WO2020259569A1

WO2020259569A1 - An engineered microbial strain for hydroxytyrosol production

Info

Publication number: WO2020259569A1
Application number: PCT/CN2020/098056
Authority: WO
Inventors: Hua Zhao; Ting Zhang; Tianqing SONG; Faxian JIANG
Original assignee: Maple Bio (Nanjing) Co., Ltd.
Priority date: 2019-06-25
Filing date: 2020-06-24
Publication date: 2020-12-30

Abstract

Provided is an approach using an engineered strain for producing hydroxytyrosol. The engineered strain simultaneously expresses a hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol, and an enzyme that catalyzes the reduction of NAD ⁺ into NADH, thereby establishing a microbial system for the efficient production of hydroxytyrosol. Using the engineered strain, hydroxytyrosol can be produced as the only product from tyrosol in significantly higher titer and yield, through a simple procedure that involves easier purification.

Description

An Engineered microbial strain for hydroxytyrosol production

Filed of the invention

The present invention relates to industrial biotechnology; in particular, it relates to an engineered strain for producing hydroxytyrosol.

Background of the invention

Hydroxytyrosol (HT) , also called 3, 4-dihydroxyphenylethanol. Molecular formula: C ₈H ₁₀O ₃, molecular mass: 154.1632.

Hydroxytyrosol is a natural, lipid-soluble, water-soluble, and biologically active polyphenolic compound. Oleuropein, the ester form of hydroxytyrosol, exists in various parts of olive trees. Free hydroxytyrosol can be obtained by hydrolyzing oleuropein. Research has shown that hydroxytyrosol is the most powerful natural antioxidant discovered to date and provides great benefits to human health, as exemplified by its protective effects against cancer, atherosclerosis, inflammation, oxidative DNA damage, and photodamage to the skin. Recently, these benefits have attracted great attention from biologists and medical researchers. To date, hydroxytyrosol-containing capsules, tablets and powder-based products have been developed.

Currently, hydroxytyrosol is mainly obtained by plant extraction and chemical synthesis. Chemical synthesis of hydroxytyrosol suffers from several drawbacks, including low yields, requirement for expensive catalysts, and use of highly toxic reagents. Therefore, chemical synthesis of hydroxytyrosol is not a good option for industrial application. Meanwhile, hydroxytyrosol used as food additives and dietary supplements is mainly obtained via plant extraction. For example, one Chinese patent application CN20161083391.5 disclosed a method of extracting hydroxytyrosol from olive leaves. In another patent application CN201710195462, a method for extracting hydroxytyrosol from olive leaves was revealed. However, plant extraction is typically expensive and limited by the availability of raw plant materials. Due to the current industrial emphasis for sustainable manufacturing and market preference for natural ingredients, bioconversion has gained increasing attention as an alternative strategy for producing hydroxytyrosol.

Microbial production of hydroxytyrosol has been employed in some reports. The patent application CN201510242626.8 disclosed the synthesis of hydroxytyrosol in Escherichia coli with glucose as substrate by overexpressing Escherichia coli-derived monooxygenase HpaBC. However, due to the toxicity of hydroxytyrosol to HpaBC enzyme, the final titer of hydroxytyrosol was only 349.05 mg/L with a yield of only 0.017 mol/mol.

In 2012, Satoh Y et al. proposed an approach for hydroxytyrosol biosynthesis using tyrosine as substrate through a catalytic cascade comprising tyrosine hydroxylase, L-dopa decarboxylase and tyramine oxygenase (Engineering of L-tyrosine oxidation in Escherichia coli and microbial production of hydroxytyrosol [J] . Metabolic engineering, 2012, 14 (6) ) . In their method, the use of 1 mM tyrosine (0.18 g/L) yielded only 0.19 mM hydroxytyrosol, and 1 mM L-DOPA (0.19 g/L) gave rise to only 0.74 mM (0.11 g/L) hydroxytyrosol in 74%yield. Furthermore, in their publication, the key genes involved in the heterologous production of hydroxytyrosol were mainly derived from mouse and human, and were incompatible with the expression machinery of the Escherichia coli host, resulting in poor substrate utilization and difficulty with industrial-scale production.

One Chinese patent application CN107586794A disclosed a method using Escherichia coli to heterologously produce tyrosol or hydroxytyrosol. In this method, aminotransferase, ketoacid decarboxylase and alcohol dehydrogenase were expressed heterologously together in the host strain for tyrosol production, followed by the generation of hydroxytyrosol under the catalysis of 4-hydroxyphenylacetic acid hydroxylase. The method produced 1243±165 mg/L (8 mM) hydroxytyrosol from 6 g/L (33 mM) tyrosine, corresponding to a yield of 0.24 mol/mol. The disadvantages of the method include the need to add large amounts of costly pyridoxal phosphate (PLP) and NADH, and the low yields of hydroxytyrosol due to tyrosol accumulation.

Because the above methods all have their own disadvantages, it is particularly necessary to develop an engineered microbial strain suitable for industrial-scale production of hydroxytyrosol.

Summary of the invention

This invention provides an engineered strain for producing hydroxytyrosol. The engineered strain can produce hydroxytyrosol in high titer and yield, and therefore shows a good prospect of industrial application.

To achieve the abovementioned objectives, the following technical solutions are used:

The present invention provides an engineered, hydroxytyrosol-producing strain. The engineered strain expresses a hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol and an enzyme that recycles NADH.

In some embodiments of the present invention, said hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol is a tyrosinase or 4-hydroxyphenylacetate 3-monooxygenase (HpaBC) .

In some embodiments of the present invention, said hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol is a tyrosinase.

In some embodiments of the present invention, said tyrosinase is isolated from Stenotrophomonas maltophilia (smtyrosinase) , Bacillus megaterium (bmtyrosinase) , Bacillus thuringiensis (bttyrosinase) , Bacillus endophyticus (betyrosinase) , Diplocarpon rosae (drtyrosinase) and /or Ralstonia solanacearum (rstyrosinase) .

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said betyrosinase is WP_063592733.1.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said drtyrosinase is PBP28426.1.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said smtyrosinase is AAC16658.1. The nucleotide sequence encoding smtyrosinase is as shown in SEQ ID NO: 5.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said bmtyrosinase is ACC86108.1. The nucleotide sequence encoding bmtyrosinase is as shown in SEQ ID NO: 4.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said bttyrosinase is AAR88107.1. The nucleotide sequence encoding bttyrosinase is as shown in SEQ ID NO: 6.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said rstyrosinase is AFR68815.1. The nucleotide sequence encoding rstyrosinase is as shown in SEQ ID NO: 7.

In some embodiments of the present invention, the hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol is HpaBC.

In some embodiments of the present invention, said HpaBC is from Escherichia coli BL21 (DE3) (ecHpaBC) or Pseudomonas aeruginosa BAR65782 (paHpaBC) .

In some embodiments of the present invention, the NCBI accession number of the nucleotide sequence of said ecHpaBC is NC_012892 REGION: 4498782... 4500874. The nucleotide sequence of paHpaBC is as shown in SEQ ID NO: 3.

In some embodiments of the present invention, the hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol is from a microorganism, such as a bacterium or fungus.

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is a formate dehydrogenase (FDH) , an alcohol dehydrogenase (ADH) , a glucose dehydrogenase (GDH) , or a phosphite dehydrogenase (PDH) .

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is an FDH or an ADH.

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is an FDH.

In some embodiments of the present invention, said FDH is from Candida boidinii (CbFDH) , Saccharomyces cerevisiae (ScFDH) , or Mycobacterium intracellulare (MiFDH) .

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said CbFDH is AF004096. The nucleotide sequence encoding CbFDH is as shown in SEQ ID NO: 9.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said ScFDH is NM_001183808.1. The nucleotide sequence encoding ScFDH is as shown in SEQ ID NO: 8.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said MiFDH is WP_009957650. The nucleotide sequence encoding MiFDH is as shown in SEQ ID NO: 10.

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is an ADH.

In some embodiments of the present invention, said ADH is from Lactobacillus brevis (LbADH) .

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said LbADH is WP_107696682. The nucleotide sequence encoding LbADH is as shown in SEQ ID NO: 11.

The present invention in another aspect provides an engineered strain for producing hydroxytyrosol. Said engineered strain is constructed by transforming pETDuet-1 into Escherichia coli BL21 (DE3) . Said pETDuet-1 carries a nucleotide sequence encoding a hydroxylase that catalyzes the conversion of tyrosol to hydroxytyrosol, and a nucleotide sequence encoding an enzyme that catalyzes the reduction of NAD ⁺ to NADH.

In some embodiments of the present invention, the genes involved in the decomposition of phenolic compounds are deleted from said Escherichia coli.

In some embodiments of the present invention, the genes involved in the decomposition of phenolic compounds are hpaD and/or hpaE.

In some embodiments of the present invention, the genes involved in the decomposition of phenolic compounds are hpaD and hpaE.

In some embodiments of the present invention, the NCBI accession number of the amino acid sequence of said HpaD is ACT46009.1. The NCBI accession number of the amino acid sequence of said HpaE is ACT46010.1.

In some embodiments of the present invention, said tyrosinase is from Stenotrophomonas maltophilia (smtyrosinase) , Bacillus megaterium (bmtyrosinase) , Bacillus thuringiensis (bttyrosinase) , Bacillus endophyticus (betyrosinase) , Diplocarpon rosae (drtyrosinase) or Ralstonia solanacearum (rstyrosinase) .

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is an FDH, an ADH, a GDH or a PDH.

In some embodiments of the present invention, said enzyme that catalyzes the reduction of NAD ⁺ into NADH is an FDH, or an ADH.

In some embodiments of the present invention, said FDH is from Candida boidinii (CbFDH) , Saccharomyces cerevisiae (ScFDH) or Mycobacterium intracellulare (MiFDH) .

The term “OD ₆₀₀” refers to the optical density of a cell culture or a solution at the wavelength of 600 nm.

The term “titer” refers to the concentration of a product in a solution.

The term “yield” refers to the ratio of the actual versus the theoretical amount of a product.

The term “pETDuet-1” refer to any pETDuet-derived plasmid containing DNA insert (s) . In some embodiments of the present invention, said pETDuet-1 is pETDuet-echpaBC-CbFDH, pETDuet-echpaBC-ScFDH, pETDuet-echpaBC-MiFDH, pETDuet-echpaBC-LbADH, pETDuet-rstyrosinase, pETDuet-bmtyrosinase, pETDuet-smtyrosinase, pETDuet-bttyrosinase, pETDuet-ecHpaBC, or pETDuet-paHpaBC.

Benefits of the invention

The present invention provides a recombinant microbial strain capable of producing hydroxytyrosol in high yield via biotransformation. The engineered strain simultaneously expresses a hydroxylase that catalyzes the conversion of tyrosol into hydroxytyrosol and an enzyme that recycles NADH. Furthermore, the genes involved in the decomposition of phenolic compounds have been deleted from the Escherichia coli host strain. Thus, the said recombinant microbial strain enables the efficient production of hydroxytyrosol as a single product from tyrosol in high titer and yield, which greatly facilitates its subsequent purification. Because of these beneficial features, the present invention shows a good prospect of industrial application.

Examples of the invention

1. Plasmids and strains

Plasmid pETDuet was purchased from Novagen. Escherichia coli BL21 (DE3) was used for protein overexpression. Escherichia coli DH5α was used for plasmid maintenance.

2. Enzymes

1) Tyrosol hydroxylase

Tyrosol hydroxylases and 4-hydroxypheylacetate 3 hydroxylases (HpaBC) described in the present invention were chosen from various source organisms. The selected tyrosol hydroxylases are from Stenotrophomonas maltophilia (smtyrosinase) , Bacillus megaterium (bmtyrosinase) , Bacillus thuringiensis (bttyrosinase) , Bacillus endophyticus (betyrosinase) , Diplocarpon rosae (drtyrosinase) and Ralstonia solanacearum (rstyrosinase) . The selected HpaBCs are from Escherichia coli BL21 (DE3) (ecHpaBC) and Pseudomonas aeruginosa BAR65782 (paHpaBC) .

2) NAD ⁺-reducing enzymes

The catalytic conversion of tyrosol to hydroxytyrosol by tyrosol hydroxylase is NADH-dependent. Therefore, overexpressing enzymes that play important roles in the biosynthesis of NADH in Escherichia coli would be beneficial to hydroxytyrosol biosynthesis. In the present invention, four enzymes capable of catalyzing the reduction of NAD ⁺ to NADH were selected, including two formate dehydrogenases (FDH) and two alcohol dehydrogenases (ADH) .

3. Construction of the recombinant Escherichia coli strain

A tyrosol hydroxylase and an NAD ⁺-reducing enzyme were selected from the abovementioned sources. The gene encoding said tyrosol hydroxylase and the gene encoding said NAD ⁺-reducing enzyme were co-expressed in pETDuet-1. The resultant plasmid, which carries the gene of said tyrosol hydroxylase and the gene of said NAD ⁺-reducing enzyme, was transformed into chemically component Escherichia coli BL21 (DE3) cells. Transformants were selected on LB agar plates supplemented with 100 μg/L ampicillin.

The recombinant Escherichia coli was inoculated into TB medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) and grown to an OD ₆₀₀ of 0.6 -0.8, followed by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) . After induced expression, the cells were harvested by centrifugation.

4. Biotransformation of tyrosol into hydroxytyrosol

The recombinant Escherichia coli cells were resuspended in a 50 mM phosphate buffer to an OD ₆₀₀ of 10 -600. Then, tyrosol was added to the Escherichia coli suspension to a final concentration of 0.5-50 g/L. The pH of the suspension was adjusted to 4.0-8.0. Then, the biotransformation reaction was incubated at 15 -40 ℃ for 0.5 -60 h. After the reaction, the resultant mixture was centrifuged at 4 ℃, 8000 rpm for 20 min, and the supernatant was obtained for subsequent analysis by high-performance liquid chromatography (HPLC) to determine the titer and yield of hydroxytyrosol.

5. Sample analysis

For sample analysis, each sample was loaded onto an Agilent C18 column (Agilent Polaris C18-A4.6×100 mm, 3.5 μm) coupled to an Agilent 1260 HPLC system using a mobile phase of 0.1%formic acid in pure methanol. Elution was performed at a flow rate of 0.8 mL/min in an isocratic mobile phase of 0.1%formic acid in methanol. The column temperature was maintained at 35 ℃. The detection wavelength was set to 280 nm. The sample volume was 5 μL.

All reagents and materials mentioned in the examples of the present invention, unless otherwise indicated, are purchased from commercial vendors.

Below, the present invention will be described in detail with reference to the examples. It should be noted that the specific examples described herein are only used to explain the present invention, and are not intended to limit the present invention.

Example 1: Plasmid construction

1) Primers

The PCR primer sequences were as follows.

Table 1: PCR primers

Primer name	Prime sequence (5’ to 3’)	SEQ ID NO
ecHpaBC-F	Gatgaaaccagaagatttccgcg	SEQ ID NO: 1
ecHpaBC-R	ttaaatcgcagcttccatttccagcacta	SEQ ID NO: 2

2) PCR amplification

Genomic DNA was extracted from Escherichia coli cells using a Genomic DNA Purification Kit based on the manufacturer’s instructions. The isolated genomic DNA was used as template for PCR amplification with the primers listed in Table 1. A typical PCR reaction consisted of 0.5 μL of Prime STARHS DNA Polymerase (2.5 U/μL) , 10 μL of 10×Prime STAR Buffer, 4 μL of dNTP Mixture (2.5 mM each) , 1 μL of template DNA, 1 μL of forward primer (20 μM) , 1 μL of reverse primer (20 μM) and 32.5 μL of ddH ₂O. The PCR cycle was as follows: 98 ℃ for 15 s, then 30 cycles of 98 ℃ for 10 s, 55 ℃ for 30 s and 72 ℃ for 2 min, followed by 72 ℃ for 10 min. The resultant PCR product was verified by DNA sequencing.

Four tyrosinases and two HpaBCs were selected. Among them, the DNA sequence encoding the native HpaBC from Escherichia coli was amplified directly from the isolated Escherichia coli genomic DNA. The DNA sequences encoding the remaining five enzymes were first codon-optimized by using JCAT (http//www. jcat. de) and OPTIMIZER ( http: //genomes. urv. es/OPTIMIZER/) based on the codon preference of Escherichia coli, and then synthesized. The SEQ ID No. of the optimized gene sequences were listed in Table 2.

Table 2: SEQ ID No. of the optimized gene sequences of paHpaBC and tyrosinases.

Gene name	SEQ ID NO
paHpaBC	SEQ ID NO: 3
bmtyrosinase	SEQ ID NO: 4
smtyrosinase	SEQ ID NO: 5
bttyrosinase	SEQ ID NO: 6
rstyrosinase	SEQ ID NO: 7

The genes encoding the selected FDHs and ADHs for NADH recycling were codon-optimized using JCAT and OPTIMIZER based on the codon preference of Escherichia coli. The SEQ ID No. of the optimized gene sequences were summarized in Table 3.

Table 3: SEQ ID No. of the optimized gene sequences of FDHs and ADHs.

Name	SEQ ID NO
ScFDH	SEQ ID NO: 8
CbFDH	SEQ ID NO: 9
MiFDH	SEQ ID NO: 10
LbADH	SEQ ID NO: 11

3) Construction of pETDuet-1

pETDuet and the PCR products of the selected hpaBC and tyrosinase genes were separately digested at 37 ℃ for 1 h. A typical digestion reaction consisted of 5 μL of 10× digestion buffer, 10 μL of DNA, 1 μL of restriction endonuclease SacI, 1 μL of restricton endonuclease SalI, and 33 μL of ddH ₂O. The digested DNA from each reaction was then purified. The ligation reaction was performed at 16 ℃ overnight. A typical ligation reaction consisted of 2.5 μL of 10× DNA ligase buffer, 8 μL of DNA fragment, 2 μL of vector DNA, 1 μL of T4 DNA ligase, and 11.5 μL of ddH ₂O. The resultant plasmid constructs were designated as pETDuet-rstyrosinase, pETDuet-bmtyrosinase, pETDuet-smtyrosinase, pETDuet-bttyrosinase, pETDuet-ecHpaBC, and pETDuet-paHpaBC.

Example 2: Screening of tyrosol hydroxylases

The recombinant plasmids generated in Example 1 were separately transformed into Escherichia coli BL21 (DE3) . Specifically, the recombinant Escherichia coli cells were inoculated into a TB medium and grown in an orbital shaker at 37 ℃, 200 rpm to an OD ₆₀₀ of 0.6-0.8. Then, IPTG was added to the cell culture to a final concentration of 0.2 mM, followed by induction at 18 ℃ for 12 h. The cells are then harvested by centrifugation at 20 ℃ and 8000 rpm for 20 min. Subsequently, biotransformation reactions were performed in 50 mM phosphate buffer at pH 6.5 containing 10 mM tyrosol, 10 mM formate, and various amounts of recombinant cells. The biotransformation efficiencies of the recombinant strains were indicated in Table 4.

Table 4: Comparison of the catalytic effects of different tyrosol hydroxylases

Recombinant strain	Hydroxytyrosol (g/L)
pETDuet-rstyrosinase	0.01
pETDuet-bmtyrosinase	0.04
pETDuet-smtyrosinase	0.01
pETDuet-bttyrosinase	0.01
pETDuet-paHpaBC	0.01
pETDuet-ecHpaBC	1.58

As indicated in Table 4, the recombinant Escherichia coli cells transformed with pETDuet-ecHpaBC demonstrated the best efficiency in catalyzing the conversion of tyrosol into hydroxytyrosol.

Example 3: Gene deletion

Two native Escherichia coli genes, hpaD and hpaE, were deleted from the Escherichia coli BL21 (DE3) host strain using the primers shown in Table 5, based on a method described in the following publication: Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. J Appl Environ Microbiol, 2016, 82 (12) : 3693. Two plasmids, pCasRed and pCRISPR-gDNA containing the guide RNA that targeted hpaED, were used for gene deletion and were transformed together with the homologous arm (hpaED donor) into Escherichia coli BL21 (DE3) . The introduced Cas9/sgRNA induced double-strand breaks in hpaED of the host strain. The Red recombinase then integrated hpaED donor at the hpaED locus, resulting in the deletion of hpaD and hpaE. The deletion of hpaD and hpaE was verified by DNA sequencing.

Table 5: PCR primers for the deletion of hpaD and hpaE

For biotranformation, the recombinant Escherichia coli cells were resuspended to an OD ₆₀₀ of 20 into a 50 mM phosphate buffer at pH 6.5 containing 30 mM tyrosol and 30 mM formate. The reaction was then incubated at 30 ℃ for 48 h. After the reaction, the resultant mixture was centrifuged at 4 ℃, 8000 rpm for 20 min, and the supernatant was obtained for subsequent HPLC analysis. Hydroxytyrosol yields from the fermentation of the recombinant Escherichia coli strains with or without hpaED were summarized in Table 6.

Table 6: Yield of hydroxytyrosol

As indicated in Table 6, deleting hpaE and hpaD from the Escherichia coli host strain increased the titer and yield of hydroxytyrosol by 43.7%and 55.2%, respectively.

In addition, it can be seen from Table 6 that, with an initial tyrosol concentration of 30 mM, the tyrosol substrate was not fully consumed at the end of the reaction, suggesting a depletion of intracellular NADH. Without sufficient intracellular NADH, it is difficult to sustain the biotransformation of tyrosol to hydroxytyrosol. Therefore, a continuous intracellular supply of NADH is essential for achieving a higher product titer and yield. This can be done by introducing an enzyme for recycling NADH.

Example 4: Selection of an NAD ⁺-reducing enzyme for effective hydroxytyrosol production

The pETDuet-ecHpaBC plasmid and the PCR products of genes encoding MiFDH, CbFDH, ScFDH and LbADH described in step (2) of Example 1 were double-digested at 37 ℃ for 1 h. A typical double digestion reaction consisted of 5 μL of 10× digestion buffer, 10 μL of DNA, 1 μL of restriction endonuclease NdeI, 1 μL of restriction endonuclease XhoI, and 33 μL of ddH ₂O. For each double digestion reaction, the digested DNA was electrophoresized and purified from the agarose gel. The double-digested gene encoding MiFDH, CbFDH, ScFDH or LbADH was ligated with linearized pETDuet-ecHpaBC at 16 ℃ overnight. A typical ligation reaction consisted of 2.5 μL of 10× DNA ligase buffer, 8 μL of DNA insert, 2 μL of vector DNA, 1 μL of T4DNA ligase and 11.5 μL of ddH ₂O.

The ligation reaction was mixed with chemically competent Escherichia coli DH5α cells and incubated on ice for 30 min. Cells were transformed by heat shock at 42 ℃ for 90 s, followed by immediate ice incubation for 2-min. Subsequently, 1 mL of LB medium was added to the transformation mixture and the resultant culture was incubated at 37 ℃ for 1 h. After the incubation, the cells were spread on LB plates supplemented with 100 μg/mL ampicillin. Plasmids were extracted from single colonies isolated from the LB plates. The plasmid constructs were subsequently verified initially by restriction digestion and then by DNA sequencing. The confirmed constructs were designated as pETDuetecHpaBC-MiFDH, pETDuet-ecHpaBC-CbFDH, pETDuet-ecHpaBC-ScFDH, and pETDuet-ecHpaBC-LbADH.

Said recombinant plasmids were expressed in the Escherichia coli BL21 (DE3) strain from which hapE and hapD had been deleted. The recombinant Escherichia coli cells were inoculated into a TB medium and grown to an OD ₆₀₀ of 0.6 -0.8, IPTG is then added to the culture to a final concentration of 0.2 mM, followed by induction at 30 ℃ for 8 h. After the induction, the cells were harvested by centrifugation at 30 ℃ and 8000 rpm for 20 min. For biotransformation, the cell pellet was resuspended into a 50 mM phosphate buffer at pH 6.5, supplemented with 120 mM (16.5 g/L) tyrosol and 120 mM (7.56 g/L) ammonium formate. Substrate consumption and product formation during the biotransformation reaction were monitored by HPLC. The catalytic efficiencies of different recombinant Escherichia coli strains were evaluated and summarized in Table 7.

Table 7: Tyrosol consumption and hydroxytyrosol formation in the biotransformation reactions using different recombinant Escherichia coli strains with hpaE and hpaD deletion

It can be seen from the Table 7 that the heterologous expression of an NADH-recycling enzyme significantly increased both the titer and yield of hydroxytyrosol. Particularly, we observed that the heterologous expression of ScFDH or MiFDH led to increased tyrosol consumption and hydroxytyrosol yield. The recombinant Escherichia coli strain that heterologously expressed MiFDH produced hydroxytyrosol with a titer of 15.1 g/L and yield of 0.99 mol/mol, which are much higher than those of previously reported methods.

Claims

An engineered strain for producing hydroxytyrosol, wherein the engineered strain expresses a hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol and an enzyme that catalyzes the reduction of NAD ⁺ into NADH.
The engineered strain of claim 1, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a tyrosinase or 4-hydroxyphenylacetate 3-monooxygenase.
The engineered strain of claim 2, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a tyrosinase.
The engineered strain of claim 3, wherein said tyrosinase is from Stenotrophomonas maltophilia, Bacillus megaterium, Bacillus thuringiensis, Bacillus endophyticus, Diplocarpon rosae or Ralstonia solanacearum.
The engineered strain of claim 2, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a 4-hydroxyphenylacetate 3-monooxygenase.
The engineered strain of claim 5, wherein said 4-hydroxyphenylacetate 3-monooxygenase is from Escherichia coli or Pseudomonas aeruginosa.
The engineered strain of claim 6, wherein said 4-hydroxyphenylacetate 3-monooxygenase is from Escherichia coli.
The engineered strain of claim 1, wherein said enzyme that catalyzes the reduction of NAD ⁺ into NADH is a formate dehydrogenase, an alcohol dehydrogenase, a glucose dehydrogenase or a phosphite dehydrogenase.
The engineered strain of claim 8, wherein said enzyme that catalyzes the reduction of NAD ⁺ into NADH is a formate dehydrogenase or an alcohol dehydrogenase.
The engineered strain of claim 9, wherein said enzyme that catalyzes the reduction of NAD ⁺ into NADH is a formate dehydrogenase.
The engineered strain of claim 10, wherein said formate dehydrogenase is from Candida boidinii, Saccharomyces cerevisiae or Mycobacterium intracellulare.
The engineered strain of claim 11, wherein said formate dehydrogenase is from Mycobacterium intracellulare.
The engineered strain of claim 12, wherein the nucleotide sequence encoding the formate dehydrogenase from Mycobacterium intracellulare is as shown in SEQ ID NO: 10.
The engineered strain of claim 9, wherein the alcohol dehydrogenase is from Lactobacillus brevis.
The engineered strain of claim 14, wherein the nucleotide sequence encoding the alcohol dehydrogenase from Lactobacillus brevis is as shown in SEQ ID NO: 11.
An engineered strain for producing hydroxytyrosol, wherein said engineered strain is constructed by transforming pETDuet-1 into Escherichia coli BL21 (DE3) ; said pETDuet-1 carries a nucleotide sequence encoding a hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol, and a nucleotide sequence encoding an enzyme that catalyzes the reduction of NAD ⁺ to NADH.
The engineered strain of claim 16, wherein the genes involved in the decomposition of phenolic compounds are deleted in said Escherichia coli BL21 (DE3) .
The engineered strain of claim 17, wherein said genes involved in the decomposition of phenolic compounds are hpaD and/or hpaE.
The engineered strain of claim 18, wherein said genes involved in the decomposition of phenolic compounds are hpaD and hpaE.
Any engineered strain of claims 16 to 19, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a tyrosinase or 4-hydroxyphenylacetate 3-monooxygenase.
The engineered strain of claim 20, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a tyrosinase.
The engineered strain of claim 21, wherein said tyrosinase is from Stenotrophomonas maltophilia, Bacillus megaterium, Bacillus thuringiensis, Bacillus endophyticus, Diplocarpon rosae or Ralstonia solanacearum.
The engineered strain of claim 20, wherein said hydroxylase that catalyzes the conversion of tyrosol into hydrotyrosol is a 4-hydroxyphenylacetate 3-monooxygenase.
The engineered strain of claim 23, wherein said 4-hydroxyphenylacetate 3-monooxygenase is from Escherichia coli or Pseudomonas aeruginosa.
The engineered strain of claim 24, wherein said 4-hydroxyphenylacetate 3-monooxygenase is from Escherichia coli.
The engineered strain of claim 20, wherein said enzyme that catalyzes the reduction of NAD ⁺ to NADH is a formate dehydrogenase, an alcohol dehydrogenase, a glucose dehydrogenase or a phosphite dehydrogenase.
The engineered strain of claim 26, wherein said enzyme that catalyzes the reduction of NAD ⁺ to NADH is a formate dehydrogenase or an alcohol dehydrogenase.
The engineered strain of claim 27, wherein said enzyme that catalyzes the reduction of NAD ⁺ to NADH is a formate dehydrogenase.
The engineered strain of claim 28, wherein said formate dehydrogenase is from Candida boidinii, Saccharomyces cerevisiae or Mycobacterium intracellulare.
The engineered strain of claim 29, wherein said formate dehydrogenase is from Mycobacterium intracellulare.
The engineered strain of claim 30, wherein the nucleotide sequence encoding the formate dehydrogenase from Mycobacterium intracellulare is as shown in SEQ ID NO: 10.
The engineered strain of claim 27, wherein said alcohol dehydrogenase is from Lactobacillus brevis.
The engineered strain of claim 32, wherein the nucleotide sequence encoding the alcohol dehydrogenase from Lactobacillus brevis is as shown in SEQ ID NO: 11.