CN117866867A - A caffeic acid producing strain and its construction method and application - Google Patents

Abstract

The invention provides a caffeic acid producing strain and a construction method and application thereof. The strain is obtained by further transforming a coumaric acid producing strain based on a starting strain by using metabolic engineering means, specifically adjusting the expression intensity of pykF , tyrP, RgTal , fre , tyrA ^fbr genes, heterologously expressing KpHpaBC , and constructing a PETH01 plasmid capable of expressing the KpHpaBC gene on the basis of a PETX02 plasmid. The strain uses glucose as a carbon source, does not need to add a tyrosine substrate, has low production cost, has the advantages of high strain stability, and has high economic benefits. The caffeic acid producing strain uses glucose as a substrate and adopts a fermentation method to efficiently and stably synthesize caffeic acid from scratch, has the advantages of low production cost, no generation of toxic metabolic byproducts, and the like, and has very good industrial application value.

Description

A caffeic acid producing strain and its construction method and application

Technical Field

The invention relates to the field of fermentation engineering technology production, in particular to a caffeic acid production strain and a construction method and application thereof.

Background technique

Caffeic acid, also known as 3,4-dihydroxycinnamic acid, is a natural phenolic acid compound found in many plants. It has antioxidant, anti-inflammatory and anti-tumor effects. It is a precursor of many important compounds and has a wide range of applications in food, medicine, cosmetics and other fields.

At present, the main methods for synthesizing caffeic acid are plant extraction, chemical synthesis and microbial fermentation. Since caffeic acid exists in coffee, wormwood, artichoke, honeysuckle and many other plants, it can be directly extracted from these plants, but the plant growth cycle is long, the product accumulation is low, and a variety of solvents are required in the plant extraction process, which limits its large-scale production; the chemical synthesis method has problems such as high energy consumption, many by-products, low yield, and high pollution; the microbial fermentation method uses glucose as the energy source for microbial growth, synthesizes caffeic acid from scratch, does not need to add substrates, reduces production costs, and has mild fermentation conditions, which has the potential for industrial production.

There are two different biosynthetic pathways for caffeic acid in organisms. One pathway is that phenylalanine is deaminated by phenylalanine ammonia lyase to generate cinnamic acid, which is then catalyzed by cinnamic acid 4-hydroxylase to generate p-coumaric acid, and finally caffeic acid is generated under the action of 4-hydroxyphenylacetic acid-3-monooxygenase. The other pathway uses tyrosine as a substrate and generates caffeic acid through continuous deamination and hydroxylation. This synthetic pathway has the advantages of short reaction path and high catalytic efficiency, so this pathway is usually used to synthesize caffeic acid in microorganisms.

However, at present, the process of synthesizing caffeic acid in microorganisms using tyrosine as a substrate is affected by problems such as excessive accumulation of intermediates, limited synthesis of cofactors and poor product tolerance, and the yield is not ideal. Therefore, how to use biological methods to synthesize caffeic acid and obtain higher yields is a problem that needs to be solved at present.

Summary of the invention

The technical problem to be solved by the present invention is to provide a caffeic acid producing strain.

Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned caffeic acid producing strain.

Another technical problem to be solved by the present invention is to provide the application of the above-mentioned caffeic acid producing strain.

In order to solve the above technical problems, the technical solution of the present invention is:

A caffeic acid producing strain, strain HY07, is obtained by further transforming a starting strain of p-coumaric acid producing strain by metabolic engineering means, specifically adjusting the expression intensity of pykF , tyrP, RgTal , fre , tyrA ^fbr genes, heterologously expressing KpHpaBC , and constructing a PETH01 plasmid capable of expressing the KpHpaBC gene (4-hydroxyphenylacetic acid-3-monooxygenase gene) on the basis of the PETX02 plasmid, wherein:

The pykF gene was knocked out in the genome of the p-coumaric acid production strain of the starting strain to prevent its expression.

The tyrP gene was overexpressed using the P _trc promoter at the yjiT pseudogene locus.

The _PT7 promoter was used to control the overexpression of the RgTal gene at the ycgH pseudogene site.

The P _trc promoter was used to control the overexpression of the fre gene at the yeep pseudogene locus.

The tyrA ^fbr gene was overexpressed using the P _trc promoter at the ilvG pseudogene locus.

The KpHpaBC gene was overexpressed using the _Ptrc promoter at the ylbE pseudogene locus.

The KpHpaBC gene was overexpressed using the T7 promoter on the PETH01 plasmid.

Preferably, in the above-mentioned caffeic acid-producing strain, the metabolic engineering means is CRISPR-Cas9 gene editing technology.

Preferably, the starting strain of the above-mentioned caffeic acid producing strain is p-coumaric acid producing strain ZG08. The p-coumaric acid producing strain ZG08 is the strain ZG08 described in the specification of patent application No. 202311666349.4.

Preferably, in the above-mentioned caffeic acid producing strain, the pykF gene (pyruvate kinase gene) is derived from Escherichia coli, and reducing the expression level of the pykF gene can effectively promote the condensation of PEP and 4-phosphate erythrose to produce DAHP, the first product in the aromatic amino acid pathway, and can effectively promote the accumulation of tyrosine, a precursor of caffeic acid.

Preferably, in the above-mentioned caffeic acid producing strain, the tyrP gene (tyrosine transporter gene) is derived from Escherichia coli, and the enzyme encoded by the tyrP gene can promote the bacteria to absorb tyrosine and transport the intracellular product caffeic acid to the outside of the cell.

Preferably, in the above-mentioned caffeic acid producing strain, the RgTal gene (tyrosine ammonia lyase gene) is derived from the RgTal gene of Rhodotorula glutinosus after codon optimization, and the enzyme encoded by the RgTal gene can promote the production of p-coumaric acid, a precursor of caffeic acid.

Preferably, in the above-mentioned caffeic acid producing strain, the fre gene (flavin reductase gene) is derived from Escherichia coli, and the enzyme encoded by the fre gene can promote the reduction of FAD into FADH ₂ .

Preferably, in the above-mentioned caffeic acid producing strain, the tyrA ^fbr gene (prephenate dehydrogenase gene) is derived from Escherichia coli, and is obtained by codon modification of the tyrA gene, specifically: the methionine (methionine) at position 53 is modified to isoleucine, and the alanine at position 354 is modified to valine. It encodes the first enzyme for tyrosine synthesis, and the negative feedback inhibition can be released after mutation. The enzyme can effectively increase the yield of tyrosine, a precursor of caffeic acid.

Preferably, in the above-mentioned caffeic acid producing strain, the KpHpaBC gene (4-hydroxyphenylacetic acid-3-monooxygenase gene) is derived from the codon-optimized KpHpaBC gene of Klebsiella pneumoniae, and the enzyme encoded by the KpHpaBC gene is a key enzyme that catalyzes the production of caffeic acid from p-coumaric acid.

Preferably, in the above-mentioned caffeic acid-producing strain, the nucleotide sequence of the P _trc promoter is shown in the sequence listing SEQ ID NO.1; the nucleotide sequence of the P _T7 promoter is shown in the sequence listing SEQ ID NO.2; the nucleotide sequence of the pykF gene is shown in the sequence listing SEQ ID NO.3; the nucleotide sequence of the tyrP gene is shown in the sequence listing SEQ ID NO.4; the nucleotide sequence of the RgTal gene is shown in the sequence listing SEQ ID NO.5; the nucleotide sequence of the fre gene is shown in the sequence listing SEQ ID NO.6; the nucleotide sequence of the tyrA ^fbr gene is shown in the sequence listing SEQ ID NO.7; and the nucleotide sequence of the KpHpaBC gene is shown in the sequence listing SEQ ID NO.8.

Preferably, in the above-mentioned caffeic acid producing strain, the PETX02 plasmid has some characteristics of the PET-28a(+) plasmid vector and has been appropriately modified. The base sequence of the PETX02 plasmid is shown in the sequence listing SEQ ID NO.9.

Preferably, in the above-mentioned caffeic acid producing strain, the base sequence of the PETH01 plasmid is shown in the sequence listing SEQ ID NO.10.

The method for constructing the above-mentioned caffeic acid production strain is to carry out directional transformation on the basis of the starting strain p-coumaric acid production strain ZG08, and the specific steps are as follows:

(1) The pykF gene was knocked out from the genome of the starting strain ZG08 to obtain strain HY01;

(2) Using strain HY01 as the starting strain, strain HY02 was obtained by overexpressing the tyrP gene using the P _trc promoter at the yjiT pseudogene site;

(3) Using strain HY02 as the starting strain, the _PT7 promoter was used to control the overexpression of the RgTal gene at the ycgH pseudogene site to obtain strain HY03;

(4) Using strain HY03 as the starting strain, the P _trc promoter was used to control the overexpression of the fre gene at the yeep pseudogene locus to obtain strain HY04;

(5) Using strain HY04 as the starting strain, the P _trc promoter was used to control the heterologous expression of the tyrA ^fbr gene at the ilvG pseudogene site to obtain strain HY05;

(6) Using strain HY05 as the starting strain, the KpHpaBC gene was overexpressed at the ylbE pseudogene locus using the P _trc promoter to obtain strain HY06;

(7) Using strain HY07 as the starting strain, a PETH01 plasmid was constructed based on the PETX02 plasmid, in which KpHpaBC was controlled by the T7 promoter and overexpressed to obtain strain HY07. Strain HY07 was the target strain after successful transformation.

Application of the caffeic acid producing strain in fermentation production of caffeic acid.

Preferably, the application of the caffeic acid producing strain uses a mechanically stirred fermenter to synthesize caffeic acid using glucose as a substrate through seed culture and fermentation culture.

Preferably, the application of the above-mentioned caffeic acid producing strain comprises the following specific steps:

(1) Seed activation: Take the caffeic acid-producing strain and inoculate it on the kanamycin-resistant activation slant, culture it at 32°C for 12 h, and subculture it twice; wash the activated bacteria on the slant with sterilized distilled water and transfer it to a 5 L mechanically stirred fermenter to start seed culture;

(2) Seed culture: Use a mechanically stirred fermenter with a culture temperature of 34°C. Maintain the culture pH at 6.6±0.2 by automatically adding 25% ammonia solution. Maintain the culture dissolved oxygen value at 40% by adjusting the stirring speed or ventilation volume. The inoculation requirement is met when the OD _600nm is 15.

(3) Fermentation culture: Use a mechanically stirred fermenter with an inoculation volume of 20% and a culture temperature of 34°C. Maintain the culture pH at 6.6±0.2 by automatically adding 25% ammonia solution. Maintain the culture dissolved oxygen value at 40% by adjusting the stirring speed or ventilation volume. Control the glucose concentration in the tank to ≤0.5 g/L by adding 80% (mass volume fraction) glucose solution. The fermentation period is ≤50 h.

Preferably, in the application of the above-mentioned caffeic acid-producing strain, the seed culture medium used in the seed culture comprises: 30 g/L glucose, 5 g/L yeast, 3 g/L peptone, 1 g/L (NH ₄ ) ₂ SO _{4 ,} 2 g/L KH ₂ PO ₄ , 1 g/L MgSO ₄ ·7H ₂ O , 3 g/L citric acid, 3 g/L glutamic acid, and the rest water.

Preferably, in the application of the above-mentioned caffeic acid-producing strain, the fermentation medium used in the fermentation culture comprises: 15 g/L glucose, 5 g/L yeast powder, 2 g/L peptone, 3 g/L citric acid, 1.5 g/L (NH ₄ ) ₂ SO ₄ , 3 g/L KH ₂ PO ₄ , 2 g/L MgSO ₄ ·7H ₂ O , 3 g/L glutamate, 10 mg/L MnSO ₄ ·H ₂ O , 20 mg/L FeSO ₄ ·7H ₂ O , 0.3 mg/L biotin, 10 mg/L riboflavin, and the rest is water.

The above culture media can be prepared using standard methods.

Preferably, in the application of the above-mentioned caffeic acid producing strain, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar solution during fermentation culture, specifically: 6 mg PLP, 1.5 g choline chloride, 1 g betaine and 20 mg riboflavin are added to each liter of 80% (mass volume fraction) glucose solution (i.e., PLP 6 mg/L _{sugar solution} , choline chloride 1.5 g/L _{sugar solution} , betaine 1 g/L _{sugar solution} , riboflavin 20 mg/L _{sugar solution} ).

Beneficial effects:

The caffeic acid producing strain is obtained by adopting a directed transformation method of de novo synthesis through the caffeic acid metabolic synthesis pathway, uses glucose as a carbon source, does not need to add tyrosine substrate, has the advantages of low production cost, high strain stability, and high economic benefit. The caffeic acid producing strain uses glucose as a substrate and adopts a fermentation method to efficiently and stably synthesize caffeic acid from scratch, has the advantages of low production cost, no generation of toxic metabolic by-products, etc., produces 15.1 g/L of caffeic acid after 50 hours of fermentation, and has very good industrial application value. Since caffeic acid is toxic to the bacteria themselves, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added during the application process, which can ensure the catalytic requirements of tyrosine ammonia lyase and 4-hydroxyphenylacetic acid-3-monooxygenase genes on the one hand, and ensure the vitality of the strain on the other hand, improve production efficiency, and lay a foundation for the large-scale production of caffeic acid.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 is a diagram showing the genetic modification process of the de novo synthesis pathway of caffeic acid producing strains.

Detailed ways

In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

The percentage sign "%" involved in the examples, unless otherwise specified, refers to mass percentage. The percentage of a solution refers to the number of grams of a solute contained in 100 mL. The percentage between liquids refers to the volume ratio of the solution at 25°C.

The starting strain p-coumaric acid producing strain ZG08 used in the example is the strain ZG08 described in the specification of patent application No. 202311666349.4. The corresponding promoters and genes are shown in the sequence table.

As shown in Figure 1, the caffeic acid producing strain was constructed by the following method: the pykF gene was knocked out in the genome of the starting strain p-coumaric acid producing strain ZG08 to prevent its expression; the tyrP gene was overexpressed by using the _Ptrc promoter at the yjiT pseudogene site; the RgTal gene was overexpressed by using the _Pt7 promoter at the ycgH pseudogene site; the fre gene was overexpressed by using the _Ptrc promoter at the yeep pseudogene site; the tyrAfbr gene was overexpressed by using the _Ptrc promoter at the ilvG ^pseudogene site; the KpHpaBC gene was overexpressed by using the _Ptrc promoter at the ylbE pseudogene site; and the KpHpaBC gene was overexpressed by using the T7 promoter on the PETH01 plasmid.

Example 1

1. Methods of gene editing

The gene editing method used is based on the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic Engineering, 2015, 31: 13-21.). The method involves engineering plasmids pREDCas9 and pGRB, wherein pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, the Cas9 protein expression system, and spectinomycin resistance (working concentration: 100 mg/L); pGRB uses pUC18 as the backbone, including the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, and ampicillin resistance (working concentration: 100 mg/L). The professional terms involved in the following Examples 2-4 can all be explained in this article.

2. The primers used in the strain construction process are shown in Table 1.

Table 1 Primers involved in strain construction

Primer name Primer sequence (5'-3') serial number pykF -pGRB-S AGTCCTAGGTATAATACTAGTGACAAACAGGACCTGATCTTGTTTTAGAGCTAGAA SEQ ID NO.11 pykF -pGRB-A TTCTAGCTCTAAAACAAGATCAGGTCCTGTTTGTCACTAGTATTATACCTAGGACT SEQ ID NO.12 pykF -US ATCCTTAGAGCGAGGCACC SEQ ID NO.13 pykF -UA CCAGTTCTTTACCCAGACGCAGGATAGCGGCGGTTTTA SEQ ID NO.14 pykF -DS TAAAACCGCCGCTATCCTGCGTCTGGGTAAAGAACTGG SEQ ID NO.15 pykF -DA GATCGTTCGCTCAAAGAAGC SEQ ID NO.16 pGRB- yjiT -S AGTCCTAGGTATAATACTAGTCTGATAACCTCAATTCCTTAGTTTTAGAGCTAGAA SEQ ID NO.17 pGRB- yjiT -A TTCTAGCTCTAAAACTAAGGAATTGAGGTTATCAGACTAGTATTATACCTAGGACT SEQ ID NO.18 yjiT -US CATTCCCTCTACAGAACTAGCCCTT SEQ ID NO.19 YJT -UA AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAAAAACAGGCAGCAAAGTCCC SEQ ID NO.20 yjiT -DS GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATAAGCACTACCTGTGAAGGGATGT SEQ ID NO.21 YJT -DA CAGGGCTTCCACAGTCACAAT SEQ ID NO.22 yjiT - tyrP -S CGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCGTGAAAAACAGAACCCTGGGAA SEQ ID NO.23 yjiT-tyrP-A ATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTCACCCCACTTCTGGTAACAACC SEQ ID NO.24 pGRB- ycgH -S AGTCCTAGGTATAATACTAGTTATGCGTCTGAACGACCGTGGTTTTAGAGCTAGAA SEQ ID NO.25 pGRB- ycgH -A TTCTAGCTCTAAAACCACGGTCGTTCAGACGCATAACTAGTATTATACCTAGGACT SEQ ID NO.26 ycgH -US TAAACTCGTCAGCGGCACAA SEQ ID NO.27 ycgH -UA CTCCTTCTTAAAGTTAAACAAAATTATTTCTAGACCCTATAGTGAGTCGTATTAGGTAGGCGTTTCTGTTGATTCTG SEQ ID NO.28 ycgH -DS CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCGTGTCGGATTATCGTTCGA SEQ ID NO.29 ycgH -DA GATTCAGGTTGCCATTTACGC SEQ ID NO.30 ycgH - RgTal -S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGCGCCGCGCCCGACGAG SEQ ID NO.31 ycgH - RgTal -A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTAGGCTAACATTTTCAGCAGCACG SEQ ID NO.32 pGRB- yeeP -S AGTCCTAGGTATAATACTAGTAGGCGGTATTCCGTCTGTTCGTTTTAGAGCTAGAA SEQ ID NO.33 pGRB- yeeP -A TTCTAGCTCTAAAACGAACAGACGGAATACCGCCTACTAGTATTATACCTAGGACT SEQ ID NO.34 yeeP -US GGTCAGGAGGTAACTTATCAGCG SEQ ID NO.35 yeeP -UA AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAATGGCAGGGCTCCGTTTT SEQ ID NO.36 yeeP -DS AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGAACTGGATTTTCTTCTGAACCTGT SEQ ID NO.37 yeeP -DA ACGATGTCAGCAGCCAGCA SEQ ID NO.38 yeeP - fre -S CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGACAACCTTAAGCTGTAAAGTGACC SEQ ID NO.39 yeeP - fre -A CAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTCAGATAAATGCAAACGCATCGC SEQ ID NO.40 ilvG -pGRB-S AGTCCTAGGTATAATACTAGTTATCGGCACTGACGCATTTCGTTTTAGAGCTAGAA SEQ ID NO.41 ilvG -pGRB-A TTCTAGCTCTAAAACGAAATGCGTCAGTGCCGATAACTAGTATTATACCTAGGACT SEQ ID NO.42 ilvG -US CCGAGGAGCAGACAATGAATAACAG SEQ ID NO.43 ilvG -UA GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACGGTGATGGCAACAACAGGG SEQ ID NO.44 ilvG -DS CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGCTATCTACGCGCCGTTGTTG SEQ ID NO.45 ilvG -DA GAAGGCGCTGGCTAACATGAGG SEQ ID NO.46 ilvG - tyrA ^fbr -S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGTTGCTGAATTGACCGC SEQ ID NO.47 ilvG - tyrA ^fbr -A GACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACTGGCGATTGTCATTCGC SEQ ID NO.48 ylbE -pGRB-U AGTCCTAGGTATAATACTAGTACACTGGCTGGATGTGCAACGTTTTAGAGCTAGAA SEQ ID NO.49 ylbE -pGRB-D TTCTAGCTCTAAAACGTTGCACATCCAGCCAGTGTACTAGTATTATACCTAGGACT SEQ ID NO.50 ylbE -US ACCCAACCTTACGCAACCAG SEQ ID NO.51 ylbE -UA GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAATTGTTCGATAACCGCAGCAT SEQ ID NO.52 ylbE -DS CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCGCTGGCGTGCTTTGAAC SEQ ID NO.53 ylbE -DA GGCGTAACTCAGCAGGCAG SEQ ID NO.54 ylbE - KpHpaBC -S TATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAACCGGAAGATTTTCGCG SEQ ID NO.55 ylbE - KpHpaBC -A CAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACACCGCCACTTCCATTTCC SEQ ID NO.56 KpHpaBC -Pet-S GTGAGCGGATAACAATTCCCCTCTAGAATGAAACCGGAAGATTTTCGCG SEQ ID NO.57 KpHpaBC -Pet-A GTTTCCGCGGTGCTGCCCATGAATTCTTACACCGCCACTTCCATTTCC SEQ ID NO.58

Example 2

This example is intended to illustrate the steps of knocking out the pykF gene in the genome, and the specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, pykF -US, pykF -UA and pykF -DS, pykF -DA as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm and the downstream homology arm, and then using it as a template, HS enzyme overlapping PCR was performed to obtain the Δ pykF gene knockout fragment, and the gene integration fragment consisted of the pykF upstream homology arm and the pykF downstream homology arm.

② Using pGRB- pykF -S and pGRB- pykF -A as primers, construct a DNA fragment containing the target sequence used by pGRB- pykF through a PCR annealing program, and transform it into Top10 competent cells, screen to obtain positive transformants, and extract plasmid pGRB- pykF ;

③The ΔpykF gene knockout fragment obtained in steps ② and ③ and the pGRB- pykF plasmid were electroporated into the ZG08 strain, and positive transformants were obtained after screening and named HY01.

Example 3

This example is intended to illustrate the steps of using the P _trc promoter to control the overexpression of the tyrP gene at the yjiT pseudogene site. The specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, yjiT -US, yjiT -UA, yjiT -DS, yjiT -DA and tyrP -S, tyrP -A as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm, downstream homology arm and target gene fragment, and then using it as a template, HS enzyme overlapping PCR was performed to obtain the P _trc - tyrP ( ycgH ) gene integration fragment, which consists of the ycgH upstream homology arm, the P _trc - tyrP target gene and the ycgH downstream homology arm.

② Using pGRB- yjiT -S and pGRB- yjiT -A as primers, construct a DNA fragment containing the target sequence used in pGRB- yjiT through a PCR annealing program, and transform it into Top10 competent cells, screen to obtain positive transformants, and extract plasmid pGRB- yjiT .

③The P _trc - tyrP ( yjiT ) gene integration fragment obtained in steps ② and ③ and the pGRB- yjiT plasmid were electroporated into the HY01 strain, and positive transformants were obtained after screening and named HY02.

Example 4

This example is intended to illustrate the steps of controlling the overexpression of the RgTal gene using the _PT7 promoter at the ycgH pseudogene site. The specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, and using ycgH -US, ycgH -UA, ycgH -DS, ycgH -DA and RgTal -S, RgTal -A as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm, downstream homology arm, and target gene fragment, and then using it as a template, HS enzyme overlapping PCR was performed to obtain the _PT7 - RgTal ( ycgH ) gene integration fragment, which consists of the ycgH upstream homology arm, the _PT7 - RgTal target gene and the ycgH downstream homology arm.

② Using pGRB- ycgH -S and pGRB- ycgH -A as primers, construct a DNA fragment containing the target sequence used in pGRB- ycgH through a PCR annealing program, and transform it into Top10 competent cells, screen to obtain positive transformants, and extract plasmid pGRB- ycgH .

③The _PT7 - RgTal ( ycgH ) gene integration fragment obtained in steps ② and ③ and the pGRB- ycgH plasmid were electroporated into the HY02 strain, and positive transformants were obtained after screening and named HY03.

Example 5

This example is intended to illustrate the steps of controlling the overexpression of the fre gene using the P _trc promoter at the yeeP pseudogene site. The specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, yeeP -US, yeeP -UA, yeeP -DS, yeeP -DA and fre -S, fre -A as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm, downstream homology arm, and target gene fragment, and then using it as a template, HS enzyme overlapping PCR was performed to obtain the P _trc - fre ( yeeP ) gene integration fragment, which consists of the yeeP upstream homology arm, the P _trc - fre target gene and the yeeP downstream homology arm.

② Using pGRB- yeeP -S and pGRB- yeeP -A as primers, construct a DNA fragment containing the target sequence used in pGRB- yeeP through a PCR annealing program, and transform it into Top10 competent cells, screen for positive transformants, and extract plasmid pGRB- yeeP .

③The P _trc - fre ( yeeP ) gene integration fragment obtained in steps ② and ③ and the pGRB- yeeP plasmid were electroporated into the HY03 strain, and positive transformants were obtained after screening and named HY04.

Example 6

This example is intended to illustrate the steps of controlling the overexpression of the tyrA ^fbr gene using the P _trc promoter at the ilvG pseudogene site. The specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, ilvG -US, ilvG -UA, ilvG -DS, ilvG -DA and tyrA ^fbr -S, tyrA ^fbr -A as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm, downstream homology arm, and target gene fragment, and then using it as a template, HS enzyme overlapping PCR was performed to obtain the P _trc - tyrA ^fbr ( ilvG ) gene integration fragment, which consists of the ilvG upstream homology arm, the P _trc - tyrA ^fbr target gene and the ilvG downstream homology arm.

② Using pGRB- ilvG -S and pGRB- ilvG -A as primers, construct a DNA fragment containing the target sequence used by pGRB- ilvG through a PCR annealing program, and transform it into Top10 transfection competent cells, screen to obtain positive transformants, and extract plasmid pGRB- ilvG .

③The P _trc - tyrA ^fbr ( ilvG ) gene integration fragment obtained in steps ② and ③ and the pGRB- ilvG plasmid were electroporated into the HY04 strain, and positive transformants were obtained after screening and named HY05.

Example 7

This example is intended to illustrate the steps of using the P _trc promoter to control the heterologous expression of the KpHpaBC gene at the ylbE pseudogene site. The specific steps are as follows:

① Using the Escherichia coli W3110 genome as a template, ylbE -US, ylbE -UA, ylbE -DS, and ylbE -DA as primers, HS enzyme PCR amplification was performed to obtain the upstream homology arm and the downstream homology arm; using the Rhodotorula glutinosus genome as a template, ylbE - KpHpaBC -S and ylbE - KpHpaBC -A as primers, HS enzyme PCR amplification was performed to obtain the target gene fragment, and codon optimization was performed on it; then, using the upstream homology arm, the downstream homology arm, and the target gene fragment after codon optimization as templates, HS enzyme overlapping PCR was performed to obtain the P _trc - KpHpaBC ( ylbE ) gene integration fragment, which consists of the ylbE upstream homology arm, the P _trc - KpHpaBC target gene, and the ylbE downstream homology arm.

② Using pGRB- ylbE -S and pGRB- ylbE -A as primers, construct a DNA fragment containing the target sequence used in pGRB- ylbE through a PCR annealing program, and transform it into Top10 transfection competent cells, screen to obtain positive transformants, and extract plasmid pGRB- ylbE .

③The P _trc - KpHpaBC ( ylbE ) gene integration fragment obtained in steps ② and ③ and the pGRB- ylbE plasmid were electroporated into the HY05 strain, and positive transformants were obtained after screening and named HY06.

Example 8

This example is intended to illustrate the steps of constructing a PETH01 plasmid that can express the KpHpaBC gene (4-hydroxyphenylacetic acid-3-monooxygenase gene), and the specific steps are as follows:

① Using the Klebsiella pneumoniae genome as a template and KpHpaBC -Pet-S and KpHpaBC -Pet-A as primers, the target gene fragment was amplified by HS enzyme PCR and codon optimized.

③Use XbaΙ and EcoRΙ as restriction enzyme cutting sites to digest the PETX02 plasmid, use recombinase to connect the linearized vector with the codon-optimized KpHpaBC target gene fragment, and transform it into Top10 transfection competent cells, screen to obtain positive transformants, and extract plasmid PETH01.

④The PETH01 plasmid obtained in step ③ was electroporated into the HY06 strain, and positive transformants were obtained after screening and named HY07.

Example 9

The strain HY07 obtained in Example 8 was used as a caffeic acid producing strain. This example aims to illustrate a method for producing caffeic acid using the producing strain. The specific cultivation method is as follows:

Seed activation: Take the -80℃ preserved strain and streak it on the kanamycin-resistant activation slant, culture it at 32℃ for 12h, and subculture it twice; wash the activated bacteria on the slant with sterilized distilled water and transfer it to a 5 L mechanically stirred fermenter to start seed culture.

Seed culture: A 5 L mechanically stirred fermenter was used with a culture temperature of 34°C. The culture pH was maintained at 6.6±0.2 by automatically adding 25% ammonia solution. The culture dissolved oxygen value was maintained at 40% by adjusting the stirring speed or ventilation volume. The inoculation requirement was met when the OD _600nm was 15. The seed culture medium used was: 30 g/L glucose, 5 g/L yeast, 3 g/L peptone, 1 g/L (NH ₄ ) ₂ SO _{4 ,} 2 g/L KH ₂ PO ₄ , 1 g/L MgSO ₄ ·7H ₂ O , 3 g/L citric acid, 3 g/L glutamic acid, and the rest was water.

Fermentation culture: A 5 L mechanically stirred fermenter was used, the fermentation inoculation amount was 20%, the culture temperature was 34°C, the culture pH was maintained at 6.6±0.2 by automatic flow addition of 25% ammonia solution, the culture dissolved oxygen value was maintained at 40% by adjusting the stirring speed or ventilation volume, and the glucose concentration in the tank was controlled at ≤0.5 g/L by flow addition of 80% (mass volume fraction) glucose solution, and the fermentation cycle was 50 h; the fermentation medium used was: glucose 15 g/L, yeast powder 5 g/L, peptone 2 g/L, citric acid 3 g/L, (NH ₄ ) ₂ SO ₄ 1.5 g/L, KH ₂ PO ₄ 3 g/L, MgSO ₄ ·7H ₂ O 2 g/L, glutamate 3 g/L, MnSO ₄ ·H ₂ O 10 mg/L, FeSO ₄ ·7H ₂ O 20 mg/L, biotin 0.3 mg/L, riboflavin 10 mg/L, and the rest was water.

During fermentation culture, PLP (pyridoxal phosphate), choline chloride, betaine and riboflavin are added with the sugar solution flow, specifically: 6 mg PLP, 1.5 g choline chloride, 1 g betaine and 20 mg riboflavin are added to each liter of 80% (mass volume fraction) glucose solution, that is, PLP 6 mg/L _{sugar solution} , choline chloride 1.5 g/L _{sugar solution} , betaine 1 g/L _{sugar solution} , riboflavin 20 mg/L _{sugar solution} .

Example 10

Taking strain HY07 as the production strain, this example is intended to illustrate the effects of PLP, choline chloride, betaine and riboflavin in the application of caffeic acid fermentation. The specific fermentation culture method is as shown in Example 9, the only difference is the addition amount of PLP, choline chloride, betaine and riboflavin in 80% glucose solution, and a total of four groups of controls are set. The present invention discloses data of four groups of fermentation tanks fermented for 50 hours, and the results are shown in Table 2, Table 3, Table 4, Table 5 and Table 6.

Table 2 Effects of PLP on bacterial biomass and caffeic acid production

Group 1 Group 2 Group 3 Group 4 PLP addition amount (mg/L _{sugar solution} ) 0 3 6 9 Bacterial biomass OD _600nm 88.1 87.5 89.4 90.1 Caffeic acid yield g/L 3.3 5.1 7.6 5.8

Table 3 Effect of choline chloride on bacterial biomass

Group 1 Group 2 Group 3 Group 4 Choline chloride addition amount (g/L _{sugar solution} ) 0 1 1.5 2 Bacterial biomass OD _600nm 88.4 96.7 106.8 98.1

Table 4 Effect of betaine on bacterial biomass

Group 1 Group 2 Group 3 Group 4 Betaine addition amount (g/L _{sugar solution} ) 0 1 2 3 Bacterial biomass OD _600nm 86.1 113.3 105.2 99.7

Table 5 Effects of riboflavin on bacterial biomass and caffeic acid production

Group 1 Group 2 Group 3 Group 4 Riboflavin addition amount (mg/L _{sugar solution} ) 5 10 20 30 Bacterial biomass OD _600nm 89.8 91.4 90.8 88.1 Caffeic acid yield g/L 5.7 7.8 10.2 9.1

Table 6 Effects of PLP, choline chloride, betaine and riboflavin on bacterial biomass and caffeic acid production

Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 PLP addition amount (mg/L _{sugar solution} ) 0 6 6 6 6 6 Choline chloride addition amount (g/L _{sugar solution} ) 0 1.5 0 0 1.5 0 Betaine addition amount (g/L _{sugar solution} ) 0 0 1 0 1 1 Riboflavin addition amount (mg/L _{sugar solution} ) 0 0 0 20 0 20 Bacterial biomass OD _600nm 87.5 105.7 112.9 89.4 122.3 114.7 Caffeic acid yield g/L 3.1 8.2 8.7 11.7 9.1 13.1

Group 7 Group 8 Group 9 Group 10 Group 11 Group 12 PLP addition amount (mg/L _{sugar solution} ) 0 0 0 0 6 6 Choline chloride addition amount (g/L _{sugar solution} ) 1.5 1.5 0 1.5 1.5 1.5 Betaine addition amount (g/L _{sugar solution} ) 1 0 1 1 0 1 Riboflavin addition amount (mg/L _{sugar solution} ) 0 20 20 20 20 20 Bacterial biomass OD _600nm 121.9 103.2 111.4 122.7 105.5 123.3 Caffeic acid yield g/L 4.5 11.6 12.5 12.9 13.3 15.1

The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. Improvements and modifications such as strain transformation carried out by technicians in this technical field based on the method of the present invention or on the basis of the method are deemed to be within the scope of protection of the present invention.

Claims (10)

1. A caffeic acid producing strain, characterized in that: is obtained by further modifying the coumaric acid producing strain based on the original strain by using metabolic engineering means, in particular to the coumaric acid producing strainpykF、tyrP、RgTal、fre、tyrA ^fbr The expression intensity of the gene was adjusted toKpHpaBCHeterologous expression is performed and at PConstruction of expression on the basis of ETX02 plasmidKpHpaBCA PETH01 plasmid of a gene, wherein:

knockout on genome of original strain p-coumaric acid producing strainpykFThe gene is not expressed by the gene,

at the position ofyjiTPseudogene locus use P _trc Promoter controltyrPThe gene is over-expressed and the expression of the gene is improved,

at the position ofycgHPseudogene locus use P _T7 Promoter controlRgTalThe gene is over-expressed and the expression of the gene is improved,

at the position ofyeepPseudogene locus use P _trc Promoter controlfreThe gene is over-expressed and the expression of the gene is improved,

at the position ofilvGPseudogene locus use P _trc Promoter controltyrA ^fbr The gene is over-expressed and the expression of the gene is improved,

at the position ofylbEPseudogene locus use P _trc Promoter controlKpHpaBCThe gene is over-expressed and the expression of the gene is improved,

use of T7 promoter control on PETH01 plasmidKpHpaBCThe gene is over-expressed.

2. The caffeic acid producing strain according to claim 1, wherein: the P is _trc The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 1; the P is _T7 The nucleotide sequence of the promoter is shown in a sequence table SEQ ID NO. 2; the saidpykFThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 3; the saidtyrPThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 4; the saidRgTalThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 5; the saidfreThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 6; the saidtyrA ^fbr The nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 7; the saidKpHpaBCThe nucleotide sequence of the gene is shown in a sequence table SEQ ID NO. 8.

3. The caffeic acid producing strain according to claim 1, wherein: the PETX02 plasmid has the partial characteristics of a PET-28a (+) plasmid vector and is properly modified, and the base sequence of the PETX02 plasmid is shown as a sequence table SEQ ID NO. 9; the base sequence of the PETH01 plasmid is shown in a sequence table SEQ ID NO. 10.

4. The method for constructing a caffeic acid producing strain according to claim 1, wherein: the method is characterized by directionally modifying a coumaric acid production strain ZG08 based on an original strain, and comprises the following specific steps:

(1) Knock-out on the genome of the starting strain ZG08pykFObtaining a strain HY01 by genes;

(2) Starting from strain HY01, inyjiTPseudogene locus use P _trc Promoter controltyrPThe gene is over-expressed to obtain a strain HY02;

(3) Starting strain HY02, inycgHPseudogene locus use P _T7 Promoter controlRgTalThe gene is over-expressed to obtain a strain HY03;

(4) Starting from strain HY03, inyeepPseudogene locus use P _trc Promoter controlfreThe gene is over-expressed to obtain a strain HY04;

(5) Starting strain HY04ilvGPseudogene locus use P _trc Promoter controltyrA ^fbr Heterologous gene expression to obtain strain HY05;

(6) Starting strain HY05ylbEPseudogene locus use P _trc Promoter controlKpHpaBCThe gene is over-expressed to obtain a strain HY06;

(7) The strain HY07 is taken as an original strain, and a T7 promoter is constructed and used for controlling on the basis of PETX02 plasmidKpHpaBCAnd (3) the PETH01 plasmid is subjected to overexpression to obtain a strain HY07, wherein the strain HY07 is the target bacterium after being successfully transformed.

5. Use of the caffeic acid producing strain according to claim 1 for the fermentative production of caffeic acid.

6. Use of a caffeic acid producing strain according to claim 5, wherein: and (3) using a mechanical stirring type fermentation tank to synthesize caffeic acid by seed culture and fermentation culture and taking glucose as a substrate.

7. Use of a caffeic acid producing strain according to claim 5 or 6, characterized in that: the method comprises the following specific steps:

(1) Seed activation: streaking and inoculating a caffeic acid production strain on a kanamycin resistance activation inclined plane, culturing and passaging;

(2) Seed culture: transferring the activated thallus to a mechanical stirring fermenter, culturing at 34 deg.C, maintaining culture pH at 6.6+ -0.2 by automatic feeding 25% ammonia water solution, maintaining culture dissolved oxygen value at 40%, and obtaining OD _600nm 15, the inoculation requirement is met;

(3) Fermentation culture: the inoculation amount is 20%, the culture temperature is 34 ℃, the culture pH is maintained at 6.6+/-0.2 by automatically feeding 25% ammonia water solution, the dissolved oxygen value of the culture is maintained at 40%, the glucose concentration in the tank is controlled to be less than or equal to 0.5g/L by feeding glucose solution, and the fermentation period is less than or equal to 50 hours.

8. Use of a caffeic acid producing strain according to claim 7, wherein: the seed culture medium adopted in the seed culture comprises: glucose 30 g/L, yeast 5g/L, peptone 3g/L, (NH) ₄ ) ₂ SO ₄ 1 g/L，KH ₂ PO ₄ 2 g/L，MgSO ₄ ·7H ₂ O1 g/L, citric acid 3g/L, glutamic acid 3g/L and the balance of water.

9. Use of a caffeic acid producing strain according to claim 7, wherein: the fermentation culture medium adopted in the fermentation culture comprises the following components: glucose 15 g/L, yeast powder 5g/L, peptone 2 g/L, citric acid 3g/L, (NH) ₄ ) ₂ SO ₄ 1.5 g/L，KH ₂ PO ₄ 3 g/L，MgSO ₄ ·7H ₂ O2 g/L, glutamic acid 3g/L, mnSO ₄ ·H ₂ O 10 mg/L，FeSO ₄ ·7H ₂ O20 mg/L, biotin 0.3 mg/L, riboflavin 10 mg/L and the balance water.

10. Use of a caffeic acid producing strain according to claim 7, wherein: during fermentation culture, PLP, choline chloride, betaine and riboflavin are added along with the sugar liquid flow, and the specific steps are as follows: to 80% glucose solution per liter, 6mg PLP, 1.5g choline chloride, 1g betaine and 20mg riboflavin were added.