CN117866867B - Caffeic acid production strain, construction method and application thereof - Google Patents

Caffeic acid production strain, construction method and application thereof Download PDF

Info

Publication number
CN117866867B
CN117866867B CN202410275934.XA CN202410275934A CN117866867B CN 117866867 B CN117866867 B CN 117866867B CN 202410275934 A CN202410275934 A CN 202410275934A CN 117866867 B CN117866867 B CN 117866867B
Authority
CN
China
Prior art keywords
strain
gene
caffeic acid
overexpression
culture
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410275934.XA
Other languages
Chinese (zh)
Other versions
CN117866867A (en
Inventor
徐庆阳
肖志刚
袁梦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN202410275934.XA priority Critical patent/CN117866867B/en
Publication of CN117866867A publication Critical patent/CN117866867A/en
Application granted granted Critical
Publication of CN117866867B publication Critical patent/CN117866867B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a caffeic acid producing strain and a construction method and application thereof, wherein the caffeic acid producing strain is obtained by further modifying a starting strain on the basis of the coumaric acid producing strain by utilizing a metabolic engineering means, in particular to adjusting the expression intensity of pykF, tyrP, rgTal, fre, tyrA fbr genes, carrying out heterologous expression on KpHpaBC, constructing PETH01 plasmids capable of expressing KpHpaBC genes on the basis of PETX plasmids, and the caffeic acid producing strain takes glucose as a carbon source, does not need to add tyrosine substrates, has the advantages of low production cost and high stability of the strain, has high economic benefit, utilizes glucose as a substrate, adopts a fermentation method to efficiently and stably synthesize caffeic acid from scratch, has the advantages of low production cost, no toxic metabolic byproducts, and the like, and has very good industrial application value.

Description

Caffeic acid production strain, construction method and application thereof
Technical Field
The invention relates to the technical production field of fermentation engineering, in particular to a caffeic acid production strain, a construction method and application thereof.
Background
Caffeic acid (CAFFEIC ACID), also known as 3, 4-dihydroxycinnamic acid, is a natural phenolic acid compound existing in various plants, has the functions of resisting oxidation, inflammation and tumor, is a precursor of a plurality of important compounds, and has wide application in the fields of foods, medicines, cosmetics and the like.
At present, the caffeic acid synthesis method mainly comprises a plant extraction method, a chemical synthesis method and a microbial fermentation method. Because caffeic acid exists in coffee and various plants such as herba Artemisiae Scopariae, herba Cynarae, flos Lonicerae, etc., it can be directly extracted from these plants, but the plant growth cycle is long, the product accumulation is low, and multiple solvents are needed in the plant extraction process, thus limiting the large-scale production; the chemical synthesis method has the problems of high energy consumption, more byproducts, low yield, high pollution and the like; the microbial fermentation method takes glucose as an energy source for microbial growth, and caffeic acid is synthesized from the head without adding a substrate, so that the production cost is reduced, the fermentation process condition is mild, and the method has potential of industrial production.
There are two distinct biosynthetic pathways for caffeic acid in organisms. One of the ways is to produce cinnamic acid by deaminase catalyzing phenylalanine and then produce p-coumaric acid by cinnamic acid 4-hydroxylase catalyzing cinnamic acid, and finally produce caffeic acid under the action of 4-hydroxyphenylacetic acid-3-monooxygenase. The other way is to take tyrosine as a substrate and produce caffeic acid through continuous deamination and hydroxylation modification, and the synthetic way has the advantages of short reaction path, high catalytic efficiency and the like, so that the path is generally adopted to synthesize caffeic acid in microorganisms.
However, at present, the process of synthesizing caffeic acid in microorganisms by using tyrosine as a substrate is affected by problems of excessive accumulation of intermediate products, limited synthesis of cofactors, poor product tolerance and the like, and the yield is not ideal, so how to synthesize caffeic acid by using a biological method and obtain higher yield is a problem to be solved at present.
Disclosure of Invention
The invention aims to provide a caffeic acid producing strain.
Another technical problem to be solved by the present invention is to provide a method for constructing the caffeic acid producing strain.
Another technical problem to be solved by the present invention is to provide the use of the above-mentioned caffeic acid-producing strain.
In order to solve the technical problems, the technical scheme of the invention is as follows:
A caffeic acid producing strain, which is a strain HY07, is obtained by further modifying a coumaric acid producing strain based on a starting strain by utilizing a metabolic engineering means, specifically, adjusting the expression intensity of pykF, tyrP, rgTal, fre, tyrA fbr genes, carrying out heterologous expression on KpHpaBC, and constructing a PETH01 plasmid capable of expressing KpHpaBC genes (4-hydroxyphenylacetic acid-3-monooxygenase genes) based on PETX plasmid, wherein:
Knocking out the pykF gene on the genome of the coumaric acid production strain of the original strain so as to ensure that the gene is not expressed,
The P trc promoter was used to control the overexpression of the tyrP gene at yjiT pseudogene locus,
The P T7 promoter was used to control RgTal gene overexpression at ycgH pseudogene locus,
The use of the P trc promoter at the yeep pseudogene locus controls the overexpression of the fre gene,
The P trc promoter is used for controlling the overexpression of tyrA fbr gene at the ilvG pseudogene locus,
The P trc promoter was used to control KpHpaBC gene overexpression at ylbE pseudogene locus,
The T7 promoter was used on PETH.sub.01 plasmid to control KpHpaBC gene overexpression.
Preferably, the above caffeic acid producing strain, the metabolic engineering means is CRISPR-Cas9 gene editing technology.
Preferably, the above caffeic acid producing strain, the starting strain is p-coumaric acid producing strain ZG08. The p-coumaric acid producing strain ZG08 is the strain ZG08 described in the specification of patent application number 202311666349.4.
Preferably, the above-mentioned caffeic acid producing strain, wherein the pyruvic acid kinase gene (pykF gene) is derived from escherichia coli, and decreasing the expression level of the pyruvic acid gene is effective to promote condensation of PEP and erythrose 4-phosphate to form DAHP, which is the first product in the aromatic amino acid pathway, and to promote accumulation of tyrosine, a precursor of caffeic acid.
Preferably, the above-mentioned caffeic acid producing strain, the tyrP gene (tyrosine transporter gene) is derived from Escherichia coli, and the enzyme encoded thereby can promote the absorption of tyrosine by the cells and transport of intracellular caffeic acid.
Preferably, in the above caffeic acid producing strain, the RgTal gene (tyrosine ammonia lyase gene) is derived from a RgTal gene after codon optimization of rhodotorula glutinis, and the coded enzyme can promote the generation of coumaric acid by a precursor of caffeic acid.
Preferably, the above-mentioned caffeic acid producing strain, the fre gene (flavin reductase gene) is derived from Escherichia coli, and the enzyme encoded thereby promotes the reduction of FAD to FADH 2.
Preferably, the above caffeic acid producing strain, the tyrA fbr gene (prephenate dehydrogenase gene) is derived from escherichia coli, and is obtained by modifying the tyrA gene by codons, specifically: methionine at position 53 is modified to isoleucine, alanine at position 354 is modified to valine, which encodes the first enzyme for tyrosine synthesis, which releases negative feedback inhibition after mutation, and which effectively increases the yield of caffeic acid precursor tyrosine.
Preferably, in the above caffeic acid producing strain, the KpHpaBC gene (4-hydroxyphenylacetic acid-3-monooxygenase gene) is derived from KpHpaBC gene after codon optimization of klebsiella pneumoniae, and the encoded enzyme is a key enzyme for catalyzing p-coumaric acid to generate caffeic acid.
Preferably, the nucleotide sequence of the P trc promoter of the caffeic acid producing strain is shown as a sequence table SEQ ID NO. 1; the nucleotide sequence of the P T7 promoter is shown in a sequence table SEQ ID NO. 2; the nucleotide sequence of the pykF gene is shown in a sequence table SEQ ID NO. 3; the nucleotide sequence of the tyrP gene is shown in a sequence table SEQ ID NO. 4; the nucleotide sequence of the RgTal gene is shown in a sequence table SEQ ID NO. 5; the nucleotide sequence of the fre gene is shown in a sequence table SEQ ID NO. 6; the nucleotide sequence of the tyrA fbr gene is shown in a sequence table SEQ ID NO. 7; the nucleotide sequence of KpHpaBC gene is shown in sequence table SEQ ID NO. 8.
Preferably, in the caffeic acid producing strain, the PETX plasmid has the partial characteristics of PET-28a (+) plasmid vector and is modified appropriately, and the base sequence of the PETX plasmid is shown as a sequence table SEQ ID NO. 9.
Preferably, the nucleotide sequence of the PETH plasmid of the caffeic acid producing strain is shown in a sequence table SEQ ID NO. 10.
The construction method of the caffeic acid producing strain is based on directional transformation of a starting strain on a coumaric acid producing strain ZG08, and comprises the following specific steps:
(1) Knocking out the pykF gene on the genome of the original strain ZG08 to obtain a strain HY01;
(2) Taking the strain HY01 as an original strain, and controlling tyrP gene overexpression at yjiT pseudogene locus by using a P trc promoter to obtain a strain HY02;
(3) Taking the strain HY02 as an original strain, and controlling RgTal gene overexpression at ycgH pseudogene sites by using a P T7 promoter to obtain a strain HY03;
(4) Taking the strain HY03 as an original strain, and controlling the overexpression of the fre gene by using a P trc promoter at yeep pseudogene locus to obtain a strain HY04;
(5) The strain HY04 is taken as a starting strain, and the P trc promoter is used for controlling the tyrA fbr gene heterologous expression at the ilvG pseudogene locus to obtain a strain HY05;
(6) Using a bacterial strain HY05 as an original bacterial strain, and controlling KpHpaBC gene overexpression at ylbE pseudogene sites by using a P trc promoter to obtain a bacterial strain HY06;
(7) The strain HY07 is taken as an original strain, a PETH plasmid which uses a T7 promoter to control KpHpaBC is constructed on the basis of PETX plasmid, and the strain HY07 is obtained through overexpression, and the strain HY07 is the target strain after transformation is successful.
The application of the caffeic acid producing strain in the aspect of producing caffeic acid by fermentation.
Preferably, the caffeic acid producing strain is prepared by using a mechanical stirring type fermentation tank, and synthesizing caffeic acid by seed culture and fermentation culture with glucose as a substrate.
Preferably, the application of the caffeic acid producing strain comprises the following specific steps:
(1) Seed activation: streaking and inoculating caffeic acid producing strain on kanamycin resistance activating inclined plane, culturing at 32deg.C for 12 hr, and passaging for 2 times; eluting activated thalli on the inclined plane by sterilized distilled water, and transferring the thalli into a 5L mechanical stirring type fermentation tank to start seed culture;
(2) Seed culture: using a mechanical stirring type fermentation tank, wherein the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the culture dissolved oxygen value is maintained at 40% by adjusting the stirring rotation speed or ventilation quantity, and the inoculation requirement is met when the OD 600nm is 15;
(3) Fermentation culture: the mechanical stirring type fermentation tank is used, the inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40% by adjusting the stirring speed or ventilation, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding 80% (mass volume fraction) glucose solution, and the fermentation period is less than or equal to 50h.
Preferably, the use of the above-mentioned caffeic acid producing strain, the seed culture medium used in the seed culture: glucose 30 g/L, yeast 5 g/L, peptone 3 g/L,(NH4)2SO41 g/L,KH2PO42 g/L,MgSO4·7H2O 1 g/L, citric acid 3g/L, glutamic acid 3g/L, and the balance being water.
Preferably, the use of the above-mentioned caffeic acid producing strain, the fermentation medium used in the fermentation culture: 15 g/L glucose, 5g/L yeast powder, 2 g/L peptone, 3 g/L,(NH4)2SO41.5 g/L,KH2PO43 g/L,MgSO4·7H2O 2 g/L, glutamic acid 3 g/L citric acid, 20 mg/L MnSO 4·H2O 10 mg/L,FeSO4·7H2 O, 0.3 mg/L biotin, 10 mg/L riboflavin, and the balance being water.
The above culture medium can be prepared by standard method.
Preferably, the above-mentioned caffeic acid producing strain is used, and PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar stream during fermentation culture, specifically: to 80% (mass volume fraction) glucose solution per liter, 6mgPLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin (i.e. PLP 6mg/L Sugar solution , choline chloride 1.5g/L Sugar solution , betaine 1g/L Sugar solution , riboflavin 20mg/L Sugar solution ) were added.
The beneficial effects are that:
The caffeic acid production strain is obtained by adopting a directional transformation method of de novo synthesis through a caffeic acid metabolic synthesis way, glucose is used as a carbon source, tyrosine substrates are not required to be added, the production cost is low, the caffeic acid production strain has the advantage of high strain stability, the caffeic acid production strain has very high economic benefit, the caffeic acid production strain utilizes glucose as a substrate, the caffeic acid is efficiently and stably synthesized from the de novo through a fermentation method, the production cost is low, no toxic metabolic byproducts are generated, and the like, and the caffeic acid 15.1g/L is produced during 50 h of fermentation, so that the caffeic acid production strain has very good industrial application value; because caffeic acid has toxic action on thalli, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added in the application process, so that the catalytic demands of tyrosine ammonia lyase and 4-hydroxyphenylacetic acid-3-monooxygenase genes can be ensured on one hand, the activity of strains can be ensured on the other hand, the production benefit is improved, and a foundation is laid for realizing the mass production of caffeic acid.
Drawings
FIG. 1 is a diagram of the process of genetic engineering of caffeic acid producing strains from the head synthesis pathway.
Detailed Description
In order to enable those skilled in the art to better understand the technical scheme of the present invention, the technical scheme of the present invention will be further described in detail below with reference to the specific embodiments.
The percentage "%" referred to in the examples refers to mass percent, the percentage of the solution refers to grams of solute contained in 100 mL, and the percentage between liquids refers to the volume ratio of the solution at 25 ℃.
The starting strain used in the examples was p-coumaric acid producing strain ZG08, which is strain ZG08 described in the specification of patent application number 202311666349.4. The corresponding promoters and genes are shown in the sequence table.
As shown in FIG. 1, a caffeic acid producing strain was constructed by the following method: knocking out the pykF gene on the genome of a coumaric acid production strain ZG08 of the original strain so as not to express the pykF gene; the P trc promoter was used to control tyrP gene overexpression at yjiT pseudogene locus; the P T7 promoter was used to control RgTal gene overexpression at ycgH pseudogene locus; the use of the P trc promoter at the yeep pseudogene locus controls the overexpression of the fre gene; the P trc promoter is used for controlling the overexpression of tyrA fbr gene at the ilvG pseudogene locus; the P trc promoter was used to control KpHpaBC gene overexpression at ylbE pseudogene locus; the T7 promoter was used on PETH.sub.01 plasmid to control KpHpaBC gene overexpression.
Example 1
1. Method for gene editing
The adopted gene editing method refers to literature （Li Y,Lin Z,Huang C,et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic Engineering,2015,31：13-21.）., and the method relates to engineering plasmids pREDCas and pGRB, wherein pREDCas carries an elimination system of a gRNA expression plasmid pGRB, a Red recombination system of lambda phage, a Cas9 protein expression system and the resistance of Qamycin (working concentration: 100 mg/L); pGRB pUC18 was used as a backbone, comprising the promoter J23100, the gRNA-Cas9 binding domain sequence and the terminator sequence, and ampicillin resistance (working concentration: 100 mg/L). The terminology referred to in examples 2-4 below is explained in this article.
2. The primers used in the strain construction are shown in Table 1.
TABLE 1 primers involved in the construction of strains
Primer name Primer sequence (5 '-3') Sequence number
pykF-pGRB-S AGTCCTAGGTATAATACTAGTGACAAACAGGACCTGATCTTGTTTTAGAGCTAGAA SEQ ID NO.11
pykF-pGRB-A TTCTAGCTCTAAAACAAGATCAGGTCCTGTTTGTCACTAGTATTATACCTAGGACT SEQ ID NO.12
pykF-U-S ATCCTTAGAGCGAGGCACC SEQ ID NO.13
pykF-U-A CCAGTTCTTTACCCAGACGCAGGATAGCGGCGGTTTTA SEQ ID NO.14
pykF-D-S TAAAACCGCCGCTATCCTGCGTCTGGGTAAAGAACTGG SEQ ID NO.15
pykF-D-A GATCGTTCGCTCAAAGAAGC SEQ ID NO.16
pGRB-yjiT-S AGTCCTAGGTATAATACTAGTCTGATAACCTCAATTCCTTAGTTTTAGAGCTAGAA SEQ ID NO.17
pGRB-yjiT-A TTCTAGCTCTAAAACTAAGGAATTGAGGTTATCAGACTAGTATTATACCTAGGACT SEQ ID NO.18
yjiT-U-S CATTCCCTCTACAGAACTAGCCCTT SEQ ID NO.19
yjiT-U-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAAAAACAGGCAGCAAAGTCCC SEQ ID NO.20
yjiT-D-S GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATAAGCACTACCTGTGAAGGGATGT SEQ ID NO.21
yjiT-D-A CAGGGCTTCCACAGTCACAAT SEQ ID NO.22
yjiT-tyrP-S CGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCGTGAAAAACAGAACCCTGGGAA SEQ ID NO.23
yjiT-tyrP-A ATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTCACCCCACTTCTGGTAACAACC SEQ ID NO.24
pGRB-ycgH-S AGTCCTAGGTATAATACTAGTTATGCGTCTGAACGACCGTGGTTTTAGAGCTAGAA SEQ ID NO.25
pGRB-ycgH-A TTCTAGCTCTAAAACCACGGTCGTTCAGACGCATAACTAGTATTATACCTAGGACT SEQ ID NO.26
ycgH-U-S TAAACTCGTCAGCGGCACAA SEQ ID NO.27
ycgH-U-A CTCCTTCTTAAAGTTAAACAAAATTATTTCTAGACCCTATAGTGAGTCGTATTAGGTAGGCGTTTCTGTTGATTCTG SEQ ID NO.28
ycgH-D-S CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCGTGTCGGATTATCGTTCGA SEQ ID NO.29
ycgH-D-A GATTCAGGTTGCCATTTACGC SEQ ID NO.30
ycgH-RgTal-S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGCGCCGCGCCCGACGAG SEQ ID NO.31
ycgH-RgTal-A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTAGGCTAACATTTTCAGCAGCACG SEQ ID NO.32
pGRB-yeeP-S AGTCCTAGGTATAATACTAGTAGGCGGTATTCCGTCTGTTCGTTTTAGAGCTAGAA SEQ ID NO.33
pGRB-yeeP-A TTCTAGCTCTAAAACGAACAGACGGAATACCGCCTACTAGTATTATACCTAGGACT SEQ ID NO.34
yeeP-U-S GGTCAGGAGGTAACTTATCAGCG SEQ ID NO.35
yeeP-U-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAATGGCAGGGCTCCGTTTT SEQ ID NO.36
yeeP-D-S AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGAACTGGATTTTCTTCTGAACCTGT SEQ ID NO.37
yeeP-D-A ACGATGTCAGCAGCCAGCA SEQ ID NO.38
yeeP-fre-S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGACAACCTTAAGCTGTAAAGTGACC SEQ ID NO.39
yeeP-fre-A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTCAGATAAATGCAAACGCATCGC SEQ ID NO.40
ilvG-pGRB-S AGTCCTAGGTATAATACTAGTTATCGGCACTGACGCATTTCGTTTTAGAGCTAGAA SEQ ID NO.41
ilvG-pGRB-A TTCTAGCTCTAAAACGAAATGCGTCAGTGCCGATAACTAGTATTATACCTAGGACT SEQ ID NO.42
ilvG-U-S CCGAGGAGCAGACAATGAATAACAG SEQ ID NO.43
ilvG-U-A GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACGGTGATGGCAACAACAGGG SEQ ID NO.44
ilvG-D-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGCTATCTACGCGCCGTTGTTG SEQ ID NO.45
ilvG-D-A GAAGGCGCTGGCTAACATGAGG SEQ ID NO.46
ilvG-tyrAfbr-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGTTGCTGAATTGACCGC SEQ ID NO.47
ilvG-tyrAfbr-A GACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACTGGCGATTGTCATTCGC SEQ ID NO.48
ylbE-pGRB-U AGTCCTAGGTATAATACTAGTACACTGGCTGGATGTGCAACGTTTTAGAGCTAGAA SEQ ID NO.49
ylbE-pGRB-D TTCTAGCTCTAAAACGTTGCACATCCAGCCAGTGTACTAGTATTATACCTAGGACT SEQ ID NO.50
ylbE-U-S ACCCAACCTTACGCAACCAG SEQ ID NO.51
ylbE-U-A GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTGTTCGATAACCGCAGCAT SEQ ID NO.52
ylbE-D-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCGCTGGCGTGCTTTGAAC SEQ ID NO.53
ylbE-D-A GGCGTAACTCAGCAGGCAG SEQ ID NO.54
ylbE-KpHpaBC-S TATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAACCGGAAGATTTTCGCG SEQ ID NO.55
ylbE-KpHpaBC-A CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACACCGCCACTTCCATTTCC SEQ ID NO.56
KpHpaBC-Pet-S GTGAGCGGATAACAATTCCCCTCTAGAATGAAACCGGAAGATTTTCGCG SEQ ID NO.57
KpHpaBC-Pet-A GTTTCCGCGGTGCTGCCCATGAATTCTTACACCGCCACTTCCATTTCC SEQ ID NO.58
Example 2
This example is intended to illustrate the steps of knocking out the genomic pykF gene, in particular as follows:
① The E.coli W3110 genome is used as a template, pykF-U-S, pykF-U-A and pykF-D-S, pykF-D-A are respectively used as primers, an upstream homology arm and a downstream homology arm are obtained through HS enzyme PCR amplification, and then delta pykF gene knockout fragments are obtained through HS enzyme overlap PCR by using the primers as templates, wherein the gene integration fragments consist of the pykF upstream homology arm and the pykF downstream homology arm.
② Constructing Sub>A DNA fragment containing Sub>A target sequence for pGRB-pykF by using pGRB-pykF-S and pGRB-pykF-A as primers through Sub>A PCR annealing program, carrying out transformation on the DNA fragment into Top10 transformation competent cells, screening to obtain positive transformants, and extracting plasmid pGRB-pykF;
③ The ΔpykF knockout fragment obtained in step ②、③ was electrotransformed with pGRB-pykF plasmid into ZG08 strain, and positive transformants were obtained by screening and designated HY01.
Example 3
This example is intended to illustrate the steps for controlling the overexpression of tyrP gene using the P trc promoter at yjiT pseudogene locus, as follows:
① The method comprises the steps of taking an escherichia coli W3110 genome as a template, respectively taking yjiT-U-S, yjiT-U-A, yjiT-D-S, yjiT-D-A and tyrP-S, tyrP-A as primers, obtaining an upstream homology arm, a downstream homology arm and a target gene fragment through HS enzyme PCR amplification, and obtaining a P trc -tyrP (ycgH) gene integration fragment by taking the upstream homology arm, the P trc -tyrP target gene and the ycgH downstream homology arm through HS enzyme overlap PCR by taking the upstream homology arm, the downstream homology arm and the target gene fragment as templates.
② DNA fragments containing target sequences used in pGRB-yjiT were constructed by PCR annealing procedure using pGRB-yjiT-S and pGRB-yjiT-A as primers, transformed into Top10 transformed competent cells, screened to obtain positive transformants, and plasmids pGRB-yjiT were extracted.
③ The P trc -tyrP (yjiT) gene integrated fragment obtained in the step ②、③ and a pGRB-yjiT plasmid are electrotransferred into an HY01 strain, and positive transformants are obtained through screening and named HY02.
Example 4
This example is intended to illustrate the steps for controlling the overexpression of the RgTal gene using the P T7 promoter at the ycgH pseudogene locus, as follows:
① The E.coli W3110 genome is used as a template, ycgH-U-S, ycgH-U-A, ycgH-D-S, ycgH-D-A and RgTal-S, rgTal-A are respectively used as primers, an upstream homology arm, a downstream homology arm and a target gene fragment are obtained through HS enzyme PCR amplification, then the upstream homology arm, the downstream homology arm and the target gene fragment are used as templates, and the P T7 -RgTal (ycgH) gene integration fragment is obtained through HS enzyme overlap PCR, wherein the gene integration fragment consists of ycgH upstream homology arms, P T7 -RgTal target genes and ycgH downstream homology arms.
② DNA fragments containing target sequences used in pGRB-ycgH were constructed by PCR annealing procedure using pGRB-ycgH-S and pGRB-ycgH-A as primers, transformed into Top10 transformed competent cells, screened to obtain positive transformants, and plasmids pGRB-ycgH were extracted.
③ The P T7 -RgTal (ycgH) gene integrated fragment obtained in the step ②、③ and a pGRB-ycgH plasmid are electrotransformed into an HY02 strain, and positive transformants are obtained through screening and named HY03.
Example 5
This example is intended to illustrate the steps for controlling the overexpression of the fre gene at yeeP pseudogene locus using the P trc promoter, as follows:
① The E.coli W3110 genome is used as a template, yeeP-U-S, yeeP-U-A, yeeP-D-S, yeeP-D-A and fre-S, fre-A are respectively used as primers, an upstream homology arm, a downstream homology arm and a target gene fragment are obtained through HS enzyme PCR amplification, then the upstream homology arm, the downstream homology arm and the target gene fragment are used as templates, and the P trc -fre (yeeP) gene integration fragment is obtained through HS enzyme overlap PCR, wherein the gene integration fragment consists of the yeeP upstream homology arm, the P trc -fre target gene and the yeeP downstream homology arm.
② DNA fragments containing target sequences used in pGRB-yeeP were constructed by PCR annealing procedure using pGRB-yeeP-S and pGRB-yeeP-A as primers, transformed into Top10 transformed competent cells, screened to obtain positive transformants, and plasmids pGRB-yeeP were extracted.
③ The P trc -fre (yeeP) gene integrated fragment obtained in the step ②、③ and a pGRB-yeeP plasmid are electrotransformed into an HY03 strain, and positive transformants are obtained through screening and named HY04.
Example 6
This example is intended to illustrate the steps for controlling the overexpression of tyrA fbr gene at the ilvG pseudogene locus using the P trc promoter, the specific steps being as follows:
① The method comprises the steps of taking an escherichia coli W3110 genome as a template, respectively taking ilvG-U-S, ilvG-U-A, ilvG-D-S, ilvG-D-A and tyrA fbr-S、tyrAfbr -A as primers, obtaining an upstream homology arm, a downstream homology arm and a target gene fragment through HS enzyme PCR amplification, and obtaining a P trc-tyrAfbr (ilvG) gene integration fragment by taking the same as the template through HS enzyme overlap PCR, wherein the gene integration fragment consists of the ilvG upstream homology arm, the P trc-tyrAfbr target gene and the ilvG downstream homology arm.
② Ext> byext> usingext> pGRBext> -ext> ilvGext> -ext> Sext> andext> pGRBext> -ext> ilvGext> -ext> Aext> asext> primersext>,ext> constructingext> aext> DNAext> fragmentext> containingext> aext> targetext> sequenceext> forext> pGRBext> -ext> ilvGext> throughext> aext> PCRext> annealingext> programext>,ext> transformingext> theext> DNAext> fragmentext> intoext> Topext> 10ext> transformedext> competentext> cellsext>,ext> screeningext> toext> obtainext> positiveext> transformantsext>,ext> andext> extractingext> plasmidext> pGRBext> -ext> ilvGext>.ext>
③ The P trc-tyrAfbr (ilvG) gene integrated fragment obtained in the step ②、③ and a pGRB-ilvG plasmid are electrotransformed into an HY04 strain, and positive transformants are obtained through screening and named HY05.
Example 7
This example is intended to illustrate the steps for controlling heterologous expression of a KpHpaBC gene using the P trc promoter at ylbE pseudogene locus, as follows:
① The method comprises the steps of taking an escherichia coli W3110 genome as a template, respectively taking ylbE-U-S, ylbE-U-A, ylbE-D-S, ylbE-D-A as a primer, obtaining an upstream homology arm and a downstream homology arm through HS enzyme PCR amplification, taking rhodotorula glutinis genome as the template, taking ylbE-KpHpaBC-S, ylbE-KpHpaBC-A as the primer, obtaining a target gene fragment through HS enzyme PCR amplification, carrying out codon optimization on the target gene fragment, and obtaining a P trc -KpHpaBC (ylbE) gene integration fragment through HS enzyme overlap PCR by taking the upstream homology arm, the downstream homology arm and the target gene fragment after the codon optimization as the template, wherein the gene integration fragment consists of ylbE upstream homology arm, P trc -KpHpaBC target gene and ylbE downstream homology arm.
② DNA fragments containing target sequences used in pGRB-ylbE were constructed by PCR annealing procedure using pGRB-ylbE-S and pGRB-ylbE-A as primers, transformed into Top10 transformed competent cells, screened to obtain positive transformants, and plasmids pGRB-ylbE were extracted.
③ The P trc -KpHpaBC (ylbE) gene integrated fragment obtained in the step ②、③ and a pGRB-ylbE plasmid are electrotransformed into an HY05 strain, and positive transformants are obtained through screening and named HY06.
Example 8
This example is intended to illustrate the steps of constructing a PETH01 plasmid capable of expressing KpHpaBC gene (4-hydroxyphenylacetic acid-3-monooxygenase gene), as follows:
① The genome of klebsiella pneumoniae is used as a template, kpHpaBC-Pet-S, kpHpaBC-Pet-A is used as a primer, a target gene fragment is obtained through HS enzyme PCR amplification, and codon optimization is carried out on the target gene fragment.
③ Xba I and EcoR I are used as restriction enzyme sites, PETX plasmid is digested, a linearization vector and KpHpaBC target gene fragment after codon optimization are connected by utilizing recombinase, and the linearization vector is transformed into Top10 competent cells, positive transformants are obtained by screening, and plasmid PETH is extracted.
④ The PETH01 plasmid obtained in the step ③ is electrotransformed into the HY06 strain, and positive transformant is obtained through screening and named HY07.
Example 9
The strain HY07 obtained in example 8 was used as a caffeic acid producing strain, and this example was intended to illustrate a method for producing caffeic acid using the producing strain, and the specific cultivation method was as follows:
seed activation: inoculating a storage strain at-80 ℃ to a kanamycin resistance activation inclined plane by streaking, culturing for 12 hours at 32 ℃ and passaging for 2 times; eluting the activated thallus on the inclined plane by sterilized distilled water, and transferring the thallus to a 5L mechanical stirring type fermentation tank to start seed culture.
Seed culture: using a 5L mechanical stirring type fermentation tank, wherein the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40% by adjusting the stirring rotation speed or ventilation quantity, and the inoculation requirement is met when the OD 600nm is 15; the seed culture medium adopted is as follows: glucose 30 g/L, yeast 5 g/L, peptone 3 g/L,(NH4)2SO41 g/L,KH2PO42 g/L,MgSO4·7H2O 1 g/L, citric acid 3g/L, glutamic acid 3g/L and the balance of water;
Fermentation culture: using a 5L mechanical stirring type fermentation tank, wherein the fermentation inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40% by adjusting the stirring rotation speed or ventilation, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding 80% (mass volume fraction) glucose solution, and the fermentation period is 50h; the fermentation medium adopted is: 15 g/L glucose, 5g/L yeast powder, 2 g/L peptone, 3 g/L,(NH4)2SO41.5 g/L,KH2PO43 g/L,MgSO4·7H2O 2 g/L, glutamic acid 3 g/L citric acid, 20mg/L MnSO 4·H2O 10 mg/L,FeSO4·7H2 O, 0.3 mg/L biotin, 10 mg/L riboflavin, and the balance being water.
During fermentation culture, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar stream, specifically: to 80% (mass volume fraction) glucose solution per liter, 6mgPLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin, namely PLP 6mg/L Sugar solution , choline chloride 1.5g/L Sugar solution , betaine 1g/L Sugar solution , riboflavin 20mg/L Sugar solution were added.
Example 10
The strain HY07 is used as a production strain, and the effect of PLP, choline chloride, betaine and riboflavin in caffeic acid fermentation applications is described in this example. The specific fermentation culture was as in example 9, and four groups of controls were set up, with the only difference being the amounts of PLP, choline chloride, betaine and riboflavin added to the 80% glucose solution. The invention discloses data for four groups of fermentors for 50h, the results are shown in tables 2, 3, 4, 5 and 6.
TABLE 2 PLP influence on biomass of cells and caffeic acid production
Group 1 Group 2 Group 3 Group 4
PLP addition amount (mg/L Sugar solution ) 0 3 6 9
Bacterial biomass OD 600nm 88.1 87.5 89.4 90.1
Caffeic acid yield g/L 3.3 5.1 7.6 5.8
TABLE 3 Effect of Choline chloride on cell biomass
Group 1 Group 2 Group 3 Group 4
Choline chloride addition (g/L Sugar solution ) 0 1 1.5 2
Bacterial biomass OD 600nm 88.4 96.7 106.8 98.1
TABLE 4 Effect of betaine on cell biomass
Group 1 Group 2 Group 3 Group 4
Betaine addition amount (g/L Sugar solution ) 0 1 2 3
Bacterial biomass OD 600nm 86.1 113.3 105.2 99.7
TABLE 5 Effect of riboflavin on biomass of thallus and production of caffeic acid
Group 1 Group 2 Group 3 Group 4
Riboflavin addition (mg/L Sugar solution ) 5 10 20 30
Bacterial biomass OD 600nm 89.8 91.4 90.8 88.1
Caffeic acid yield g/L 5.7 7.8 10.2 9.1
TABLE 6 PLP influence of choline chloride, betaine and riboflavin on biomass of cells and caffeic acid production
Group 1 Group 2 Group 3 Group 4 Group 5 Group 6
PLP addition amount (mg/L Sugar solution ) 0 6 6 6 6 6
Choline chloride addition (g/L Sugar solution ) 0 1.5 0 0 1.5 0
Betaine addition amount (g/L Sugar solution ) 0 0 1 0 1 1
Riboflavin addition (mg/L Sugar solution ) 0 0 0 20 0 20
Bacterial biomass OD 600nm 87.5 105.7 112.9 89.4 122.3 114.7
Caffeic acid yield g/L 3.1 8.2 8.7 11.7 9.1 13.1
Group 7 Group 8 Group 9 Group 10 Group 11 Group 12
PLP addition amount (mg/L Sugar solution ) 0 0 0 0 6 6
Choline chloride addition (g/L Sugar solution ) 1.5 1.5 0 1.5 1.5 1.5
Betaine addition amount (g/L Sugar solution ) 1 0 1 1 0 1
Riboflavin addition (mg/L Sugar solution ) 0 20 20 20 20 20
Bacterial biomass OD 600nm 121.9 103.2 111.4 122.7 105.5 123.3
Caffeic acid yield g/L 4.5 11.6 12.5 12.9 13.3 15.1
The foregoing is merely illustrative of the preferred embodiments of this invention, and it will be appreciated by those skilled in the art that variations and modifications of the invention and strain changes, which are carried out by or based on the methods of this invention, may be made without departing from the spirit of this invention.

Claims (8)

1. A caffeic acid producing strain, characterized in that: the method is obtained by further modifying a coumaric acid production strain ZG08 on the basis of a starting strain by utilizing a metabolic engineering means, wherein the coumaric acid production strain ZG08 is the strain ZG08 in the specification of patent application number 202311666349.4, specifically, the expression intensity of pykF, tyrP, rgTal, fre, tyrA fbr gene is regulated, kpHpaBC is subjected to heterologous expression, and PETH01 plasmid for expressing KpHpaBC gene is constructed on the basis of PETX02 plasmid, wherein:
Knocking out the pykF gene on the genome of the coumaric acid production strain of the original strain so as to ensure that the gene is not expressed,
The P trc promoter was used to control the overexpression of the tyrP gene at yjiT pseudogene locus,
The P T7 promoter was used to control RgTal gene overexpression at ycgH pseudogene locus,
The use of the P trc promoter at the yeep pseudogene locus controls the overexpression of the fre gene,
The P trc promoter is used for controlling the overexpression of tyrA fbr gene at the ilvG pseudogene locus,
The P trc promoter was used to control KpHpaBC gene overexpression at ylbE pseudogene locus,
The T7 promoter was used to control KpHpaBC gene overexpression on PETH.sub.01 plasmid;
The nucleotide sequence of the P trc promoter is shown in a sequence table SEQ ID NO. 1; the nucleotide sequence of the P T7 promoter is shown in a sequence table SEQ ID NO. 2; the nucleotide sequence of the pykF gene is shown in a sequence table SEQ ID NO. 3; the nucleotide sequence of the tyrP gene is shown in a sequence table SEQ ID NO. 4; the nucleotide sequence of the RgTal gene is shown in a sequence table SEQ ID NO. 5; the nucleotide sequence of the fre gene is shown in a sequence table SEQ ID NO. 6; the nucleotide sequence of the tyrA fbr gene is shown in a sequence table SEQ ID NO. 7; the nucleotide sequence of the KpHpaBC gene is shown in a sequence table SEQ ID NO. 8; the base sequence of PETX plasmid is shown in SEQ ID NO.9 of the sequence table; the base sequence of PETH plasmid is shown in SEQ ID NO.10 of the sequence table.
2. The method for constructing a caffeic acid producing strain according to claim 1, wherein: the method is characterized by directionally modifying a coumaric acid production strain ZG08 based on an original strain, and comprises the following specific steps:
(1) Knocking out the pykF gene on the genome of the original strain ZG08 to obtain a strain HY01;
(2) Taking the strain HY01 as an original strain, and controlling tyrP gene overexpression at yjiT pseudogene locus by using a P trc promoter to obtain a strain HY02;
(3) Taking the strain HY02 as an original strain, and controlling RgTal gene overexpression at ycgH pseudogene sites by using a P T7 promoter to obtain a strain HY03;
(4) Taking the strain HY03 as an original strain, and controlling the overexpression of the fre gene by using a P trc promoter at yeep pseudogene locus to obtain a strain HY04;
(5) The strain HY04 is taken as a starting strain, and the P trc promoter is used for controlling the tyrA fbr gene heterologous expression at the ilvG pseudogene locus to obtain a strain HY05;
(6) Using a bacterial strain HY05 as an original bacterial strain, and controlling KpHpaBC gene overexpression at ylbE pseudogene sites by using a P trc promoter to obtain a bacterial strain HY06;
(7) The strain HY07 is taken as an original strain, a PETH plasmid which uses a T7 promoter to control KpHpaBC is constructed on the basis of PETX plasmid, and the strain HY07 is obtained through overexpression, and the strain HY07 is the target strain after transformation is successful.
3. Use of the caffeic acid producing strain according to claim 1 for the fermentative production of caffeic acid.
4. Use of a caffeic acid producing strain according to claim 3, wherein: and (3) using a mechanical stirring type fermentation tank to synthesize caffeic acid by seed culture and fermentation culture and taking glucose as a substrate.
5. Use of a caffeic acid producing strain according to claim 3 or 4, characterized in that: the method comprises the following specific steps:
(1) Seed activation: streaking and inoculating a caffeic acid production strain on a kanamycin resistance activation inclined plane, culturing and passaging;
(2) Seed culture: transferring the activated thalli into a mechanical stirring type fermentation tank, wherein the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40%, and the inoculation requirement is met when the OD 600nm is 15;
(3) Fermentation culture: the inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40%, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding glucose solution, and the fermentation period is less than or equal to 50 hours.
6. Use of a caffeic acid producing strain according to claim 5, wherein: the seed culture medium adopted in the seed culture comprises: glucose 30 g/L, yeast 5g/L, peptone 3 g/L,(NH4)2SO4 1 g/L,KH2PO4 2 g/L,MgSO4·7H2O 1 g/L, citric acid 3g/L, glutamic acid 3g/L, and the balance being water.
7. Use of a caffeic acid producing strain according to claim 5, wherein: the fermentation culture medium adopted in the fermentation culture comprises the following components: 15 g/L glucose, 5g/L yeast powder, 2 g/L peptone, 3 g/L,(NH4)2SO41.5 g/L,KH2PO43 g/L,MgSO4·7H2O 2 g/L, glutamic acid 3 g/L citric acid, 20 mg/L MnSO 4·H2O 10 mg/L,FeSO4·7H2 O, 0.3 mg/L biotin, 10 mg/L riboflavin, and the balance being water.
8. Use of a caffeic acid producing strain according to claim 5, wherein: during fermentation culture, PLP, choline chloride, betaine and riboflavin are added along with the sugar liquid flow, and the specific steps are as follows: to each liter of 80% glucose solution, 6mgPLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin were added.
CN202410275934.XA 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof Active CN117866867B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410275934.XA CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410275934.XA CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN117866867A CN117866867A (en) 2024-04-12
CN117866867B true CN117866867B (en) 2024-05-28

Family

ID=90579591

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410275934.XA Active CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN117866867B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118064474B (en) * 2024-04-18 2024-07-09 天津科技大学 Ferulic acid production strain, construction method and application thereof

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130143507A (en) * 2012-06-21 2013-12-31 한국생명공학연구원 Method of production of 4-coumaric acid, caffeic acid and ferulic acid by artificial metabolism pathway in strain producing high tyrosine
CN106032538A (en) * 2015-03-20 2016-10-19 爱普香料集团股份有限公司 Metabolic engineering bacteria and application thereof to production of vanillin by using various substrates
CN106591383A (en) * 2016-12-16 2017-04-26 江南大学 Method for efficient synthesis of caffeic acid with catechol as substrate
CN106755135A (en) * 2016-12-15 2017-05-31 江南大学 It is a kind of to synthesize caffeinic method by substrate resting cell of levodopa
CN111849794A (en) * 2020-06-29 2020-10-30 扬州大学 Saccharomyces cerevisiae recombinant strain and construction method and application thereof
CN115948312A (en) * 2022-10-31 2023-04-11 江南大学 Recombinant escherichia coli for producing caffeic acid and application
CN116376792A (en) * 2023-03-22 2023-07-04 天津科技大学 Directional transformation method of tyrosine production strain, production strain and tyrosine fermentation method
CN116814516A (en) * 2023-06-14 2023-09-29 天津科技大学 Tyramine production strain, construction method and application thereof
CN116948932A (en) * 2023-07-20 2023-10-27 深圳中科欣扬生物科技有限公司 Construction and application of caffeic acid strain synthesized from head by taking glucose as substrate
CN117230098A (en) * 2023-09-04 2023-12-15 天津科技大学 Levodopa production strain and directional transformation method and application thereof
CN117384817A (en) * 2023-12-07 2024-01-12 天津科技大学 Parcoumaric acid production strain, construction method and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8809028B2 (en) * 2011-11-07 2014-08-19 University Of Georgia Research Foundation, Inc. Biosynthesis of caffeic acid and caffeic acid derivatives by recombinant microorganisms

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130143507A (en) * 2012-06-21 2013-12-31 한국생명공학연구원 Method of production of 4-coumaric acid, caffeic acid and ferulic acid by artificial metabolism pathway in strain producing high tyrosine
CN106032538A (en) * 2015-03-20 2016-10-19 爱普香料集团股份有限公司 Metabolic engineering bacteria and application thereof to production of vanillin by using various substrates
CN106755135A (en) * 2016-12-15 2017-05-31 江南大学 It is a kind of to synthesize caffeinic method by substrate resting cell of levodopa
CN106591383A (en) * 2016-12-16 2017-04-26 江南大学 Method for efficient synthesis of caffeic acid with catechol as substrate
CN111849794A (en) * 2020-06-29 2020-10-30 扬州大学 Saccharomyces cerevisiae recombinant strain and construction method and application thereof
CN115948312A (en) * 2022-10-31 2023-04-11 江南大学 Recombinant escherichia coli for producing caffeic acid and application
CN116376792A (en) * 2023-03-22 2023-07-04 天津科技大学 Directional transformation method of tyrosine production strain, production strain and tyrosine fermentation method
CN116814516A (en) * 2023-06-14 2023-09-29 天津科技大学 Tyramine production strain, construction method and application thereof
CN116948932A (en) * 2023-07-20 2023-10-27 深圳中科欣扬生物科技有限公司 Construction and application of caffeic acid strain synthesized from head by taking glucose as substrate
CN117230098A (en) * 2023-09-04 2023-12-15 天津科技大学 Levodopa production strain and directional transformation method and application thereof
CN117384817A (en) * 2023-12-07 2024-01-12 天津科技大学 Parcoumaric acid production strain, construction method and application thereof

Also Published As

Publication number Publication date
CN117866867A (en) 2024-04-12

Similar Documents

Publication Publication Date Title
EP4019624B1 (en) Genetically engineered strain having high-yield of l-valine and method for producing l-valine by fermentation
CN110468092B (en) Genetically engineered bacterium capable of producing L-valine at high yield, and construction method and application thereof
CN117866867B (en) Caffeic acid production strain, construction method and application thereof
CN101501204B (en) Method for producing amino acids using glycerol
CN109777763B (en) Genetically engineered bacterium for producing L-theanine and construction and application thereof
CN117384817B (en) Parcoumaric acid production strain, construction method and application thereof
CN116814516A (en) Tyramine production strain, construction method and application thereof
WO2022174597A1 (en) Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof
CN118086346B (en) Hydroxytyrosol production strain as well as construction method and application thereof
CN117844728B (en) L-valine production strain and construction method and application thereof
CN113278641A (en) Recombinant escherichia coli for producing L-valine, construction method and application thereof
CN112592875B (en) Homoserine producing strain and construction method and application thereof
CN113278569B (en) Plasmid-free and inducer-free gene engineering bacterium for producing D-pantothenic acid and construction method
CN117683802A (en) Ralstonia engineering strain for producing isoleucine through methyl malic acid pathway, construction method and production method thereof
CN106834128A (en) Genetically engineered bacterium for producing beta-alanine by glucose fermentation and construction method and application thereof
CN111304138B (en) Recombinant escherichia coli for producing beta-carotene and construction method and application thereof
CN114941001A (en) Construction method and application of metabolic engineering strain for producing sakuranetin by saccharomyces cerevisiae
CN118064474B (en) Ferulic acid production strain, construction method and application thereof
CN118006652B (en) Dopamine production strain, construction method and application thereof
CN117866868B (en) L-high proline production strain and construction method and application thereof
CN118389392B (en) L-phenylalanine production strain and construction method and application thereof
CN117004547B (en) Genetically engineered bacterium for synthesizing cis, cis-muconic acid from glucose as substrate and application thereof
CN118272285B (en) Uracil nucleotide production strain, directional transformation method and application thereof
US11479795B2 (en) Genetically engineered bacterium for sarcosine production as well as construction method and application
Yang et al. Engineering an efficient H2 utilizing Escherichia coli platform by modulation of endogenous hydrogenases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant