CN117866867A - Caffeic acid production strain, construction method and application thereof - Google Patents

Caffeic acid production strain, construction method and application thereof Download PDF

Info

Publication number
CN117866867A
CN117866867A CN202410275934.XA CN202410275934A CN117866867A CN 117866867 A CN117866867 A CN 117866867A CN 202410275934 A CN202410275934 A CN 202410275934A CN 117866867 A CN117866867 A CN 117866867A
Authority
CN
China
Prior art keywords
gene
strain
caffeic acid
acid producing
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202410275934.XA
Other languages
Chinese (zh)
Other versions
CN117866867B (en
Inventor
徐庆阳
肖志刚
袁梦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN202410275934.XA priority Critical patent/CN117866867B/en
Publication of CN117866867A publication Critical patent/CN117866867A/en
Application granted granted Critical
Publication of CN117866867B publication Critical patent/CN117866867B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a caffeic acid producing strain, a construction method and application thereof, wherein the strain is obtained by further modifying a coumaric acid producing strain based on an original strain by utilizing a metabolic engineering means, in particular to a coumaric acid producing strainpykF、tyrP、RgTal、fre、tyrA fbr The expression intensity of the gene was adjusted toKpHpaBCHeterologous expression is carried out, and the expression can be constructed on the basis of PETX02 plasmidKpHpaBCThe PETH01 plasmid of the gene uses glucose as a carbon source, does not need to add tyrosine substrate, has low production cost and stable strainThe method has the advantages of high performance, high economic benefit, low production cost, no toxic metabolic byproducts and the like, and has very good industrial application value.

Description

Caffeic acid production strain, construction method and application thereof
Technical Field
The invention relates to the technical production field of fermentation engineering, in particular to a caffeic acid production strain, a construction method and application thereof.
Background
Caffeic acid (caffeic acid), also known as 3, 4-dihydroxycinnamic acid, is a natural phenolic acid compound existing in various plants, has the functions of resisting oxidation, inflammation and tumor, is a precursor of a plurality of important compounds, and has wide application in the fields of foods, medicines, cosmetics and the like.
At present, the caffeic acid synthesis method mainly comprises a plant extraction method, a chemical synthesis method and a microbial fermentation method. Because caffeic acid exists in coffee and various plants such as herba Artemisiae Scopariae, herba Cynarae, flos Lonicerae, etc., it can be directly extracted from these plants, but the plant growth cycle is long, the product accumulation is low, and multiple solvents are needed in the plant extraction process, thus limiting the large-scale production; the chemical synthesis method has the problems of high energy consumption, more byproducts, low yield, high pollution and the like; the microbial fermentation method takes glucose as an energy source for microbial growth, and caffeic acid is synthesized from the head without adding a substrate, so that the production cost is reduced, the fermentation process condition is mild, and the method has potential of industrial production.
There are two distinct biosynthetic pathways for caffeic acid in organisms. One of the ways is to produce cinnamic acid by deaminase catalyzing phenylalanine and then produce p-coumaric acid by cinnamic acid 4-hydroxylase catalyzing cinnamic acid, and finally produce caffeic acid under the action of 4-hydroxyphenylacetic acid-3-monooxygenase. The other way is to take tyrosine as a substrate and produce caffeic acid through continuous deamination and hydroxylation modification, and the synthetic way has the advantages of short reaction path, high catalytic efficiency and the like, so that the path is generally adopted to synthesize caffeic acid in microorganisms.
However, at present, the process of synthesizing caffeic acid in microorganisms by using tyrosine as a substrate is affected by problems of excessive accumulation of intermediate products, limited synthesis of cofactors, poor product tolerance and the like, and the yield is not ideal, so how to synthesize caffeic acid by using a biological method and obtain higher yield is a problem to be solved at present.
Disclosure of Invention
The invention aims to provide a caffeic acid producing strain.
Another technical problem to be solved by the present invention is to provide a method for constructing the caffeic acid producing strain.
Another technical problem to be solved by the present invention is to provide the use of the above-mentioned caffeic acid-producing strain.
In order to solve the technical problems, the technical scheme of the invention is as follows:
a caffeic acid producing strain, strain HY07, is obtained by further modifying a coumaric acid producing strain based on a starting strain by using metabolic engineering means, specificallypykF、tyrP、RgTal、fre、tyrA fbr The expression intensity of the gene was adjusted toKpHpaBCHeterologous expression is carried out, and the expression can be constructed on the basis of PETX02 plasmidKpHpaBCA PETH01 plasmid of the gene (4-hydroxyphenylacetic acid-3-monooxygenase gene), wherein:
knockout on genome of original strain p-coumaric acid producing strainpykFThe gene is not expressed by the gene,
at the position ofyjiTPseudogene locus use P trc Promoter controltyrPThe gene is over-expressed and the expression of the gene is improved,
at the position ofycgHPseudogene locus use P T7 Promoter controlRgTalThe gene is over-expressed and the expression of the gene is improved,
at the position ofyeepPseudogene locus use P trc Promoter controlfreThe gene is over-expressed and the expression of the gene is improved,
at the position ofilvGPseudogene locus use P trc Promoter controltyrA fbr The gene is over-expressed and the expression of the gene is improved,
at the position ofylbEPseudogene locus use P trc Promoter controlKpHpaBCThe gene is over-expressed and the expression of the gene is improved,
use of T7 promoter control on PETH01 plasmidKpHpaBCThe gene is over-expressed.
Preferably, the above caffeic acid producing strain, the metabolic engineering means is CRISPR-Cas9 gene editing technology.
Preferably, the above caffeic acid producing strain, the starting strain is p-coumaric acid producing strain ZG08. The p-coumaric acid producing strain ZG08 is the strain ZG08 described in the specification of patent application No. 202311666349.4.
Preferably, the above caffeic acid producing strain, saidpykFThe gene (pyruvate kinase gene) is derived from Escherichia coli, and is reducedpykFThe expression level of the gene can effectively promote the condensation of PEP and erythrose 4-phosphate to generate a first product DAHP in an aromatic amino acid pathway, and can effectively promote the accumulation of caffeic acid precursor tyrosine.
Preferably, the above caffeic acid producing strain, saidtyrPThe gene (tyrosine transporter gene) is derived from Escherichia coli, and the encoded enzyme can promote the absorption of tyrosine by the bacterial cells and transport of the intracellular product caffeic acid to the outside of the cells.
Preferably, the above caffeic acid producing strain, saidRgTalThe gene (tyrosine ammonia-lyase gene) is derived from rhodotorula glutinis after codon optimizationRgTalGenes encoding enzymes that promote the production of coumaric acid, a precursor of caffeic acid.
Preferably, the above caffeic acid producing strain, saidfreThe gene (flavin reductase gene) is derived from Escherichia coli, and the encoded enzyme can promote reduction of FAD into FADH 2 。
Preferably, the above caffeic acid producing strain, saidtyrA fbr The gene (prephenate dehydrogenase gene) is derived from Escherichia coli and is composed oftyrAThe gene is obtained after codon modification, and specifically comprises the following steps: methionine at position 53 is modified to isoleucine, alanine at position 354 is modified to valine, which encodes the first enzyme for tyrosine synthesis, which releases negative feedback inhibition after mutation, and which effectively increases the yield of caffeic acid precursor tyrosine.
Preferably, the above caffeic acid producing strain, saidKpHpaBCThe gene (4-hydroxyphenylacetic acid-3-monooxygenase gene) is derived from klebsiella pneumoniae after codon optimizationKpHpaBCGenes encoding enzymes that are key enzymes for catalyzing the production of caffeic acid from p-coumaric acid.
Preferably, the caffeic acid producing strain, the P trc The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 1; the P is T7 The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 2; the saidpykFThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 3; the saidtyrPThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 4; the saidRgTalThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 5; the saidfreThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 6; the saidtyrA fbr The nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 7; the saidKpHpaBCThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 8.
Preferably, the caffeic acid producing strain has the characteristics of a PET-28a (+) plasmid vector part, and is properly modified, and the base sequence of the PETX02 plasmid is shown as a sequence table SEQ ID NO. 9.
Preferably, the base sequence of the PETH01 plasmid of the caffeic acid producing strain is shown in a sequence table SEQ ID NO. 10.
The construction method of the caffeic acid producing strain is based on directional transformation of a starting strain on a coumaric acid producing strain ZG08, and comprises the following specific steps:
(1) Knock-out on the genome of the starting strain ZG08pykFObtaining a strain HY01 by genes;
(2) Starting from strain HY01, inyjiTPseudogene locus use P trc Promoter controltyrPThe gene is over-expressed to obtain a strain HY02;
(3) Starting strain HY02, inycgHPseudogene locus use P T7 Promoter controlRgTalThe gene is over-expressed to obtain a strain HY03;
(4) Starting from strain HY03, inyeepPseudogene locus use P trc Promoter controlfreThe gene is over-expressed to obtain a strain HY04;
(5) Starting strain HY04ilvGPseudogene locus use P trc Promoter controltyrA fbr Heterologous gene expression to obtain strain HY05;
(6) By bacteriaThe HY05 strain is used as a starting strainylbEPseudogene locus use P trc Promoter controlKpHpaBCThe gene is over-expressed to obtain a strain HY06;
(7) The strain HY07 is taken as an original strain, and a T7 promoter is constructed and used for controlling on the basis of PETX02 plasmidKpHpaBCAnd (3) the PETH01 plasmid is subjected to overexpression to obtain a strain HY07, wherein the strain HY07 is the target bacterium after being successfully transformed.
The application of the caffeic acid producing strain in the aspect of producing caffeic acid by fermentation.
Preferably, the caffeic acid producing strain is prepared by using a mechanical stirring type fermentation tank, and synthesizing caffeic acid by seed culture and fermentation culture with glucose as a substrate.
Preferably, the application of the caffeic acid producing strain comprises the following specific steps:
(1) Seed activation: streaking and inoculating caffeic acid producing strain on kanamycin resistance activating inclined plane, culturing at 32deg.C for 12 hr, and passaging for 2 times; eluting activated thalli on the inclined plane by sterilized distilled water, and transferring the thalli into a 5L mechanical stirring type fermentation tank to start seed culture;
(2) Seed culture: using a mechanical stirring type fermenter, culturing at 34 deg.C, maintaining culture pH at 6.6+ -0.2 by automatically feeding 25% ammonia water solution, maintaining culture dissolved oxygen value at 40% by adjusting stirring speed or ventilation, and obtaining OD 600nm 15, the inoculation requirement is met;
(3) Fermentation culture: the mechanical stirring type fermentation tank is used, the inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40% by adjusting the stirring speed or ventilation, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding 80% (mass volume fraction) glucose solution, and the fermentation period is less than or equal to 50h.
Preferably, the use of the above-mentioned caffeic acid producing strain, the seed culture medium used in the seed culture: glucose 30 g/L, yeast 5g/L, peptone 3g/L, (NH) 4 ) 2 SO 4 1 g/L，KH 2 PO 4 2 g/L，MgSO 4 ·7H 2 O1 g/L, citric acid 3g/L, cereal3g/L of amino acid and the balance of water.
Preferably, the use of the above-mentioned caffeic acid producing strain, the fermentation medium used in the fermentation culture: glucose 15 g/L, yeast powder 5g/L, peptone 2 g/L, citric acid 3g/L, (NH) 4 ) 2 SO 4 1.5 g/L，KH 2 PO 4 3 g/L，MgSO 4 ·7H 2 O2 g/L, glutamic acid 3g/L, mnSO 4 ·H 2 O 10 mg/L，FeSO 4 ·7H 2 O20 mg/L, biotin 0.3 mg/L, riboflavin 10 mg/L and the balance water.
The above culture medium can be prepared by standard method.
Preferably, the above-mentioned caffeic acid producing strain is used, and PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar stream during fermentation culture, specifically: to 80% (mass volume fraction) glucose solution per liter, 6mg PLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin (i.e. PLP 6 mg/L) were added Sugar solution Choline chloride 1.5g/L Sugar solution Betaine 1g/L Sugar solution 20mg/L riboflavin Sugar solution ）。
The beneficial effects are that:
the caffeic acid production strain is obtained by adopting a directional transformation method of de novo synthesis through a caffeic acid metabolic synthesis way, glucose is used as a carbon source, tyrosine substrates are not required to be added, the production cost is low, the caffeic acid production strain has the advantage of high strain stability, the caffeic acid production strain has very high economic benefit, the caffeic acid production strain utilizes glucose as a substrate, and the caffeic acid is efficiently and stably synthesized from the de novo through a fermentation method, the production cost is low, no toxic metabolic byproducts are generated, and the like, and the caffeic acid 15.1g/L is produced during 50 g/h fermentation, so that the caffeic acid production strain has very good industrial application value; because caffeic acid has toxic action on thalli, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added in the application process, so that the catalytic demands of tyrosine ammonia lyase and 4-hydroxyphenylacetic acid-3-monooxygenase genes can be ensured on one hand, the activity of strains can be ensured on the other hand, the production benefit is improved, and a foundation is laid for realizing the mass production of caffeic acid.
Drawings
FIG. 1 is a diagram of the process of genetic engineering of caffeic acid producing strains from the head synthesis pathway.
Detailed Description
In order to enable those skilled in the art to better understand the technical scheme of the present invention, the technical scheme of the present invention will be further described in detail below with reference to the specific embodiments.
The percentage "%" referred to in the examples is the mass percentage, the percentage of the solution is the gram of the solute contained in 100 mL, and the percentage between the liquids is the volume ratio of the solution at 25 ℃.
The starting strain used in the examples was p-coumaric acid producing strain ZG08, which is strain ZG08 described in the specification of patent application No. 202311666349.4. The corresponding promoters and genes are shown in the sequence table.
As shown in FIG. 1, a caffeic acid producing strain was constructed by the following method: knockout on the genome of the original strain p-coumaric acid-producing strain ZG08pykFGenes, such that they are not expressed; at the position ofyjiTPseudogene locus use P trc Promoter controltyrPOverexpression of genes; at the position ofycgHPseudogene locus use P T7 Promoter controlRgTalOverexpression of genes; at the position ofyeepPseudogene locus use P trc Promoter controlfreOverexpression of genes; at the position ofilvGPseudogene locus use P trc Promoter controltyrA fbr Overexpression of genes; at the position ofylbEPseudogene locus use P trc Promoter controlKpHpaBCOverexpression of genes; use of T7 promoter control on PETH01 plasmidKpHpaBCThe gene is over-expressed.
Example 1
1. Method for gene editing
Gene editing methods employed are described in the literature (Li Y, lin Z, huang C, et al Metabolic engineering of Escherichia coli using CRISPR-Cas9 mediated genome coding Metabolic Engineering,2015, 31:13-21.). Engineering plasmids pREDCas9 and pGRB related by the method, wherein pREDCas9 carries an elimination system of a gRNA expression plasmid pGRB, a Red recombination system of lambda phage, a Cas9 protein expression system and the resistance of Qamycin (working concentration: 100 mg/L); pGRB takes pUC18 as a backbone, and comprises the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, and ampicillin resistance (working concentration: 100 mg/L). The terminology referred to in examples 2-4 below is explained in this article.
2. The primers used in the strain construction are shown in Table 1.
TABLE 1 primers involved in the construction of strains
Primer name Primer sequence (5 '-3') Sequence number
pykF-pGRB-S AGTCCTAGGTATAATACTAGTGACAAACAGGACCTGATCTTGTTTTAGAGCTAGAA SEQ ID NO.11
pykF-pGRB-A TTCTAGCTCTAAAACAAGATCAGGTCCTGTTTGTCACTAGTATTATACCTAGGACT SEQ ID NO.12
pykF-U-S ATCCTTAGAGCGAGGCACC SEQ ID NO.13
pykF-U-A CCAGTTCTTTACCCAGACGCAGGATAGCGGCGGTTTTA SEQ ID NO.14
pykF-D-S TAAAACCGCCGCTATCCTGCGTCTGGGTAAAGAACTGG SEQ ID NO.15
pykF-D-A GATCGTTCGCTCAAAGAAGC SEQ ID NO.16
pGRB-yjiT-S AGTCCTAGGTATAATACTAGTCTGATAACCTCAATTCCTTAGTTTTAGAGCTAGAA SEQ ID NO.17
pGRB-yjiT-A TTCTAGCTCTAAAACTAAGGAATTGAGGTTATCAGACTAGTATTATACCTAGGACT SEQ ID NO.18
yjiT-U-S CATTCCCTCTACAGAACTAGCCCTT SEQ ID NO.19
yjiT-U-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAAAAACAGGCAGCAAAGTCCC SEQ ID NO.20
yjiT-D-S GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATAAGCACTACCTGTGAAGGGATGT SEQ ID NO.21
yjiT-D-A CAGGGCTTCCACAGTCACAAT SEQ ID NO.22
yjiT-tyrP-S CGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCGTGAAAAACAGAACCCTGGGAA SEQ ID NO.23
yjiT-tyrP-A ATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTCACCCCACTTCTGGTAACAACC SEQ ID NO.24
pGRB-ycgH-S AGTCCTAGGTATAATACTAGTTATGCGTCTGAACGACCGTGGTTTTAGAGCTAGAA SEQ ID NO.25
pGRB-ycgH-A TTCTAGCTCTAAAACCACGGTCGTTCAGACGCATAACTAGTATTATACCTAGGACT SEQ ID NO.26
ycgH-U-S TAAACTCGTCAGCGGCACAA SEQ ID NO.27
ycgH-U-A CTCCTTCTTAAAGTTAAACAAAATTATTTCTAGACCCTATAGTGAGTCGTATTAGGTAGGCGTTTCTGTTGATTCTG SEQ ID NO.28
ycgH-D-S CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCGTGTCGGATTATCGTTCGA SEQ ID NO.29
ycgH-D-A GATTCAGGTTGCCATTTACGC SEQ ID NO.30
ycgH-RgTal-S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGCGCCGCGCCCGACGAG SEQ ID NO.31
ycgH-RgTal-A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTAGGCTAACATTTTCAGCAGCACG SEQ ID NO.32
pGRB-yeeP-S AGTCCTAGGTATAATACTAGTAGGCGGTATTCCGTCTGTTCGTTTTAGAGCTAGAA SEQ ID NO.33
pGRB-yeeP-A TTCTAGCTCTAAAACGAACAGACGGAATACCGCCTACTAGTATTATACCTAGGACT SEQ ID NO.34
yeeP-U-S GGTCAGGAGGTAACTTATCAGCG SEQ ID NO.35
yeeP-U-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAATGGCAGGGCTCCGTTTT SEQ ID NO.36
yeeP-D-S AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGAACTGGATTTTCTTCTGAACCTGT SEQ ID NO.37
yeeP-D-A ACGATGTCAGCAGCCAGCA SEQ ID NO.38
yeeP-fre-S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGACAACCTTAAGCTGTAAAGTGACC SEQ ID NO.39
yeeP-fre-A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTCAGATAAATGCAAACGCATCGC SEQ ID NO.40
ilvG-pGRB-S AGTCCTAGGTATAATACTAGTTATCGGCACTGACGCATTTCGTTTTAGAGCTAGAA SEQ ID NO.41
ilvG-pGRB-A TTCTAGCTCTAAAACGAAATGCGTCAGTGCCGATAACTAGTATTATACCTAGGACT SEQ ID NO.42
ilvG-U-S CCGAGGAGCAGACAATGAATAACAG SEQ ID NO.43
ilvG-U-A GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACGGTGATGGCAACAACAGGG SEQ ID NO.44
ilvG-D-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGCTATCTACGCGCCGTTGTTG SEQ ID NO.45
ilvG-D-A GAAGGCGCTGGCTAACATGAGG SEQ ID NO.46
ilvG-tyrA fbr -S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGTTGCTGAATTGACCGC SEQ ID NO.47
ilvG-tyrA fbr -A GACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACTGGCGATTGTCATTCGC SEQ ID NO.48
ylbE-pGRB-U AGTCCTAGGTATAATACTAGTACACTGGCTGGATGTGCAACGTTTTAGAGCTAGAA SEQ ID NO.49
ylbE-pGRB-D TTCTAGCTCTAAAACGTTGCACATCCAGCCAGTGTACTAGTATTATACCTAGGACT SEQ ID NO.50
ylbE-U-S ACCCAACCTTACGCAACCAG SEQ ID NO.51
ylbE-U-A GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTGTTCGATAACCGCAGCAT SEQ ID NO.52
ylbE-D-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCGCTGGCGTGCTTTGAAC SEQ ID NO.53
ylbE-D-A GGCGTAACTCAGCAGGCAG SEQ ID NO.54
ylbE-KpHpaBC-S TATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAACCGGAAGATTTTCGCG SEQ ID NO.55
ylbE-KpHpaBC-A CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACACCGCCACTTCCATTTCC SEQ ID NO.56
KpHpaBC-Pet-S GTGAGCGGATAACAATTCCCCTCTAGAATGAAACCGGAAGATTTTCGCG SEQ ID NO.57
KpHpaBC-Pet-A GTTTCCGCGGTGCTGCCCATGAATTCTTACACCGCCACTTCCATTTCC SEQ ID NO.58
Example 2
This example is intended to illustrate the knockout of a genomepykFThe gene comprises the following steps:
(1) the E.coli W3110 genome was used as a template, respectivelypykF-U-S、pykF-U-A andpykF-D-S、pykFD-A is used as a primer, an upstream homology arm and a downstream homology arm are obtained through HS enzyme PCR amplification, and delta is obtained through HS enzyme overlap PCR by using the same as a templatepykFA gene knockout fragment consisting ofpykFUpstream homology armpykFDownstream homology arms.
(2) By pGRB-pykFS and pGRB-pykFConstructing pGRB by PCR annealing procedure using A as primerpykFThe target-containing sequences usedTransforming the DNA fragment into Top10 transformed competent cells, screening to obtain positive transformant, and extracting plasmid pGRB-pykF；
(3) Delta obtained in the steps (2) and (3) is reducedpykFGene knockout fragment and pGRBpykFThe plasmid was electrotransferred into ZG08 strain, and positive transformants were obtained by selection and named HY01.
Example 3
The present embodiment is intended to be described inyjiTPseudogene locus use P trc Promoter controltyrPThe method comprises the following steps of gene overexpression:
(1) the E.coli W3110 genome was used as a template, respectivelyyjiT-U-S、yjiT-U-A、yjiT-D-S、yjiT-D-A andtyrP-S、tyrPthe primer A is amplified by HS enzyme PCR to obtain upstream homology arm, downstream homology arm and target gene fragment, and the template A is used as template to obtain P by HS enzyme overlap PCR trc -tyrP（ycgH) A gene integration fragment consisting ofycgHUpstream homology arm, P trc -tyrPGenes of interestycgHDownstream homology arms.
(2) By pGRB-yjiTS and pGRB-yjiTConstructing pGRB by PCR annealing procedure using A as primeryjiTThe DNA fragment containing the target sequence is used and transformed into Top10 transformed competent cells, positive transformants are obtained by screening, and plasmid pGRB-yjiT。
(3) The P obtained in the steps (2) and (3) is reacted with trc -tyrP（yjiT) Gene integration fragment and pGRByjiTThe plasmid is electrotransformed into HY01 strain, and positive transformant is obtained through screening and named HY02.
Example 4
The present embodiment is intended to be described inycgHPseudogene locus use P T7 Promoter controlRgTalThe method comprises the following steps of gene overexpression:
(1) the E.coli W3110 genome was used as a template, respectivelyycgH-U-S、ycgH-U-A、ycgH-D-S、ycgH-D-A andRgTal-S、RgTal-A as primer, PCR amplification by HS enzymeObtaining upstream homology arm, downstream homology arm and target gene fragment, and obtaining P by HS enzyme overlap PCR with the target gene fragment as template T7 -RgTal（ycgH) A gene integration fragment consisting ofycgHUpstream homology arm, P T7 -RgTalGenes of interestycgHDownstream homology arms.
(2) By pGRB-ycgHS and pGRB-ycgHConstructing pGRB by PCR annealing procedure using A as primerycgHThe DNA fragment containing the target sequence is used and transformed into Top10 transformed competent cells, positive transformants are obtained by screening, and plasmid pGRB-ycgH。
(3) The P obtained in the steps (2) and (3) is reacted with T7 -RgTal（ycgH) Gene integration fragment and pGRBycgHThe plasmid is electrotransformed into HY02 strain, and positive transformant is obtained through screening and named HY03.
Example 5
The present embodiment is intended to be described inyeePPseudogene locus use P trc Promoter controlfreThe method comprises the following steps of gene overexpression:
(1) the E.coli W3110 genome was used as a template, respectivelyyeeP-U-S、yeeP-U-A、yeeP-D-S、yeeP-D-A andfre-S、frethe primer A is amplified by HS enzyme PCR to obtain upstream homology arm, downstream homology arm and target gene fragment, and the template A is used as template to obtain P by HS enzyme overlap PCR trc -fre（yeeP) A gene integration fragment consisting ofyeePUpstream homology arm, P trc -freGenes of interestyeePDownstream homology arms.
(2) By pGRB-yeePS and pGRB-yeePConstructing pGRB by PCR annealing procedure using A as primeryeePThe DNA fragment containing the target sequence is used and transformed into Top10 transformed competent cells, positive transformants are obtained by screening, and plasmid pGRB-yeeP。
(3) The P obtained in the steps (2) and (3) is reacted with trc -fre（yeeP) Gene integration fragment and pGRByeePPlasmid electrotransformation into HY03 bacteriaAmong the strains, positive transformants were obtained by screening and designated HY04.
Example 6
The present embodiment is intended to be described inilvGPseudogene locus use P trc Promoter controltyrA fbr The method comprises the following steps of gene overexpression:
(1) the E.coli W3110 genome was used as a template, respectivelyilvG-U-S、ilvG-U-A、ilvG-D-S、ilvG-D-A andtyrA fbr -S、tyrA fbr the primer A is amplified by HS enzyme PCR to obtain upstream homology arm, downstream homology arm and target gene fragment, and the template A is used as template to obtain P by HS enzyme overlap PCR trc -tyrA fbr （ilvG) A gene integration fragment consisting ofilvGUpstream homology arm, P trc -tyrA fbr Genes of interestilvGDownstream homology arms.
(2) By pGRB-ilvGS and pGRB-ilvGConstructing pGRB by PCR annealing procedure using A as primerilvGThe DNA fragment containing the target sequence is used and transformed into Top10 transformed competent cells, positive transformants are obtained by screening, and plasmid pGRB-ilvG。
(3) The P obtained in the steps (2) and (3) is reacted with trc -tyrA fbr （ilvG) Gene integration fragment and pGRBilvGThe plasmid is electrotransformed into HY04 strain, and positive transformant is obtained through screening and named HY05.
Example 7
The present embodiment is intended to be described inylbEPseudogene locus use P trc Promoter controlKpHpaBCThe heterologous gene expression includes the following steps:
(1) the E.coli W3110 genome was used as a template, respectivelyylbE-U-S、ylbE-U-A、ylbE-D-S、ylbEThe D-A is used as a primer, the upstream homology arm and the downstream homology arm are obtained through HS enzyme PCR amplification, and the rhodotorula glutinis genome is used as a template, so thatylbE-KpHpaBC-S、ylbE-KpHpaBC-A is a primer byCarrying out PCR amplification on the target gene fragment by using HS enzyme, carrying out codon optimization on the target gene fragment, and carrying out overlapping PCR on the target gene fragment by using an upstream homologous arm, a downstream homologous arm and the target gene fragment subjected to the codon optimization as a template to obtain P trc -KpHpaBC（ylbE) A gene integration fragment consisting ofylbEUpstream homology arm, P trc -KpHpaBCGenes of interestylbEDownstream homology arms.
(2) By pGRB-ylbES and pGRB-ylbEConstructing pGRB by PCR annealing procedure using A as primerylbEThe DNA fragment containing the target sequence is used and transformed into Top10 transformed competent cells, positive transformants are obtained by screening, and plasmid pGRB-ylbE。
(3) The P obtained in the steps (2) and (3) is reacted with trc -KpHpaBC（ylbE) Gene integration fragment and pGRBylbEThe plasmid is electrotransformed into HY05 strain, and positive transformant is obtained through screening and named HY06.
Example 8
This example is intended to illustrate that the constructs may be expressedKpHpaBCThe steps of the PETH01 plasmid of the gene (4-hydroxyphenylacetic acid-3-monooxygenase gene) are as follows:
(1) the klebsiella pneumoniae genome is used as a templateKpHpaBC-Pet-S、KpHpaBCAnd (3) taking the Pet-A as a primer, obtaining a target gene fragment through HS enzyme PCR amplification, and carrying out codon optimization on the target gene fragment.
(3) The Xba I and EcoR I are taken as restriction enzyme cutting sites, the PETX02 plasmid is cut by enzyme, and the linearization vector is connected with the vector subjected to codon optimization by utilizing recombinaseKpHpaBCAnd (3) transforming the target gene fragment into Top10 transformed competent cells, screening to obtain positive transformants, and extracting plasmid PETH01.
(4) Electrotransferring the PETH01 plasmid obtained in the step (3) into an HY06 strain, screening to obtain a positive transformant, and naming the positive transformant as HY07.
Example 9
The strain HY07 obtained in example 8 was used as a caffeic acid producing strain, and this example was intended to illustrate a method for producing caffeic acid using the producing strain, and the specific cultivation method was as follows:
seed activation: inoculating a storage strain at-80 ℃ to a kanamycin resistance activation inclined plane by streaking, culturing for 12 hours at 32 ℃ and passaging for 2 times; the activated cells on the inclined plane were eluted with sterilized distilled water and transferred to a 5L mechanical stirring fermenter to start seed culture.
Seed culture: using 5L mechanical stirring fermenter, culturing at 34 deg.C, maintaining culture pH at 6.6+ -0.2 by automatic feeding of 25% ammonia water solution, maintaining culture dissolved oxygen value at 40% by adjusting stirring speed or ventilation, and obtaining OD 600nm 15, the inoculation requirement is met; the seed culture medium adopted is as follows: glucose 30 g/L, yeast 5g/L, peptone 3g/L, (NH) 4 ) 2 SO 4 1 g/L，KH 2 PO 4 2 g/L，MgSO 4 ·7H 2 O1 g/L, citric acid 3g/L, glutamic acid 3g/L and the balance of water;
fermentation culture: using a 5L mechanical stirring type fermentation tank, wherein the fermentation inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40% by adjusting the stirring rotation speed or ventilation, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding 80% (mass volume fraction) glucose solution, and the fermentation period is 50h; the fermentation medium adopted is: glucose 15 g/L, yeast powder 5g/L, peptone 2 g/L, citric acid 3g/L, (NH) 4 ) 2 SO 4 1.5 g/L，KH 2 PO 4 3 g/L，MgSO 4 ·7H 2 O2 g/L, glutamic acid 3g/L, mnSO 4 ·H 2 O 10 mg/L，FeSO 4 ·7H 2 O20 mg/L, biotin 0.3 mg/L, riboflavin 10 mg/L and the balance water.
During fermentation culture, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar stream, specifically: to 80% (mass volume fraction) glucose solution per liter, 6mg PLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin were added, i.e. PLP 6mg/L Sugar solution Choline chloride 1.5g/L Sugar solution Betaine 1g/L Sugar solution 20mg/L riboflavin Sugar solution 。
Example 10
The strain HY07 is used as a production strain, and the effect of PLP, choline chloride, betaine and riboflavin in caffeic acid fermentation applications is described in this example. The specific fermentation culture was as in example 9, and four groups of controls were set up, with the only difference being the amounts of PLP, choline chloride, betaine and riboflavin added to the 80% glucose solution. The invention discloses data for four groups of fermentors for 50h, the results are shown in tables 2, 3,4, 5 and 6.
TABLE 2 influence of PLP on cell biomass and caffeic acid production
Group 1 Group 2 Group 3 Group 4
PLP addition amount (mg/L) Sugar solution ） 0 3 6 9
Bacterial biomass OD 600nm 88.1 87.5 89.4 90.1
Caffeic acid yield g/L 3.3 5.1 7.6 5.8
TABLE 3 Effect of Choline chloride on cell biomass
Group 1 Group 2 Group 3 Group 4
Choline chloride addition (g/L) Sugar solution ） 0 1 1.5 2
Bacterial biomass OD 600nm 88.4 96.7 106.8 98.1
TABLE 4 Effect of betaine on cell biomass
Group 1 Group 2 Group 3 Group 4
Betaine addition amount (g/L) Sugar solution ） 0 1 2 3
Bacterial biomass OD 600nm 86.1 113.3 105.2 99.7
TABLE 5 Effect of riboflavin on biomass of thallus and production of caffeic acid
Group 1 Group 2 Group 3 Group 4
Riboflavin addition (mg/L) Sugar solution ） 5 10 20 30
Bacterial biomass OD 600nm 89.8 91.4 90.8 88.1
Caffeic acid yield g/L 5.7 7.8 10.2 9.1
TABLE 6 effects of PLP, choline chloride, betaine and riboflavin on biomass of cells and production of caffeic acid
Group 1 Group 2 Group 3 Group 4 Group 5 Group 6
PLP addition amount (mg/L) Sugar solution ） 0 6 6 6 6 6
Choline chloride addition (g/L) Sugar solution ） 0 1.5 0 0 1.5 0
Betaine addition amount (g/L) Sugar solution ） 0 0 1 0 1 1
Riboflavin addition (mg/L) Sugar solution ） 0 0 0 20 0 20
Bacterial biomass OD 600nm 87.5 105.7 112.9 89.4 122.3 114.7
Caffeic acid yield g/L 3.1 8.2 8.7 11.7 9.1 13.1
Group 7 Group 8 Group 9 Group 10 Group 11 Group 12
PLP addition amount (mg/L) Sugar solution ） 0 0 0 0 6 6
Choline chloride addition (g/L) Sugar solution ） 1.5 1.5 0 1.5 1.5 1.5
Betaine addition amount (g/L) Sugar solution ） 1 0 1 1 0 1
Riboflavin addition (mg/L) Sugar solution ） 0 20 20 20 20 20
Bacterial biomass OD 600nm 121.9 103.2 111.4 122.7 105.5 123.3
Caffeic acid yield g/L 4.5 11.6 12.5 12.9 13.3 15.1
The foregoing is merely illustrative of the preferred embodiments of this invention, and it will be appreciated by those skilled in the art that variations and modifications of the invention and strain changes, which are carried out by or based on the methods of this invention, may be made without departing from the spirit of this invention.

Claims (10)

1. A caffeic acid producing strain, characterized in that: is obtained by further modifying the coumaric acid producing strain based on the original strain by using metabolic engineering means, in particular to the coumaric acid producing strainpykF、tyrP、RgTal、fre、tyrA fbr The expression intensity of the gene was adjusted toKpHpaBCHeterologous expression is performed and at PConstruction of expression on the basis of ETX02 plasmidKpHpaBCA PETH01 plasmid of a gene, wherein:
knockout on genome of original strain p-coumaric acid producing strainpykFThe gene is not expressed by the gene,
at the position ofyjiTPseudogene locus use P trc Promoter controltyrPThe gene is over-expressed and the expression of the gene is improved,
at the position ofycgHPseudogene locus use P T7 Promoter controlRgTalThe gene is over-expressed and the expression of the gene is improved,
at the position ofyeepPseudogene locus use P trc Promoter controlfreThe gene is over-expressed and the expression of the gene is improved,
at the position ofilvGPseudogene locus use P trc Promoter controltyrA fbr The gene is over-expressed and the expression of the gene is improved,
at the position ofylbEPseudogene locus use P trc Promoter controlKpHpaBCThe gene is over-expressed and the expression of the gene is improved,
use of T7 promoter control on PETH01 plasmidKpHpaBCThe gene is over-expressed.
2. The caffeic acid producing strain according to claim 1, wherein: the P is trc The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 1; the P is T7 The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 2; the saidpykFThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 3; the saidtyrPThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 4; the saidRgTalThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 5; the saidfreThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 6; the saidtyrA fbr The nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 7; the saidKpHpaBCThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 8.
3. The caffeic acid producing strain according to claim 1, wherein: the PETX02 plasmid has the partial characteristics of a PET-28a (+) plasmid vector and is properly modified, and the base sequence of the PETX02 plasmid is shown as a sequence table SEQ ID NO. 9; the base sequence of the PETH01 plasmid is shown in a sequence table SEQ ID NO. 10.
4. The method for constructing a caffeic acid producing strain according to claim 1, wherein: the method is characterized by directionally modifying a coumaric acid production strain ZG08 based on an original strain, and comprises the following specific steps:
(1) Knock-out on the genome of the starting strain ZG08pykFObtaining a strain HY01 by genes;
(2) Starting from strain HY01, inyjiTPseudogene locus use P trc Promoter controltyrPThe gene is over-expressed to obtain a strain HY02;
(3) Starting strain HY02, inycgHPseudogene locus use P T7 Promoter controlRgTalThe gene is over-expressed to obtain a strain HY03;
(4) Starting from strain HY03, inyeepPseudogene locus use P trc Promoter controlfreThe gene is over-expressed to obtain a strain HY04;
(5) Starting strain HY04ilvGPseudogene locus use P trc Promoter controltyrA fbr Heterologous gene expression to obtain strain HY05;
(6) Starting strain HY05ylbEPseudogene locus use P trc Promoter controlKpHpaBCThe gene is over-expressed to obtain a strain HY06;
(7) The strain HY07 is taken as an original strain, and a T7 promoter is constructed and used for controlling on the basis of PETX02 plasmidKpHpaBCAnd (3) the PETH01 plasmid is subjected to overexpression to obtain a strain HY07, wherein the strain HY07 is the target bacterium after being successfully transformed.
5. Use of the caffeic acid producing strain according to claim 1 for the fermentative production of caffeic acid.
6. Use of a caffeic acid producing strain according to claim 5, wherein: and (3) using a mechanical stirring type fermentation tank to synthesize caffeic acid by seed culture and fermentation culture and taking glucose as a substrate.
7. Use of a caffeic acid producing strain according to claim 5 or 6, characterized in that: the method comprises the following specific steps:
(1) Seed activation: streaking and inoculating a caffeic acid production strain on a kanamycin resistance activation inclined plane, culturing and passaging;
(2) Seed culture: transferring the activated thallus to a mechanical stirring fermenter, culturing at 34 deg.C, maintaining culture pH at 6.6+ -0.2 by automatic feeding 25% ammonia water solution, maintaining culture dissolved oxygen value at 40%, and obtaining OD 600nm 15, the inoculation requirement is met;
(3) Fermentation culture: the inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40%, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding glucose solution, and the fermentation period is less than or equal to 50 hours.
8. Use of a caffeic acid producing strain according to claim 7, wherein: the seed culture medium adopted in the seed culture comprises: glucose 30 g/L, yeast 5g/L, peptone 3g/L, (NH) 4 ) 2 SO 4 1 g/L，KH 2 PO 4 2 g/L，MgSO 4 ·7H 2 O1 g/L, citric acid 3g/L, glutamic acid 3g/L and the balance of water.
9. Use of a caffeic acid producing strain according to claim 7, wherein: the fermentation culture medium adopted in the fermentation culture comprises the following components: glucose 15 g/L, yeast powder 5g/L, peptone 2 g/L, citric acid 3g/L, (NH) 4 ) 2 SO 4 1.5 g/L，KH 2 PO 4 3 g/L，MgSO 4 ·7H 2 O2 g/L, glutamic acid 3g/L, mnSO 4 ·H 2 O 10 mg/L，FeSO 4 ·7H 2 O20 mg/L, biotin 0.3 mg/L, riboflavin 10 mg/L and the balance water.
10. Use of a caffeic acid producing strain according to claim 7, wherein: during fermentation culture, PLP, choline chloride, betaine and riboflavin are added along with the sugar liquid flow, and the specific steps are as follows: to 80% glucose solution per liter, 6mg PLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin were added.
CN202410275934.XA 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof Active CN117866867B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410275934.XA CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410275934.XA CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Publications (2)

Publication Number Publication Date
CN117866867A true CN117866867A (en) 2024-04-12
CN117866867B CN117866867B (en) 2024-05-28

Family

ID=90579591

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410275934.XA Active CN117866867B (en) 2024-03-12 2024-03-12 Caffeic acid production strain, construction method and application thereof

Country Status (1)

Country Link
CN (1) CN117866867B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118064474A (en) * 2024-04-18 2024-05-24 天津科技大学 Ferulic acid production strain, construction method and application thereof

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130130340A1 (en) * 2011-11-07 2013-05-23 Yajun Yan Biosynthesis of caffeic acid and caffeic acid derivatives by recombinant microorganisms
KR20130143507A (en) * 2012-06-21 2013-12-31 한국생명공학연구원 Method of production of 4-coumaric acid, caffeic acid and ferulic acid by artificial metabolism pathway in strain producing high tyrosine
CN106032538A (en) * 2015-03-20 2016-10-19 爱普香料集团股份有限公司 Metabolic engineering bacteria and application thereof to production of vanillin by using various substrates
CN106591383A (en) * 2016-12-16 2017-04-26 江南大学 Method for efficient synthesis of caffeic acid with catechol as substrate
CN106755135A (en) * 2016-12-15 2017-05-31 江南大学 It is a kind of to synthesize caffeinic method by substrate resting cell of levodopa
CN111849794A (en) * 2020-06-29 2020-10-30 扬州大学 Saccharomyces cerevisiae recombinant strain and construction method and application thereof
CN115948312A (en) * 2022-10-31 2023-04-11 江南大学 Recombinant escherichia coli for producing caffeic acid and application
CN116376792A (en) * 2023-03-22 2023-07-04 天津科技大学 Directional transformation method of tyrosine production strain, production strain and tyrosine fermentation method
CN116814516A (en) * 2023-06-14 2023-09-29 天津科技大学 Tyramine production strain, construction method and application thereof
CN116948932A (en) * 2023-07-20 2023-10-27 深圳中科欣扬生物科技有限公司 Construction and application of caffeic acid strain synthesized from head by taking glucose as substrate
CN117230098A (en) * 2023-09-04 2023-12-15 天津科技大学 Levodopa production strain and directional transformation method and application thereof
CN117384817A (en) * 2023-12-07 2024-01-12 天津科技大学 Parcoumaric acid production strain, construction method and application thereof

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130130340A1 (en) * 2011-11-07 2013-05-23 Yajun Yan Biosynthesis of caffeic acid and caffeic acid derivatives by recombinant microorganisms
KR20130143507A (en) * 2012-06-21 2013-12-31 한국생명공학연구원 Method of production of 4-coumaric acid, caffeic acid and ferulic acid by artificial metabolism pathway in strain producing high tyrosine
CN106032538A (en) * 2015-03-20 2016-10-19 爱普香料集团股份有限公司 Metabolic engineering bacteria and application thereof to production of vanillin by using various substrates
CN106755135A (en) * 2016-12-15 2017-05-31 江南大学 It is a kind of to synthesize caffeinic method by substrate resting cell of levodopa
CN106591383A (en) * 2016-12-16 2017-04-26 江南大学 Method for efficient synthesis of caffeic acid with catechol as substrate
CN111849794A (en) * 2020-06-29 2020-10-30 扬州大学 Saccharomyces cerevisiae recombinant strain and construction method and application thereof
CN115948312A (en) * 2022-10-31 2023-04-11 江南大学 Recombinant escherichia coli for producing caffeic acid and application
CN116376792A (en) * 2023-03-22 2023-07-04 天津科技大学 Directional transformation method of tyrosine production strain, production strain and tyrosine fermentation method
CN116814516A (en) * 2023-06-14 2023-09-29 天津科技大学 Tyramine production strain, construction method and application thereof
CN116948932A (en) * 2023-07-20 2023-10-27 深圳中科欣扬生物科技有限公司 Construction and application of caffeic acid strain synthesized from head by taking glucose as substrate
CN117230098A (en) * 2023-09-04 2023-12-15 天津科技大学 Levodopa production strain and directional transformation method and application thereof
CN117384817A (en) * 2023-12-07 2024-01-12 天津科技大学 Parcoumaric acid production strain, construction method and application thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118064474A (en) * 2024-04-18 2024-05-24 天津科技大学 Ferulic acid production strain, construction method and application thereof

Also Published As

Publication number Publication date
CN117866867B (en) 2024-05-28

Similar Documents

Publication Publication Date Title
EP4019624B1 (en) Genetically engineered strain having high-yield of l-valine and method for producing l-valine by fermentation
CN110468092B (en) Genetically engineered bacterium capable of producing L-valine at high yield, and construction method and application thereof
CN117384817B (en) Parcoumaric acid production strain, construction method and application thereof
CN117866867B (en) Caffeic acid production strain, construction method and application thereof
CN109777763B (en) Genetically engineered bacterium for producing L-theanine and construction and application thereof
CN116814516A (en) Tyramine production strain, construction method and application thereof
CN108949652A (en) A kind of engineering bacteria and its caffeinic application of production
CN109456987B (en) High-yield L-leucine related gene and engineering bacterium construction method and application
CN112592875B (en) Homoserine producing strain and construction method and application thereof
CN109929786B (en) Escherichia coli for producing tyrosine by fermentation method and construction method and application thereof
CN101654666B (en) Biocatalyst for production of d-lactic acid
CN114941001A (en) Construction method and application of metabolic engineering strain for producing sakuranetin by saccharomyces cerevisiae
CN111304138B (en) Recombinant escherichia coli for producing beta-carotene and construction method and application thereof
CN118064474B (en) Ferulic acid production strain, construction method and application thereof
CN118006652B (en) Dopamine production strain, construction method and application thereof
CN117866868B (en) L-high proline production strain and construction method and application thereof
CN117683802B (en) Ralstonia engineering strain for producing isoleucine through methyl malic acid pathway, construction method and production method thereof
CN117004547B (en) Genetically engineered bacterium for synthesizing cis, cis-muconic acid from glucose as substrate and application thereof
CN117844728B (en) L-valine production strain and construction method and application thereof
CN117417947A (en) Recombinant escherichia coli for producing 2, 5-dimethylpyrazine and application thereof
CN116769687A (en) Recombinant escherichia coli for producing L-phenyllactic acid as well as construction method and application thereof
CN113817659A (en) Method for preparing beta-alanine by fermenting escherichia coli modified by metabolic engineering
CN117887649A (en) Leucine production strain, construction method and application thereof
CN118109382A (en) Isoleucine-producing strain, construction method and application thereof
CN114480234A (en) Strain for producing L-alanine by high-efficiency fermentation and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant