

gagaggtggg acttcaagga gatccaaagg ttgccagaat gcatgaagct ttgtttcaag 1080

gctttgtacg ataccaccaa cgagatggct tacgagatcg gtaggaggaa cacttggaag 1140

agggtccttc cacacttgaa gaaagagtgg agcgacttct gcaagagctt gcttgttgag 1200

gctaaatggc agaagagggg acatactcct tgcttgcaag aatacttgtc taacgcatgg 1260

atcagcagca gcggaaccgt cttgtctgtt tacagcttct tcggtatcat gaaggaagct 1320

accgaggaaa ccgctggttt cttgaagctt aatcaagact tggtctacaa ctcttctttg 1380

attatcagat tgtgcaacga ccttggtact tcttctgcag agcttgagag gggtgatgtt 1440

gctagcagca ttctttgttg catgactgag atgaacatca gcgaggagat cgcaagaaac 1500

tatattaaag gaatgattag caaaacttgg accaaaatca acggtcagtg tttcacccaa 1560

agccctcttc ttcagagctt catccatatc accactaact ttgcaagggt cgtccatagc 1620

ttgtaccaat acggagacgg attcggagtc caagacggtg acaccaagaa acagatcttg 1680

agccttttga tcgagcctat gcctcctagc ccatttagct aa 1722

<210> 3

<211> 576

<212> PRT

<213> Artificial Synthesis

<400> 3

Met Glu Phe Arg Val His Leu Gln Ala Asp Asn Glu Gln Lys Ile Phe

1 5 10 15

Gln Asn Gln Met Lys Pro Glu Pro Glu Ala Ser Tyr Leu Ile Asn Gln

20 25 30

Arg Arg Ser Ala Asn Tyr Lys Pro Asn Ile Trp Lys Asn Asp Phe Leu

35 40 45

Asp Gln Ser Leu Ile Ser Lys Tyr Asp Gly Asp Glu Tyr Arg Lys Leu

50 55 60

Ser Glu Lys Leu Ile Glu Glu Val Lys Ile Tyr Ile Ser Ala Glu Thr

65 70 75 80

Met Asp Leu Val Ala Lys Leu Glu Leu Ile Asp Ser Val Arg Lys Leu

85 90 95

Gly Leu Ala Asn Leu Phe Glu Lys Glu Ile Lys Glu Ala Leu Asp Ser

100 105 110

Ile Ala Ala Ile Glu Ser Asp Asn Leu Gly Thr Arg Asp Asp Leu Tyr

115 120 125

Gly Thr Ala Leu His Phe Lys Ile Leu Arg Gln His Gly Tyr Lys Val

130 135 140

Ser Gln Asp Ile Phe Gly Arg Phe Met Asp Glu Lys Gly Thr Leu Glu

145 150 155 160

Asn His His Phe Ala His Leu Lys Gly Met Leu Glu Leu Phe Glu Ala

165 170 175

Ser Asn Leu Gly Phe Glu Gly Glu Asp Ile Leu Asp Glu Ala Lys Ala

180 185 190

Ser Leu Thr Leu Ala Leu Arg Asp Ser Gly His Ile Cys Tyr Pro Asp

195 200 205

Ser Asn Leu Ser Arg Asp Val Val His Ser Leu Glu Leu Pro Ser His

210 215 220

Arg Arg Val Gln Trp Phe Asp Val Lys Trp Gln Ile Asn Ala Tyr Glu

225 230 235 240

Lys Asp Ile Cys Arg Val Asn Ala Thr Leu Leu Glu Leu Ala Lys Leu

245 250 255

Asn Phe Asn Val Val Gln Ala Gln Leu Gln Lys Asn Leu Arg Glu Ala

260 265 270

Ser Arg Trp Trp Ala Asn Leu Gly Phe Ala Asp Asn Leu Lys Phe Ala

275 280 285

Arg Asp Arg Leu Val Glu Cys Phe Ser Cys Ala Val Gly Val Ala Phe

290 295 300

Glu Pro Glu His Ser Ser Phe Arg Ile Cys Leu Thr Lys Val Ile Asn

305 310 315 320

Leu Val Leu Ile Ile Asp Asp Val Tyr Asp Ile Tyr Gly Ser Glu Glu

325 330 335

Glu Leu Lys His Phe Thr Asn Ala Val Asp Arg Trp Asp Ser Arg Glu

340 345 350

Thr Glu Gln Leu Pro Glu Cys Met Lys Met Cys Phe Gln Val Leu Tyr

355 360 365

Asn Thr Thr Cys Glu Ile Ala Arg Glu Ile Glu Glu Glu Asn Gly Trp

370 375 380

Asn Gln Val Leu Pro Gln Leu Thr Lys Val Trp Ala Asp Phe Cys Lys

385 390 395 400

Ala Leu Leu Val Glu Ala Glu Trp Tyr Asn Lys Ser His Ile Pro Thr

405 410 415

Leu Glu Glu Tyr Leu Arg Asn Gly Cys Ile Ser Ser Ser Val Ser Val

420 425 430

Leu Leu Val His Ser Phe Phe Ser Ile Thr His Glu Gly Thr Lys Glu

435 440 445

Met Ala Asp Phe Leu His Lys Asn Glu Asp Leu Leu Tyr Asn Ile Ser

450 455 460

Leu Ile Val Arg Leu Asn Asn Asp Leu Gly Thr Ser Ala Ala Glu Gln

465 470 475 480

Glu Arg Gly Asp Ser Pro Ser Ser Ile Val Cys Tyr Met Arg Glu Val

485 490 495

Asn Ala Ser Glu Glu Thr Ala Arg Lys Asn Ile Lys Gly Met Ile Asp

500 505 510

Asn Ala Trp Lys Lys Val Asn Gly Lys Cys Phe Thr Thr Asn Gln Val

515 520 525

Pro Phe Leu Ser Ser Phe Met Asn Asn Ala Thr Asn Met Ala Arg Val

530 535 540

Ala His Ser Leu Tyr Lys Asp Gly Asp Gly Phe Gly Asp Gln Glu Lys

545 550 555 560

Gly Pro Arg Thr His Ile Leu Ser Leu Leu Phe Gln Pro Leu Val Asn

565 570 575

<210> 4

<211> 1731

<212> DNA

<213> Artificial Synthesis

<400> 4

atggaatttc gcgtgcatct gcaagccgac aacgagcaga agatcttcca gaaccagatg 60

aagccggagc cagaagcgag ttatctgatc aatcagcgcc gcagcgcgaa ctacaagccg 120

aacatctgga agaacgactt cctcgaccag agtctgatca gcaagtacga cggcgatgag 180

taccgcaagc tgagtgagaa gctcatcgaa gaagttaaga tctacatcag cgcggaaacc 240

atggatctgg tggccaagct ggagctcatc gacagtgtgc gtaaactggg tctggccaat 300

ctgttcgaga aggagatcaa agaggcgctg gatagcatcg ccgccattga aagcgacaat 360

ctcggcaccc gcgatgatct gtatggcacc gcgctgcact tcaaaatcct ccgccagcac 420

ggctacaagg tgagccaaga catcttcggc cgttttatgg acgagaaagg cacgctggag 480

aatcaccact tcgcgcatct gaagggcatg ctcgaactgt tcgaggcgag caatctcggt 540

ttcgagggcg aggatattct ggatgaggcc aaagcgagcc tcacgctggc gctgcgtgat 600

agtggtcaca tctgctaccc ggatagcaac ctcagccgtg acgttgtgca tagtctggaa 660

ctcccaagcc accgccgcgt tcagtggttt gacgtgaagt ggcagatcaa cgcgtacgag 720

aaagacatct gccgcgttaa cgccacgctg ctcgagctgg ccaagctgaa ctttaatgtg 780

gtgcaagccc agctgcagaa aaacctccgc gaagcgagcc gttggtgggc gaatctcggc 840

ttcgccgata atctgaagtt tgcgcgcgat cgtctggtgg aatgcttcag ctgcgccgtg 900

ggtgttgcgt tcgagccaga gcatagcagt ttccgcatct gcctcaccaa agtgatcaat 960

ctggttctga tcatcgacga tgtgtacgat atctacggca gcgaagaaga actgaaacac 1020

tttaccaacg cggttgatcg ctgggatagc cgcgagaccg agcagctgcc ggagtgtatg 1080

aagatgtgct tccaagttct ctacaatacg acgtgcgaga tcgcccgcga aatcgaagaa 1140

gaaaatggct ggaaccaagt tctcccacag ctgacgaagg tttgggcgga cttttgcaaa 1200

gcgctgctgg tggaggcgga gtggtacaat aagagccaca ttccgaccct cgaggaatac 1260

ctccgcaatg gttgcatcag cagcagcgtt agcgtgctcc tcgttcacag cttcttcagc 1320

attacccacg agggcaccaa ggaaatggcg gatttcctcc acaagaacga ggatctgctc 1380

tacaacatca gtctgatcgt gcgcctcaat aatgatctgg gtacgagtgc ggccgagcaa 1440

gaacgcggcg acagtccaag cagcatcgtg tgctacatgc gcgaggttaa tgccagtgaa 1500

gagacggccc gcaagaatat caagggcatg atcgacaacg cgtggaagaa ggttaacggc 1560

aagtgcttca ccaccaacca agttccgttt ctcagcagtt tcatgaacaa cgcgaccaac 1620

atggcgcgtg ttgcgcacag tctgtataaa gacggcgacg gtttcggtga tcaagaaaag 1680

ggtccgcgca cccacattct gagtctgctg tttcaaccgc tggttaacta a 1731

Claims (10)

1. An alpha-farnesene synthetase FSCS gene is characterized in that the amino acid sequence of the alpha-farnesene synthetase FSCS gene is shown in SEQ ID No. 1.

2. The alpha-farnesene synthase FSCS gene according to claim 1, wherein the nucleotide sequence encoding the alpha-farnesene synthase FSCS gene is shown in SEQ ID No. 2.

3. An expression vector comprising the FSCS gene for α -farnesene synthase according to claim 1.

4. A recombinant saccharomyces cerevisiae strain comprising the α -farnesene synthase FSCS gene according to claim 1.

5. A method of producing a recombinant strain of Saccharomyces cerevisiae according to claim 4, characterized in that the recombinant strain of Saccharomyces cerevisiae is constructed by a method comprising the steps of: cloning an alpha-farnesene synthetase FSCS gene with a nucleotide sequence shown as SEQ ID No.2 into an expression vector to obtain a recombinant expression vector plasmid Ts gal80-xtpfscs, and transforming the recombinant plasmid into host cell saccharomyces cerevisiae.

6. Use of a recombinant strain of saccharomyces cerevisiae according to claim 4 in the fermentative production of α -farnesene in saccharomyces cerevisiae.

7. The use of a recombinant strain of saccharomyces cerevisiae according to claim 6, wherein the fermentation medium for the production of α -farnesene is: 10g/L yeast powder, 20g/L peptone, 30g/L glucose and 10% (V/V) dodecane, wherein the fermentation conditions are as follows: the fermentation time in the logarithmic growth phase of the thalli is 24-30h, the temperature is 30 ℃, and the subsequent fermentation is carried out when the glucose is completely consumed and the temperature is 20 ℃; the fermentation time is 24-96 h.

8. Use of a recombinant strain of saccharomyces cerevisiae according to claim 6, characterized in thatAdding Mg into the fermentation medium^{2 +}And/or K⁺。

9. Use of a recombinant strain of saccharomyces cerevisiae according to claim 6, wherein Mg is present in the culture medium²⁺The final concentration is 10.0-80.0 mmol/L.

10. Use of a recombinant strain of saccharomyces cerevisiae according to claim 6, wherein K is present in the culture medium⁺The final concentration is 10.0-50.0 mmol/L.

Images