CN109385379A

CN109385379A - A kind of engineering bacteria of high yield rhodioside and its application

Info

Publication number: CN109385379A
Application number: CN201811116170.0A
Authority: CN
Inventors: 罗云孜; 刘化; 刘化一
Original assignee: Chengdu Weihe Biotechnology Co Ltd
Current assignee: Chengdu Weihe Biotechnology Co Ltd
Priority date: 2018-09-25
Filing date: 2018-09-25
Publication date: 2019-02-26
Also published as: CN110499260B; CN110499260A

Abstract

The invention discloses a kind of engineering bacteria of high yield rhodioside, it be the codon mutation that the ARO4 gene in S. cervisiae is encoded into the 229th amino acids is encode the codon of leucine, the codon mutation of the 141st glycine of ARO7 gene be the codon of encoding serine, the 222nd lysine of ARO3 gene codon mutation be the recombinant yeast for encoding the codon of leucine.The invention also discloses the hairs that rhodioside is prepared using aforementioned engineering bacteria.Engineering bacteria of the present invention can be with high yield rhodioside, and economic value is high, and prospects for commercial application is good.

Description

A kind of engineering bacteria of high yield rhodioside and its application

Technical field

The present invention relates to bioengineering fields, and in particular to a kind of engineering bacteria of high yield rhodioside and its application.

Background technique

Root of kirilow rhodiola is the rare wild plant for being grown in high and cold contamination-freely band, is that China's Tibetan people commonly uses drug, So far oneself has more than 1000 years applicating histories, has stimulation nervous system, increases working efficiency, eliminates fatigue and prevention high mountain The effects of disease, also has protection cardiovascular and cerebrovascular, the functions such as nerve cell and anti-tumor radiation.The main medicinal work of root of kirilow rhodiola Property ingredient is rhodioside and its tyrosol.In recent years, using rhodioside and its tyrosol as main material production The product categories such as medicament, beverage, food and cosmetics are more and more, and the demand to rhodioside and its tyrosol is also more next It is higher.

The chemical name of rhodioside (Salidroside) is 2- (4-hydroxypHenyl) ethyl- β-D- Glucopyranoside, molecular formula C₁₄H₂₀O₇, molecular weight 300.304, No. CAS is 10338-51-9, and structural formula is

The tyrosol (Tyrosol) of rhodioside, its chemical name is 4- (2-Hydroxyethyl) pHeno1, molecules Formula is C₈H₁₀O₂, molecular weight 138.164, No. CAS is 501-94-0, and structural formula is

Currently, the main production ways of rhodioside and its tyrosol are extracted from root of kirilow rhodiola plant.However, due to Naturally the rhodiola plant resource grown is rare, and the cost of the rhodiola plant of artificial cultivation is also higher, also, its rhodioside Content is lower, if the content of rhodioside in most common sachalin rhodiola rhizome and rhodiola only has 0.5%-0.8%, extracts At high cost, low efficiency.And the long not easy operation control of chemical synthesis process process, it is at high cost, it is difficult to realize industrialization；Plant group It is long reaction time to knit culture, potency is lower.Biosynthesis is smaller to the dependence of natural environment, it is possible to overcome from rhodioside and plant The above problem existing for rhodioside and its tyrosol is extracted in object.

Wang Mengliang etc. is screened obtained microbial strains and is acted on, successfully synthesized red using D-Glucose and tyrosol as substrate Red-spotted stonecrop glycosides (Wang Mengliang, Zhang Fang, Liu Yunnan are raw, mono- glucose of microorganism catalysis D and Synthesis of Salidroside through Glucosylation just Step research, is catalyzed journal, 2006,27 (3): 233 1 236), but obtains very low compared with high product concentration.Existing literature report Changing the gene of Escherichia coli and saccharomyces cerevisiae come by way of improving rhodioside production concentration, but also not to the utmost such as people Meaning causes the later period to be extracted and still has the problem that difficulty is big, at high cost.Such as: Bi Huiping, using Escherichia coli as platform construction It is logical to realize the tyrosol biosynthesis that one is different from plant for high yield tyrosol and/or rhodioside and icariside D2 bacterial strain Road.In the bacterial strain of building, the yield of tyrosol is up to 600mg/L, and the yield of rhodioside is up to 50mg/L, icariside D2 Yield up to 40mg/L.(a kind of high yield tyrosol of and/or rhodioside and Herba Epimedii are waited with refined in Bi Huiping, Bai Yanfen, the village The E. coli expression strains of glycosides D2 and its 104940575 A of .CN is applied, 2015.)；The production rhodioside in building such as Liu Tao Recombination bacillus coli research in, by knock out or silencing galE, galT, ugd, and import be overexpressed ARO10, pgm, UGT73B6, GalU, T7ploymerase gene, the maximum output of rhodioside are able to ascend to 0.7g/L (Liu Tao, Bi Huiping, Zhuan Yibin Deng, a kind of recombination bacillus coli producing rhodioside and construction method and 107435049 A of .CN is applied, 2016.)；East China Liu Tao seminar, Polytechnics has utilized saccharomyces cerevisiae de novo formation rhodioside, but yield is lower, only 732.5mg/L (Jiang J,Yin H,Wang S,et al.Metabolic Engineering of Saccharomyces cerevisiae for High-Level Production of Salidroside from Glucose.Journal of Agricultural&Food Chemistry,2018.)。

Accordingly, it is desirable to provide a kind of engineering bacteria and method of high yield rhodioside.

Summary of the invention

In order to solve the above-mentioned technical problems, the present invention provides a kind of new engineering bacterias, can be with high yield rhodioside.

The engineering bacteria of high yield rhodioside of the present invention, it is that the ARO4 gene in S. cervisiae is encoded to the 229th ammonia The codon mutation of base acid is that ARO4 gene mutation (is ARO4 by the codon of coding leucine^K229L), ARO7 gene the 141st The codon mutation of position glycine is that (i.e. ARO7 gene mutation is ARO7 for the codon of encoding serine^G141S), ARO3 gene The codon mutation of 222 lysine be encode leucine codon (i.e. ARO3 gene mutation is ARO3^K222L) recombination ferment Female bacterium.

ARO4 gene: referring to, Gene ID:852551, Chromosome:II；NC_001134.8 (716882..717994)

ARO7 gene: referring to, Gene ID:856173, Chromosome:XVI；NC_001148.4 (674861..675631)

ARO3 gene: referring to, Gene ID:851605, Chromosome:IV；NC_001136.10 (521816..522928)

The codon of the ARO4 gene the 229th is TTG, and the codon of the ARO7 gene the 141st is agt；The 222 codons are CTA, specifically:

ARO4^K229LSequence can be following sequence:

atgagtgaatctccaatgttcgctgccaacggcatgccaaaggtaaatcaaggtgctgaagaagatgt cagaattttaggttacgacccattagcttctccagctctccttcaagtgcaaatcccagccacaccaacttctttg gaaactgccaagagaggtagaagagaagctatagatattattaccggtaaagacgacagagttcttgtcattgtcg gtccttgttccatccatgatctagaagccgctcaagaatacgctttgagattaaagaaattgtcagatgaattaaa aggtgatttatccatcattatgagagcatacttggagaagccaagaacaaccgtcggctggaaaggtctaattaat gaccctgatgttaacaacactttcaacatcaacaagggtttgcaatccgctagacaattgtttgtcaacttgacaa atatcggtttgccaattggttctgaaatgcttgataccatttctcctcaatacttggctgatttggtctccttcgg tgccattggtgccagaaccaccgaatctcaactgcacagagaattggcctccggtttgtctttcccagttggtttc aagaacggtaccgatggtaccttaaatgttgctgtggatgcttgtcaagccgctgctcattctcaccatttcatgg gtgttactTTGcatggtgttgctgctatcaccactactaagggtaacgaacactgcttcgttattctaagaggtgg taaaaagggtaccaactacgacgctaagtccgttgcagaagctaaggctcaattgcctgccggttccaacggtcta atgattgactactctcacggtaactccaataaggatttcagaaaccaaccaaaggtcaatgacgttgtttgtgagc aaatcgctaacggtgaaaacgccattaccggtgtcatgattgaatcaaacatcaacgaaggtaaccaaggcatccc agccgaaggtaaagccggcttgaaatatggtgtttccatcactgatgcttgtataggttgggaaactactgaagac gtcttgaggaaattggctgctgctgtcagacaaagaagagaagttaacaagaaatag

ARO7^G141SSequence can be following sequence:

ATGGATTTCACAAAACCAGAAACTGTTTTAAATCTACAAAATATTAGAGATGAATTAGTTAGAATGGA GGATTCGATCATCTTCAAATTTATTGAGAGGTCGCATTTCGCCACATGTCCTTCAGTTTATGAGGCAAACCATCCA GGTTTAGAAATTCCGAATTTTAAAGGATCTTTCTTGGATTGGGCTCTTTCAAATCTTGAAATTGCGCATTCTCGCA TCAGAAGATTCGAATCACCTGATGAAACTCCCTTCTTTCCTGACAAGATTCAGAAATCATTCTTACCGAGCATTAA CTACCCACAAATTTTGGCGCCTTATGCCCCAGAAGTTAATTACAATGATAAAATAAAAAAAGTTTATATTGAAAAG ATTATACCATTAATTTCGAAAAGAGATGGTGATGATAAGAATAACTTCagtTCTGTTGCCACTAGAGATATAGAAT GTTTGCAAAGCTTGAGTAGGAGAATCCACTTTGGCAAGTTTGTTGCTGAAGCCAAGTTCCAATCGGATATCCCGCTA TACACAAAGCTGATCAAAAGTAAAGATGTCGAGGGGATAATGAAGAATATCACCAATTCTGCCGTTGAAGAAAAGAT TCTAGAAAGATTAACTAAGAAGGCTGAAGTCTATGGTGTGGACCCTACCAACGAGTCAGGTGAAAGAAGGATTACTC CAGAATATTTGGTAAAAATTTATAAGGAAATTGTTATACCTATCACTAAGGAAGTTGAGGTGGAATACTTGCTAAGA AGGTTGGAAGAGTAA

ARO3^K222LSequence can be following sequence:

Atgttcattaaaaacgatcacgccggtgacaggaaacgcttggaagactggagaatcaaaggttatga tccattaacccctccagatctgcttcaacatgaatttccaatttcagccaaaggtgaggaaaacattatcaaggca agagactccgtctgtgatattttgaatggtaaagatgatcgtttagttatcgtgatcgggccatgttccctacatg accccaaagccgcttacgattacgctgacagattggctaaaatttcagaaaagttgtcaaaagacttattgattat tatgagagcgtatttagaaaaaccaaggactactgttggctggaaagggttgattaacgaccctgatatgaataac tcttttcaaatcaataaaggtctacggatttcgagagaaatgttcataaaactggttgaaaaattacccattgctg gtgagatgttggataccatttctccgcagtttttgagtgattgtttctccttgggtgccatcggcgccagaactac tgaatcccaactgcacagagaattagcatccggtctatctttccctattggatttaagaacggtactgatggtggt ttgcaagtcgccatcgacgctatgagagccgctgcacatgaacattacttcctttctgtcacaCTAccaggtgtca ctgctatcgtgggcactgaaggtaacaaggataccttcctgatcttgagaggtggtaagaacggtactaactttga caaagaaagtgttcaaaatactaagaaacagttagaaaaggccggtttgactgatgattcccagaaaagaattatg atcgattgttcccacggcaacagtaataaagatttcaagaaccaaccaaaggttgccaaatgtatttatgaccagc tgacggagggtgagaatagtctctgtggtgttatgattgagtccaacataaatgaaggtagacaagatattcccaa agaaggtggcagagagggattgaagtatggttgttctgttacggatgcttgtattggctgggagtccaccgaacag gtattggagctattggcagaaggtgttagaaacagaagaaaggccttgaaaaaatag

Remarks: underscore indicates mutational site

Further, in the recombinant yeast, in the recombinant yeast, gene RIC1, gene pHA2 and/or TRP2 It is deactivated；Preferably, gene RIC1, gene pHA2 and/or TRP2 sport sequence shown in NO:4~6 SEQ ID respectively.

RIC1 gene: referring to, Gene ID:850728Chromosome:XII；NC_001144.5 (225426..228596)

PHA2 gene: referring to, Gene ID:855400Chromosome:XIV；NC_001146.8(42071..43075)

TRP2 gene: referring to, Gene ID:856824Chromosome:V；NC_001137.3(337949..339472)

The sequence of gene knockout (remarks: dash area represents gene and has been knocked)

Δ RIC1 (SEQ ID NO:4):

Δ TRP2 (SEQ ID NO:5)

Δ PHA2 (SEQ ID NO:6)

Further, the rigorous type plasmid comprising carrying UGP1, PGM and/or RrU8GT33 in the recombinant yeast PRS413 plasmid；Preferably, the also integrated pRS425 comprising carrying ARO10, ARO2 and/or ARO1 in the recombinant yeast Plasmid.

UGP1 gene: referring to, GeneID:853830Chromosome:XI；NC_001143.9(369891..371390)；

PGM gene: referring to, GeneID:853732；

RrU8GT33 gene: referring to, GenBank:MF674558.1；

ARO1 gene: referring to, Gene ID:851705Chromosome:IV；NC_001136.10 (704484..709250)；

ARO2 gene: referring to, Gene ID:852729Chromosome:VII；NC_001139.9 (226399..227529)；

ARO10 gene: referring to, Gene ID:851987Chromosome:IV；NC_001136.10 (1234218..1236125)。

The present invention also provides application of the aforementioned engineering bacteria in production rhodioside.

The present invention also provides a kind of methods for preparing rhodioside, it is prepared using engineering bacterium fermentation above-mentioned.

Described method includes following steps:

(1) engineering bacteria above-mentioned is taken, cultivates, obtains saccharomyces cerevisiae seed liquor；

(2) saccharomyces cerevisiae seed liquor is inoculated into fermentation medium, ferments, obtains fermentation liquid；

(3) it isolates and purifies.

The technique of step (1) are as follows: engineering bacteria is taken, is inoculated into SC fluid nutrient medium, 28~32 DEG C, 100~300rpm shakes Bed culture 12~36h, preferably 30 DEG C, 200rpm shaking table culture for 24 hours.

SC fluid nutrient medium:

In step (2), the condition of fermentation are as follows: after saccharomyces cerevisiae seed liquor is inoculated into fermentation medium, OD600 is 0.1~0.3, preferably 0.2；The temperature of fermentation is 28~32 DEG C, is selected as 30 DEG C, 100~300rpm of agitation speed, preferably 200rpm；Control control pH is 5.3~5.8, preferably 5.5；Air velocity is 2~6L/min, preferably 4L/min；When fermentation Between be 120~170h, preferably fermentation time be 144h.

In step (2), the fermentation medium is SC culture medium, continuously adds glucose solution during fermentation, Keeping concentration of glucose in fermentation medium is 10-20g/L.

In step (3), the isolation and purification method is column chromatography method.

The column chromatography method are as follows: fermentation liquid HP20 macroporous absorbent resin is adsorbed, after with clear water wash resin, then according to Secondary 40% ethyl alcohol, 70% ethanol elution, obtain the sterling of rhodioside；Preferably, loading volume: column volume 3:1；It has adsorbed The water washing resin of 3 times of column volumes of Cheng Houyong, rear 40% ethyl alcohol with 20 times of column volumes, then 70% ethyl alcohol of 40 times of column volumes are washed It is de-.

Key of the invention is to establish the recombinant Saccharomyces cerevisiae of high yield rhodioside, can be high using the saccharomyces cerevisiae Rhodioside is produced, specific preparation method is not limited to the method that the present invention enumerates.

The results show, the improved engineering bacteria of the present invention can be 1g/L- with high yield rhodioside, rhodioside yield 1.1g/L, economic value is high, and zymotechnique is simple, and low in cost, prospects for commercial application is good.

Obviously, above content according to the present invention is not being departed from according to the ordinary technical knowledge and customary means of this field Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.

The specific embodiment of form by the following examples remakes further specifically above content of the invention It is bright.But the range that this should not be interpreted as to the above-mentioned theme of the present invention is only limitted to example below.It is all to be based on above content of the present invention The technology realized all belongs to the scope of the present invention.

Detailed description of the invention

The building schematic diagram of Fig. 1 recombinant plasmid

Specific embodiment

The building of embodiment 1, engineering bacteria of the present invention

1, the construction method of engineering bacteria

(1) from original Wine brewing yeast strain HY001 (the CEN.PK-1C), successively to three kinds of ARO of main metabolic fluxes approach Gene is mutated, and mutation method is the genome site-directed mutagenesis technique that CRISPR-Cas9 is mediated:

The method of site-directed point mutation, the plasmid of use carry the gene and one section of base for being used to transcribe of Cas9 albumen Cause, RNA and the Cas9 protein binding of transcription, only need to be imported again on plasmid one section with target gene match gene spacer and The plasmid rebuild is imported cell by homologous recombination segment, because the homologous recombination segment of design is rite-directed mutagenesis, ferment The target gene being cut off in female eukaryocyte body, in a manner of homologous recombination, using the homology arm on plasmid as template, reparation is caused Rite-directed mutagenesis, to complete site-directed point mutation purpose.

It is ARO4 by ARO4 gene mutation on HY001 bacterial strain^K229L, thus obtain bacterial strain HY002

(CEN.PK-1C-mutARO4)；

Spacer:TTCATGGGTGTTACTAAGCA

Homology arm:

HR-Left:aatgttgctgtggatgcttgtcaagccgctgctcattctcaccatttcatgggtgttact TTG

HR-Right:catggtgttgctgctatcaccactactaagggtaacgaacactgcttcgttattcta

It is ARO7 by ARO7 gene mutation on HY002 bacterial strain^G141S, thus obtain bacterial strain HY003

(CEN.PK-1C-mutARO4-mutARO7)；

Spacer:GGTGATGATAAGAATAACTT

Homology arm

HR-Left:GATTATACCATTAATTTCGAAAAGAGATGGTGATGATAAGAATAACTTCAGT

HR-Right:TCTGTTGCCACTAGAGATATAGAATGTTTGCAAAGCTTGAGTAGGAGA

It is ARO3 by ARO3 gene mutation on HY003 bacterial strain^K222L, thus obtain bacterial strain HY004

(CEN.PK-1C-mutARO4-mutARO7-mutARO3)。

ARO3^K229LAbrupt information:

Spacer:TTCCTTTCTGTCACAAAGCC

HR-Left:CATCGACGCTATGAGAGCCGCTGCACATGATCATTACTTCCTTTCTGT CACACTA

HR-Right:CCAGGTGTCACTGCTATCGTGGGCACTGAAGGTAACAAGGATACCTT CCTGATCTTGAG

(2) on Wine brewing yeast strain HY004, first gene knockout RIC1 solves the related inhibition of transcription, obtains bacterial strain HY005(CEN.PK-1C-mutARO4-mutARO7-mutARO3-ΔRIC1).Mutation method is the base that CRISPR-Cas9 is mediated Because of a group knockout.

The method of gene site-directed knockout, the plasmid of use carry the gene and one section of base for being used to transcribe of Cas9 albumen Cause, RNA and the Cas9 protein binding of transcription, only need to be imported again on plasmid one section with target gene match gene spacer and The plasmid rebuild is imported cell by homologous recombination segment, because the homologous recombination segment of design is that have one section of base to lack It loses, the target gene being cut off in yeast eukaryocyte body, in a manner of homologous recombination, using the homology arm on plasmid as template, Reparation causes frameshift mutation, and gene function is caused to destroy, to complete gene knockout purpose.

Δ RIC1 information:

Spacer:GGAATTCTAAGCAATTGGGG

HR-Left:CGGAAGCTGCAAGAAACTGAACACGTGGAAAATGCACTTATGGCCAGT CA

HR-Right:CAATTGCTTAGAATTCCACCCCGCAACGCCGAATTAGGTGAAGGTAC TAA

(2) on Wine brewing yeast strain HY005, pHA2, TRP2 are knocked out, tryptophan is reduced and phenylalanine competes approach, It obtains bacterial strain HY006 (CEN.PK-1C-mutARO4-mutARO7-mutARO3- Δ RIC1- Δ pHA2- Δ TRP2).Mutation side Method is the genomic knockout that CRISPR-Cas9 is mediated.

PHA2

Spacer:GGGGGATAGAGGCTGCTGGG

Homology arm

HR-Left:AGGTACGTATTCCCATCAAGCTGCATTACAACAATTTCAATCAACATCTGATGTTGAGTA

HR-Right:AATGTTTTAACCAATTGGAGAACGACACTAGTATAGATTATTCAGTGGTACCGTTGG

TRP2

Spacer:ATTGGATCTGACTCCTCACG

Homology arm

HR-Left:ACAGCAGCAAAATGACGATAGTTCCATAAATATGTATCCCGTGTATGCGTATTTGCCATC

HR-Right:CATATCTAAAATTGGCACAATTGAACAACCCTGATAGAAAGGAATCATTTCTGTTGGAAA

(3) gene UGP1, PGM are inserted also by the method for single-swap in Wine brewing yeast strain of the invention,

RrU8GT33, and Gene A RO10, ARO2, ARO1 relevant to the regulation of main metabolic fluxes.

Genome conformity is usually to ensure that the best approach of approach stability and homologous expression in group.

The present invention utilizes rigorous type plasmid pRS413 by UGP1, PGM, RrU8GT33 expressing in series, composition module 1, utilization The high expression of gene is realized by gene integration into genome as insertion point in multiple sites Delta on S. cerevisiae chromosomal Purpose.

Integration site:

delta1:

ctcgagggatataggaatcctcaaaatggaatctatatttctacatactaatattacgattattcatt ccgttttatatgtttatatttcattgatcctattacattatcaatccttgcgtttcagcttccactaatttagatg actatttctcatcatttgcgtcatcttctaagccagccgtatatgataatatactagtaatgtaaatactagttag tagatgatagttgatttctattccaaca

Delta2:

tggaagctgaaacgtctaacggatcttgatttgtgtggacttccttagaagtaaccgaagcacaggcg ctaccatgagaaatgggtgaatgttgagataattgttgggattccattgttgataaaggctataatattaggtata cagaatatactagaagttctc

Select integrative plasmid pRS406 will Gene A RO10 relevant to the regulation of main metabolic fluxes, ARO2, ARO1 go here and there in order Connection expression, constitutes module 2.

Insertion point are as follows: ura 3-52

Module 1, the construction method of module 2 are yeast connection method.

It is integrated on Yeast genome using the site Delta, technology path is as shown in Figure 1.Connection Step is as follows:

Each segment DNA is determined last total volume (being concentrated into 10ul), condensing mode can be QI according to equimolar than mixing Aquick concentration.

1) plate is drawn on YPAD plate, prepares fresh HZ848 monoclonal

2) monoclonal is chosen into 2-3ml YPAD, and 30 degree of shaking tables are incubated overnight (about 16h)

3) take 1ml seed bacterium solution in 50ml YPAD, 30 degree of cultures to OD600=0.6-0.8 (generally supporting 4h) yeast passes For 2h/ generation

4) by yeast in 4 degree, 4000rpm, it is centrifuged 2-3min, abandons supernatant

5) plus ddH is pre-chilled in 50ml₂O cleans cell, is centrifuged, abandoning supernatant (1ml sterile water is first taken, after blowing even thallus, then plus Remaining water)

6) plus ddH2O is pre-chilled in 1ml, is resuspended, and moves to 1.5ml EP pipe, and 7000rpm 4 degree, is centrifuged 30s, abandons supernatant

7) plus 1M sorbitol is pre-chilled in 1ml, cleans cell, and supernatant is abandoned in centrifugation

8) plus 1M sorbitol is pre-chilled in 400-600ul, is resuspended, and is distributed into 100ul/ pipe electricity and turns

1) it takes 10ul DNA that 100ul competence is added, electric revolving cup (1.5kv, the 5.0-5.2ms point of pre-cooling is transferred to after mixing Hit), 1ml YPAD is rapidly joined after electric shock

2) 30 degree, 250rpm, recovery 1h.5000rpm is centrifuged 1min, abandons supernatant

3) plus 1ml 1M sorbitol cleans cell, washes three times, is finally resuspended to 1ml 1M sorbitol

4) 100ul, 900ul is divided to be respectively coated on screening flat board, 30 degree of cultures.

Conversion: yeast robin imports the plasmid built in purpose bacterial strain.

1, inoculation purpose bacterial strain is supported overnight in 5ml YPAD, 30 degree of vibrations

2, it takes 2ml bacterium solution in 50ml YPAD, sets 30 degree of feeding 4-5h that shake, OD600=0.8-1.0 (at least complete twice by cell Division, during three or four divisions, transformation efficiency is constant)

3, it is centrifuged, 2500rpm, 5min (can also be with 4000rpm, 2-3min), abandons supernatant

4, [SSDNA sample is boiled into 10min, in quick insertion ice]

5, it washes: being resuspended with 50ml sterile water, be ibid centrifuged

6,100mM LiAc is washed: being resuspended with the 100mM LiAc of 50ul, 12000rpm, 3s (or 4000rpm, 1min) are exhausted Supernatant

7, suspension cell is to final volume 500ul, about plus 100mM LiAc 400ul, is divided into 50ul/ pipe, centrifugation, in abandoning It is to be vortexed below more easily that (4000rpm, the 30s) time, which shortens, clearly

8, it is sequentially added into " conversion mixed liquor "

240ul PEG3350 (50%)

36ul 1M LiAc

10ul ssDNA(10mg/ml)

50ul water and plasmid (plasmid 1ug-5ug)

9, it is vortexed and shakes each reaction tube until cell mixes completely

10,30 degree of heat preservation 30min are set

11,42 degree of heat shock 20min-25min are set

12,15s is centrifuged with 6000-8000rpm, exhausts supernatant

13, precipitating is gently resuspended with 200ul sterile water

14, selection plate is applied, insulating box is set

Gene UGP1, the rigorous type plasmid pRS413 of PGM, RrU8GT33 are had by preceding method, and carries master Metabolic fluxes regulate and control relevant Gene A RO10, and the integrative plasmid pRS406 of ARO2, ARO1 obtain rhodioside superior strain HY007。

ARO4^K229L:

ARO7^G141S

ARO3^K222L

Remarks: underscore indicates mutational site

The sequence of gene knockout (remarks: dash area represents the gene being knocked)

ΔRIC1

ΔTRP2

ΔPHA2

Embodiment 2 prepares rhodioside using engineering bacterium fermentation of the present invention

Rhodioside superior strain HY007 prepared by Example 1, is prepared as follows rhodioside:

1, fermentation process:

(1) the above-mentioned bacterium solution for being incubated overnight 1ml is seeded in 50ml SC fluid nutrient medium, OD600=0.2 after inoculation, 30 DEG C, 200rpm shaking table culture 24 hours, obtain saccharomyces cerevisiae seed liquor；

(2) 5L that the 50ml saccharomyces cerevisiae seed liquor cultivated in step 1 is inoculated into the culture medium of SC containing 2.5L is fermented In tank, initial OD 600=0.2 after inoculation, 30 DEG C of fermentation temperature, agitation speed 200-300rpm, control pH=5.5 is (by certainly The ammonium hydroxide of dynamic addition 5M is adjusted), air velocity 4L/min, 500g/L glucose solution continuously adds, to keep fermentation medium In concentration of glucose between 10-20g/L, fermented and cultured 144 hours.

2, purification process

The fermentation liquid HP20 macroporous absorbent resin adsorbed target product that fermentation is obtained, loading volume: column volume=3: 1, the water washing resin of three times column volume is used after the completion of absorption, finally with 40% ethyl alcohol of 20 times of column volumes, 40 times of column volumes 70% ethyl alcohol successively elutes, and obtains the sterling of rhodioside.

3, testing result

After measured, high yield rhodioside Wine brewing yeast strain HY007 is in 5L fermentation cylinder for fermentation, rhodioside yield 1g/L-1.1g/L。

To sum up, rhodioside is produced using engineering bacteria of the present invention, rhodioside yield is 1g/L-1.1g/L, economic value Height, also, zymotechnique is simple, and raw material is relatively more conventional and cheap, and low in cost, prospects for commercial application is good.

Sequence table

<110>Chengdu Wei He Biotechnology Co., Ltd

<120>a kind of engineering bacteria of high yield rhodioside and its application

<130> GY771-18P1492

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1113

<212> DNA

<213>sequence (artificial) of ARO4K229L

<400> 1

atgagtgaat ctccaatgtt cgctgccaac ggcatgccaa aggtaaatca aggtgctgaa 60

gaagatgtca gaattttagg ttacgaccca ttagcttctc cagctctcct tcaagtgcaa 120

atcccagcca caccaacttc tttggaaact gccaagagag gtagaagaga agctatagat 180

attattaccg gtaaagacga cagagttctt gtcattgtcg gtccttgttc catccatgat 240

ctagaagccg ctcaagaata cgctttgaga ttaaagaaat tgtcagatga attaaaaggt 300

gatttatcca tcattatgag agcatacttg gagaagccaa gaacaaccgt cggctggaaa 360

ggtctaatta atgaccctga tgttaacaac actttcaaca tcaacaaggg tttgcaatcc 420

gctagacaat tgtttgtcaa cttgacaaat atcggtttgc caattggttc tgaaatgctt 480

gataccattt ctcctcaata cttggctgat ttggtctcct tcggtgccat tggtgccaga 540

accaccgaat ctcaactgca cagagaattg gcctccggtt tgtctttccc agttggtttc 600

aagaacggta ccgatggtac cttaaatgtt gctgtggatg cttgtcaagc cgctgctcat 660

tctcaccatt tcatgggtgt tactttgcat ggtgttgctg ctatcaccac tactaagggt 720

aacgaacact gcttcgttat tctaagaggt ggtaaaaagg gtaccaacta cgacgctaag 780

tccgttgcag aagctaaggc tcaattgcct gccggttcca acggtctaat gattgactac 840

tctcacggta actccaataa ggatttcaga aaccaaccaa aggtcaatga cgttgtttgt 900

gagcaaatcg ctaacggtga aaacgccatt accggtgtca tgattgaatc aaacatcaac 960

gaaggtaacc aaggcatccc agccgaaggt aaagccggct tgaaatatgg tgtttccatc 1020

actgatgctt gtataggttg ggaaactact gaagacgtct tgaggaaatt ggctgctgct 1080

gtcagacaaa gaagagaagt taacaagaaa tag 1113

<210> 2

<211> 771

<212> DNA

<213>sequence (artificial) of ARO7G141S

<400> 2

atggatttca caaaaccaga aactgtttta aatctacaaa atattagaga tgaattagtt 60

agaatggagg attcgatcat cttcaaattt attgagaggt cgcatttcgc cacatgtcct 120

tcagtttatg aggcaaacca tccaggttta gaaattccga attttaaagg atctttcttg 180

gattgggctc tttcaaatct tgaaattgcg cattctcgca tcagaagatt cgaatcacct 240

gatgaaactc ccttctttcc tgacaagatt cagaaatcat tcttaccgag cattaactac 300

ccacaaattt tggcgcctta tgccccagaa gttaattaca atgataaaat aaaaaaagtt 360

tatattgaaa agattatacc attaatttcg aaaagagatg gtgatgataa gaataacttc 420

agttctgttg ccactagaga tatagaatgt ttgcaaagct tgagtaggag aatccacttt 480

ggcaagtttg ttgctgaagc caagttccaa tcggatatcc cgctatacac aaagctgatc 540

aaaagtaaag atgtcgaggg gataatgaag aatatcacca attctgccgt tgaagaaaag 600

attctagaaa gattaactaa gaaggctgaa gtctatggtg tggaccctac caacgagtca 660

ggtgaaagaa ggattactcc agaatatttg gtaaaaattt ataaggaaat tgttatacct 720

atcactaagg aagttgaggt ggaatacttg ctaagaaggt tggaagagta a 771

<210> 3

<211> 1113

<212> DNA

<213>sequence (artificial) of ARO3K222L

<400> 3

atgttcatta aaaacgatca cgccggtgac aggaaacgct tggaagactg gagaatcaaa 60

ggttatgatc cattaacccc tccagatctg cttcaacatg aatttccaat ttcagccaaa 120

ggtgaggaaa acattatcaa ggcaagagac tccgtctgtg atattttgaa tggtaaagat 180

gatcgtttag ttatcgtgat cgggccatgt tccctacatg accccaaagc cgcttacgat 240

tacgctgaca gattggctaa aatttcagaa aagttgtcaa aagacttatt gattattatg 300

agagcgtatt tagaaaaacc aaggactact gttggctgga aagggttgat taacgaccct 360

gatatgaata actcttttca aatcaataaa ggtctacgga tttcgagaga aatgttcata 420

aaactggttg aaaaattacc cattgctggt gagatgttgg ataccatttc tccgcagttt 480

ttgagtgatt gtttctcctt gggtgccatc ggcgccagaa ctactgaatc ccaactgcac 540

agagaattag catccggtct atctttccct attggattta agaacggtac tgatggtggt 600

ttgcaagtcg ccatcgacgc tatgagagcc gctgcacatg aacattactt cctttctgtc 660

acactaccag gtgtcactgc tatcgtgggc actgaaggta acaaggatac cttcctgatc 720

ttgagaggtg gtaagaacgg tactaacttt gacaaagaaa gtgttcaaaa tactaagaaa 780

cagttagaaa aggccggttt gactgatgat tcccagaaaa gaattatgat cgattgttcc 840

cacggcaaca gtaataaaga tttcaagaac caaccaaagg ttgccaaatg tatttatgac 900

cagctgacgg agggtgagaa tagtctctgt ggtgttatga ttgagtccaa cataaatgaa 960

ggtagacaag atattcccaa agaaggtggc agagagggat tgaagtatgg ttgttctgtt 1020

acggatgctt gtattggctg ggagtccacc gaacaggtat tggagctatt ggcagaaggt 1080

gttagaaaca gaagaaaggc cttgaaaaaa tag 1113

<210> 4

<211> 3171

<212> DNA

<213> RIC1(artificial)

<400> 4

atgttcatca aacagtctga aaaaaataca cctaaatgcc tctacaaaaa aaaaggtaag 60

gtaagagtgt tattgaccgg aagctgtaag aaactgaaca cgtggaaaat gcacttatgg 120

ccagtcagtc cgccccaatt gcttagaatt ccaccccgca acgccgaatt aggtgagggt 180

actaaaatag atgattgcaa tattcttcaa tcaatgacac taccccaggc caatgttctt 240

atcatgctaa ccccaacaag agtgctcatt tacaacttca aaccaatggc actagtagct 300

agccatgaac gaacaatggc ttctcttaag gaatttggcg ataacagatc aatgaaacga 360

tcagctccat ataatgatat catcgaaggg cttatttcaa aaaaggactc gcaatactta 420

ttgtggcacc agggaaagct gatattttac gtaatgactg ataaaaactt ccttttaaca 480

taccaaattt taaaaaactg cacaaatgaa ataattttca aagaatacgg catacccgtc 540

atagagcctc ttttaatgag tgaagaagaa gcgaacagtg ctgaatatga ctataacaac 600

gatgatgata ctctcacggt atttgataaa aatagttctt caagaattat acagaatgga 660

tttggcataa ctaaggaaaa agggttttta cactttcttt ctaatcaaga aaacattgat 720

gaactccccg tgaaaaaact agaacttcgt ttaaaagtag ttcttaaatt tgactatgaa 780

atcatagaca tgattggcat caagacattt tccaaagtcg gggatgggcg ttatgaagaa 840

gttttgatag ttttattccc tcatggatta caaatactta caatatcgga ttttaaagtt 900

agcaagagct cgttggttga agtgaagaag ggatccaaga caattgtgtg taataaacaa 960

ttaatggttt tatctcatga ttccgtcgaa aagcagacta ttgtaagcat tatagacatt 1020

gaaaagcaag ctgttgaagc aataccgtta acggacacac cagatgaact tttgacttgc 1080

ctagaagtta atggatacct ggtggtcgtt tacaaagaaa aaataatctg ctttgataca 1140

agaattaaaa aagtaagcca ttcttggaaa ccaccatttg tgataaaact ttgcgataaa 1200

attaatgata aaatattact tttggtttct gaggatagtg ttaacattca tttttacaca 1260

gaatttggga atctgctatt cgctacatat tttgacgaag atgattataa tggtgataac 1320

aataatgaca acagcaagga taaaaatgag aaaaaggcgg ctgaatataa aatttctgat 1380

tttgtatgct tggataaatc actaataaca gtgtctcatt ccggaaaata tcaagtttgg 1440

aaattatggg aagaaataaa acaaacacaa tttgatttca gaaacccaaa atgttacgta 1500

ttaaccaata cgaacaatga tgtaatcata tattcacctg tgacaagttc ttcaatcaat 1560

aatgataatt tacaagtcat aaaacttcct acaaagactt tcaataatca tattgctttt 1620

gtaaaaatta attcttcctt gaggttattt gctacttatg tgtcgaacaa aaacatactg 1680

cttatccaca atctagagac caatatgtgg tctagttttg ctgaccaaaa cgtgttggat 1740

ttacattggc taggtgataa ttatttggtt tgtcatatga agaatgatga tggctcaaca 1800

aatctgaaat gtctgcagat tccactgcaa gaagcgaatc cggacgtgga actatcagat 1860

tatgtcatgt gggaatacaa tgttccagag aatacgattg ttttcagttt acatgttaat 1920

actttatccc ggtataagtt gttgaaaatg aaatccaaga atcacaatgc ttctgaaaaa 1980

caacctgatg cattgcttaa aactgccgag attattttag ttactgatac acagacaatt 2040

gtcttcgatg taatttctac tgtacatcca tgtggattaa acatcatcaa aaaattctac 2100

cagtatctca aaattaacat tccaattgat gttttaccca acaaaattga gtggataatt 2160

aacatgaagg agggcttgtt attttttgcc gataggaaat ttataaagct tggcaaagtg 2220

gatggagggg gctggcaaac cttaactttg ttggataaca tagaaaaaat aatcgatgtt 2280

atcagggacg aaatatttgt agttcaaggc cataattacg tcgtatactc tttggaagat 2340

ttatgggatg ataaaaagcc actagtttcc attccaatcg aagaagattt gtatccaata 2400

tcaaccaccc cagaaacagc tacaacacat acacttcact gcatttttaa cgcgcgattt 2460

tccaaattgg tggtgaaaca ccaaatatac ctcgaccaat taatcttagc caaattagaa 2520

gacaacacag atttggagga tatttcacac aattatcgtt ttttaaagcc ttacaaattt 2580

gcactcgaaa agattttgtc tactaaaata ctgcgaagcg actctttgga tgatatcctg 2640

aaattaatta agatgtatga caacaccgat cctgagcata atatttcacc accaacccac 2700

agtggtatgt tagaaattat tagtaattgt ttaaggaaga tcgaaactaa atactggaac 2760

catctattca ctaatctaaa gatgacacca agagatttat tagcactctg tatcgaagaa 2820

aatgaggcta aaatgcttgg cgtacttctg ttagtgtttt taaattacga tgagaaagat 2880

ttgggagatg atctacattt taagaaatca gatttaggga ctgaggaaag caaagctcta 2940

aatgataact ctacaaaaaa gtcagagaaa tctgtcacta atttattgaa ggatgaagaa 3000

ttaatgctta aagtcttaga gcttttggtg acaagtgctg caaacgccac agacccaatt 3060

aaagctaccg attcgtggga catgtgtttc caattaatac gcttactcaa ggaattagac 3120

agagaaaaca acacacaatt ggttcaaaaa gcactcgaga gattcaaata a 3171

<210> 5

<211> 3524

<212> DNA

<213> TRP2(artificial)

<400> 5

tctgggactt tgatactaat atggatgtag ccgtacatcc gctatggtct tctttcatca 60

caggatcttg taacagtttc acgtctgtgt ttatgaaagt atcaatcaaa gcccttggta 120

aatttccttc atggaacgat ttctgctctt gcaggatctc cactatttta ttaccacagt 180

attctgctac tttagcgcca ccatgaccat cgaatatacc gtaaaatgca atatggtcct 240

tatcggactt tgtcaaaaca ttaggctcta gaatgtgtga atcctccatt gacatccgcc 300

acccttgcat tgcacacagt ccaaacgcgg tcaacgagtc agcaccggag tggctctctt 360

tatcaattac cgggtttgat agaatttgtc ccatttttct ttttctggtt ctctatatgt 420

tatacaacaa tggaatagtc aaaatcctag ggatgttatt aatcggaaaa ctactatctc 480

gaacgaatag ttataattaa tcaatgaaaa aaaaaagaga aagtaaaaaa tgttacaaca 540

actaatatac actaattgtc cttgataaca gaacttgttg tagttttatt ccgtggggag 600

gagggtgaat tttttttatt tagttttaaa gaacaaaaca gaagtctata tacttagcac 660

tataatatcc agtttcaatt tgctctgtca gaatccgaat tggctggttt tctttgtttt 720

accaccccct tccatttatc agcatgatat ttttttttta gaataatcct ttcaatcgtt 780

gaagtagttt gtgggaaaag aaaagttgtt aaaggcatta acgtacacag tgatttgctg 840

actcattacg atttttcact catcgaagta ttgttaaatt tcgatatatt aacatgacta 900

aagggctatg gtccgtcgta gcagaaggca atcatcactt taaaaccgag gccacaatcg 960

ataattagca ctgatattct gattggaaaa aaggcaaaaa atgaccgctt ccatcaaaat 1020

tcaaccggat attgactctc taaagcaatt acagcagcaa aatgacgata gttccataaa 1080

tatgtatccc gtgtatgcgt atttgccatc attggatctg actcctcacg tggcatatct 1140

aaaattggca caattgaaca accctgatag aaaggaatca tttctgttgg aaagtgctaa 1200

gacaaataat gaattagatc gttattcatt cataggtatc tcgccacgca agaccatcaa 1260

aaccggtcct actgaaggca ttgaaacaga tcctttggaa attttggaaa aggagatgtc 1320

cacctttaaa gtagccgaaa atgttcctgg tttaccgaag ttaagtggtg gtgctattgg 1380

ttatatttct tatgactgtg ttcgttattt cgagccaaaa acaagaaggc ctttgaaaga 1440

tgtcctaaga cttccagagg catatttaat gctttgtgat accattattg cctttgataa 1500

tgtttttcag agatttcaaa tcattcataa cattaatacc aatgaaactt cgttggagga 1560

aggttacaaa gctgcagcac aaataatcac tgatatcgta tcaaagctaa ccgacgattc 1620

ctcgccaata ccatatccag aacaacctcc tattaaattg aatcaaactt ttgaatcgaa 1680

tgtaggcaag gaaggttacg aaaatcacgt ctccactttg aagaagcata ttaagaaagg 1740

tgatattatt caaggtgtgc catcgcaaag agtggcaagg ccaacttcgt tacatccttt 1800

caatatttac agacatttac gtactgtgaa cccatctcct tacctgtttt atattgattg 1860

tttggatttc caaatcattg gtgcatctcc agaattgttg tgcaaatcgg attccaaaaa 1920

tagagtcatt acccatccaa ttgctggtac tgtcaaacgt ggggctacta ctgaagagga 1980

tgatgcttta gcggaccaat tacgtggctc gttaaaagac cgtgcagaac atgttatgct 2040

ggtagattta gcaagaaacg atattaacag aatttgtgac ccattaacaa caagtgtcga 2100

taaactgtta actattcaaa aattttctca tgtccaacat ctggtttctc aagtcagcgg 2160

tgttttccgc ccagaaaaga caagatttga tgcattcaga tcgattttcc ctgcaggtac 2220

tgtcagtggt gctccaaagg ttagagccat ggaattgatt gccgaactag aaggagaaag 2280

gcgtggggtt tatgcgggcg ccgtaggtca ttggtcatac gacggtaaaa caatggacaa 2340

ttgtatcgct ttaaggacta tggtctataa agatggtatt gcttacttgc aagctggcgg 2400

tggtattgtt tacgattcag atgagtacga tgaatatgtc gaaaccatga ataaaatgat 2460

ggccaatcac agtactattg tgcaagcaga agaattgtgg gccgatatcg taggatcggc 2520

ttaaaagggc attctctgtt tttctcccct tagacgacat ttttatagtt ttcgaataat 2580

atgatataat gatgtatagc aggattctga aaagtattat tcttccgaca tatacatttg 2640

gtccgactta caaccaaaaa tttttgttca aaaaatatag gaaagtttag aaaacgaatg 2700

ttgaatgcgt tataaataat acagaatgta cgtgtatata aaaatataat aaaaaaaatg 2760

caagagttat ggctttgtaa taaaattgat atcaaaaaat tacccaaata aacttttaaa 2820

tgtgaacaca aaaattaaat caccgatgtt gaatcccaga ataaaaaaca aaaagttcag 2880

aaaatatcat tactttgctt cctttttaaa accttaattc ttgtattgtt cacggaagta 2940

cttggcggct tcgaccatat gagtcaaaga caatctagtt tcttcccagc ctctagtctt 3000

caaaccacag tctgggttaa cccagaactt ttcagctggg tagctcttca agatggttga 3060

aatcttggcg ataaattcat cctttgatgg aattcttgga gaatgaatat cgaataaacc 3120

cagaccaatg tggtttggat agtttttgaa ttcagcaatg tagttagcat cgtccttctt 3180

agagaattcg atggaaacaa catcagcatc caaagccttg atatggtttg gatccaagtc 3240

agagtaacag aaatgagagt gtatttgagt cttgttagca acaccagaag tagcaactct 3300

gaaagcttcg gcagcccagg tgtagtaagc agatctctca gcaccttctc tcaatggtaa 3360

accttctctt aaagctggtt catcaacttg gataaccttg ataccggcag cttccaaatc 3420

attgacttca tctctcaaag ccaaagctaa ttgcatagct tgagtttttt ggtcgacatc 3480

gtctcttggg aaagaccatc tcaaacaggt aattggacca gtca 3524

<210> 6

<211> 3005

<212> DNA

<213> PHA2(artificial)

<400> 6

ctatagagtc taagaagcgg gaatttaata aaatcgaccc cctgaaagaa ctagaggatt 60

accaacaaaa aactcaaatg gaaaataaca actccaagca tttgatgacg aaatcaagaa 120

gtcctctcga tccaagtgct cctaaagttc ccttcaaaac attggactct tttttggatg 180

ttggaaaact gaaggactta tcgaaacagg aagtagagtt tctttggaga gcaagatggg 240

cacaaaaaga taatacatta tgcgctgtga ttcctgtctc cgtttatgat aagatgatgg 300

caaatgccag gaataaccct atattcgtgt tgccacttcc tagacaagtt caatctgagg 360

atgcaaaacc gaacgaagaa cagggaatgg aactacacta catccaatgg cagtttgtcg 420

gaccccaaac aacacattgt atgatgactt ccctagcaga atacaaacta caccaggaat 480

ttgcaaggcc acatactacc ttgcagttcc attctgattt ggtcaaggat aagggaattg 540

tttttatgaa tggccatgtt gaaccggata caaacgtgaa tgtacaggat gcacagctgt 600

tattgctaaa cgtgcaaagg ttttatggtg caatgggtga agaaactcca gttgctaaac 660

agagagtgca gttgttaaga gatttctcta aggcctctcc gggattcacc gtcgagaaat 720

tgatttcgct atcacagtcc atggaaaatt aacgaagaat tacttccgta tacgtatata 780

tatatatata tatatattaa tgacacctgt aaataaaata cgtactacat catctgcgac 840

aagcgtacag tttctttaca cagttatcag catgactctt gtattttcat aatgaaaaat 900

gaaaataaaa attttagtag atgaatataa tacgcagaaa gaacaggcta aaaaagtacg 960

aaaagcaact tcattatatt tccgcattca tccttcaatt atggccagca agactttgag 1020

ggttcttttt ctgggtccca aaggtacgta ttcccatcaa gctgcattac aacaatttca 1080

atcaacatct gatgttgagt acctcccagc agcctctatc ccccaatgtt ttaaccaatt 1140

ggagaacgac actagtatag attattcagt ggtaccgttg gaaaattcca ccaatggaca 1200

agtagttttt tcctatgatc tcttgcgtga taggatgatc aaaaaagccc tatccttacc 1260

tgctccagca gatactaata gaattacacc agatatagaa gttatagcgg agcaatatgt 1320

acccattacc cattgtctaa tcagcccaat ccaactacca aatggtattg catcccttgg 1380

aaattttgaa gaagtcataa tacactcaca tccgcaagta tggggccagg ttgaatgtta 1440

cttaaggtcc atggcagaaa aatttccgca ggtcaccttt ataagattgg attgttcttc 1500

cacatctgaa tcagtgaacc aatgcattcg gtcatcaacg gccgattgcg acaacattct 1560

gcatttagcc attgctagtg aaacagctgc ccaattgcat aaggcgtaca tcattgaaca 1620

ttcgataaat gataagctag gaaatacaac aagattttta gtattgaaga gaagggagaa 1680

cgcaggcgac aatgaagtag aagacactgg attactacgg gttaacctac tcacctttac 1740

tactcgtcaa gatgaccctg gttctttggt agatgttttg aacatactaa aaatccattc 1800

actcaacatg tgttctataa actctagacc attccatttg gacgaacatg atagaaactg 1860

gcgatattta tttttcattg aatattacac cgagaagaat accccaaaga ataaagaaaa 1920

attctatgaa gatatcagcg acaaaagtaa acagtggtgc ctgtggggta cattccccag 1980

aaatgagaga tattatcaca aataatatgt tatatagtct ttttatttat gtatcctaaa 2040

atctcgtcaa agcgcacttt tatatgctta aacctggcaa tgtggaactc ttgatgtttg 2100

aatcgatgcc tgggatttct tgacgcggtt tcttgttgat gaatccattc atgtttggta 2160

acgcatgtgg ttcaagtgta gctggtggtg gcggggccgc accgaattca ctcttctctc 2220

tcacagcatt gatgtcgtta ttgatgccaa aaaaccatcc atttatcttc ttattgttat 2280

aagttggatc atcatatgca ttaggatcaa ttggcctcgc tctagtccaa aatcttatgg 2340

ttctatcctt agctgctgtg gcaaatatat gtcctactgg attatatgat aacgaggtga 2400

tacacttatc atgggcgtat ggaatagtca aaataggttc gtttagattt tgtaaaagat 2460

caaaatgctt tagcgagccg tcatagcacg ccagagtgaa catagattca tttattgggt 2520

gccattctag tgtcatataa tccgtttcat ctcttacaca cattagttcc ttcatactgt 2580

atctaatgtc gaacacacga cacgatttat cttttgaaat cgccattaat agatttccct 2640

tggtgggttg aaatcgcgtc ttcaagacag tatgtttgaa cttcagaatt gatgatatgc 2700

agtttccgga acgcggatcc cacagtttta ctaaattgtc cttagatgcg gaggcaatta 2760

accccatctc gggatgccaa tcacaacttt tcacgtccca gtggtgcccc gataatactc 2820

tttcttgttt gccattgctg aagttccaaa tcttcaagat attatcatct gaacaggtaa 2880

caaatttcga gtcgttacta ctgaatgcca tatccctaat actttccgtg tgtgcagcat 2940

caatttcttt aaccatacta aagtttggtt gccatatctt aatcattcca tctgcgtccc 3000

cacta 3005

<210> 7

<211> 20

<212> DNA

<213>spacer (artificial) of ARO4 gene mutation

<400> 7

ggtgatgata agaataactt 20

<210> 8

<211> 52

<212> DNA

<213>HR-Left (artificial) of ARO4 gene mutation

<400> 8

gattatacca ttaatttcga aaagagatgg tgatgataag aataacttca gt 52

<210> 9

<211> 48

<212> DNA

<213>HR-Right (artificial) of ARO4 gene mutation

<400> 9

tctgttgcca ctagagatat agaatgtttg caaagcttga gtaggaga 48

<210> 10

<211> 20

<212> DNA

<213>Spacer (artificial) of ARO3 gene mutation

<400> 10

ttcctttctg tcacaaagcc 20

<210> 11

<211> 55

<212> DNA

<213>HR-Left (artificial) of ARO3 gene mutation

<400> 11

catcgacgct atgagagccg ctgcacatga tcattacttc ctttctgtca cacta 55

<210> 12

<211> 59

<212> DNA

<213>HR-Right (artificial) of ARO3 gene mutation

<400> 12

ccaggtgtca ctgctatcgt gggcactgaa ggtaacaagg ataccttcct gatcttgag 59

<210> 13

<211> 20

<212> DNA

<213>Spacer (artificial) of RIC1

<400> 13

ggaattctaa gcaattgggg 20

<210> 14

<211> 50

<212> DNA

<213>HR-Left (artificial) of RIC1

<400> 14

cggaagctgc aagaaactga acacgtggaa aatgcactta tggccagtca 50

<210> 15

<211> 50

<212> DNA

<213>HR-Right (artificial) of RIC1

<400> 15

caattgctta gaattccacc ccgcaacgcc gaattaggtg aaggtactaa 50

<210> 16

<211> 20

<212> DNA

<213>Spacer (artificial) of PHA2

<400> 16

gggggataga ggctgctggg 20

<210> 17

<211> 60

<212> DNA

<213>HR-Left (artificial) of PHA2

<400> 17

aggtacgtat tcccatcaag ctgcattaca acaatttcaa tcaacatctg atgttgagta 60

<210> 18

<211> 57

<212> DNA

<213>HR-Right (artificial) of PHA2

<400> 18

aatgttttaa ccaattggag aacgacacta gtatagatta ttcagtggta ccgttgg 57

<210> 19

<211> 20

<212> DNA

<213>Spacer (artificial) of TRP2

<400> 19

attggatctg actcctcacg 20

<210> 20

<211> 60

<212> DNA

<213>HR-Left (artificial) of TRP2

<400> 20

acagcagcaa aatgacgata gttccataaa tatgtatccc gtgtatgcgt atttgccatc 60

<210> 21

<211> 60

<212> DNA

<213>HR-Right:(artificial of TRP2)

<400> 21

catatctaaa attggcacaa ttgaacaacc ctgatagaaa ggaatcattt ctgttggaaa 60

<210> 22

<211> 248

<212> DNA

<213> delta1(artificial)

<400> 22

ctcgagggat ataggaatcc tcaaaatgga atctatattt ctacatacta atattacgat 60

tattcattcc gttttatatg tttatatttc attgatccta ttacattatc aatccttgcg 120

tttcagcttc cactaattta gatgactatt tctcatcatt tgcgtcatct tctaagccag 180

ccgtatatga taatatacta gtaatgtaaa tactagttag tagatgatag ttgatttcta 240

ttccaaca 248

<210> 23

<211> 165

<212> DNA

<213> delta2(artificial)

<400> 23

tggaagctga aacgtctaac ggatcttgat ttgtgtggac ttccttagaa gtaaccgaag 60

cacaggcgct accatgagaa atgggtgaat gttgagataa ttgttgggat tccattgttg 120

ataaaggcta taatattagg tatacagaat atactagaag ttctc 165

Claims

1. a kind of engineering bacteria of high yield rhodioside, it is characterised in that: it is by the ARO4 gene coding the in S. cervisiae The codon mutation of 229 amino acids is the codon for encoding leucine, the codon mutation of the 141st glycine of ARO7 gene It is the codon for encoding leucine for the codon of encoding serine, the codon mutation of the 222nd lysine of ARO3 gene Recombinant yeast.

2. engineering bacteria according to claim 1, it is characterised in that: the codon of the ARO4 gene the 229th is TTG, The codon of the ARO7 gene the 141st is AGT；222nd codon is CTA.

3. engineering bacteria according to claim 1, it is characterised in that: in the recombinant yeast, gene RIC1, gene pHA2 And/or TRP2 inactivation；Preferably, gene RIC1, gene pHA2 and/or TRP2 are sported respectively shown in NO:4~6 SEQ ID Sequence.

4. engineering bacteria according to claim 1 or 2, it is characterised in that: comprising carrying UGP1 in the recombinant yeast, The rigorous type plasmid pRS413 plasmid of PGM and/or RrU8GT33；Preferably, also comprising carrying in the recombinant yeast The integrated pRS425 plasmid of ARO10, ARO2 and/or ARO1.

5. application of the engineering bacteria described in Claims 1 to 4 any one in production rhodioside.

6. a kind of method for preparing rhodioside, it is characterised in that: it is using work described in Claims 1 to 4 any one The fermentation preparation of journey bacterium.

7. according to the method described in claim 6, it is characterized by: it includes the following steps:

(1) engineering bacteria described in 4 any one of Claims 1 to 4 is taken, cultivates, obtains saccharomyces cerevisiae seed liquor；

(3) it isolates and purifies.

8. according to the method described in claim 7, it is characterized by: the technique of step (1) are as follows: take engineering bacteria, be inoculated into SC liquid In body culture medium, 28~32 DEG C, 100~300rpm, 12~36h of shaking table culture, preferably 30 DEG C, 200rpm shaking table culture for 24 hours.

9. according to the method described in claim 7, it is characterized by: in step (2), the condition of fermentation are as follows: by saccharomyces cerevisiae kind After sub- liquid is inoculated into fermentation medium, OD600 is 0.1~0.3, preferably 0.2；The temperature of fermentation is 28~32 DEG C, there is choosing It is 30 DEG C, 100~300rpm of agitation speed, preferably 200rpm；Control control pH is 5.3~5.8, preferably 5.5；Air stream Speed is 2~6L/min, preferably 4L/min；Fermentation time is 120~170h, and preferably fermentation time is 144h；

And/or in step (2), the fermentation medium is SC culture medium, and it is molten that glucose is continuously added during fermentation Liquid, keep fermentation medium in concentration of glucose be 10-20g/L and/or, in step (3), the isolation and purification method be column layer Analysis method.

10. according to the method for claim 9 it is characterized by: the column chromatography method are as follows: by fermentation liquid HP20 macropore Adsorb resin adsorption, after with clear water wash resin, then successively obtain the sterling of rhodioside with 40% ethyl alcohol, 70% ethanol elution； Preferably, loading volume: column volume 3:1；With the water washing resin of 3 times of column volumes, rear 20 times of column volumes after the completion of absorption 40% ethyl alcohol, then 70% ethanol elution of 40 times of column volumes.