CN111849794B

CN111849794B - Saccharomyces cerevisiae recombinant strain and construction method and application thereof

Info

Publication number: CN111849794B
Application number: CN202010606941.5A
Authority: CN
Inventors: 周萍萍; 岳春磊; 杜艺
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2020-06-29
Filing date: 2020-06-29
Publication date: 2022-05-31
Anticipated expiration: 2040-06-29
Also published as: CN111849794A

Abstract

The invention discloses a recombinant strain of saccharomyces cerevisiae, which integrates the recombinant strain of saccharomyces cerevisiae into a genomeRgTALGene, gene,HpaBGenes andHpaCa gene. The invention also discloses a construction method and application of the saccharomyces cerevisiae recombinant bacteria. The invention finally discloses a production method of the caffeic acid. According to the invention, three exogenous genes required for caffeic acid synthesis are integrated into a saccharomyces cerevisiae chromosome, and through gene knockout in a competitive way, elimination of a feedback inhibition step and overexpression of a rate-limiting enzyme, the total synthesis from glucose to caffeic acid is realized, the shake flask yield reaches about 760 mg/L, and the method is the highest level of yeast yield in the current report, and provides a new method for industrial production of caffeic acid.

Description

Saccharomyces cerevisiae recombinant strain and construction method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a saccharomyces cerevisiae recombinant strain and a construction method and application thereof.

Background

Caffeic acid (Caffeic acid) is a secondary metabolite widely distributed in plants, not only has biological activities of resisting bacteria and diseases, but also is an important raw material and intermediate of medicines. The main sources of caffeic acid are currently chemical synthesis and plant extraction. The chemical synthesis of caffeic acid has the problems of multiple synthesis steps, complex process, environment-friendliness and the like, and the plant extraction yield is low and the price is high, so that the production of caffeic acid by utilizing microbial fermentation becomes an important option with the development of synthetic biological technology.

In the prior patent (CN 108949652A), the fermentation of glucose to produce caffeic acid is realized by constructing escherichia coli genetic engineering bacteria, L-lactate dehydrogenase is expressed in the escherichia coli genetic engineering bacteria, so that L-lactate is dehydrogenated to generate pyruvic acid and NADH by taking NAD in bacteria as coenzyme, exogenously expressed tyrosine phenol lyase further catalyzes pyruvic acid, ammonia ions and catechol to generate levodopa, and levodopa is catalyzed by introduced tyrosine ammonia lyase to generate caffeic acid. In addition, Escherichia coli belongs to non-food safety strains, can produce endotoxin, and is not favorable for production of caffeic acid. And the saccharomyces cerevisiae is used as a biological safe strain, has clear genetic background and mature high-density fermentation technology, and is an ideal chassis cell synthesized by natural products. At present, few documents have achieved caffeic acid production by Engineering Saccharomyces cerevisiae (ACS Synthetic Biology 2020, 9: 756-765; Engineering 2019, 5: 287-295), but the yields are relatively low, only up to 289.4mg/L, and rely on the addition of the precursor L-tyrosine. Insufficient supply of precursors and low catalytic efficiency of exogenous pathway enzymes are major reasons limiting caffeic acid synthesis.

Disclosure of Invention

The purpose of the invention is as follows: in order to realize the construction of the Engineering strain for producing caffeic acid, the starting strain related BY the invention is YXWP-113 (from professor Huisei, Huisei university at Zhejiang, the strain is constructed BY knocking out GAL80 gene of wild type Saccharomyces cerevisiae BY4741, Metabolic Engineering, 2015, 30: 69-78), and the technical problem to be solved BY the invention is to provide the recombinant strain of the Saccharomyces cerevisiae for producing caffeic acid at low cost.

The invention also aims to solve the technical problem of providing a construction method of the saccharomyces cerevisiae recombinant bacteria.

The technical problem to be solved by the invention is to provide the application of the saccharomyces cerevisiae recombinant strain.

The invention finally solves the technical problem of providing a production method of caffeic acid.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows: a recombinant strain of saccharomyces cerevisiae integrates RgTAL gene, HpaB gene and HpaC gene in genome.

Wherein, the base sequence of the RgTAL gene is shown as SEQ ID NO: 1, and the base sequence of the HpaB gene is shown as SEQ ID NO: 2, the base sequence of the HpaC gene is shown as SEQ ID NO: 3, respectively.

Wherein, the amino acid sequence corresponding to the RgTAL gene is shown as SEQ ID NO: 5, and the corresponding amino acid sequence of the HpaB gene is shown as SEQ ID NO: 6, and the corresponding amino acid sequence of the HpaC gene is shown as SEQ ID NO: shown at 7.

Wherein, in order to improve the caffeic acid yield of the saccharomyces cerevisiae recombinant strain, the saccharomyces cerevisiae recombinant strain also comprises one or two combinations of genes of Aro3 and Aro10 knocked out on a saccharomyces cerevisiae chromosome; and/or overexpresses mutant Aro4 that is not subject to feedback inhibition by tyrosine^K229LAnd Aro7^G141SOne or two combinations of genes; and/or overexpresses Zymomonas mobilis-derived prephenate dehydrogenase TyrC.

The key points are that the caffeic acid pathway in the saccharomyces cerevisiae is optimized, and the synthesis capacity of the caffeic acid of the saccharomyces cerevisiae is enhanced.

Wherein, the gene sequence for coding the prephenate dehydrogenase TyrC is shown in SEQ ID NO: 4, and the corresponding amino acid sequence is shown as SEQ ID NO: shown in fig. 8. The TyrC gene is obtained by whole gene synthesis after being optimized according to the codon preference of saccharomyces cerevisiae.

The invention also comprises a construction method of the saccharomyces cerevisiae recombinant bacteria, and the construction method of the recombinant bacteria comprises the following steps:

1) Obtaining recombinant vectors pUMRI-13-HpaB-HpaC and pUMRI-11-RgTAL plasmids;

2) introducing the recombinant vector pUMRI-13-HpaB-HpaC into Saccharomyces cerevisiae to obtain YCA 113-1B;

2) introducing the pUMRI-11-RgTAL plasmid obtained in the step 1) into YCA113-1B to obtain a saccharomyces cerevisiae recombinant strain.

The construction method of the recombinant strain comprises the step of knocking out the Aro3 and/or Aro10 genes on the chromosome of the obtained saccharomyces cerevisiae recombinant strain in addition to the construction method; and/or overexpresses one or a combination of two of the mutant Aro4K229L and Aro7G141S genes that are not subject to tyrosine feedback inhibition; and/or overexpresses Zymomonas mobilis-derived prephenate dehydrogenase TyrC.

The invention also comprises the application of the saccharomyces cerevisiae recombinant bacteria in the production of caffeic acid.

The invention also discloses a production method of the caffeic acid, and the method comprises the step of carrying out fermentation culture on the saccharomyces cerevisiae recombinant bacteria.

The invention integrates three exogenous genes required by the synthesis of caffeic acid based on the approach of aromatic amino acid of saccharomyces cerevisiae: tyrosine ammonia lyase gene, 4-hydroxyphenylacetic acid-3-monooxygenase (HpaB) gene and NADPH-flavin oxidoreductase (HpaC) gene, and regulates and controls the step of limiting the synthesis of precursors in cells, so that the obtained stable and high-yield saccharomyces cerevisiae engineering bacteria realize the one-step synthesis of glucose to caffeic acid, do not need to add other exogenous precursor substances, provide reference for the green production of caffeic acid, and provide a foundation for the industrial fermentation production.

Has the beneficial effects that: according to the invention, three exogenous genes required for synthesis of caffeic acid are integrated into a saccharomyces cerevisiae chromosome, and complete synthesis from glucose to caffeic acid is realized through gene knockout of a competitive pathway, elimination of a feedback inhibition step and overexpression of a rate-limiting enzyme (the constructed pathway is shown in figure 1), the yield of a shake flask reaches about 760mg/L, the method is the highest level of yeast yield in the current report, and a new method is provided for industrial production of caffeic acid.

Drawings

FIG. 1 is a schematic representation of the de novo biosynthetic pathway for caffeic acid constructed in accordance with the present invention.

FIG. 2 liquid chromatography of caffeic acid standard and fermentation product.

FIG. 3 gel electrophoresis of PCR products of RgTAL, HpaB, HpaC genes.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Media, stock solutions used in the examples:

Luria-Bertani (LB) Medium: purchased from Shanghai bioengineering Co., Ltd, sterilized at 115 ℃ for 21 min.

Yeast Extract Peptone Dextrose (YPD) medium: 10g/L yeast extract powder, 20g/L peptone, 20g/L glucose, solid YPD medium added with 1.5-2% agar powder, and sterilizing at 115 deg.C for 21 min.

Kanamycin stock (50 mg/mL): 0.5g kanamycin was dissolved in 10mL ddH₂O, filtering, sterilizing, storing at-20 deg.C, and diluting 1000 times to obtain final concentration of 50 μ g/mL.

Geneticin (G418) stock (20 mg/mL): 0.2g G418 was dissolved in 10mL ddH2O, sterilized by filtration, stored at-20 ℃ and diluted 100-fold to a final concentration of 200. mu.g/mL at the time of use.

5-Fluorotic acid (FOA) stock (100 mg/mL): 0.1g of 5-FOA was dissolved in 1mL of dimethyl sulfoxide, and 1mL of the mother solution was directly added to 100mL of SD solid medium for use in preparing SD-FOA plates.

10 XYNB stock solution: weigh 1.7% YNB and 5% (NH)₄)₂SO₄Soluble in ddH₂O, filtering and sterilizing with 0.22 μm sterile needle filter, storing in refrigerator at 4 deg.C, and diluting 10 times.

10 × amino acid mixed stock solution: weighing various amino acids according to the following formula, mixing and dissolving in ddH ₂In O, the concentration is: l-adenine sulfate 200mg/L, L-arginine 200mg/L, L-histidine 200mg/L, L-isoleucine 300mg/L, L-leucine 1000mg/L, L-lysine 300mg/L, L-methionine 200mg/L, L-phenylalanine 500mg/L, L-threonine 2000mg/L, L-tryptophan 200mg/L, L-tyrosine 300mg/L, L-uracil 200mg/L, L-valine 1500mg/L (note: when preparing the amino acid mother liquor, corresponding amino acids are deleted according to different nutrition screens). Filtering and sterilizing with 0.22 μm sterile needle filter, and storing in refrigerator at 4 deg.C. It is diluted 10 times when used.

Synthetic Defined (SD) medium: 2% glucose, 10% (V/V) of 10 XYNB mother liquor, and 10% (V/V) of 10 XMA mixed mother liquor. The specific flow of preparing 100mL SD culture medium is as follows: 2g glucose was dissolved in 80mL water, autoclaved at 115 ℃ for 21min, and 10mL of a 10 XYNB mother liquor and 10mL of a 10 Xamino acid mixed mother liquor were added after the medium had cooled to below 60 ℃. Adding 1.5-2% agar powder into solid SD culture medium. Wherein SD-URA-represents SD medium lacking uracil.

Reagents used in examples:

high fidelity enzymes DNA polymerase (Prime STARTM HS DNA polymers), DNA restriction enzyme, T4 DNA ligase were all purchased from Dalianbao Bio Inc. (Takara, Dalian); DNA marker (1kb DNA ladder) purchased from Thermo Scientific; nucleic acid electrophoresis related reagents and a yeast genome extraction kit are purchased from Shanghai bioengineering Co., Ltd; the bacterial plasmid extraction kit, the PCR product purification kit and the DNA gel purification kit are purchased from Axygen, Hangzhou; yeast nitrogen base without amino group (YNB) purchased from Shanghai bioengineering, Inc. for preparation of synthetic medium; PCR primer synthesis and sequencing services were provided by Shanghai bioengineering, Inc. or Shanghai Boshang Biotechnology, Inc.

The examples use conventional technical methods:

e, preparing escherichia coli competence:

(1) streaking E.coli DH5 alpha on LB solid plate, culturing at 37 deg.C overnight for about 15 h; then selecting single colony to inoculate into 5mL LB liquid culture medium, culturing overnight at 220rpm and 37 ℃, taking 1mL inoculum to transfer into 100mL LB liquid culture medium, culturing at 37 ℃ and 200rpm to OD₆₀₀About 0.35 to about 0.40.

(2) Subpackaging 25mL of bacterial solution into a precooled 50mL centrifuge tube, carrying out ice bath for 10min, centrifuging at 3000rpm and 4 ℃ for 10min, collecting thalli, and discarding supernatant;

(3) adding 30mL of precooled CaCl into each tube of thalli₂-MgCl₂Solution (80mmol/L MgCl)₂，20mmol/L CaCl₂) Resuspending the thallus (operation on ice), centrifuging at 3000rpm for 10min, collecting the thallus, and discarding the supernatant;

(4) with 2mL of precooled 0.1M CaCl₂The cell was resuspended in glycerol solution (containing 0.1mol/L CaCl2 and 15% glycerol), mixed well and dispensed into precooled 1.5mL centrifuge tubes at 100. mu.L per tube, and stored at-80 ℃ for future use.

The Escherichia coli transformation method comprises the following steps:

(1) the E.coli competence was taken out from the freezer at-80 ℃ and thawed on ice.

(2) Add 10. mu.L of recombinant plasmid and let stand on ice for 20 min.

(3) The mixture was heat shocked at 42 ℃ for 90s, and immediately ice-cooled for 5 min.

(4) Adding 1mL LB, mixing, and recovering for 50min by 37 shaking table.

(5) Centrifugation was carried out at 12000rpm for 1min, the supernatant was removed, 100. mu.L of the resuspended suspension was retained, the LB plate containing the corresponding resistance was smeared, and the plate was incubated at 37 ℃ overnight.

A saccharomyces cerevisiae lithium acetate conversion method:

(1) selecting single clone, inoculating into 5mL YPD test tube, culturing at 30 deg.C and 220rpm overnight, inoculating 1mL to 250mL triangular flask containing 50mL YPD, culturing at 30 deg.C and 220rpm for about 5 hr, and adjusting OD₆₀₀Is about 2.

(2) The suspension was transferred to a 50mL sterilized centrifuge tube, centrifuged at 5000 Xg for 5min and the supernatant removed.

(3) The cells were washed with 30mL of sterilized water, centrifuged at 5000 Xg for 5min, and the supernatant was removed.

(4) Adding 800 μ L of sterilized water to resuspend the thallus, mixing well, subpackaging in 1.5mL EP tube according to 100 μ L per tube, centrifuging at 12000 Xg for 1min, and removing supernatant for use.

(5) To the cells in the above 1.5mL EP tube were added 240. mu.L of PEG MW3350 (50% w/v), 36. mu.L of 1.0M lithium acetate, 30. mu.L of sterile water, 50. mu.L of Single-stranded DNA (2.0 mg/mL), 4. mu.L of linearized plasmid fragment, and the remainder was added sterile water to a total volume of 360. mu.L, resuspended and mixed well.

(6) A1.5 mL EP tube was placed in a 42 ℃ water bath and heat shocked for 40 min.

(7) After the heat shock was completed, the mixture was centrifuged at 12000 Xg for 1min to remove the supernatant.

(8) Adding 1mL YPD culture medium, mixing the cells uniformly, placing at 30 ℃, and recovering for 1.5-2h by shaking table at 220 rpm.

(9) Centrifuging the recovered cells at 12000 Xg for 1min, removing a supernatant culture medium, washing the cells with 1mL of sterilized purified water for precipitation, centrifuging at 12000 Xg for 1min, removing the supernatant, adding 1mL of sterilized purified water, reselecting the cells, taking 15 mu L of the cells, coating the cells on a corresponding G418 plate, and culturing the cells in an incubator at 30 ℃ for 3 days.

The culture method of the saccharomyces cerevisiae comprises the following steps:

individual colonies were picked from agar plates, inoculated into 5mL fresh YPD tubes, and cultured overnight at 30 ℃ for about 15h on a 220rpm constant temperature shaker. Then transferred to a 250mL Erlenmeyer flask containing 50mL YPD medium to obtain the initial OD in the flask₆₀₀0.05, the mixture was incubated at 30 ℃ for 72 hours on a constant temperature shaker at 220 rpm.

EXAMPLE 1 construction of recombinant plasmids required for caffeic acid Synthesis

Firstly, the genome of salmonella enteritidis C50336 (presented by the teacher of the institute of bioscience and technology at Yangzhou university) is used as a template, HpaC-F (EcoR I) (GCGGAATTCATGCAAGTAGATG AACAACGT) and HpaC-R (Bgl II) (CCTTAGATCTTAAACAGGCGCTTCCATC TC) are used as primers, HpaC gene (figure 3) is amplified, then EcoR I and Bgl II are used for double digestion, the obtained fragment is connected with pURI-13 (GenBank: KM216415.1) plasmid which is subjected to double digestion by the same EcoR I and Bgl II for transformation, and pURI-13-HpaC plasmid is constructed.

The PCR reaction system is as follows:

the PCR procedure was as follows:

the plasmid or gene fragment digestion system is as follows:

the enzyme was cleaved at 37 ℃ for 2 h. The enzyme digestion product is separated by 1.0 percent agarose gel electrophoresis, and the gel with the gene fragment is cut off and purified and recovered by a gel recovery kit.

The linking system is as follows:

and (3) carrying out enzyme inoculation for 50min at 22 ℃, transforming the ligation product into an escherichia coli competence, and placing the escherichia coli competence in an incubator at 37 ℃ for overnight culture to obtain a positive clone for plasmid extraction.

Using HpaB synthesized after codon optimization as a template, using HpaB-F (BamH I) (GCGGGATCCATGAAGCCAGAAGACTTCAG) and HpaB-R (Sal I) (GGAAGTCGACTTATTGTCTGATTCTGTGTCTGTCTCTCTCA) to amplify HpaB genes (figure 3) with BamH I and Sal I enzyme cutting sites at two ends, then using BamH I and Sal I to carry out double enzyme cutting, connecting and transforming the obtained fragments and BamHI and pUMRI-13-HpaC plasmids which are subjected to double enzyme cutting by BamH I and Xho I according to the mode, and constructing and obtaining pUMRI-13-HpaB-HpaC plasmids.

The RgTAL synthesized after codon optimization is used as a template, RgTAL-F (BamH I) (GCGGGATCCATGGCTCCAAGACCAACTTC) and RgTAL-R (Sal I) (GGAAGTCGACTTAAGCCAACATCTTCTCAACA) are used as primers to amplify the RgTAL gene (figure 3) with BamH I and Sal I enzyme cutting sites at two ends, then BamH I and Sal I are used for double enzyme cutting, the obtained fragment and pUMRI-11 plasmid (GenBank: KM216413.1) which is double enzyme cut by BamH I and Xho I are connected and transformed according to the mode, and the pUMRI-11-RgTAL plasmid is constructed.

Example 2 construction of caffeic acid-producing strains

The recombinant vector pUMRI-13-HpaB-HpaC contains Sfi I sites, and the vector is linearized by an Sfi I enzyme digestion method for the first time.

Enzyme digestion system: total 50. mu.L, plasmid 43.5. mu.L, 10 Xquick Cut Buffer 5. mu.L, Quick Cut Sfi I enzyme 1.5. mu.L.

Enzyme cutting conditions are as follows: the mixture is placed at 50 ℃ for enzyme digestion for 2-3 hours.

The linearized plasmid pUMRI-13-HpaB-HpaC was introduced into Saccharomyces cerevisiae YXWP-113, and positive recombinant yeast, named YCA113-1B, was obtained by screening on a G418 resistant YPD plate. Since pUMRI-13-HpaB-HpaC contains URA3 and KanMX (encoding geneticin G418 resistance in yeast) dual selection markers, URA3 encodes orotidine-5-phosphate dehydrogenase (orotidine 5-phosphate dehydrogenase), which catalyzes one of the key reactions during the synthesis of yeast RNA pyrimidine nucleotides. The orotidine 5-phosphate decarboxylase from normal prototrophic yeast cells can convert 5-FOA into lethal 5-fluorouracil (5-fluorouracil) when 5-fluoroorotic acid (5-FOA) is added to the medium. The saccharomyces cerevisiae strain is subcultured in YPD liquid medium, homologous recombination can occur between forward repeated segments at two ends of URA3 and KanMX, URA3 and KanMX genes are naturally lost in the process, and therefore, clones with lost resistance can be screened on an SD-FOA plate. The selected clones were then spotted on YPD plates without G418 resistance and YPD plates with G418 resistance, respectively, for validation, and the strains selected for resistance were removed for the next round of gene integration. Further, pUMRI-11-ORgTAL was linearized with Sfi I in the same manner as described above and integrated into recombinant Saccharomyces cerevisiae YCA113-1B to obtain caffeic acid-producing strain YCA 113-2B.

Example 3 caffeic acid production analysis and detection

Culturing an original strain YXWP-113 and an engineering strain YCA113-2B in a YPD shake flask for 72h according to a saccharomyces cerevisiae culture method, after the culture is finished, placing 2mL of fermentation liquor in a 2mL EP tube, centrifuging at 12000 Xg for 1min, removing a supernatant, adding 2mL of purified water to clean cells, centrifuging at 12000 Xg for 1min, after the supernatant is removed, placing the centrifuge tube in an oven at 100 ℃ and drying to constant weight for dry weight measurement.

And sample processing and yield analysis were performed as follows:

(1) 1mL of the fermentation broth was transferred to a 1.5mL EP tube and centrifuged at 12000 Xg for 1min at room temperature.

(2) 50 μ L of the supernatant was transferred to a new 1.5mL EP tube and diluted 20-fold with 950 μ L of purified water.

(3) The sample was obtained by filtration through a 0.22 μm water system needle filter for caffeic acid determination.

Quantitative analysis of caffeic acid: the samples were analyzed using an Agilent 1200 hplc. The chromatographic conditions are as follows: the mobile phase A pump is 0.1% formic acid water solution, the B pump is 100% acetonitrile, and the gradient elution mode is as follows:

by using

QS-C18 Plus chromatographic column (4.6X 250mm, 5 μm) with flow rate of 1mL/min, column temperature of 35 deg.C, sample volume of 20 μ L, and detection wavelength of 320 nm. As shown in FIG. 2, the accumulation of caffeic acid was successfully detected in the YCA113-2B fermentation broth, and the yield reached 313.8 mg/L.

Example 4 Elimination of the feedback inhibition step in the shikimate pathway to increase the caffeic acid production from Saccharomyces cerevisiae

In the precursor synthesis pathway of caffeic acid, two 3-deoxy-D-arabinose-hepturonic acid-7-phosphate synthases Aro3 and Aro4 in the shikimic acid pathway catalyze the reaction of phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to generateThe important precursor for caffeic acid, 3-deoxy-D-arabino-heptanone-7-phosphate, is formed, but these two enzymes are subject to feedback inhibition by phenylalanine and tyrosine, respectively. In addition, chorismate mutase Aro7 catalyzes chorismate to produce prepinnamic acid, competes for the carbon flux of tryptophan biosynthesis, and transfers it to the tyrosine biosynthesis pathway, but also Aro7 enzyme activity is subject to tyrosine feedback inhibition. If these feedback inhibition steps can be eliminated, the caffeic acid precursor supply is expected to increase, thus having great significance for the production of caffeic acid. In the early stage, we obtained an Aro3 gene knockout plasmid pUMRI-delta Aro3 and a gene Aro4 carrying a tyrosine feedback-insensitive mutant^K229LAnd Aro7^G141SpUMRI-. DELTA.Aro 3-Aro4^K229LAnd pUMRI-DELTA Aro3-Aro4^K229L-Aro7^G141SThe study of plasmids (three plasmids were given by professor of chemical engineering and bioengineering college of Zhejiang university, hong Wei, and the study of heterologous synthesis of vitamin E (tocotrienol) in Saccharomyces cerevisiae [ D ]2019, Zhejiang university).

According to example 2, the plasmid pURI-Delta Aro3 was linearized with Sfi I and introduced into YCA113-2B strain, the constructed Saccharomyces cerevisiae was named YCA113-3B, and the YCA113-3B strain from which URA3 and KanMX tags were removed was selected in the same manner as in example 2, and further Sfi I linearized pURI-Delta Aro3-Aro4 were incorporated^K229LAnd pUMRI-DELTA Aro3-Aro4^K229L-Aro7^G141SPlasmids were used to obtain YCA113-4B and YCA113-5B strains, respectively. YCA113-2B, YCA113-3B, YCA113-4B, YCA113-5B were subjected to shake flask culture, and after completion thereof, HPLC analysis was performed according to the method of example 3 to determine the caffeic acid yields, the results are shown in Table 1.

TABLE 1 Elimination of the effect of the tyrosine feedback inhibition step on caffeic acid production

The yield of the YCA113-5B caffeic acid is the highest, and is improved by 1.76 times compared with the YCA113-2B, so the YCA113-5B is selected for the next research.

Example 5 knockout of the competitive pathway and overexpression of the rate-limiting enzyme increases the production of caffeic acid from Saccharomyces cerevisiae

In the caffeic acid synthesis pathway, the endogenous prephenate dehydrogenase Tyr1 of Saccharomyces cerevisiae catalyzes the production of 4-hydroxyphenylpyruvate (4-HPP), an important precursor of caffeic acid from prephenate, but is subject to feedback inhibition by phenylalanine in Saccharomyces cerevisiae, thus limiting the synthesis of 4-hydroxyphenylpyruvate. However, the prephenate dehydrogenase TyrC derived from Zymomonas mobilis is not subject to feedback inhibition by aromatic amino acids, and thus can replace the function of Tyr 1. In addition, the endogenous phenylpyruvate decarboxylase Aro10 of the saccharomyces cerevisiae competes with the caffeic acid synthesis pathway to convert 4-HPP into other byproducts, so that the Aro10 gene knockout liquid is expected to improve the caffeic acid yield. In the present invention, we obtained the research of the Aro10 gene knockout plasmid pUMRI- Δ Aro10 and pUMRI- Δ Aro10-TyrC plasmid expressing TyrC, which were presented by the university of Zhejiang university college of chemical engineering and bioengineering, professor hong Wei, and the research of heterologous synthesis of vitamin E (tocotrienol) in Saccharomyces cerevisiae [ D ] university of Zhejiang province 2019). Linearized pUMRI-delta Aro10 and pUMRI-delta Aro10-TyrC plasmids of Sfi I were transformed into YCA113-5B strains with URA3 and KanMX tags removed, respectively, in the same manner as in example 2, and the obtained Saccharomyces cerevisiae strains were named YCA113-6B and YCA113-8B, respectively. YCA113-6B and YCA113-8B strains were subjected to shake flask culture according to the Saccharomyces cerevisiae culture method and analyzed for caffeic acid production according to example 3. The results are shown in table 2:

TABLE 2 Effect of knockout of Aro10 and overexpression of TyrC on caffeic acid production

By knocking out the Aro10 and overexpressing the TryC, the yield of the caffeic acid is obviously improved, reaches 769.3mg/L, is the highest level reported by yeast at present, and lays a foundation for the industrial production of the caffeic acid.

Sequence listing

<110> Yangzhou university

<120> saccharomyces cerevisiae recombinant bacterium and construction method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2082

<212> DNA

<213> RgTAL Gene (Artificial Sequence)

<400> 1

atggctccaa gaccaacttc tcaatctcaa gctagaactt gtccaactac tcaagttact 60

caagttgaca tcgttgaaaa gatgttggct gctccaactg actctacttt ggaattggac 120

ggttactctt tgaacttggg tgacgttgtt tctgctgcta gaaagggtag accagttaga 180

gttaaggact ctgacgaaat cagatctaag atcgacaagt ctgttgaatt cttgagatct 240

caattgtcta tgtctgttta cggtgttact actggtttcg gtggttctgc tgacactaga 300

actgaagacg ctatctcgct ccaaaaggcg ttgttggaac accagctctg cggtgtcctc 360

ccatcttctt tcgactcttt cagattgggt agaggcctcg aaaacagctt gccattggaa 420

gttgttagag gtgctatgac tatcagagtt aactctttga ctagaggtca ctctgctgtt 480

agattggttg ttttggaagc tttgactaac ttcttgaacc acggtatcac tccaatcgtt 540

ccattgagag gtactatctc tgcttctggt gacttgtctc cattgtctta catcgctgct 600

gctatctctg gtcacccaga ctctaaggtt cacgttgttc acgaaggtaa ggaaaagatc 660

ttgtacgcta gagaagcgat ggcgttgttc aacctcgagc cagttgtcct cggtccaaag 720

gagggcttgg gcttggttaa cggtactgct gtttctgctt ctatggctac tctcgctctc 780

cacgacgctc atatgttgtc tttgttgtct caatctttga ctgctatgac tgttgaagct 840

atggttggtc acgctggttc tttccaccca ttcttgcacg acgttactag accacaccca 900

actcaaatcg aagttgctgg taacatcaga aagttgttgg aaggttctag attcgctgtt 960

caccacgaag aagaagttaa ggttaaggac gacgaaggta tcttgagaca agacagatac 1020

ccattgagaa cttctccaca gtggcttggt ccattggtaa gcgacttgat ccacgctcac 1080

gctgttttga ctatcgaagc tggtcaatct actactgaca acccattgat cgacgttgaa 1140

aacaagactt ctcaccacgg tggtaacttc caagctgctg ctgttgctaa cactatggaa 1200

aagactagat tgggtttggc tcaaatcggt aagttgaact tcactcaatt gactgaaatg 1260

ttgaacgctg gtatgaacag aggtttgcca tcttgtttgg ctgctgaaga cccatctttg 1320

tcttatcatt gtaagggtct cgacatcgct gcggctgctt acacttctga attgggtcac 1380

ttggctaacc cagttactac tcacgttcaa ccagctgaaa tggctaacca agctgttaac 1440

tctttggctt tgatctctgc tagaagaact actgaatcta acgacgttct cagcttgttg 1500

ctcgctactc acttgtactg tgttttgcaa gctatcgact tgagagctat cgaattcgaa 1560

ttcaagaagc aattcggtcc agctatcgtt tctttgatcg accaacactt cggttctgct 1620

atgactggtt ctaacttgag agacgaattg gttgaaaagg ttaacaagac tttggctaag 1680

agattggaac aaactaactc ttacgacttg gttccaagat ggcacgacgc tttctctttc 1740

gctgctggta ctgttgttga agttttgtct tctacttctt tgtctttggc tgctgttaac 1800

gcttggaagg ttgctgctgc tgaatctgct atctctttga ctagacaagt tcgtgaaaca 1860

ttctggtctg ctgcgtctac ttcttctcca gctttgtctt acttgtctcc aagaactcaa 1920

atcttgtacg ctttcgttag agaagaattg ggtgttaagg ctagaagagg tgacgttttc 1980

ttgggtaagc aagaagttac tatcggttct aacgtttcta agatctacga agctatcaag 2040

tctggtagaa tcaacaacgt tttgttgaag atgttggctt aa 2082

<210> 2

<211> 1563

<212> DNA

<213> HpaB Gene (Artificial Sequence)

<400> 2

atgaagccag aagacttcag agcttctgct actagaccat tcactggtga agaatacttg 60

gcttctttga gagacgacag agaaatctac atctacggtg acagagttaa ggacgttact 120

tctcacccag ctttcagaaa cgctgctgct tctatggcta gattgtacga cgctttgcac 180

gacccacaat ctaaggaaaa gttgtgttgg gaaactgaca ctggtaacgg tggttacact 240

cacaagttct tcagatacgc tagatctgct gacgaattga gacaacaaag agacgctatc 300

gctgaatggt ctagattgac ttacggttgg atgggtagaa ctccagacta caaggctgct 360

ttcggttctg ctttgggtgc taacccaggt ttctacggta gattcgaaga caacgctaag 420

acttggtaca agagaatcca agaagcttgt ttgtacttga accacgctat cgttaaccca 480

ccaatcgaca gagacaagcc agttgaccaa gttaaggacg ttttcatctc tgttgacgaa 540

gaagttgacg gtggtatcgt tgtttctggt gctaaggttg ttgctactaa ctctgctttg 600

actcactaca acttcgttgg tcaaggttct gctcaattgt tgggtgacaa cactgacttc 660

gctttgatgt tcatcgctcc aatgaacact ccaggtatga agttgatctg tagaccatct 720

tacgaattgg ttgctggtat cgctggttct ccattcgact acccattgtc ttctagattc 780

gacgaaaacg acgctatctt ggttatggac aaggttttca tcccatggga aaacgttttg 840

atctacagag acttcgaaag atgtaagcaa tggttcccac aaggtggttt cggtagattg 900

ttcccaatgc aaggttgtac tagattggct gttaagttgg acttcatcac tggtgctttg 960

tacaaggctt tgcaatgtac tggttctttg gaattcagag gtgttcaagc tcaagttggt 1020

gaagttgttg cttggagaaa cttgttctgg tctttgactg acgctatgta cggtaacgct 1080

tctgaatggc acggtggtgc tttcttgcca tctgctgaag ctttgcaagc ttacagagtt 1140

ttggctccac aagcttaccc agaaatcaag aagactatcg aacaagttgt tgcttctggt 1200

ttgatctact tgccatctgg tgttagagac ttgcacaacc cacaattgga caagtacttg 1260

tctacttact gtagaggttc tggtggtatg ggtcacagag aaagaatcaa gatcttgaag 1320

ttgttgtggg acgctatcgg ttctgaattc ggtggtagac acgaattgta cgaaatcaac 1380

tacgctggtt ctcaagacga aatcagaatg caagctttga gacaagctat cggttctggt 1440

gctatgaagg gtatgttggg tatggttgaa caatgtatgg gtgactacga cgaaaacggt 1500

tggactgttc cacacttgca caacccagac gacatcaacg ttttggacag aatcagacaa 1560

taa 1563

<210> 3

<211> 513

<212> DNA

<213> HpaC Gene (Artificial Sequence)

<400> 3

atgcaagtag atgaacaacg tctgcgtttt cgcgatgcga tggcaagtct ggcggcagcg 60

gtcaacatcg taaccacggc gggtcacgcc ggacgctgcg gtatcaccgc aacagcggtc 120

tgttccgtca ccgatacgcc gccctccgtg atggtatgta ttaatgccaa tagcgccatg 180

aaccccgtct ttcagggcaa cggcaagctg tgcattaatg tacttaacca tgagcaggag 240

ctgatggcgc gccactttgc cggtatgacg gggatggcga tggaagagcg ttttcaccag 300

ccatgttggc aaaacgggcc gctgggccag ccggtactta acggcgcgct ggccggtctt 360

gaaggcgaga tcagcgaggt acaaaccatt ggcacgcatc tggtgtatct ggtggcgatc 420

aaaaatatta ttcttagcca ggatgggcat ggcctgattt atttcaaacg ccgttttcat 480

ccggtcagac ttgagatgga agcgcctgtt taa 513

<210> 4

<211> 882

<212> DNA

<213> TyrC Gene (Artificial Sequence)

<400> 4

atgacagttt ttaaacatat tgcaattatt ggtttgggtt tgattggttc ttcagcagct 60

agagctacta aagcatattg tccagatgtt acagtttctt tgtatgataa atctgaattt 120

gtttgtgata gggcaagggc tttgaattta ggtgataatg ttactgatga tattcaagat 180

gctgttagag aagctgattt agttttgttg tgtgttccag ttagagctat gggtattgtt 240

gcagcagcta tggctcctgc tttgaaaaaa gatgttatta tttgtgatac tggttctgtt 300

aaagtttcag ttattaaaac tttacaagat aatttaccta atcatattat tgttccttct 360

catccattag caggtacaga aaataatggt cctgatgcag gttttgcaga attgtttcaa 420

gatcatccag ttattttgac accagatgca catacacctg cacaagcaat tgcttatatt 480

gcagattatt gggaagaaat tggtggtagg attaatttaa tgtcagctga acatcatgat 540

catgttttag ctttgacttc acatttacca catgttattg catatcaatt aattggtatg 600

gtttctggtt atgaaaaaaa atctaggact ccaattatga ggtattcagc aggttctttt 660

agggatgcta ctagagttgc tgcatctgaa cctaggttgt ggcaagatat tatgttggaa 720

aatgctcctg cattgttacc agttttggat cattttattg ctgatttgaa aaaattaagg 780

acagcaattg cttctcaaga tgaagattat ttgttggaac attttaaaga atctcaaaaa 840

gcaaggttgg cattgaaaac agatcatgat attcatccat aa 882

<210> 5

<211> 693

<212> PRT

<213> RgTAL Gene (Artificial Sequence)

<400> 5

Met Ala Pro Arg Pro Thr Ser Gln Ser Gln Ala Arg Thr Cys Pro Thr

1 5 10 15

Thr Gln Val Thr Gln Val Asp Ile Val Glu Lys Met Leu Ala Ala Pro

20 25 30

Thr Asp Ser Thr Leu Glu Leu Asp Gly Tyr Ser Leu Asn Leu Gly Asp

35 40 45

Val Val Ser Ala Ala Arg Lys Gly Arg Pro Val Arg Val Lys Asp Ser

50 55 60

Asp Glu Ile Arg Ser Lys Ile Asp Lys Ser Val Glu Phe Leu Arg Ser

65 70 75 80

Gln Leu Ser Met Ser Val Tyr Gly Val Thr Thr Gly Phe Gly Gly Ser

85 90 95

Ala Asp Thr Arg Thr Glu Asp Ala Ile Ser Leu Gln Lys Ala Leu Leu

100 105 110

Glu His Gln Leu Cys Gly Val Leu Pro Ser Ser Phe Asp Ser Phe Arg

115 120 125

Leu Gly Arg Gly Leu Glu Asn Ser Leu Pro Leu Glu Val Val Arg Gly

130 135 140

Ala Met Thr Ile Arg Val Asn Ser Leu Thr Arg Gly His Ser Ala Val

145 150 155 160

Arg Leu Val Val Leu Glu Ala Leu Thr Asn Phe Leu Asn His Gly Ile

165 170 175

Thr Pro Ile Val Pro Leu Arg Gly Thr Ile Ser Ala Ser Gly Asp Leu

180 185 190

Ser Pro Leu Ser Tyr Ile Ala Ala Ala Ile Ser Gly His Pro Asp Ser

195 200 205

Lys Val His Val Val His Glu Gly Lys Glu Lys Ile Leu Tyr Ala Arg

210 215 220

Glu Ala Met Ala Leu Phe Asn Leu Glu Pro Val Val Leu Gly Pro Lys

225 230 235 240

Glu Gly Leu Gly Leu Val Asn Gly Thr Ala Val Ser Ala Ser Met Ala

245 250 255

Thr Leu Ala Leu His Asp Ala His Met Leu Ser Leu Leu Ser Gln Ser

260 265 270

Leu Thr Ala Met Thr Val Glu Ala Met Val Gly His Ala Gly Ser Phe

275 280 285

His Pro Phe Leu His Asp Val Thr Arg Pro His Pro Thr Gln Ile Glu

290 295 300

Val Ala Gly Asn Ile Arg Lys Leu Leu Glu Gly Ser Arg Phe Ala Val

305 310 315 320

His His Glu Glu Glu Val Lys Val Lys Asp Asp Glu Gly Ile Leu Arg

325 330 335

Gln Asp Arg Tyr Pro Leu Arg Thr Ser Pro Gln Trp Leu Gly Pro Leu

340 345 350

Val Ser Asp Leu Ile His Ala His Ala Val Leu Thr Ile Glu Ala Gly

355 360 365

Gln Ser Thr Thr Asp Asn Pro Leu Ile Asp Val Glu Asn Lys Thr Ser

370 375 380

His His Gly Gly Asn Phe Gln Ala Ala Ala Val Ala Asn Thr Met Glu

385 390 395 400

Lys Thr Arg Leu Gly Leu Ala Gln Ile Gly Lys Leu Asn Phe Thr Gln

405 410 415

Leu Thr Glu Met Leu Asn Ala Gly Met Asn Arg Gly Leu Pro Ser Cys

420 425 430

Leu Ala Ala Glu Asp Pro Ser Leu Ser Tyr His Cys Lys Gly Leu Asp

435 440 445

Ile Ala Ala Ala Ala Tyr Thr Ser Glu Leu Gly His Leu Ala Asn Pro

450 455 460

Val Thr Thr His Val Gln Pro Ala Glu Met Ala Asn Gln Ala Val Asn

465 470 475 480

Ser Leu Ala Leu Ile Ser Ala Arg Arg Thr Thr Glu Ser Asn Asp Val

485 490 495

Leu Ser Leu Leu Leu Ala Thr His Leu Tyr Cys Val Leu Gln Ala Ile

500 505 510

Asp Leu Arg Ala Ile Glu Phe Glu Phe Lys Lys Gln Phe Gly Pro Ala

515 520 525

Ile Val Ser Leu Ile Asp Gln His Phe Gly Ser Ala Met Thr Gly Ser

530 535 540

Asn Leu Arg Asp Glu Leu Val Glu Lys Val Asn Lys Thr Leu Ala Lys

545 550 555 560

Arg Leu Glu Gln Thr Asn Ser Tyr Asp Leu Val Pro Arg Trp His Asp

565 570 575

Ala Phe Ser Phe Ala Ala Gly Thr Val Val Glu Val Leu Ser Ser Thr

580 585 590

Ser Leu Ser Leu Ala Ala Val Asn Ala Trp Lys Val Ala Ala Ala Glu

595 600 605

Ser Ala Ile Ser Leu Thr Arg Gln Val Arg Glu Thr Phe Trp Ser Ala

610 615 620

Ala Ser Thr Ser Ser Pro Ala Leu Ser Tyr Leu Ser Pro Arg Thr Gln

625 630 635 640

Ile Leu Tyr Ala Phe Val Arg Glu Glu Leu Gly Val Lys Ala Arg Arg

645 650 655

Gly Asp Val Phe Leu Gly Lys Gln Glu Val Thr Ile Gly Ser Asn Val

660 665 670

Ser Lys Ile Tyr Glu Ala Ile Lys Ser Gly Arg Ile Asn Asn Val Leu

675 680 685

Leu Lys Met Leu Ala

690

<210> 6

<211> 520

<212> PRT

<213> HpaB Gene (Artificial Sequence)

<400> 6

Met Lys Pro Glu Asp Phe Arg Ala Ser Ala Thr Arg Pro Phe Thr Gly

1 5 10 15

Glu Glu Tyr Leu Ala Ser Leu Arg Asp Asp Arg Glu Ile Tyr Ile Tyr

20 25 30

Gly Asp Arg Val Lys Asp Val Thr Ser His Pro Ala Phe Arg Asn Ala

35 40 45

Ala Ala Ser Met Ala Arg Leu Tyr Asp Ala Leu His Asp Pro Gln Ser

50 55 60

Lys Glu Lys Leu Cys Trp Glu Thr Asp Thr Gly Asn Gly Gly Tyr Thr

65 70 75 80

His Lys Phe Phe Arg Tyr Ala Arg Ser Ala Asp Glu Leu Arg Gln Gln

85 90 95

Arg Asp Ala Ile Ala Glu Trp Ser Arg Leu Thr Tyr Gly Trp Met Gly

100 105 110

Arg Thr Pro Asp Tyr Lys Ala Ala Phe Gly Ser Ala Leu Gly Ala Asn

115 120 125

Pro Gly Phe Tyr Gly Arg Phe Glu Asp Asn Ala Lys Thr Trp Tyr Lys

130 135 140

Arg Ile Gln Glu Ala Cys Leu Tyr Leu Asn His Ala Ile Val Asn Pro

145 150 155 160

Pro Ile Asp Arg Asp Lys Pro Val Asp Gln Val Lys Asp Val Phe Ile

165 170 175

Ser Val Asp Glu Glu Val Asp Gly Gly Ile Val Val Ser Gly Ala Lys

180 185 190

Val Val Ala Thr Asn Ser Ala Leu Thr His Tyr Asn Phe Val Gly Gln

195 200 205

Gly Ser Ala Gln Leu Leu Gly Asp Asn Thr Asp Phe Ala Leu Met Phe

210 215 220

Ile Ala Pro Met Asn Thr Pro Gly Met Lys Leu Ile Cys Arg Pro Ser

225 230 235 240

Tyr Glu Leu Val Ala Gly Ile Ala Gly Ser Pro Phe Asp Tyr Pro Leu

245 250 255

Ser Ser Arg Phe Asp Glu Asn Asp Ala Ile Leu Val Met Asp Lys Val

260 265 270

Phe Ile Pro Trp Glu Asn Val Leu Ile Tyr Arg Asp Phe Glu Arg Cys

275 280 285

Lys Gln Trp Phe Pro Gln Gly Gly Phe Gly Arg Leu Phe Pro Met Gln

290 295 300

Gly Cys Thr Arg Leu Ala Val Lys Leu Asp Phe Ile Thr Gly Ala Leu

305 310 315 320

Tyr Lys Ala Leu Gln Cys Thr Gly Ser Leu Glu Phe Arg Gly Val Gln

325 330 335

Ala Gln Val Gly Glu Val Val Ala Trp Arg Asn Leu Phe Trp Ser Leu

340 345 350

Thr Asp Ala Met Tyr Gly Asn Ala Ser Glu Trp His Gly Gly Ala Phe

355 360 365

Leu Pro Ser Ala Glu Ala Leu Gln Ala Tyr Arg Val Leu Ala Pro Gln

370 375 380

Ala Tyr Pro Glu Ile Lys Lys Thr Ile Glu Gln Val Val Ala Ser Gly

385 390 395 400

Leu Ile Tyr Leu Pro Ser Gly Val Arg Asp Leu His Asn Pro Gln Leu

405 410 415

Asp Lys Tyr Leu Ser Thr Tyr Cys Arg Gly Ser Gly Gly Met Gly His

420 425 430

Arg Glu Arg Ile Lys Ile Leu Lys Leu Leu Trp Asp Ala Ile Gly Ser

435 440 445

Glu Phe Gly Gly Arg His Glu Leu Tyr Glu Ile Asn Tyr Ala Gly Ser

450 455 460

Gln Asp Glu Ile Arg Met Gln Ala Leu Arg Gln Ala Ile Gly Ser Gly

465 470 475 480

Ala Met Lys Gly Met Leu Gly Met Val Glu Gln Cys Met Gly Asp Tyr

485 490 495

Asp Glu Asn Gly Trp Thr Val Pro His Leu His Asn Pro Asp Asp Ile

500 505 510

Asn Val Leu Asp Arg Ile Arg Gln

515 520

<210> 7

<211> 170

<212> PRT

<213> HpaC Gene (Artificial Sequence)

<400> 7

Met Gln Val Asp Glu Gln Arg Leu Arg Phe Arg Asp Ala Met Ala Ser

1 5 10 15

Leu Ala Ala Ala Val Asn Ile Val Thr Thr Ala Gly His Ala Gly Arg

20 25 30

Cys Gly Ile Thr Ala Thr Ala Val Cys Ser Val Thr Asp Thr Pro Pro

35 40 45

Ser Val Met Val Cys Ile Asn Ala Asn Ser Ala Met Asn Pro Val Phe

50 55 60

Gln Gly Asn Gly Lys Leu Cys Ile Asn Val Leu Asn His Glu Gln Glu

65 70 75 80

Leu Met Ala Arg His Phe Ala Gly Met Thr Gly Met Ala Met Glu Glu

85 90 95

Arg Phe His Gln Pro Cys Trp Gln Asn Gly Pro Leu Gly Gln Pro Val

100 105 110

Leu Asn Gly Ala Leu Ala Gly Leu Glu Gly Glu Ile Ser Glu Val Gln

115 120 125

Thr Ile Gly Thr His Leu Val Tyr Leu Val Ala Ile Lys Asn Ile Ile

130 135 140

Leu Ser Gln Asp Gly His Gly Leu Ile Tyr Phe Lys Arg Arg Phe His

145 150 155 160

Pro Val Arg Leu Glu Met Glu Ala Pro Val

165 170

<210> 8

<211> 293

<212> PRT

<213> TyrC Gene (Artificial Sequence)

<400> 8

Met Thr Val Phe Lys His Ile Ala Ile Ile Gly Leu Gly Leu Ile Gly

1 5 10 15

Ser Ser Ala Ala Arg Ala Thr Lys Ala Tyr Cys Pro Asp Val Thr Val

20 25 30

Ser Leu Tyr Asp Lys Ser Glu Phe Val Cys Asp Arg Ala Arg Ala Leu

35 40 45

Asn Leu Gly Asp Asn Val Thr Asp Asp Ile Gln Asp Ala Val Arg Glu

50 55 60

Ala Asp Leu Val Leu Leu Cys Val Pro Val Arg Ala Met Gly Ile Val

65 70 75 80

Ala Ala Ala Met Ala Pro Ala Leu Lys Lys Asp Val Ile Ile Cys Asp

85 90 95

Thr Gly Ser Val Lys Val Ser Val Ile Lys Thr Leu Gln Asp Asn Leu

100 105 110

Pro Asn His Ile Ile Val Pro Ser His Pro Leu Ala Gly Thr Glu Asn

115 120 125

Asn Gly Pro Asp Ala Gly Phe Ala Glu Leu Phe Gln Asp His Pro Val

130 135 140

Ile Leu Thr Pro Asp Ala His Thr Pro Ala Gln Ala Ile Ala Tyr Ile

145 150 155 160

Ala Asp Tyr Trp Glu Glu Ile Gly Gly Arg Ile Asn Leu Met Ser Ala

165 170 175

Glu His His Asp His Val Leu Ala Leu Thr Ser His Leu Pro His Val

180 185 190

Ile Ala Tyr Gln Leu Ile Gly Met Val Ser Gly Tyr Glu Lys Lys Ser

195 200 205

Arg Thr Pro Ile Met Arg Tyr Ser Ala Gly Ser Phe Arg Asp Ala Thr

210 215 220

Arg Val Ala Ala Ser Glu Pro Arg Leu Trp Gln Asp Ile Met Leu Glu

225 230 235 240

Asn Ala Pro Ala Leu Leu Pro Val Leu Asp His Phe Ile Ala Asp Leu

245 250 255

Lys Lys Leu Arg Thr Ala Ile Ala Ser Gln Asp Glu Asp Tyr Leu Leu

260 265 270

Glu His Phe Lys Glu Ser Gln Lys Ala Arg Leu Ala Leu Lys Thr Asp

275 280 285

His Asp Ile His Pro

290

Claims

1. The saccharomyces cerevisiae recombinant strain is characterized in that the saccharomyces cerevisiae recombinant strain integrates genomeRgTALGene, gene,HpaBGenes andHpaCa gene ofRgTALThe base sequence of the gene is shown as SEQ ID NO: 1, saidHpaBThe base sequence of the gene is shown as SEQ ID NO: 2, saidHpaCThe base sequence of the gene is shown as SEQ ID NO: 3, saidRgTALThe corresponding amino acid sequence of the gene is shown as SEQ ID NO: 5, saidHpaBThe corresponding amino acid sequence of the gene is shown as SEQ ID NO: 6, said HpaCThe corresponding amino acid sequence of the gene is shown as SEQ ID NO: 7, the saccharomyces cerevisiae recombinant strain also comprises a strain with a knockout on a saccharomyces cerevisiae chromosomeAro3AndAro10a gene; overexpression of mutants not subject to feedback inhibition by tyrosineAro4 ^K229LAndAro7 ^G141Sa gene; the gene sequence of the preprenzoate dehydrogenase TyrC which is over-expressed and derived from zymomonas mobilis is shown as SEQ ID NO: 4, and the corresponding amino acid sequence is shown as SEQ ID NO: 8, the construction method of the saccharomyces cerevisiae recombinant bacteria comprises the following steps:

1) recombinant vector pUMRI-13-HpaB-HpaCAnd pUMRI-11-RgTALObtaining a plasmid;

2) recombinant vector pUMRI-13-HpaB-HpaCIntroducing Saccharomyces cerevisiae to obtain YCA 113-1B;

3) the pUMRI-11-one obtained in the step 1)RgTALIntroducing the plasmid into YCA113-1B to obtain Saccharomyces cerevisiae recombinant strain YCA 113-2B;

4) pUMRI-ΔAro3-Aro4 ^K229L-Aro7 ^G141SIntroducing into Saccharomyces cerevisiae recombinant strain YCA113-2B to obtain YCA113-5B strain in the recombinant strain;

5) pUMRI-ΔAro10-TyrCThe strain was introduced into YCA113-5B to obtain a recombinant strain YCA 113-8B.

2. The construction method of the saccharomyces cerevisiae recombinant bacteria, which is characterized by comprising the following steps:

1) recombinant vector pUMRI-13-HpaB-HpaCAnd pUMRI-11- RgTALObtaining a plasmid;

3. The recombinant Saccharomyces cerevisiae strain of claim 1 for use in the production of caffeic acid.

4. A production method of caffeic acid, which is characterized in that the method comprises the step of carrying out fermentation culture on the saccharomyces cerevisiae recombinant strain of claim 1.