CN102277327B - Colon bacillus for over-expressing RimL and application on preparing N-extrasin alpha acetylate - Google Patents

Abstract

The invention discloses a colon bacillus for over-expressing RimL and an application on preparing N-extrasin alpha acetylate. The invention provides a recombinant strain and the recombinant strain is obtained by introducing a coding gene of the RimL and a coding gene of the extrasin alpha into host bacteria. The experiment provided by the invention shows that the invention constructs the recombinant strain which is obtained by co-expressing the coding genes of N-acetylase RimL and the extrasin alpha, the recombinant strain is fermented to obtain the extrasin alpha, and a large part of the extrasin alpha is the N-extrasin alpha acetylate; and the colon bacillus has a obvious application prospect.

Description

The intestinal bacteria of process LAN RimL and the application in preparation N-acetylated thymosin alpha thereof

Technical field

The present invention relates to biological technical field, particularly relate to the intestinal bacteria of a kind of process LAN RimL and the application in preparation N-acetylated thymosin alpha thereof.

Background technology

The terminated acetylated modification of N-of proteins and peptides is that in eukaryotic cell, ubiquitous one is modified, and the eukaryotic cell plasmosin of more than 50% has this modification.Preliminary functional study shows that N-is terminated acetylated and closes the modes such as N end by changing the charge of N-end, produces material impact to the characteristic such as space structure, part identification, anti-degraded of many proteins and peptides.The terminated acetylated modification of N-as small molecules GTPaes-Arl3P albumen facilitates the identification of itself and membrane receptor Sys1p/hSys1, and makes it navigate on film.Terminated acetylated its tetrameric depolymerization ability that can make of the N-of foetal haemoglobin improves 30 times.The N-of thymosin α1 (thymosin α 1, T α 1) is terminated acetylated has vital role to its stability in blood plasma.Except T α 1; also just like melanocyte-stimulating hormone (Melanocyte-Stimulating Hormones; α-MSH), a collection of polypeptide clinically with important application such as extrasin beta 4 (Thymosin β 4, T β 4) also needs the terminated acetylated modification of N-.

Visibly different with the ubiquity phenomenon in eukaryote, the terminated acetylated modification of procaryotic N-is very rare.Several albumen only having ribosomal subunit L7, S5, S18, elongation factor EF-Tu and chaperone SecB etc. few in number of the terminated acetylated modification of known generation N-in intestinal bacteria intrinsic protein.The acetyltransferase of the terminated acetylated modification of N-of the participation proteins and peptides had been found that in intestinal bacteria only has the RimI of responsible ribosomal subunit S5 acetylation modification; the RimJ of ribosomal subunit S18 acetylation modification, and the RimL of ribosomal subunit L7 acetylation modification.These acetyltransferases have very strong Substratspezifitaet.Except the specific substrate that above-mentioned each enzyme is corresponding, unknown its can modify other albumen colibacillary or polypeptide.

Extrasin alpha is the immunoloregulation polypeptide that gang has same or analogous N-terminal sequence, and they comprise prophymosin-alpha, thymosin α1, thymosin α1 1 and various fusion roteins thereof etc.Thymosin α1 and thymosin α1 1 are the products of prophymosin-alpha degradation in vivo, and the N-that they include prophymosin-alpha respectively holds 28 and 35 amino acid.The extrasin alpha of different plant species has very high conservative property.On the aminoacid sequence of extrasin alpha there is polymorphism in some site, and as its N-holds the 13rd amino acids residue, have plenty of Threonine, have plenty of Isoleucine, they have same or analogous function.

Zadaxin is the immunological reagent comprising various extrasin alpha and other thymic origin peptide class extracted in a class animal thymus, has been widely used in the treatment of viral hepatitis, tumour etc.But the Zadaxin that animal is extracted exists complicated component, and purity is low, is wherein mixed with the pollutent of animal-origin, easily produce the problems such as anaphylaxis.The N-acetylated thymosin alpha 1 of chemosynthesis, it is a kind of N-acetylated thymosin alpha 1 adopting chemiluminescent polypeptide synthetic method to prepare, T α 1 purity of this kind of method acquisition is high, activity is high, do not have obvious side reaction, as " Zadaxin " of SciClone company, be included China and obtained as immunoregulation druge at interior multiple state approvals for the treatment of viral hepatitis; But chemosynthesis N-acetylated thymosin alpha 1 such 28 amino acid whose polypeptide, synthesis and purifying process complexity, yield is lower, and therefore goods price is high, limits the widespread use of this medicine.

Summary of the invention

An object of the present invention is to provide a kind of recombinant bacterium.

Recombinant bacterium provided by the invention is following 1) or 2):

1) encoding gene of the encoding gene of RimL and extrasin alpha is imported the recombinant bacterium obtained in Host Strains; Described Host Strains is the Host Strains containing RimL encoding gene in genome;

2) encoding gene of extrasin alpha is imported the recombinant bacterium obtained in recombinant bacterium as described below;

Described RimL is the albumen shown in following (a), (b) or (c):

A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;

B aminoacid sequence shown in sequence in sequence table 2 is had the albumen of identical function through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation by ();

C () and DNA sequence dna a) or b) limited at least have 90% homology and have the albumen of identical function;

Described extrasin alpha is a peptide species or albumen, and in 28 amino-acid residues of 28 amino-acid residues of its N-terminal or its N-terminal identical with 28 amino acid of the N-terminal of sequence in sequence table 3 and sequence table, 28 amino acid of the N-terminal of sequence 3 at least have 90% homology.

The replacement of one or several amino-acid residue described and/or disappearance and/or be added to the replacement of 10 amino-acid residues and/or disappearance and/or interpolation.

1), in the recombinant bacterium shown in, the described method encoding gene of the encoding gene of RimL and extrasin alpha being imported Host Strains comprises the steps:

A) encoding gene of described RimL is imported described Host Strains by recombinant vectors 2, obtain recombinant bacterium A;

B) by the described recombinant bacterium A that the encoding gene of described extrasin alpha a) is obtained by recombinant vectors 1 steps for importing, recombinant bacterium is obtained;

Described recombinant vectors 1 is that described extrasin alpha encoding gene inserts in expression vector 1, obtains the recombinant vectors 1 of expressing extrasin alpha; Described expression vector 1 is preferably pBV220; Described recombinant vectors 1 is specially and is inserted between BamHI and the EcoRI restriction enzyme site of pBV220 by described extrasin alpha encoding gene, obtains the recombinant vectors 1 of expressing extrasin alpha;

The encoding gene of described RimL imports in Host Strains by recombinant vectors 2 by described recombinant bacterium A, the recombinant bacterium A obtained; Described expression vector 2 is preferably pOKBV; Described recombinant vectors 2 is specially and is inserted by the encoding gene of described RimL between EcoR I in pOKBV carrier and Sal I restriction enzyme site, obtains the recombinant vectors 2 of expressing RimL.

1), in the recombinant bacterium shown in, described Host Strains is intestinal bacteria;

Described RimL encoding gene is following 1) or 2) arbitrary shown DNA molecular:

1) DNA molecular shown in sequence 1 in sequence table;

2) with 1) DNA sequence dna that limits at least has 90% homology and the DNA molecular of the albumen with identical function of encoding;

Described extrasin alpha encoding gene is a kind of polynucleotide, and it is identical or play with 5 ' end of the sequence 4 in sequence table the DNA molecular that 84 nucleotide homologies at least have 90% that its nucleotide sequence and 5 ' end of the sequence 4 in sequence table play 84 Nucleotide.

Another object of the present invention is to provide a kind of recombinant bacterium A.

Recombinant bacterium A provided by the invention, for the encoding gene of described RimL is imported in Host Strains by recombinant vectors, the recombinant bacterium A obtained;

Described recombinant vectors is inserted in expression vector by the encoding gene of described RimL, and obtain the recombinant vectors of expressing RimL, described expression vector is expressed by the encoding gene of inducible promoter control RimL.

Described inducible promoter is Lac operon, Arabinose promoter, alkaline phosphatase promotor, trp promoter, phage t7, P _l, P _rpromotor or hybrid promoter Tac, P containing these promotor subelements _lp _r, described expression vector is preferably pOKBV.

3rd object of the present invention is to provide a kind of recombinant bacterium.

Recombinant bacterium provided by the invention, for external source inducible promoter being inserted the upstream of the acetyl grouptransfer enzyme coding gene of Host Strains, for starting the expression of described acetyl grouptransfer enzyme coding gene, the recombinant bacterium obtained.

Described inducible promoter is Lac operon, Arabinose promoter, alkaline phosphatase promotor, trp promoter, phage t7, P _l, P _rpromotor or hybrid promoter Tac, P containing these promotor subelements _lp _r.

Described Host Strains is intestinal bacteria;

Described inducible promoter is phage t7 promotor, its nucleotides sequence be classified as sequence 5 in sequence table from 5 ' end 1119-1135 position Nucleotide;

Described acetyltransferase is RimL,

Described RimL is the albumen shown in following (a), (b) or (c):

A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;

B aminoacid sequence shown in sequence in sequence table 2 is had the albumen of identical function through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation by ();

C () and amino acid a) or b) limited at least have 90% homology and have the albumen of identical function.

Above-mentioned recombinant bacterium is prepared as follows:

1) pKD46 plasmid is imported in Host Strains, obtain recombinant bacterium 1;

2) by the DNA molecular steps for importing 1 containing T7 promotor) in the recombinant bacterium 1 that obtains, obtain recombinant bacterium 2;

3) by step 2) recombinant bacterium 2 that obtains cultivates respectively in the substratum containing paraxin and the substratum containing penbritin, if can grow containing on the substratum of paraxin, but do not grow at the substratum containing penbritin be recombinant bacterium;

The nucleotides sequence of the described DNA molecular containing T7 promotor is classified as the 1119-1135 position Nucleotide of the sequence 5 in sequence table.

The application of described recombinant bacterium in preparation N-acetylated thymosin alpha is also the scope of protection of the invention.

4th object of the present invention is to provide a kind of method preparing N-acetylated thymosin alpha.

Method provided by the invention, comprises the steps:

Recombinant bacterium described in fermentation, collects tunning, namely obtains N-acetylated thymosin alpha;

The temperature of described fermentation is 42 DEG C, and described fermentation time is 12h.

Experiment of the present invention proves; the encoding gene that the present invention constructs N-acetyltransferase RimL and extrasin alpha carries out the recombinant bacterium that coexpression obtains; ferment this recombinant bacterium; obtain extrasin alpha and be all mostly N-acetylated thymosin alpha; not only can improve the productive rate of N-acetylated thymosin alpha; and by reducing the ratio of non-acetylated thymosin alpha, the separation of N-acetylated thymosin alpha can be facilitated, there is obvious application prospect.

Accompanying drawing explanation

Fig. 1 is that the SDS-PAGE of process LAN RimL analyzes

Fig. 2 be in intestinal bacteria process LAN RimL on the impact (X-coordinate represents elution time (min), and ordinate zou represents ultraviolet absorption value (mAU)) of ProT α Acetylation Level

Fig. 3 is red homologous dna schematic arrangement

Fig. 4 be in intestinal bacteria in T7 expression profile group RimL on the impact (X-coordinate represents elution time (min), and ordinate zou represents ultraviolet absorption value (mAU)) of ProT α Acetylation Level

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Following sequence all can synthetic.

The colibacillary structure of the RimL process LAN of embodiment 1, expression extrasin alpha

One, the colibacillary structure of N-acetyltransferase RimL process LAN

1, the structure of pOKBV plasmid

Because wanting coexpression RimL and extrasin alpha, consider plasmid incompatibility, then by pBV220 (purchased from Shanghai Shan Jing molecular biosciences Science and Technology Ltd..) replicon and ampicillin resistance gene replace with plasmid pOK12 (Jeffrey Vieira and Joachim Messing.New pUC-derived cloning vectors with different selectable markers and DNAreplication origins.Gene, 1991,100:189-194, can build from the information that the document provides, the construction process of carrier is open (as J. Pehanorm Brooker etc. at many documents, " Molecular Cloning: A Laboratory guide " second edition, Science Press, 1995; No. Genbank, pOK12 carrier is AF223639, according to disclosed sequence library, as found in the gene pool (Genbank) etc. of NIH (NIH), the mode of total gene synthesis therefore can be utilized to obtain.) p15A replicon and kalamycin resistance gene, specific as follows:

With plasmid pBV220 for template, use primer 2 20-5 ' SphI

(AAAA gCATGCand 220-3 ' SacI AGAGCGCCCTTATCTTTCCCTTTAT)

(AAAA gAGCTCaTCAGGGTTATTGTCTCATGAGCGG) increase, obtain the PCR primer of 1.8k, be the temperature sensitive operon of pBV220.

The temperature sensitive operon of pBV220 obtained above is cut with SphI and SacI enzyme, obtain digestion products, digestion products is obtained plasmid pOK12 carrier segments and connects with cutting through same enzyme, the connection product obtained proceeds to DH5 α competent cell, picking mono-clonal, extract plasmid and send to order-checking, result is this plasmid is that the temperature sensitive operon of pBV220 is inserted the plasmid obtained between SphI and the SacI restriction enzyme site of plasmid pOK12, by this plasmid called after pOKBV, by the bacterium called after DH5 α/pOKBV containing this plasmid.

2, the clone of RimL gene

Extract bacillus coli DH 5 alpha (purchased from Beijing Quanshijin Biotechnology Co., Ltd, catalog number (Cat.No.) CD201) genomic dna be that (method is shown in J. Pehanorm Brooker etc. to template, " Molecular Cloning: A Laboratory guide " second edition, Science Press, 1995) primer L5 '-EcoR I, is used

(AAAA gAATTCand L3 '-Sal I ATGACTGAAACGATAAAAGTAAGCGAA)

(AAAA gTCGACtTATTGTGAATCGATAATACGCGCGTA) pcr amplification is carried out; obtain the PCR primer of 540bp, through order-checking, this PCR primer has the Nucleotide shown in sequence 1 in sequence table; its aminoacid sequence is sequence 2, is N-acetyltransferase RimL through comparison.

Table 1 is the comparison by Internet partial results of RimL aminoacid sequence

3, the colibacillary structure of process LAN RimL

1), the colibacillary structure of process LAN RimL

Above-mentioned 2 PCR primer obtained (the RimL gene of amplification) are cut with EcoR I and Sal I enzyme, the digestion products obtained connects with the plasmid pOKBV obtained by step one cut through same enzyme, the connection product obtained proceeds to DH5 α competent cell, picking mono-clonal, extract plasmid and send to order-checking, result is this plasmid is sequence in sequence table 1 is inserted the plasmid obtained between the EcoR I of plasmid pOKBV and Sal I restriction enzyme site, by this plasmid called after pOKBV-RimL, by the bacterium called after DH5 α/pOKBV-RimL containing this plasmid.

2), DH5 α/pOKBV-RimL process LAN RimL

DH5 α/pOKBV-RimL and contrast bacterium DH5 α/pOKBV is inoculated the 5mlLB substratum containing 100 μ g/ml kantlex respectively, 30 DEG C, 200 revs/min of shaking culture are spent the night, be seeded to 100ml containing 100 μ g/ml kantlex LB substratum in 30 DEG C, 200 revs/min of shaking culture 3-5 hour, be 0.4-0.6A600 to strain density, raise culture temperature to 42 DEG C, 200 revs/min of shaking culture 3-6 hour again, collected by centrifugation supernatant, analyze with 15%SDS-PAGE, coomassie brilliant blue staining, result as shown in Figure 1, wherein (1 is contrast bacterium DH5 α/pOKBV, 2 is DH5 α/pOKBV-RimL), obtain the target protein of about 18KD, in the same size with expection, expression amount is about 200 μ g/mL, therefore illustrate, DH5 α/pOKBV-RimL has obvious RimL process LAN band.

Two, the e. coli bl21 (DE3) of the RimL process LAN of extrasin alpha is expressed

The structure of (pOKBV-RimL/pBV220-proT α)

PBV220-proT α (Thr ¹³) be prepared as follows: by ProT α (Thr ¹³) gene (a kind of extrasin alpha, nucleotides sequence is classified as sequence 4, and its aminoacid sequence is sequence 3) inserts BamHI and the EcoRI site of pBV220 carrier, the carrier obtained, proT α gene is by the P on pBV220 carrier _lp _rpromotor controls.

By the plasmid pBV220-proT α (Thr of above-mentioned acquisition ¹³) electroporated enter in the above-mentioned one DH5 α/pOKBV-RimL obtained, obtaining transformant, extract plasmid, through order-checking, is pBV220-proT α (Thr ¹³) and pOKBV-RimL, by the bacterium called after DH5 α (pOKBV-RimL/proT α (Thr containing these two kinds of plasmids ¹³)).

With same method, by pBV220-proT α (Thr ¹³) in electroporated DH5 α/pOKBV, obtain transformant, extract plasmid, result is pBV220-proT α (Thr ¹³) and pOKBV, by the bacterium called after DH5 α (pOKBV/proT α (Thr containing these two kinds of plasmids ¹³)).

Extract DH5 α (pOKBV-RimL/proT α (Thr ¹³)) and DH5 α (pOKBV/proT α (Thr ¹³)) plasmid, proceed to respectively in BL21 (DE3), obtain recon 1 and recon 2 respectively, extract the plasmid of recon 1 and recon 2, through order-checking, be respectively pOKBV-RimL/proT α (Thr ¹³) and pOKBV/proT α (Thr ¹³), therefore prove, recon 1 is BL21 (DE3) (pOKBV-RimL/proT α (Thr ¹³)), recon 2 is BL21 (DE3) (pOKBV/proT α (Thr ¹³)).

Embodiment 2, recombinant bacterium BL21 (DE3) (pOKBV-RimL/proT α (Thr ¹³)) express the former (Thr of N-acetylated thymosin alpha ¹³)

1, recombinant bacterium is induced

By BL21 (DE3) (pOKBV-RimL/proT α (Thr ¹³)) and contrast bacterium BL21 (DE3) (pOKBV/proT α (Thr ¹³)) be seeded to the I substratum (50mM Sodium phosphate dibasic/phosphate sodium dihydrogen buffer solution of 5mL containing 50 μ g/ml kantlex and 100 μ g/ml penbritins respectively, 20g/L yeast extract, 10g/L Tryptones, 2g/L glucose) in, 30 DEG C of overnight incubation, next day according to 1% ratio the bacterium liquid of incubated overnight is forwarded in the 500ml shaking flask containing 150mL I substratum, treat A _600nmbe warming up to 42 DEG C of abduction deliverings when being about 0.6, induce that centrifugal after 12 hours (the described centrifugal time is 20 minutes, centrifugal temperature is 4 DEG C, and centrifugal force is 10,000g; ) gather in the crops thalline respectively.

2, the former (Thr of N-acetylated thymosin alpha is prepared ¹³)

1) the saturated phenol extracting of Tris

The wet thallus that every 1 gram of above-mentioned steps 1 obtains adds 10mL deionized water, carrying out ultrasonic bacteria breaking, 10, centrifugal 20 minutes of 000 × g, gets supernatant, adds the 2M pH4.5HAc-NaAc damping fluid of 1% volume in bacteria break supernatant, the heavy foreign protein of acid, 10,000 × g centrifugal 20 minutes, get supernatant, and the saturated phenol of the Tris adding 1/4 volume, be uniformly mixed 10 minutes, centrifugal 20 points of 8000 × g, water intaking phase supernatant liquor.

2) HiTrap Q Sepharose Fast Flow chromatography

By supernatant liquor HiTrap Q Sepharose Fast Flow chromatography column (purchased from American GE company) purifying, instrument is that AKTA UPC 214nm detects (purchased from American GE company), flow velocity is 1mL/min, A liquid (A liquid: 20mM pH4.5 acetic acid-sodium acetate buffer solution) is first used to balance Q anion chromatography post, with 20%B liquid (B liquid: 20mM pH4.5 acetic acid-sodium acetate buffer solution after loading, 1M NaCl) B liquid consumption is that 1 column volume washes away foreign protein, use 30%B liquid wash-out again, collect elutriant.

3) high performance liquid chromatography

Elutriant is carried out chromatography on HP 1090 type high-performance liquid chromatograph, actual conditions is for using Spherigel 300AC18 reversed-phase column ((4.6mm × 250mm is purchased from Shen, large Liaanjiang county separation science technology company), mobile phase A is the pure water containing 0.1%TFA, Mobile phase B is the trifluoroacetic acid aqueous solution containing 0.1%TFA (trifluoroacetic acid] trifluoracetic acid), first balance with 100%A, applied sample amount 25 μ L, 0%-100% Mobile phase B gradient elution in 28 minutes, with 214nm and 550nm double UV check, flow velocity is 1mL/min, collecting retention time is respectively the elutriant of 9.9min, obtain A peak sample, collecting retention time is the elutriant of 10.1min, obtain B peak sample.

As shown in Figure 2, figure is left in mapping: contrast bacterium BL21 (DE3) (pOKBV/proT α (Thr ¹³)) prophymosin-alpha (Thr for preparing ¹³); Figure is right: BL21 (DE3)/(pOKBV-RimL/proT α (Thr ¹³)) prophymosin-alpha (Thr for preparing ¹³).

A peak sample contrast bacterium and experimental bacteria collected respectively and B peak sample use mass spectrometric detection, method Wu J, Chang S, Gong X, Liu D, Ma respectively .q.Identification of N-terminal acetylation of recombinant human prothymosin alpha in Escherichia coli.Biochim Biophys Acta.2006; 1760 (8): 1241-7., mass difference 42Da between mass spectroscopy A, B two components, large 42 (molecular weight of ethanoyl) of molecular weight ratio component A of B component.Peptide MS mapping determines that the increase of this molecular weight occurs in N-and holds peptide section; with tandem mass spectrum, order-checking is carried out to this peptide section and finds that this peptide section is that N-holds the prophymosin-alpha N-of acetylation modification to hold peptide section, find that acetylation modification occurs in N and holds first amino acid---on serine residue.

The above results shows, peak A sample is the prophymosin-alpha of non-acetylation modification, and peak B sample is the prophymosin-alpha of acetylation modification.

Can find out, A peak sample is the former (Thr of non-acetylated thymosin alpha ¹³); B peak sample is the former (Thr of N-acetylated thymosin alpha ¹³), shown in composition graphs 2, can find from figure, the prophymosin-alpha (Thr that contrast bacterium is expressed ¹³) in about have 60% (instrument area integral and learn) be the former (Thr of N-acetylated thymosin alpha ¹³), and recombinant bacterium BL21 (DE3)/(pOKBV-RimL/proT α (Thr ¹³)) prophymosin-alpha (Thr that expresses ¹³) in, 90% is the former (Thr of N-acetylated thymosin alpha ¹³), A peak disappears substantially.

These results suggest that, recombinant bacterium BL21 (DE3)/(pOKBV-RimL/proT α (Thr of structure ¹³)) can the former (Thr of high expression N-acetylated thymosin alpha ¹³).

Embodiment 3, the utilization T7 promotor inserted in genome builds containing expressing the former (Thr of N-acetylated thymosin alpha ¹³) recombinant bacterium

Adopt Red recombinant technology; T7 promotor with lactose operon (is derived from PET22b plasmid; this plasmid is purchased from Novagen company) be inserted into the upstream of N-acetyltransferase RimL gene open reading frame (ORF) of e. coli bl21 (DE3), in this bacterium genome with the t7 rna polymerase gene controlled by Lac operon.When adding lactose or its analogue in substratum; during as IPTG; the t7 rna polymerase genetic expression that Lac operon controls; synthesis t7 rna polymerase with people for the T7 promotor of the upstream being inserted into RimL gene open reading frame (ORF) is combined; the lactose operon in T7 promotor downstream derepresses simultaneously; the efficient transcription of control N-acetyltransferase RimL gene, thus realize the process LAN of N-acetyltransferase RimL.

Concrete grammar comprises:

One, two ends are with the amplification of the chloramphenicol resistance gene in RimLORF upstream homology arm and ORF initiator homology arm and FRT site

1, the pcr amplification of chloramphenicol resistance gene.

Synthetic primer:

5Cm AgCgATTgTgTAggCTggAg

3Cm TAATTAACggCTgACATgggAATTAg

Extract BW25141/pKD3 (purchased from the CGSC of Yale University, CGSC#7631) plasmid pKD3 is template, with 5Cm and 3Cm for primer carries out pcr amplification, the 1055bp PCR primer obtained, through order-checking for sequence 5 from 5 ' end 41-1095 position Nucleotide, by this PCR primer called after Cm.

2, with the pcr amplification of the T7 promoter DNA segment of lactose operon

Synthetic primer:

3Cm5T7 cTAATTcccATGTcAGccGTTAATTAtcgagatctcgatcccgcga

3T7 catatgtatatctccttcttaaag

Wherein 3Cm5T7 primer is with 5 ' sequence of chloramphenicol resistance gene 3 ' sequence and T7 promotor.

With PET22b plasmid for template, carry out pcr amplification with 3T7 and 3Cm5T7 for template, the 140bp PCR primer obtained, through order-checking T7 promotor be sequence 5 from 5 ' end 1119-1135 position Nucleotide, by this PCR primer called after T7.

3, with the pcr amplification of the Red restructuring DNA of RimLORF upstream homology arm and ORF initiator homology arm.

Synthetic primer:

5RimLCm AGCCAGGCGGCTTTTTTAACAACTGCATGGATTGACTGGAAgCgATTgTgTAggCTggA

RimLORF5pt7 GTAATTCAAGTGATTCGCTTACTTTTATCGTTTCAGTCATatgtatatctccttctta

Wherein 5RimLCm contains RimLORF upstream homology arm (dashed part) and chloramphenicol resistance gene 5 ' sequence, and RimLORF5pt7 is the reverse complementary sequence of RimLORF initiator homology arm (dashed part) and T7 promotor 5 ' sequence.

With each 1 μ l of the DNA fragmentation Cm of the preparation of above-mentioned acquisition and DNA fragmentation T7 for template, with 5RimLCm and RimLORF5pt7 for primer, carry out pcr amplification, obtain 1246bpPCR product, through order-checking, nucleotides sequence is classified as sequence 5, called after Red recombinant DNA, structure iron as shown in Figure 3.

Plasmid pKD3 may be mixed with in the DNA fragmentation of gene-amplification, false positive phenomenon may be caused, so the DNA fragmentation Dpn I 37 DEG C of water bath with thermostatic control process 1h that will reclaim, to eliminate plasmid pKD3.

4, the acquisition of homologous recombination positive colony BL21 (DE3)/T7RimL

1) preparation of e. coli bl21 (DE3)/pKD46

By pKD46 plasmid (genbank AY048746, its construction process is shown in Datsenko KA, PNAS USA2000,97 (12): 6640-5, also can obtain from various preservation center, as the CGSC of Yale University, the preserving number of the intestinal bacteria BW25141/pKD46 with pKD46 plasmid at this center is 7634.Anti-penbritin.This plasmid contains RED recombinase.) transform BL21 (DE3) (purchased from the vast Tyke biological gene Technology Co., Ltd. in Beijing, catalog number CD601) be coated with the LB flat board containing penbritin, 30 DEG C of incubated overnight, next day picking mono-clonal, extract plasmid, send to order-checking and be pKD46 plasmid, by recombinant bacterium called after BL21 (the DE3)/pKD46 containing this plasmid.

2) two ends transform with the electricity of the DNA fragmentation of the chloramphenicol resistance gene in RimLORF upstream homology arm and ORF initiator homology arm and FRT site

BL21 (the DE3)/pKD46 of above-mentioned acquisition to be inoculated in LB substratum 30 DEG C and to be cultured to OD _600nmbe about 0.2, add final concentration be 0.2% L-arabinose (L-ara) induce about 1h (OD _600nmbe less than 0.6), cell is put in ice and cools 10min rapidly, with 4000rpm in 4 DEG C of centrifugal 10min, with 10% ice-cold glycerine, cell is washed three times, finally cell is concentrated into 1/200,100 μ l/ pipe packing of original bacteria liquid volume with 10% ice-cold glycerine ,-70 DEG C save backup.Every 100 μ L competent cells add the Red recombinant DNA of the above-mentioned preparation of 0.2-1 μ g, go to 0.1cm and shock by electricity in cup, do electroporated with Bio-lab electric shock instrument after mixing.600 μ l LB substratum are added immediately after electric shock, 150rpm, cultivate 1h for 30 DEG C, coating is dull and stereotyped containing the LB of paraxin (Cm), 37 DEG C of incubated overnight, and pKD46 is unstable in 37 DEG C of culturing process, can spontaneously lose, next day, picking mono-clonal, and again containing the single bacterium colony of streak culture separation on the LB flat board of paraxin (Cm), was the mono-clonal obtaining Red recombinant DNA.

Dull and stereotyped and containing penbritin (Amp) the LB of LB inoculated respectively by the mono-clonal obtaining Red recombinant DNA containing paraxin (Cm) is dull and stereotyped, 37 DEG C of incubated overnight, can at Cm grow on plates, but can not be at Amp plated growth the clone losing pKD46 plasmid.

Extract the plasmid of the clone losing pKD46 plasmid, carry out PCR qualification with the primers designed 5RimLPout synthesized and 3RimLpout,

5RimLPout GCGTCAAAGAGGTGTAAACT

3RimLpout GATAAAGAGGTTTGACGTGA

By PCR primer through 1% agarose electrophoretic analysis, obtain the positive plasmid for inserting intestinal bacteria RimL gene ORF upstream with the T7 promotor of Cm gene of 1Kb, what obtain 100bp is the T7 promotor of negative clone not containing Cm gene, is BL21 (DE3)/T7RimL by the clone designation containing positive plasmid.

5, recombinant bacterium BL21 (DE3)/T7RimL expresses RimL

It is the IPTG (sec.-propyl-D-thiogalactoside of 1mM by BL21 (DE3)/T7RimL concentration, purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) induce (after 37 DEG C of cultivation 2h, induction 6h), collect supernatant, carry out SDS-PAGE electrophoresis, obtain the fragment of 20KD, illustrate and give expression to RimL.

Two, the T7 promotor inserted in genome is utilized to build containing expressing the former (Thr of N-acetylated thymosin alpha ¹³) recombinant bacterium

PBV220-proT α (Thr ¹³) be prepared as follows: by ProT α (Thr ¹³) gene (nucleotides sequence is classified as sequence 4, and its aminoacid sequence is sequence 3) inserts BamHI and the EcoRI site of pBV220 carrier, the carrier obtained, proT α gene is by the P on pBV220 carrier _lp _rpromotor controls.

By the plasmid pBV220-proT α (Thr of above-mentioned acquisition ¹³) electroporated enter in above-mentioned one BL21 obtained (DE3)/T7RimL, obtain transformant, extract plasmid, through order-checking, pBV220-proT α (Thr ¹³), by bacterium called after BL21 (the DE3) (T7RimL/proT α (Thr containing this plasmid ¹³)).

With same method, by pBV220-proT α (Thr ¹³) in electroporated BL21 (DE3), obtain transformant, extract plasmid, result is pBV220-proT α (Thr ¹³), by bacterium called after BL21 (the DE3) (proT α (Thr containing this plasmid ¹³)).

Embodiment 4, BL21 (DE3) (T7RimL/proT α (Thr ¹³)) to prepare N-acetylated thymosin alpha former

1, protein crude extract

By BL21 (DE3) (T7RimL/proT α (Thr ¹³)) and contrast bacterium BL21 (DE3) (proT α (Thr ¹³)) be inoculated in 50ml LB liquid nutrient medium respectively, 37 DEG C of shaking table overnight incubation, then be forwarded to containing 500ml substratum (yeast extract 10g/L, Tryptones 10g/L, SODIUM PHOSPHATE, MONOBASIC 20mM, Sodium phosphate dibasic 30mM) 3L shaking flask in, after 37 DEG C of cultivation 2h, add IPTG (0.5mM) induction of 1.25ml 0.2mol/L, continue to cultivate 6h, fermented liquid is centrifugal, collects thalline.

By the thalline water resuspended (every gram of bacterium adds 10ml water) collected, supersonic wave wall breaking, collected by centrifugation supernatant, in supernatant liquor, add glacial acetic acid regulate pH to 4.5, leave standstill 30 minutes, collected by centrifugation supernatant, is protein crude extract.

2, purifying

1) SP FF Φ 1.6 × 20cm column purification (cation-exchange chromatography)

Supernatant liquor SP FF Φ 1.6 × 20cm post (medium purchased from American GE company, void column is purchased from magnificent laboratory apparatus factory) of above-mentioned acquisition is carried out purifying.Actual conditions is: the A liquid (damping fluid of 20mM sodium acetate and acetic acid composition, pH4.5), B liquid (A liquid+1M NaCl), SP FF post is first by A liquid balance, then from A channel by the above-mentioned crude extract loading containing N-acetylated thymosin alpha to SP FF post, unconjugated albumen is washed away again, finally at 0 → 30 minute: A is from 100% → 0% with A liquid; B from 0% → 100% linear gradient elution, Fractional Collections elutriant.

SDS-PAGE is made in the at different levels parts of elutriant samplings of collecting analyze and HPLC analysis, merge the elutriant (in 30%-60%B elutriant) containing prophymosin-alpha, obtain the raw product that N-acetylated thymosin alpha is former.

RP-HPLC chromatography is carried out in sampling, adopts HP1090 high pressure liquid chromatograph, and (A liquid is the pure water containing 0.1%TFA (volumn concentration) to C18 post for 4.6 × 250mm, Dalian chemical physics institute of the Chinese Academy of Sciences; B liquid is the trifluoroacetic acid aqueous solution containing 0.1%TFA (volumn concentration), gradient elution: 0min, A 100%, B 0%; 5min, A 82%, B18%; 25min A 78%, B 22%; 28min A0%, B 100%; 30min A0%, B 100%; 31min A 100%, B 0%, 214nm ultraviolet detection, flow velocity is 1mL/min, and collecting retention time is respectively the elutriant of 17.0min, obtains A peak sample, and collecting retention time is the elutriant of 20.0min, obtains B peak sample.

As shown in Figure 4, I is contrast bacterium BL21 (DE3) (proT α (Thr in mapping ¹³)) prophymosin-alpha (Thr for preparing ¹³); II is BL21 (DE3) (T7RimL/proT α (Thr ¹³)) prophymosin-alpha (Thr for preparing ¹³).

A peak sample contrast bacterium and experimental bacteria collected respectively and B peak sample use mass spectrometric detection respectively, and method is the same, and result shows, peak A sample is the prophymosin-alpha of non-acetylation modification, and peak B sample is the prophymosin-alpha of acetylation modification.

Can find out, A peak sample is the former (Thr of non-acetylated thymosin alpha ¹³); B peak sample is the former (Thr of N-acetylated thymosin alpha ¹³), shown in composition graphs 4, can find from figure, contrast bacterium BL21 (DE3) (proT α (Thr ¹³)) N-acetylated thymosin alpha was 41% (B peak) originally in the extrasin alpha prepared, and BL21 (DE3) (T7RimL/proT α (Thr ¹³)) N-acetylated thymosin alpha was the raising of 82% (B peak), this N-acetylation modification rate originally in the prophymosin-alpha prepared, providing the foundation for improving productive rate, therefore having a good application prospect.

Embodiment 5, prepare various N-acetylated thymosin alpha with the intestinal bacteria of process LAN N-acetyltransferase RimL

Adopt the preparation of the method for embodiment 1 to express the recombinant bacterium of the various extrasin alphas (aminoacid sequence of various extrasin alpha is as shown in table 2 below) in following table 1 respectively, adopt the method for embodiment 2 to carry out fermenting and detecting, result is as shown in table 2 below:

The acetyl rate of various N-acetylated thymosin alpha prepared by table 2

As can be seen from the above table, the recombinant bacterium prepared according to the method for embodiment 1 all can obtain the high N-acetylated thymosin alpha of content by fermentation.

Sequence table

<110> Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A

The intestinal bacteria of <120> process LAN RimL and the application in preparation N-acetylated thymosin alpha thereof

<160>5

<210>1

<211>540

<212>DNA

<213> artificial sequence

<220>

<223>

<400>1

atgactgaaa cgataaaagt aagcgaatca cttgaattac atgctgttgc agaaaatcac 60

gtcaaacctc tttatcagtt aatctgtaaa aataaaacct ggttacagca gtcgctaaac 120

tggccgcagt ttgttcaaag tgaagaggac acgcgaaaaa cggtgcaggg taatgtgatg 180

ttgcatcaac gcggctatgc caaaatgttc atgattttca aagaagatga acttatcggc 240

gttatctcgt ttaatcgtat tgaaccactg aataaaaccg ctgaaatagg ctactggctg 300

gacgaatctc atcaggggca ggggatcatt tctcaggcgc tgcaggcatt gattcatcat 360

tacgcccagt ctggtgaact tagacgcttc gtgatcaaat gtcgggtgga caatccgcaa 420

agcaaccagg tcgctttgcg caatggtttt atccttgaag gttgcctgaa acaggctgag 480

ttcctgaatg atgcctatga tgatgtgaac ttatacgcgc gtattatcga ttcacaataa 540

<210>2

<211>179

<212>PRT

<213> artificial sequence

<220>

<223>

<400>2

Met Thr Glu Thr Ile Lys Val Ser Glu Ser Leu Glu Leu His Ala Val

1 5 10 15

Ala Glu Asn His Val Lys Pro Leu Tyr Gln Leu Ile Cys Lys Asn Lys

20 25 30

Thr Trp Leu Gln Gln Ser Leu Asn Trp Pro Gln Phe Val Gln Ser Glu

35 40 45

Glu Asp Thr Arg Lys Thr Val Gln Gly Asn Val Met Leu His Gln Arg

50 55 60

Gly Tyr Ala Lys Met Phe Met Ile Phe Lys Glu Asp Glu Leu Ile Gly

65 70 75 80

Val Ile Ser Phe Asn Arg Ile Glu Pro Leu Asn Lys Thr Ala Glu Ile

85 90 95

Gly Tyr Trp Leu Asp Glu Ser His Gln Gly Gln Gly Ile Ile Ser Gln

100 105 110

Ala Leu Gln Ala Leu Ile His His Tyr Ala Gln Ser Gly Glu Leu Arg

115 120 125

Arg Phe Val Ile Lys Cys Arg Val Asp Asn Pro Gln Ser Asn Gln Val

130 135 140

Ala Leu Arg Asn Gly Phe Ile Leu Glu Gly Cys Leu Lys Gln Ala Glu

145 150 155 160

Phe Leu Asn Asp Ala Tyr Asp Asp Val Asn Leu Tyr Ala Arg Ile Ile

165 170 175

Asp Ser Gln

<210>3

<211>109

<212>PRT

<213> artificial sequence

<220>

<223>

<400>3

Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Tle Thr Thr Lys Asp Leu

1 5 10 15

Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu ASn Gly Arg Asp Ala

20 25 30

Pro Ala ASn Gly ASn Ala ASn Glu Glu ASn Gly Glu Gln Glu Ala Asp

35 40 45

ASn Glu Val Asp Glu Glu Glu Glu Glu Gly Gly Glu Glu Glu Glu Glu

50 55 60

Glu Glu Glu Gly Asp Gly Glu Glu Glu Asp Gly Asp Glu Asp Glu Glu

65 70 75 80

Ala Glu Ser Ala Thr Gly Lys Arg Ala Ala Glu Asp Asp Glu Asp Asp

85 90 95

Asp Val Asp Thr Lys Lys Gln Lys Thr Asp Glu Asp Asp

105

<210>4

<211>333

<212>DNA

<213> artificial sequence

<220>

<223>

<400>4

atgtctgatg cagctgtaga taccagctcc gaaatcacca ccaaggactt aaaggagaag 60

aaggaagttg tggaagaggc agaaaatgga agagacgccc ctgctaacgg gaatgctaat 120

gaggaaaatg gggagcagga ggctgacaat gaggtagacg aagaagagga agaaggtggg 180

gaggaagagg aggaggaaga agaaggtgat ggtgaggaag aggatggaga tgaagatgag 240

gaagctgagt cagctacggg caagcgggca gctgaagatg atgaggatga cgatgtcgat 300

accaagaagc agaagaccga cgaggatgac taa 333

<210>5

<211>1246

<212>DNA

<213> artificial sequence

<220>

<223>

<400>5

agccaggcgg cttttttaac aactgcatgg attgactgga agcgattgtg taggctggag 60

ctgcttcgaa gttcctatac tttctagaga ataggaactt cggaatagga acttcattta 120

aatggcgcgc cttacgcccc gccctgccac tcatcgcagt actgttgtat tcattaagca 180

tctgccgaca tggaagccat cacaaacggc atgatgaacc tgaatcgcca gcggcatcag 240

caccttgtcg ccttgcgtat aatatttgcc catggtgaaa acgggggcga agaagttgtc 300

catattggcc acgtttaaat caaaactggt gaaactcacc cagggattgg ctgagacgaa 360

aaacatattc tcaataaacc ctttagggaa ataggccagg ttttcaccgt aacacgccac 420

atcttgcgaa tatatgtgta gaaactgccg gaaatcgtcg tggtattcac tccagagcga 480

tgaaaacgtt tcagtttgct catggaaaac ggtgtaacaa gggtgaacac tatcccatat 540

caccagctca ccgtctttca ttgccatacg taattccgga tgagcattca tcaggcgggc 600

aagaatgtga ataaaggccg gataaaactt gtgcttattt ttctttacgg tctttaaaaa 660

ggccgtaata tccagctgaa cggtctggtt ataggtacat tgagcaactg actgaaatgc 720

ctcaaaatgt tctttacgat gccattggga tatatcaacg gtggtatatc cagtgatttt 780

tttctccatt ttagcttcct tagctcctga aaatctcgac aactcaaaaa atacgcccgg 840

tagtgatctt atttcattat ggtgaaagtt ggaacctctt acgtgccgat caacgtctca 900

ttttcgccaa aagttggccc agggcttccc ggtatcaaca gggacaccag gatttattta 960

ttctgcgaag tgatcttccg tcacaggtag gcgcgccgaa gttcctatac tttctagaga 1020

ataggaactt cggaatagga actaaggagg atattcatat ggaccatggc taattcccat 1080

gtcagccgtt aattatcgag atctcgatcc cgcgaaatta atacgactca ctatagggga 1140

attgtgagcg gataacaatt cccctctaga aataattttg tttaacttta agaaggagat 1200

atacatatga ctgaaacgat aaaagtaagc gaatcacttg aattac 1246

Claims (5)

1. a recombinant bacterium, for importing the recombinant bacterium obtained in Host Strains by the encoding gene of the encoding gene of RimL and extrasin alpha; Described Host Strains is the Host Strains containing RimL encoding gene in genome;

The protein of described RimL for being made up of the aminoacid sequence shown in sequence in sequence table 2;

The aminoacid sequence of described extrasin alpha is as 28 of the N-terminal of sequence in sequence table 3 amino acid;

Described Host Strains is intestinal bacteria.

2. recombinant bacterium according to claim 1, is characterized in that:

1), in the recombinant bacterium shown in, the described method encoding gene of the encoding gene of RimL and described extrasin alpha being imported Host Strains comprises the steps:

A) encoding gene of described RimL is imported described Host Strains by recombinant vectors 2, obtain recombinant bacterium A;

B) by the described recombinant bacterium A that the encoding gene of described extrasin alpha a) is obtained by recombinant vectors 1 steps for importing, recombinant bacterium is obtained;

Described recombinant vectors 1 is that described extrasin alpha encoding gene inserts in expression vector 1, obtains the recombinant vectors 1 of expressing extrasin alpha; Described expression vector 1 is pBV220;

Described recombinant vectors 2 is inserted in expression vector 2 by the encoding gene of described RimL, and obtain the recombinant vectors 2 of expressing RimL, described expression vector 2 is pOKBV.

3. recombinant bacterium according to claim 1 and 2, is characterized in that:

1) in the recombinant bacterium shown in, the encoding gene of described RimL is the DNA molecular shown in sequence 1 in sequence table, and the encoding gene of described extrasin alpha is that 5 ' end of the sequence 4 in sequence table plays 84 Nucleotide.

4. the application of arbitrary described recombinant bacterium in preparation N-acetylated thymosin alpha in claim 1-3.

5. prepare a method for N-acetylated thymosin, comprise the steps:

In fermentation claim 1-3, arbitrary described recombinant bacterium, collects tunning, namely obtains N-acetylated thymosin alpha;

The temperature of described fermentation is 42 DEG C, and described fermentation time is 12h.