CN101497863B - Method for preparing N-terminated acetylated thymosin alpha 1 and special engineering bacteria therefor - Google Patents

Abstract

The invention discloses a method for preparing N-terminal acetylation extrasin alpha1, and special engineering bacteria thereof. The engineering bacteria is obtained in such a way that encoding genes of the extrasin alpha1 and encoding genes of N-terminal acetyl transferase are introduced to host strains. The N-terminal acetyl transferase is the protein of the following a or b: a) protein is composed of amino acid sequences shown by a sequence 7 in a sequence table; and b) protein is derived from the a) and is provided with the N-terminal acetyl transferase through the replacement and/or deletion and/or adding of one or a plurality of amino acid residue of the amino acid sequences shown by the sequence 7 in the sequence table. Talpha1 obtained through the preparation of the engineering bacteria is all N-terminal acetylized. The invention overcomes the defects of no acetylization or only partial N-terminal acetylization in a traditional gene project technology, thoroughly realizes N-terminal acetylization Talpha1 through a gene engineering technology, and has strong practical purposes.

Description

A kind of method and dedicated engineering bacteria thereof for preparing the terminated acetylated thymosin of N-

Technical field

The present invention relates to the method and the dedicated engineering bacteria thereof of the terminated acetylated thymosin of a kind of N-of preparation.

Background technology

Acetylize is a kind of protein modification mode of extensive existence; be present in prokaryotic organism, archeobacteria and the eukaryote; acetylize (Polevoda B can take place in about 80～90% mammalian cell matter albumen, 50% Yeast protein, a spot of protokaryon or archeobacteria protein; Sherman F.The diversity of acetylatedproteins.Genome Biology; 2002,3:1-6).

Acetylation modification is influential to some activity of proteins and stability, as enzymic activity, enzyme stability, DNA combination, protein-protein interaction, acceptor identification or the like.In some cases, lack the acetylize meeting and cause the decline of protein thermostability or the change of other kinetic parameter, perhaps the complex body packaging efficiency descends.It is relevant that the utilization of proteinic acetylation modification and the growth of cell, non-fermenting carbon source in the yeast cell, brood cell generate etc.In mammalian cell, acetylation modification is relevant with tissue development, cell proliferation and tumour generation etc.The terminated acetylated modification of N-is to tropomyosin (tropomyosin) function and important; the tropomyosin of no acetylation modification can not combine with Actin muscle (actin); can not form polymer (Urbancikova M; andHitchcock-DeGregori SE.Requirement of amino-terminal modification forstriated muscle alpha-tropomyosin function.J.Biol.Chem.; 1994,269:24310-24315.).For peptide medicament; acetylation modification can improve the polypeptide transformation period in vivo; transformation period as the melanotropin of acetylation modification is 3 times of (Rudman D of non-acetylation modification; Hollins BM; Kutner MB; Moffitt SD, Lynn MJ:Three types of α-melanocyte-stimulating hormone:bioactivity and half-lives.Am J Physiol1983,245:E47-E54.).

Thymosin (T α 1) is made up of 28 amino acid, molecular weight 3 108kD, and iso-electric point 4.2, structure is conservative, and structure unanimity in each nurture animal is widely distributed, is present in each histoorgan of nurture animal, and is the highest with content in the thymus gland especially.The T α 1 of the terminated acetylated modification of N-is a kind of biological respinse regulatory factor, mainly is the lymphoid immunostimulant of T, and the NK cell is also had synergy.The T α 1 coupling interferon therapy hepatitis B of the terminated acetylated modification of N-and hepatitis C, coupling chemotherapy or radiotherapy or interleukin-2 (IL-2) treatment nonsmall-cell lung cancer and malignant melanoma, coupling Zidovodine and interferon therapy immunodeficiency syndrome or the like clinical trial all show its have good therapeutic action (Liu Yuying. the progress of thymosin. Shanghai medicine; 2003,24 (5): 211-216).The T α 1 of chemosynthesis in China, the U.S., Japan etc. in interior a plurality of state approval clinical applications, the disease of and serious harm human health higher with sickness rate such as treatment hepatitis B, hepatitis C and lung cancer etc.T α 1 (trade(brand)name ZADAXIN) as U.S. SciClone drugmaker produces reaches 3,243 ten thousand dollars (being roughly equal to 2.5 hundred million yuan of Renminbi) in 2006 annual sales amounts, and wherein 90% from Chinese market, increases by 16% than 2005.About 800 yuan of every of Chinese prices (1.6mg).If can further reduce production costs, as antiviral, anti-tumor medicine, T α 1 market at home will further enlarge.

All adopt chemical synthesis process to produce the terminated acetylated T α 1 of N-at present both at home and abroad.But because chemosynthesis cost height, it is more attractive to prepare T α 1 with gene engineering method.Once there were many people to attempt utilizing genetic engineering technique to express T α 1; adopt amalgamation and expression or tandem expression all can not obtain terminated acetylated T α 1 of N-or partial acetylation (Esipov RS only; Gurevich AI, Stepanenko VN, Chupova LA; ChuvikovskyDV; and Miroshnikov AI.Recombinant Thymosin α 1.Russian Journal ofBioorganic Chemistry, Vol.30, No.5; 2004, pp.431-435.).

The terminated acetylated modification of proteinic N-is that (N-terminalacetyltransferases NATs) transfers to the acetyl group of acetyl-CoA on the alpha-amino group of protein amino end by the terminal Transacetylase of N-.

There is the terminal Transacetylase of multiple N-in the cell, is responsible for the acetylation modification of dissimilar aminoacid sequence polypeptide respectively.The terminal Transacetylase research of the N-of yeast cell so far is more.Yeast has the different N-of three classes terminal Transacetylase: NatA, NatB, NatC, respectively the different substrate colony of catalysis (Polevoda B and ShermanF.N-terminal Acetyltransferases and Sequence Requirements for N-terminalAcetylation of Eukaryotic Proteins.J.Mol.Biol.2003,325:595-622.).NatA catalysis Ser, Ala, Gly and Thr residue are terminal protein acetylation modification; NatB catalysis Met-Glu, Met-Asp and part Met-Asn, Met-Met are the protein acetylation modification of terminal residue, and NatC catalysis Met-Ile, Met-Leu, Met-Trp and Met-Phe are the acetylation modification of terminal residue.Eukaryotic NATs is made up of two or above different subunit.NatA has two subunit Ard1p (27kDa), Nat1p (99kDa) at least, NatB also has two subunit Nat3p (23kDa) and Mdm20p (92kDa), and NatC is made up of three subunits: Mak3p (20kDa), Mak10p (84kDa) and Mak31p (10kDa).Also there are catalytic subunit Ard1p, the Nat3p of above-mentioned three kinds of enzymes and the homologous sequence of Mak3p in the higher eucaryote, but the activity that single subunit does not have catalysis acetyl to shift.

The terminal Transacetylase of known N-has RimI in the intestinal bacteria; RimJ and RimL; respectively with ribosomal protein S18 (N-Ala); the Ala of S5 (N-Ala) and the N-end of L12 (N-Ser) or relevant (the Yoshikawa A of Ser residue acetylize; Isono S; Sheback A; Isono K.Cloning and nucleotide sequencingof the genes rimI and rimJ which encode enzymes acetylating ribosomalproteins S18 and S5 of Escherichia coli K12.Mol Gen Genet; 1987; 209:481-488.Tanaka S; Matsushita Y; Yoshikawa A; Isono K.Cloning andmolecular characterization of the gene rimL which encodes an enzymeacetylating ribosomal protein L12 of Escherichia coli K12.Mol Gen Genet; 1989; 217,289-293.).In addition, according to bioinformatic analysis, some unknown function genes may also have acetyltransferase activity in the bacillus coli gene group.Existing studies show that, different with eukaryotic NATs, the NATs of prokaryotic cell prokaryocyte may only need a kind of protein subunit to form.The RimL of report Salmonella typhimuriums such as Vetting in 2005 has dimeric structure; and can carry out acetylation modification reaction (Vetting MW to its substrate external; de Carvalho LPS; Roderick SL, and Blanchard JS.A Novel Dimeric Structureof the RimL N ^α-acetyltransferase from Salmonella typhimurium.J Biol Chem, 2005,280 (23): 22108-22114).According to crystalline structure and Computer simulation results, show that procaryotic NATs is different from eukaryote NATs, supposition can only a kind of protein substrate of catalysis.Colibacillary RimL is in the external terminated acetylated modification of N-that can catalysis L12; and the terminated acetylated modification of N-(the Miao L of two kinds of mutant (S1A and I2D) that can catalysis L12; Fang H; Li Y; Chen H.Studies of the in vitroN α-acetyltransferase activities of E.coli RimL protein.Biochem BiophysRes Commun; 2007,357:641-64).

Summary of the invention

An object of the present invention is to provide a kind of engineering bacteria that can produce the terminated acetylated thymosin of N-.

Engineering bacteria provided by the present invention is that encoding gene with the encoding gene of thymosin and the terminal Transacetylase of N-imports in the host bacterium and obtains; The terminal Transacetylase of described N-be following a) or b) protein:

A) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 7;

B) with the aminoacid sequence shown in the sequence in the sequence table 7 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the terminal Transacetylase function of N-by a) deutero-protein.

The encoding gene of the terminal Transacetylase of described N-can be imported in the described host bacterium with adjustable promotor, and the encoding gene of the terminal Transacetylase of described N-is positioned at described adjustable promotor downstream; But described adjustable promotor is inducible promoter or constitutive promoter, but described inducible promoter is T7, Lac, Tac, Trp or P _L/ P _R

The encoding gene and the adjustable promotor of the terminal Transacetylase of described N-can import in the described host bacterium by carrier; The encoding gene and the described adjustable promotor of the terminal Transacetylase of described N-can be positioned on the described carrier, also can be incorporated on the karyomit(e) of described host bacterium.

The encoding gene of described thymosin imports in the described host bacterium with adjustable promotor, and the encoding gene of described thymosin is positioned at described adjustable promotor downstream;

The encoding gene of described thymosin and adjustable promotor import in the described host bacterium by carrier; The encoding gene of described thymosin and described adjustable promotor are positioned on the described carrier.

Wherein, the encoding gene of the terminal Transacetylase of described N-can be following 1), 2) or 3) gene:

1) its nucleotide sequence is a dna molecular shown in the sequence 8 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the terminal Transacetylase of described N-of encoding;

3) with 1) dna sequence dna that limits has the homology 90% or more and the dna molecular of the described N-end Transacetylase of encoding.

Described thymosin can be following a) or b) protein:

A) protein of holding the aminoacid sequence shown in the 2-29 amino acids residue to form from N by sequence in the sequence table 10;

B) hold the aminoacid sequence shown in the 2-29 amino acids residue through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have a thymosin active by a) deutero-protein from N sequence in the sequence table 10.

The encoding gene of described thymosin can be following 1), 2) or 3) gene:

1) its nucleotide sequence is a dna molecular shown in the 5 ' terminal 4-87 position Nucleotide of sequence 11 in the sequence table; It is codon optimized that this sequence is that the encoding gene to thymosin has carried out, to obtain better expression effect.

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described thymosin of encoding;

3) with 1) dna sequence dna that limits has the dna molecular of the homology more than 90% and the described thymosin of encoding.

The encoding gene of the terminal Transacetylase of the encoding gene of described thymosin and described N-can all import in the described host bacterium by recombinant vectors.

The encoding gene of described thymosin can be to import by the following method in the described host bacterium: the encoding gene of described thymosin and the encoding gene of intein are merged, form fusion gene, fusion gene is imported in the described host bacterium by carrier again.

Wherein, described intein can be following a) or b) protein:

A) protein of holding the aminoacid sequence shown in the 30-165 amino acids residue to form from N by sequence in the sequence table 10;

B) hold the aminoacid sequence shown in the 30-165 amino acids residue through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have a described intein active by a) deutero-protein from N sequence in the sequence table 10.

The encoding gene of described intein is can following 1), 2) or 3) gene:

1) its nucleotide sequence is a dna molecular shown in the 5 ' terminal 88-495 position Nucleotide of sequence 11 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of the described intein of encoding;

3) with 1) dna sequence dna that limits has the dna molecular of the homology more than 90% and the described intein of encoding.

The nucleotide sequence of described fusion gene specifically can be shown in sequence in the sequence table 11.

Described host bacterium can be enterobacteriaceae lactobacteriaceae, comprises Escherichia, klebsiella spp, enterobacter, Serratia, proteus, citrobacter genus, the non-fermentation of glucose bacillus etc., the intestinal bacteria of preferred Escherichia.

Wherein, described intestinal bacteria specifically can be e. coli k12 source, intestinal bacteria B source, intestinal bacteria C source or their bacterial strain of hybridization strain.More specifically can be any intestinal bacteria of expressing the T7 rna polymerase gene that have.More specifically can be e. coli jm109 (DE3), e. coli bl21 (DE3) again.

Another object of the present invention provides the method for the terminated acetylated thymosin of a kind of N-of preparation.

The method of the thymosin of preparation N-terminal acetylation modification provided by the present invention, the above-mentioned arbitrary described engineering bacteria that comprises the steps: to ferment obtains the thymosin of N-terminal acetylation modification.

When used engineering bacteria was obtaining by the following method: the encoding gene of thymosin and the encoding gene of intein merged, form fusion gene, again fusion gene is imported in the described host bacterium by carrier, also comprise the step of cutting intein in the described method.

Wherein, the method for cutting intein is: add mercaptoethanol or DTT in the fusion rotein that purifying obtains, cut 24 hours in 37 ℃.Can also further carry out desalination, carry out the anion chromatography purifying again cutting sample.

The present invention expresses rimJ gene and adorned purpose T α 1 encoding gene in intestinal bacteria simultaneously, has avoided suffered influence factor the unknown of naturally occurring rimJ genetic expression on the genome, the shortcoming that is difficult to regulate and control.The rimJ gene can be positioned on the same expression vector with adorned purpose T α 1 encoding gene, also can be cloned in respectively on the different compatible expression vectors, also can be on genome integrative gene expression rimJ, the rimJ expression of gene can be regulated and control.For example the rimJ gene can be placed the T7 promotor, or the Lac promotor, or the Tac promotor, or the Trp promotor, or P _L/ P _RPromotor, or under the control of composition promotor.

RimJ Argine Monohydrochloride sequence homology in the prokaryotic organism is higher, infers that similar gene can play a role in intestinal bacteria.So used colibacillary RimJ gene can use the homologous gene from other microorganism to substitute among the present invention, as Shigellae, Salmonellas, Klebsiella pneumonia, enterobacteria, Erwinia, Serratia, vibrios, Yersinia or the like.

When expressing T α 1,, can reach by the technology such as cutting of chemical chop, specific enzymes cutting and intein mediation for the ease of obtaining to have natural structure T α 1.

Wherein, the chemical chop method specifically can be as follows: increase a Cys residue between T α 1 and the C end fusogenic peptide section, the cutting of fusion rotein can reach by modes such as specificity chemical reagent NTCB, CDAP, and NATB mainly acts on the peptide bond between the X-Cys.

The specific enzymes cutting method specifically can be as follows: because the C-terminal residue of T α 1 is Asn, increase a Gly residue between T α 1 and C section fusogenic peptide section.The cutting of fusion rotein can be cut by azanol cutting or l-asparagine endopeptidase and be obtained complete T α 1.The azanol patterning method mainly acts on the peptide bond between the Asn-Gly.The l-asparagine endopeptidase mainly acts on Asn-X, especially the peptide bond between the Asn-Gly.

The cutting method of intein mediation specifically can be as follows: with T α 1 and intein amalgamation and expression, fusion rotein can induce cutting, Cys to induce cutting by temperature-induced cutting, DTT or mercaptoethanol.Temperature-induced cutting can avoid adding some reagent increases cost.DTT or mercaptoethanol are induced the efficient height, can obtain to have the T α 1 of complete structure.Induce cutting with Cys, can increase a Cys residue, be convenient to carry out chemically modified, improve the character of T α 1, as the transformation period in the extension body etc. at the C of T α 1 end.

Expression of Fusion Protein can adopt constitutive promoter, thermal induction type promotor or chemical inducible promoter.The preferred T7 promotor that adopts is carried out efficient controlled expression.

The inventive method has obtained abundant acetylizad T α 1 and fusion rotein thereof by the expression level of the terminal Transacetylase RimJ of regulation and control raising N-.The T α 1 for preparing with engineering bacteria of the present invention; all be that N-is terminated acetylated; overcome in the conventional art can not N-be terminated acetylated, part N-is terminated acetylated, acetylize efficient is not high shortcoming, realized completely obtaining the terminated acetylated T α 1 of N-by genetic engineering technique.Therefore, engineering bacteria of the present invention and method have broad application prospects in the terminated acetylated T α of preparation N-1 field.

Description of drawings

Fig. 1 is that engineering bacteria I is in the whole bacterial protein electrophoresis result of expressing the different periods.

Fig. 2 is the electrophorogram of elutriant behind the A2 nickel metal chelate affinity chromatography.

Fig. 3 is the A2 mass spectrometry results.

Fig. 4 is the double charge peak of tryptic digestion A2.

Fig. 5 is 733.78 acetylize peak MS-MS sequencing results.

The proteic electrophorogram that Fig. 6 obtains for A8 nickel metal chelate affinity chromatography.

Fig. 7 is the A8 mass spectrometry results.

Fig. 8 is A2 expression product mass spectroscopy in without the JM109 (DE3) of any modification.

Fig. 9 is that A2 is at mutant bacteria rimJ ^-Kan ^rExpression product mass spectroscopy among the JM109 (DE3).

Figure 10 is that A2 is at mutant bacteria rimJ ^-Kan ^rAmong the JM109 (DE3) with the product mass spectroscopy of rimJ coexpression.

Figure 11 is the albumen that engineering bacteria BL21 (DE3)/pET-AS/pACYC-rimJ expresses broken bacterium in back and nickel metal chelate affinity chromatography.

The sample electrophoresis figure that Figure 12 induces cutting and anion-exchange chromatography to obtain for mercaptoethanol.

The molecular weight of the terminated acetylated T α 1 of N-that Figure 13 is obtained by anion-exchange chromatography for mass spectroscopy.

The evaluation of the bacterium that Figure 14 is knocked out for the rimJ gene.

The evaluation of the bacterium that Figure 15 is knocked out for the rimJ gene.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

Enzyme reagent in following examples is all available from TaKaRa company.

PKD4 plasmid (Datsenko KA, Wanner BL.One-step inactivation of chromosomalgenes in Escherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 2000,97:6640-6645.) (Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A).

Embodiment 1, thymosin (T α 1) are identified with Expression of Fusion Protein and the acetylation modification of L12, S18

One, T α 1 identifies with expressing fusion protein and the acetylation modification of L12

1, expresses the structure of the fusion rotein engineering bacteria I of T α 1 and L12

The acquisition of fusion gene: with the bacillus coli gene group is template, is the sequence of the gene rplL of primer PCR amplification coding ribosomal protein L 12 with L1, L2, the about 370bp of product; PCR product with above-mentioned 370bp is a template, is that primer carries out pcr amplification with Ta2, L2, obtains about 320bp product; Product with 320bp is a template again, with Ta1, L2 is that the primer PCR amplification obtains about 370bp product, the product that obtains is the fusion encoding gene of the fusion rotein of T α 1 and L12, order-checking, get its nucleotide sequence shown in sequence in the sequence table 2, wherein from the portion gene of 5 of sequence 2 ' terminal 91-363 position Nucleotide for coding L12,4-87 position Nucleotide is the gene of coding T α 1; The aminoacid sequence of the fusion rotein (A2) of this fusion gene coding is shown in sequence in the sequence table 1, it is that the aminoacid sequence shown in T α 1, the 31-121 amino acids residue is the proteic C end parts of L12 that sequence 1 is held the aminoacid sequence shown in the 2-29 amino acids residue from N.

The acquisition of recombinant vectors pET-A2: with NdeI and the above-mentioned fusion gene of XhoI double digestion (available from precious biotechnology (Dalian) company limited), with NdeI and XhoI double digestion carrier pET22b (available from Novagen company, catalog number (Cat.No.) 69337-3), connect, obtain recombinant vectors, with recombinant vectors transformed into escherichia coli DH5 α, screening obtains positive colony, the evaluation of checking order again obtains to express the recombinant vectors pET-A2 of T α 1 and the fusion rotein (abbreviating A2 as) of L12.

The acquisition of engineering bacteria I: recombinant vectors pET-A2 is transformed host e. coli BL21 (DE3), screen, obtain expressing the engineering bacteria I of A2.

The sequence of each used primer is as follows:

L1：5’GGAATTCCATATGTCTATCACTAAAGATCA?3’

L2：5’GTGCTCGAGTTTAACTTCAACTTCAGCG?3’

Ta1：5’

GAATTCCATATGTCTGATGCAGCTGTAGATACTAGCTCTGAAATCACTACTAAAGATCTTAAGGAGAAGAAGGA 3’

Ta2：5’

GATCTTAAGGAGAAGAAGGAAGTTGTCGAAGAGGCTGAGAACGGCTTCGGTGTTTCCGCT?3’

2, the expression of A2, purifying and acetylation modification are identified

At first single bacterium colony of picking engineering bacteria I inserts 2ml LB substratum (yeast powder 5g/L, peptone 10g/L, the sodium-chlor 10g/L that contains the 100mg/L penbritin; PH 7.0) in, cultivated 12 hours for 30 ℃.Be transferred to then in the same medium of 50ml, 30 ℃ of shaking culture 10 hours are as seed.Seed is inserted (yeast powder 12g/L, peptone 15g/L, Na in 1 liter of FML substratum that contains penbritin ₂HPO ₄2H ₂O3g/L, KH ₂PO ₄3H ₂O 7g/L, NaCl 2.5g/L, 0.2% glucose, 2mM lactose, 0.05%MgSO ₄7H ₂O, 100mg/L penbritin) shaking culture is 8 hours, during at the thalline that centrifugal results express of taking a sample of different periods, carry out electrophoresis.The whole bacterial protein electrophoresis result of different periods as shown in Figure 1, showing cultivating all had target protein to express in 4 hours to 8 hours.

Get (weight in wet base) thalline 10 grams of expressing after 8 hours, add 100mL damping fluid PB (the 50mM phosphate buffered saline buffer, pH7.0), carrying out ultrasonic bacteria breaking under the condition of ice bath.Add 5.844 gram NaCl and 2 gram Triton X-100 behind the broken bacterium, be settled to 200mL, the centrifugal 40min of 8000rpm gets supernatant, and with the membrane filtration of 0.45 μ m, the filtrate that obtains is carried out nickel metal chelate affinity chromatography purifying again.

(16 * 60mm) earlier with buffer A (50mM phosphate buffered saline buffer for nickel metal chelate affinity chromatography post, 0.5MNaCl, pH7.0) 4 column volumes of balance, go up sample then, use buffer B (50mM phosphate buffered saline buffer, 0.5M NaCl, 10% glycerine again, pH7.0) 10 column volumes of flushing are then used 4 column volumes of buffer A balance again.Use damping fluid C (50mM phosphate buffered saline buffer, 0.5M NaCl, 200mM imidazoles, pH7.0) direct wash-out then.

Elutriant is carried out electrophoresis respectively, (wherein " A " represented the sample that post is preceding to protein electrophoresis figure result as shown in Figure 2, " B " expression sample passes the collection liquid behind the pillar, and M represents protein molecular weight standard, and swimming lane 1-7 is illustrated respectively in the different samples of collecting in the elution process).

The sample that previous step is collected carries out purifying with the C8 post, collects sample, is used for Q-TOF-MS mass spectroscopy determining molecular weight.The theoretical molecular of A2 is 13199.72 dalton, behind the acetylation modification then molecular weight increase by 42 dalton.Mass spectrometry results shows some A2 modification that is acetylation as shown in Figure 3, shows to have acetylize and two kinds of forms of non-acetylize.

A2 is carried out carrying out MS-MS tandem mass spectrum Analysis and Identification acetylation modification site behind the tryptic digestion; result such as Fig. 4 (tryptic digestion double charge peak; 712.78 be mass-to-charge ratio without 14 residues of acetylizad N end; 733.78 be mass-to-charge ratio through 14 residues of acetylizad N end) and shown in Figure 5, show that acetylation modification occurs on the Ser residue of N end.

Two, the antigen-4 fusion protein gene structure of T α 1 and S18 and expression, acetylation modification are identified

1, expresses the structure of the fusion rotein engineering bacteria II of T α 1 and S18

The structure of fusion gene: with the bacillus coli gene group is template, is the sequence of the gene rpsR of primer PCR amplification coding ribosomal protein S18 with S81, S82, about 230bp; PCR fragment with this 230bp is a template then, is that the primer PCR amplification obtains about 190bp product with Ta3, S82; PCR fragment with this 190bp is a template again, with Ta1, S82 is that the primer PCR amplification obtains about 230bp product, be the fusion gene of the fusion rotein of expressing T α 1 and S18, order-checking, get its nucleotide sequence shown in sequence in the sequence table 4, wherein from the gene of 5 of sequence 4 ' terminal 91-225 position Nucleotide for coding S18,4-87 position Nucleotide is the gene of coding T α 1; The aminoacid sequence of the fusion rotein (A8) of this fusion gene coding is shown in sequence in the sequence table 3, it is that the aminoacid sequence shown in T α 1, the 31-75 amino acids residue is the C end parts of S18 that sequence 3 is held the aminoacid sequence shown in the 2-29 amino acids residue from N.

The structure of recombinant vectors: with NdeI and the above-mentioned fusion gene of XhoI double digestion (available from precious biotechnology (Dalian) company limited), with NdeI and XhoI double digestion carrier pET22b (available from Novagen company, catalog number (Cat.No.) 69337-3), connect, transformed into escherichia coli DH5 α, screening obtains positive colony, and evaluations of checking order again obtains expressing the carrier pET-A8 of the fusion rotein (abbreviating A8 as) of T α 1 and S18.

The structure of engineering bacteria II: carrier pET-A8 is transformed expression host e. coli BL21 (DE3), screen, obtain expressing the engineering bacteria II of A8.

Used primer sequence is as follows:

S81：5’GGAATTCCATATGGCACGTTATTTCCGTC?3’

S82：5’GTGCTCGAGCTGATGGCGATCAGTGTA?3’

Ta1：5’

GAATTCCATATGTCTGATGCAGCTGTAGATACTAGCTCTGAAATCACTACTAAAGATCTTAAGGAGAAGAAGGA?3’

Ta3：5’

GATCTTAAGGAGAAGAAGGAAGTTGTCGAAGAGGCTGAGAACTGCAACTACATCACCGAAAGCG?3’

2, the expression of A8, purifying and acetylation modification are identified

At first single bacterium colony of picking engineering bacteria II inserts 2ml LB substratum (yeast powder 5g/L, peptone 10g/L, the sodium-chlor 10g/L that contains the 100mg/L penbritin; PH 7.0) in, cultivated 12 hours for 30 ℃.Be transferred to then in the same medium of 50ml, 30 ℃ of shaking culture 10 hours are as seed.Seed is inserted (yeast powder 12g/L, peptone 15g/L, Na in 1 liter of FML substratum that contains penbritin ₂HPO ₄2H ₂O3g/L, KH ₂PO ₄3H ₂O 7g/L, NaCl 2.5g/L, 0.2% glucose, 2mM lactose, 0.05%MgSO ₄7H ₂O, 100mg/L penbritin) shaking culture is 8 hours, the thalline that centrifugal results are expressed.

Get 10 the gram (weight in wet base) thalline, add 100mL damping fluid PB (the 50mM phosphate buffered saline buffer, pH7.0), carrying out ultrasonic bacteria breaking under the condition of ice bath.Add 5.844 gram NaCl and 2 gram Triton X-100 behind the broken bacterium, be settled to 200mL, the centrifugal 40min of 8000rpm gets supernatant, and with the membrane filtration of supernatant with 0.45 μ m, the filtrate that obtains is carried out nickel metal chelate affinity chromatography purifying again.

(16 * 60mm) earlier with buffer A (50mM phosphate buffered saline buffer for nickel metal chelate affinity chromatography post, 0.5MNaCl, pH7.0) 4 column volumes of balance, go up sample then, use buffer B (50mM phosphate buffered saline buffer, 0.5M NaCl, 10% glycerine again, pH7.0) 10 column volumes of flushing are then used 4 column volumes of buffer A balance again.Use damping fluid C (50mM phosphate buffered saline buffer, 0.5M NaCl, 200mM imidazoles, pH7.0) direct wash-out then.

Elutriant is carried out electrophoresis, (wherein " A " represented the preceding sample of post to the protein electrophoresis result as shown in Figure 6, " B " expression sample passes the collection liquid behind the pillar, and M represents protein molecular weight standard, and swimming lane 1-7 represents the different samples collected in the elution process respectively).

The sample that previous step is collected carries out purifying with the C8 post, collects sample, is used for Q-TOF-MS mass spectroscopy determining molecular weight.The theoretical molecular of A8 is 9506.61 dalton, behind the acetylation modification then molecular weight increase by 42 dalton.Mass spectrometry results shows some A8 modification that is acetylation as shown in Figure 7, shows to have acetylize and two kinds of forms of non-acetylize.

Above-mentioned experiment is earlier T α 1 to be carried out amalgamation and expression with intestinal bacteria ribosomal protein L 12 and S18 respectively, carries out the accurate determining molecular weight of purifying and Q-TOF-MS then, observes whether there is acetylation modification, determines the acetylize site by the mass spectrum sequence measurement then.Found that all there is acetylation modification in two kinds of fusion roteins, and decorating site is at first residue of N-terminal Ser.Therefore, the acetylation modification of inferring T α 1 is relevant with himself sequence, and not close with the fusion rotein sequence relation.In order to improve the acetylation modification degree, make the N end of T α 1 that abundant acetylation modification take place, necessary searching out makes it acetylizad key enzyme.

Embodiment 2, with the screening of the acetylation modification genes involved of T α 1

The terminal Transacetylase of known N-has three in the intestinal bacteria, is respectively RimI, RimJ, RimL.Wherein also may there be the terminal Transacetylase of unknown N-in the gene that also has many unknown function in the bacillus coli gene group.The contriver has selected five genes (yjaB, yjhQ, yjgM, yhhY, yiiD) that are speculated as Transacetylase from genome.Utilize the Red recombinant technology to knock out this 8 genes, make up different enzyme gene deletion mutant strains, express T α 1 therein respectively, carry out separation and purification, mass spectrum evaluation acetylation modification form.When the rimJ gene is knocked out, find that just there is not the acetylation modification form in fusion rotein A2, infer that this enzyme may be the enzyme that participates in T α 1 acetylation modification.Now details are as follows with the related experiment of rimJ gene knockout:

Fusion rotein in the present embodiment is the A2 among the embodiment 1.

Use the Red recombination system in the present embodiment and knock out candidate's enzyme gene.Because the recombination efficiency of short homologous fragment (40-60bp) in e. coli bl21 (DE3) is extremely low, so this test is implemented in e. coli jm109 (DE3).

Recombinant vectors pET-A2 among the embodiment 1 is changed in the e. coli jm109 (DE3); according to method described in the embodiment 1 recombinate bacterium screening, express, and acetylation modification identify; the result shows with changing in the e. coli bl21 (DE3) the same; the A2 that expresses in e. coli jm109 (DE3) has part to have acetylation modification, and there is not acetylation modification in another part.

One, the structure of rimJ clpp gene degerming

1, the preparation of Red reorganization competent cell

The plasmid pKOBEG (Chaveroche et al., Nucleic AcidsResearch, 28 (22): e97,2000) (Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A) of coding Red recombination system is used CaCl ₂Method is converted in the e. coli jm109 (DE3); Reorganization bacterium 30 ℃ of overnight shakings in containing the LB substratum of paraxin are cultivated; Connect 1ml bacterium liquid in the LB substratum that has paraxin of 50ml, 30 ℃ of shaking culture; To A ₆₀₀=0.2-0.4 adds L-arabinose (final concentration is 0.2%), continues shaking culture; To A ₆₀₀Be 1.0,4000g, 4 ℃ of centrifugal 10min collect thalline; Wash 3 times with deionized water, at last thalline is resuspended in the 10% cold glycerine of 150 μ l, obtain intestinal bacteria Red reorganization competent cell JM109 (DE3)/pKOBEG.

2, pcr amplification target practice fragment

With J5 and J3 is primer, pKD4 plasmid (Datsenko KA, Wanner BL.One-step inactivation ofchromosomal genes in Escherichia coli K-12 using PCR products.Proc Natl Acad Sci USA, 2000,97:6640-6645.) as masterplate, amplification has the linearity target practice fragment that resistant gene of card is used to knock out the rimJ gene, and reaction system is as follows:

10×Pyrobest?Buffer 5μL

dNTP 4μL

Primer?J5 1μL

Primer?J3 1μL

pKD4 1μL

Pyrobest?DNA?Polymerase 0.3μL

ddH ₂O 37.7μL

Cumulative volume 50 μ L

The PCR reaction conditions:

The PCR product is reclaimed (reclaiming the about 1500bp of clip size) with 1% agarose gel electrophoresis, cut with Dpn I enzyme, purpose is to digest residual plasmid template, reduces false positive, and 1% agarose gel electrophoresis reclaims once more.

Primer sequence is as follows:

J5：5’- atgtttggctatcgcagtaacgtgccaaaagtgcgcttaaccaca?TAA?gtgtaggctggagctgcttc-3’

J3：5’- ttagcggccgggcgtccagtctggggtagttaatgccg?tcagtacatgggaattagccatggtcc-3’

3, electric shock transforms

Get the linearity target practice fragment of 100～300ng recovery and mix with 50 μ L intestinal bacteria Red reorganization competent cell JM109 (the DE3)/pKOBEG of preparation in the abovementioned steps 1, the BTX electricity revolving cup that mixture is sucked 0.1cm shocks by electricity, and voltage 1850V is set.The electric shock back adds the ice-cold LB substratum of 0.5mL, mixing, 37 ℃ of shaking culture 60min fast.Whole bacterium liquid are coated on the flat board that contains 50 μ g/mL kantlex, and 37 ℃ of overnight incubation are carried out follow-up qualification test after waiting to grow bacterium colony.The bacterial strain called after rimJ that will on the kantlex flat board, grow ^-Kan ^rJM109 (DE3), the rimJ gene in this bacterial strain should be knocked out and this bacterial strain has kalamycin resistance in theory.

4, the bacterium colony PCR that knocks out bacterium identifies

Used primer sequence is as follows: Jsy:5 '-cgtattaaagacgttacggg-3 ', Jxy:5 '-cacctgcttttccagcaagc-3 ', K2:5 '-atgggaattagccatggtcc-3 '.

Scheme one: with respectively with rimJ gene upstream and downstream homologous Jsy and Jxy as primer, e. coli jm109 (DE3) and the mutant bacteria rimJ not change any carrier and gene over to respectively ^-Kan ^rJM109 (DE3) carries out pcr amplification for template.

Reaction system is as follows:

10×Takala?Taq?Buffer 5μL

dNTP 4μL

Primer?Jsy 1μL

Primer?Jxy 1μL

The Template bacterium colony picks trace

Takala?Taq 0.3μL

ddH ₂O 38.7μL

Cumulative volume 50 μ L

In theory, should amplify the fragment about 600bp in not changing the e. coli jm109 of any carrier (DE3) over to, this fragment is rimJ gene and upstream and downstream sequence thereof; Mutant bacteria rimJ ^-Kan ^rShould amplify 1600bp left and right sides fragment among the JM109 (DE3), this fragment adds the upstream and downstream partial sequence of rimJ for that resistant gene length of card.

Each PCR product is carried out detected through gel electrophoresis, and the result is (M:DNA molecular weight standard as shown in figure 14; 1, JM109 (DE3); 2, mutant bacteria rimJ ^-Kan ^rJM109 (DE3)).The result is presented at all about 600bp of length of amplified fragments in the e. coli jm109 (DE3) that does not change any carrier over to, mutant bacteria rimJ ^-Kan ^rThe amplified fragments of JM109 (DE3) is about 1600bp (this 1600bp adds the upstream and downstream partial sequence of rimJ for that resistant gene length of card), and amplified band shows mutant bacteria rimJ between 1000bp～2000bp ^-Kan ^rThe middle rimJ gene of JM109 (DE3) is knocked out but had kalamycin resistance gene, and is consistent with expected results.

Scheme two: use with rimJ upstream region of gene homologous Jsy primer and with kalamycin resistance gene homologous sequence K2 as primer, e. coli jm109 (DE3) and the mutant bacteria rimJ not change any gene and carrier respectively ^-Kan ^rJM109 (DE3) carries out PCR for template.Bacterium colony PCR reaction system and pcr amplification program are the same.

The e. coli jm109 (DE3) that does not change any gene and carrier in theory itself does not block that resistant gene sequence, so there is not K2 bonded position, should not have amplified band, mutant bacteria rimJ ^-Kan ^rJM109 (DE3) should amplify the fragment (length of kalamycin resistance gene is 1500bp) that only contains kalamycin resistance gene.

The PCR product is carried out detected through gel electrophoresis, and the result is (M:DNA molecular weight standard as shown in figure 15; 1, JM109 (DE3); 2, mutant bacteria rimJ ^-Kan ^rJM109 (DE3)).The result shows, does not change the no amplified band of e. coli jm109 (DE3) of any gene and carrier; And from mutant bacteria rimJ ^-Kan ^rJM109 (DE3) can amplify the band that is about 1500bp, and mutant bacteria rimJ is described ^-Kan ^rThere is that resistant gene of card in JM109 (DE3) between rimJ upstream and K2 bonded position, consistent with expected results.

More than prove the mutant bacteria rimJ that this experiment makes up ^-Kan ^rJM109 (DE3) is correct, and wherein, the rimJ gene is partly knocked out, and this bacterium has that resistant gene of card simultaneously.

Two, at mutant bacteria rimJ ^-Kan ^rExpress A2 among the JM109 (DE3) and carry out purifying, mass spectroscopy evaluation acetylation modification

The recombinant vectors pET-A2 that embodiment 1 is made up is transformed into JM109 (DE3) and mutant bacteria rimJ thereof ^-Kan ^rAmong the JM109 (DE3).Picking list bacterium colony inserts 5ml LB substratum (yeast powder 5g/L, peptone 10g/L, the sodium-chlor 10g/L that contains the 100mg/L penbritin; PH 7.0) in, cultivated 12 hours for 30 ℃.Get 2ml then and be transferred in the same medium of 50ml, 30 ℃ of shaking culture 10 hours are as seed.Seed is inserted in 1 liter of LB substratum that contains penbritin 37 ℃ when being cultured to nectar degree A600=0.4-0.5, and adding final concentration is 0.5mM IPTG, continues to cultivate 4 hours, centrifugal, the thalline that results are expressed.

According to method described in the embodiment 1, with the bacterial cell disruption of collecting, nickel metal chelate affinity chromatography purifying is carried out in centrifugal, filtration again, and the sample behind the chromatography carries out purifying with the C8 post again, and the sample of collection is used for Q-TOF-MS mass spectroscopy determining molecular weight.

Result such as Fig. 8 and shown in Figure 9 are at mutant strain rimJ ^-Kan ^rThere is not acetylation modification in expression product A2 among the JM109 (DE3), and still has acetylation modification in the JM109 (DE3) without any conversion.Illustrate that the rimJ gene is relevant with the acetylation modification of A2.

Three, A2 and RimJ are at mutant strain rimJ ^-Kan ^rCoexpression among the JM109 (DE3)

For a nearly step conclusive evidence rimJ is exactly the key enzyme that makes T α 1 acetylation modification, the contriver to compatible plasmid, transforms A2 and rimJ gene clone then rimJ and knocks out and carry out coexpression in the bacterium.Identify through separation and purification and mass spectrum, find, the fusion rotein A2 modification that all is acetylation when both coexpressions.And when rimJ knocked out in the bacterium single expression A2, acetylation modification did not then take place in fusion rotein fully.These results prove that rimJ gene product RimJ is exactly the specific enzymes that participates in T α 1 acetylation modification.

1, makes up the recombinant vectors pACYC-rimJ that contains the rimJ gene

With the bacillus coli gene group is template, is primer with J1, J2, and pcr amplification, the product that obtains are the terminal acetyl transferase gene rimJ (about 600bp) of coding N-.With NdeI and XhoI double digestion (available from precious biotechnology (Dalian) company limited) pcr amplification product, with NdeI and XhoI double digestion carrier pACYCDuet-1 (available from Novagen company, catalog number (Cat.No.) 71147-3), connect, transformed into escherichia coli DH5 α, screening obtains positive colony, the evaluation of checking order again, obtain to express the carrier pACYC-rimJ of rimJ, the rimJ expression of gene is controlled by the T7 promotor on this carrier.The nucleotide sequence of rimJ gene is shown in sequence in the sequence table 8, and rimJ albumen is shown in sequence in the sequence table 7.

J1, J2 primer sequence are as follows: J1:5 ' GGAATT CATATGTTTGGCTATCGCAGTAAC 3 ', J2:5 ' CGC CTCGAGTTAGCGGCCGGGCGT 3 '.

2, A2 and RimJ coexpression in the degerming of rimJ clpp gene

Plasmid pET-A2 and pACYC-rimJ are transformed into rimJ clpp gene degerming rimJ jointly ^-Kan ^rAmong the JM109 (DE3), on the LB flat board that contains 100mg/L penbritin and 25mg/L paraxin, screen, contained the reorganization bacterium rimJ of pET-A2 and pACYC-rimJ simultaneously ^-Kan ^rJM109 (DE3)/pET-A2/pACYC-rimJ.Like this, the expression of A2 and rimJ can be induced simultaneously with IPTG and express all by the control of T7 promotor in the reorganization bacterium.

Bacterium rimJ will recombinate ^-Kan ^rJM109 (DE3)/pET-A2/pACYC-rimJ inserts 2ml LB substratum (yeast powder 5g/L, peptone 10g/L, the sodium-chlor 10g/L that contains 100mg/L penbritin and 25mg/L paraxin; PH 7.0) in, cultivated 12 hours for 30 ℃.Be transferred to then in the same medium of 50ml, 30 ℃ of shaking culture 10 hours are as seed.Seed is inserted in 1 liter of LB substratum that contains 100mg/L penbritin and 25mg/L paraxin 37 ℃ be cultured to nectar degree A ₆₀0=0.4-0.5 the time, adding final concentration is 0.5mM IPTG, continues to cultivate 4 hours, centrifugal, collects thalline.

According to method described in the embodiment 1, with the bacterial cell disruption of collecting, nickel metal chelate affinity chromatography purifying is carried out in centrifugal, filtration again, and the sample behind the chromatography carries out purifying with the C8 post again, and the sample of collection is used for Q-TOF-MS mass spectroscopy determining molecular weight.

The result shows as shown in figure 10 at mutant strain rimJ ^-Kan ^rDuring with A2 and RimJ coexpression, expression product A2 all exists with acetylated form among the JM109 (DE3).The product that this result further specifies the rimJ gene has determined the acetylation modification of A2.

The thymosin T α 1 of embodiment 3, the terminated acetylated modification of preparation N-

It is exactly the key enzyme that makes T α 1 acetylation modification that rimJ has been proved conclusively in aforementioned research, by with T α 1 fusion rotein and rimJ gene co-expressing, can make the modification that all is acetylation of T α 1 fusion rotein.For obtaining the T α 1 of complete structure, need cut fusion rotein.Cutting method can adopt enzymatic lysis method, chemical cracking method, and the cutting method of intein mediation.The present embodiment introduction utilizes the intein cutting to obtain the thymosin T α 1 of the terminated acetylated modification of N-.

One, makes up engineering bacteria

(1) makes up T α 1 and Spl DnaX intein fusion protein expression vector pET-AS

The gene order of coding Spl DnaX intein is shown in sequence in the sequence table 9, and is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With the gene of restriction enzyme EcoR I and Xho I double digestion coding Spl DnaX intein, use restriction enzyme EcoR I and Xho I double digestion pET22b carrier again, connect, obtain containing the recombinant vectors pET-S of the encoding gene of Spl DnaX intein.

Design two oligonucleotide fragment TA and TAS, two bar segment are carried out self-annealing extend, obtain the product of about 100bp; Product with NdeI and Afl II double digestion, with NdeI and Afl II double digestion pET-S, is connected, and screening, sequence verification obtain expressing the recombinant vectors pET-AS of T α 1 and SplDnaX intein fusion rotein (AS).Wherein, (sequence 11 is the encoding gene of T α 1 from 5 ' terminal 4-87 position Nucleotide to the nucleotide sequence of the encoding gene of T α 1 and SplDnaX intein fusion rotein shown in sequence in the sequence table 11,88-495 position Nucleotide is the encoding gene of SplDnaX intein), the aminoacid sequence of T α 1 and SplDnaX intein fusion rotein is shown in sequence in the sequence table 10, it is that the aminoacid sequence shown in T α 1, the 30-165 amino acids residue is the SplDnaX intein that sequence 10 is held the aminoacid sequence shown in the 2-29 amino acids residue from N.

Primer sequence is as follows:

TA：5’-GAA?TTC?CAT?ATG?TCA?GAT?GCA?GCA?GTA?GAT?ACT?AGC?TCT?GAAATC?ACT?ACC?AAA?GAC?CTG?AAG?GAG?AAG?AAG-3’

TAS：5’-GCT?GCT?ACT?TAA?GCA?GTT?CTC?AGC?CTC?TTC?GAC?AAC?TTC?CTTCTT?CTC?CTT?CAG?GTC-3’

The self-annealing extension condition of TA and TAS is as follows:

Reaction system:

10×Pyrobest?Buffer 5μL

dNTP 4μL

Primer?TA 1μL

Primer?TAS 1μL

Pyrobest?DNA?Polymerase 0.3μL

ddH ₂O 38.7μL

Cumulative volume 50 μ L

The PCR reaction conditions:

(2) make up the reorganization bacterium

Recombinant vectors pET-AS and pACYC-rimJ are transformed into e. coli bl21 (DE3) jointly, on the LB flat board that contains 100mg/L penbritin and 25mg/L paraxin, screen, contained reorganization bacterium BL21 (DE3)/pET-AS/pACYC-rimJ of pET-AS and pACYC-rimJ simultaneously.Like this, the expression of AS and rimJ can be induced simultaneously with IPTG and express all by the control of T7 promotor in the reorganization bacterium.

Two, the preparation of the terminated acetylated T α 1 of N-

Fermentation: engineering bacteria BL21 (DE3)/pET-AS/pACYC-rimJ is inserted 2ml LB substratum (yeast powder 5g/L, peptone 10g/L, the sodium-chlor 10g/L that contains the 100mg/L penbritin; PH 7.0) in, cultivated 12 hours for 30 ℃.Be transferred to then in the same medium of 50ml, 30 ℃ of shaking culture 10 hours are as seed.Seed is inserted (yeast powder 12g/L, peptone 15g/L, Na in 1 liter of FML substratum that contains penbritin ₂HPO ₄2H ₂O 3g/L, KH ₂PO ₄3H ₂O 7g/L, NaCl 2.5g/L, glucose 2g/L, 2mM lactose, MgSO ₄7H ₂O 0.5g/L, the 100mg/L penbritin), 30 ℃ of shaking culture 10 hours (hunting speed is 250rpm/min), centrifugal, collect thalline.

Separation and purification: get thalline (weight in wet base 10 gram), add 100mL damping fluid PB (the 50mM phosphate buffered saline buffer, pH7.0), carrying out ultrasonic bacteria breaking under the condition of ice bath.Add 5.844 gram NaCl and 2 gram Triton X-100 behind the broken bacterium, be settled to 200mL, the centrifugal 40min of 8000rpm gets supernatant, with the membrane filtration of supernatant with 0.45 μ m, collects filtrate, and filtrate is carried out nickel metal chelate affinity chromatography purifying.

(16 * 60mm) earlier with buffer A (50mM phosphate buffered saline buffer for nickel metal chelate affinity chromatography post, 0.5MNaCl, pH7.0) 4 column volumes of balance, go up sample then, use buffer B (50mM phosphate buffered saline buffer, 0.5M NaCl, 10% glycerine again, pH7.0) 10 column volumes of flushing are then used 4 column volumes of buffer A balance again.Use damping fluid C (50mM phosphate buffered saline buffer, 0.5M NaCl, 200mM imidazoles, pH7.0) direct wash-out then.

The total protein of broken bacterium acquisition, the albumen that affinitive layer purification obtains are carried out electrophoresis, the result is (swimming lane 1 expression protein molecular weight standard as shown in figure 11, the centrifugal deposit sample that obtains behind the broken bacterium of swimming lane 2 expressions, the centrifugal supernatant sample that obtains behind the broken bacterium of swimming lane 3 expressions, swimming lane 4 expression samples pass the collection liquid behind the pillar, the different samples that swimming lane 5 to 7 expression wash-outs are collected), show that target protein substantially all hangs up post, and removed most of foreign protein.

In the component that contains target protein AS, add the mercaptoethanol of 200mM, cut 24 hours in 37 ℃, the sample after the cutting is carried out electrophoresis, then cutting sample is carried out desalination, by the anion chromatography purifying.

Cutting sample carries out the method for desalination: after the membrane filtration of 50ml cutting sample through 0.22 μ m, last G15FF gel chromatography column (column volume 300ml, the rich intelligent chromatogram of Beijing Webster Science and Technology Ltd.), the buffer A (Histidine of 20mM with 2 column volumes, PH6.0) carry out wash-out, the flow velocity of buffer A is 8mL/min, collects protein peak.

The method of anion chromatography purifying: with Q Sepharose HP (GEHealthcare on the protein peak sample of collecting above, column volume 15ml), with the buffer A (Histidine of 20mM, PH6.0) after the balance, with the buffer B (Histidine of 20mM, 1M NaCl PH6.0) carries out linear gradient elution.Flow velocity is 4ml/min.Gradient condition is: in the volume of 300ml elutriant is converted to 100% buffer B from 100% buffer A gradually.Collect sample.

The result is (swimming lane 1 expression protein molecular weight standard as shown in figure 12, sample before the swimming lane 2 expression cuttings, swimming lane 3 expression cutting back samples, swimming lane 4 expression samples pass the collection liquid behind the negatively charged ion pillar, the different samples that swimming lane 5 to 7 expression anion-exchange chromatography wash-outs are collected), show that about 80% sample all is cut, can obtain purer T α 1 by anionresin.

Purification of samples carries out mass spectroscopy; mass spectrum molecular weight determination result as shown in figure 13; has only the terminated acetylated T α of N-1 peak 3106.7Da (the molecular weight theoretical value is 3107Da); do not find non-acetylizad T α 1 (the molecular weight theoretical value is 3065Da), the T α 1 that shows acquisition all is an acetylated form.Occur on the Ser residue of N-end through tandem mass spectrum order-checking proof acetylation modification.

Sequence table

＜110〉Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A

＜120〉a kind of method and dedicated engineering bacteria thereof for preparing the terminated acetylated thymosin of N-

<130>CGGNAC92068

<160>11

<210>1

<211>129

<212>PRT

<220>

<223>

<400>1

Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp

1 5 10 15

Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Phe?Gly

20 25 30

Val?Ser?Ala?Ala?Ala?Ala?Val?Ala?Val?Ala?Ala?Gly?Pro?Val?Glu?Ala

35 40 45

Ala?Glu?Glu?Lys?Thr?Glu?Phe?Asp?Val?Ile?Leu?Lys?Ala?Ala?Gly?Ala

50 55 60

Asn?Lys?Val?Ala?Val?Ile?Lys?Ala?Val?Arg?Gly?Ala?Thr?Gly?Leu?Gly

65 70 75 80

Leu?Lys?Glu?Ala?Lys?Asp?Leu?Val?Glu?Ser?Ala?Pro?Ala?Ala?Leu?Lys

85 90 95

Glu?Gly?Val?Ser?Lys?A5p?Asp?Ala?Glu?Ala?Leu?Lys?Lys?Ala?Leu?Glu

100 105 110

Glu?Ala?Gly?Ala?Glu?Val?Glu?Val?Lys?Leu?Glu?His?His?His?His?His

115 120 125

His

<210>2

<211>390

<212>DNA

<220>

<223>

<400>2

atgtctgatg?cagctgtaga?tactagctct?gaaatcacta?ctaaagatct?taaggagaag 60

aaggaagttg?tcgaagaggc?tgagaacggc?ttcggtgttt?ccgctgctgc?tgctgtagct 120

gtagctgctg?gcccggttga?agctgctgaa?gaaaaaactg?aattcgacgt?aattctgaaa 180

gctgctggcg?ctaacaaagt?tgctgttatc?aaagcagtac?gtggcgcaac?tggcctgggt 240

ctgaaagaag?ctaaagacct?ggtagaatct?gcaccggctg?ctctgaaaga?aggcgtgagc 300

aaagacgacg?cagaagcact?gaaaaaagct?ctggaagaag?ctggcgctga?agttgaagtt 360

aaactcgagc?accaccacca?ccaccactag 390

<210>3

<211>83

<212>PRT

<220>

<223>

<400>3

Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp

1 5 10 15

Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Cys?Asn?Tyr

20 25 30

Ile?Thr?Glu?Ser?Gly?Lys?Ile?Val?Pro?Ser?Arg?Ile?Thr?Gly?Thr?Arg

35 40 45

Ala?Lys?Tyr?Gln?Arg?Gln?Leu?Ala?Arg?Ala?Ile?Lys?Arg?Ala?Arg?Tyr

50 55 60

Leu?Ser?Leu?Leu?Pro?Tyr?Thr?Asp?Arg?His?Gln?Leu?Glu?His?His?His

65 70 75 80

His?His?His

<210>4

<211>252

<212>DNA

<220>

<223>

<400>4

atgtctgatg?cagctgtaga?tactagctct?gaaatcacta?ctaaagatct?taaggagaag 60

aaggaagttg?tcgaagaggc?tgagaactgc?aactacatca?ccgaaagcgg?taagattgtc 120

ccaagccgta?tcaccggtac?ccgtgcaaaa?taccagcgtc?agctggctcg?cgctatcaaa 180

cgcgctcgct?acctgtccct?gctgccgtac?actgatcgcc?atcagctcga?gcaccaccac 240

caccaccact?ag 252

<210>5

<211>175

<212>PRT

<220>

<223>

<400>5

Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp

1 5 10 15

Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Cys?Phe?Ser

20 25 30

Phe?Thr?Ala?Leu?Thr?Val?Val?Gly?Asp?Gly?Asn?Gly?Arg?Val?Gly?Phe

35 40 45

Gly?Tyr?Gly?Lys?Ala?Arg?Glu?Val?Pro?Ala?Ala?Ile?Gln?Lys?Ala?Met

50 55 60

Glu?Lys?Ala?Arg?Arg?Asn?Met?Ile?Asn?Val?Ala?Leu?Asn?Asn?Gly?Thr

65 70 75 80

Leu?Gln?His?Pro?Val?Lys?Gly?Val?His?Thr?Gly?Ser?Arg?Val?Phe?Met

85 90 95

Gln?Pro?Ala?Ser?Glu?Gly?Thr?Gly?Ile?Ile?Ala?Gly?Gly?Ala?Met?Arg

100 105 110

Ala?Val?Leu?Glu?Val?Ala?Gly?Val?His?Asn?Val?Leu?Ala?Lys?Ala?Tyr

115 120 125

Gly?Ser?Thr?Asn?Pro?Ile?Asn?Val?Val?Arg?Ala?Thr?Ile?Asp?Gly?Leu

130 135 140

Glu?Asn?Met?Asn?Ser?Pro?Glu?Met?Val?Ala?Ala?Lys?Arg?Gly?Lys?Ser

145 150 155 160

Val?Glu?Glu?Ile?Leu?Gly?Lys?Leu?Glu?His?His?His?His?His?His

165 170 175

<210>6

<211>528

<212>DNA

<220>

<223>

<400>6

atgtctgatg?cagctgtaga?tactagctct?gaaatcacta?ctaaagatct?taaggagaag 60

aaggaagttg?tcgaagaggc?tgagaactgc?ttctccttca?cagctctgac?tgtagttggc 120

gatggtaacg?gtcgcgttgg?ttttggttac?ggtaaagcgc?gtgaagttcc?agcagcgatc 180

cagaaagcga?tggaaaaagc?ccgtcgcaat?atgattaacg?tcgcgctgaa?taacggcact 240

ctgcaacacc?ctgttaaagg?tgttcacacg?ggttctcgcg?tattcatgca?gccggcttcc 300

gaaggtaccg?gtatcatcgc?cggtggtgca?atgcgcgccg?ttctggaagt?cgctggggtt 360

cataacgttc?tggctaaagc?ctatggttcc?accaacccga?tcaacgtggt?tcgtgcaact 420

attgatggcc?tggaaaatat?gaattctcca?gaaatggtcg?ctgccaagcg?tggtaaatcc 480

gttgaagaaa?ttctggggaa?actcgagcac?caccaccacc?accactag 528

<210>7

<211>194

<212>PRT

＜213〉enterobacteriaceae Escherichia intestinal bacteria (Escherichia coli)

<400>7

Met?Phe?Gly?Tyr?Arg?Ser?Asn?Val?Pro?Lys?Val?Arg?Leu?Thr?Thr?Asp

1 5 10 15

Arg?Leu?Val?Val?Arg?Leu?Val?His?Asp?Arg?Asp?Ala?Trp?Arg?Leu?Ala

20 25 30

Asp?Tyr?Tyr?Ala?Glu?Asn?Arg?His?Phe?Leu?Lys?Pro?Trp?Glu?Pro?Val

35 40 45

Arg?Asp?Glu?Ser?His?Cys?Tyr?Pro?Ser?Gly?Trp?Gln?Ala?Arg?Leu?Gly

50 55 60

Met?Ile?Asn?Glu?Phe?His?Lys?Gln?Gly?Ser?Ala?Phe?Tyr?Phe?Gly?Leu

65 70 75 80

Phe?Asp?Pro?Asp?Glu?Lys?Glu?Ile?Ile?Gly?Val?Ala?Asn?Phe?Ser?Asn

85 90 95

Val?Val?Arg?Gly?Ser?Phe?His?Ala?Cys?Tyr?Leu?Gly?Tyr?Ser?Ile?Gly

100 105 110

Gln?Lys?Trp?Gln?Gly?Lys?Gly?Leu?Met?Phe?Glu?Ala?Leu?Thr?Ala?Ala

115 120 125

Ile?Arg?Tyr?Met?Gln?Arg?Thr?Gln?His?Ile?His?Arg?Ile?Met?Ala?Asn

130 135 140

Tyr?Met?Pro?His?Asn?Lys?Arg?Ser?Gly?Asp?Leu?Leu?Ala?Arg?Leu?Gly

145 150 155 160

Phe?Glu?Lys?Glu?Gly?Tyr?Ala?Lys?Asp?Tyr?Leu?Leu?Ile?Asp?Gly?Gln

165 170 175

Trp?Arg?Asp?His?Val?Leu?Thr?Ala?Leu?Thr?Thr?Pro?Asp?Trp?Thr?Pro

180 185 190

Gly?Arg

<210>8

<211>585

<212>DNA

＜213〉enterobacteriaceae Escherichia intestinal bacteria (Escherichia coli)

<400>8

atgtttggct?atcgcagtaa?cgtgccaaaa?gtgcgcttaa?ccacagaccg?actggtcgtg 60

cgtctggtgc?atgatcgtga?tgcctggcgt?cttgcggatt?attacgcaga?gaatcgccat 120

ttcctcaagc?cctgggagcc?agtgcgcgac?gaaagccact?gttatccatc?aggctggcag 180

gccaggctgg?ggatgattaa?cgaatttcat?aaacaaggtt?cagctttcta?ctttggctta 240

ttcgacccgg?acgaaaaaga?gattattggc?gttgccaatt?tttccaatgt?tgttcgtggc 300

tcttttcatg?cctgctatct?cggttattcg?attgggcaaa?aatggcaggg?caaaggactc 360

atgtttgaag?ccctgaccgc?agccattcgt?tatatgcagc?gcacccaaca?tattcatcgc 420

attatggcta?attatatgcc?gcacaataaa?cgcagcggtg?atttactggc?gcgactgggt 480

tttgaaaaag?aaggctatgc?gaaagactat?ctgttgattg?atggacaatg?gcgcgatcac 540

gtactgacgg?cattaactac?cccagactgg?acgcccggcc?gctaa 585

<210>9

<211>420

<212>DNA

<220>

<223>

<400>9

gaattctgct?taagcggtga?tgctctgatt?ttaagcgatc?gcggttggct?gcgtattgac 60

gatccgactc?ttcaagaatg?ccgtgttctg?agctataacg?agtctactca?gcaatgggaa 120

tggcagcagg?ttttacgctg?gcttgaccag?ggtgttcgtg?agacttggaa?aattaaaacc 180

tttcagaccg?aaatcaaatg?cactggtaat?catctgattc?gcacagataa?aggctggatc 240

aaagcggcaa?acattacccc?gaaaatgaaa?atcctgtctc?cggaaattga?tgcggctgtc 300

aagactgcac?tgcaagatgt?agaatctatc?gaaaagctgg?gtgttaacca?tgtctacgat 360

attgaggtag?aacacaatca?caactttgtg?gcgaacggtc?tgcttgtgca?tgcactcgag 420

<210>10

<211>173

<212>PRT

<220>

<223>

<400>10

Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp

1 5 10 15

Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Cys?Leu?Ser

20 25 30

Gly?Asp?Ala?Leu?Ile?Leu?Ser?Asp?Arg?Gly?Trp?Leu?Arg?Ile?Asp?Asp

35 40 45

Pro?Thr?Leu?Gln?Glu?Cys?Arg?Val?Leu?Ser?Tyr?Asn?Glu?Ser?Thr?Gln

50 55 60

Gln?Trp?Glu?Trp?Gln?Gln?Val?Leu?Arg?Trp?Leu?Asp?Gln?Gly?Val?Arg

65 70 75 80

Glu?Thr?Trp?Lys?Ile?Lys?Thr?Phe?Gln?Thr?Glu?Ile?Lys?Cys?Thr?Gly

85 90 95

Asn?His?Leu?Ile?Arg?Thr?Asp?Lys?Gly?Trp?Ile?Lys?Ala?Ala?Asn?Ile

100 105 110

Thr?Pro?Lys?Met?Lys?Ile?Leu?Ser?Pro?Glu?Ile?Asp?Ala?Ala?Val?Lys

115 120 125

Thr?Ala?Leu?Gln?Asp?Val?Glu?Ser?Ile?Glu?Lys?Leu?Gly?Val?Asn?His

130 135 140

Val?Tyr?Asp?Ile?Glu?Val?Glu?His?Asn?His?Asn?Phe?Val?Ala?Asn?Gly

145 150 155 160

Leu?Leu?Val?His?Ala?Leu?Glu?His?His?His?His?His?His

165 170

<210>11

<211>522

<212>DNA

<220>

<223>

<400>11

atgtcagatg?cagcagtaga?tactagctct?gaaatcacta?ccaaagacct?gaaggagaag 60

aaggaagttg?tcgaagaggc?tgagaactgc?ttaagcggtg?atgctctgat?tttaagcgat 120

cgcggttggc?tgcgtattga?cgatccgact?cttcaagaat?gccgtgttct?gagctataac 180

gagtctactc?agcaatggga?atggcagcag?gttttacgct?ggcttgacca?gggtgttcgt 240

gagacttgga?aaattaaaac?ctttcagacc?gaaatcaaat?gcactggtaa?tcatctgatt 300

cgcacagata?aaggctggat?caaagcggca?aacattaccc?cgaaaatgaa?aatcctgtct 360

ccggaaattg?atgcggctgt?caagactgca?ctgcaagatg?tagaatctat?cgaaaagctg 420

ggtgttaacc?atgtctacga?tattgaggta?gaacacaatc?acaactttgt?ggcgaacggt 480

ctgcttgtgc?atgcactcga?gcaccaccac?caccaccact?ga 522

Claims (9)

1. engineering bacteria is that encoding gene with the encoding gene of thymosin and the terminal Transacetylase of N-imports in the host bacterium and obtains; The terminal Transacetylase of described N-is the protein of being made up of the aminoacid sequence shown in the sequence in the sequence table 7;

The encoding gene of described thymosin is that the fusion gene that the encoding gene by the encoding gene of described thymosin and intein forms imports in the described host bacterium; The nucleotides sequence of described fusion gene is classified as in the sequence table shown in the sequence 11.

2. engineering bacteria according to claim 1, it is characterized in that: the encoding gene of the terminal Transacetylase of described N-imports in the described host bacterium with adjustable promotor, and the encoding gene of the terminal Transacetylase of described N-is positioned at described adjustable promotor downstream;

The encoding gene of described thymosin imports in the described host bacterium with adjustable promotor, and the encoding gene of described thymosin is positioned at described adjustable promotor downstream;

But described adjustable promotor is inducible promoter or constitutive promoter.

3. engineering bacteria according to claim 2 is characterized in that: the encoding gene and the adjustable promotor of the terminal Transacetylase of described N-import in the described host bacterium by carrier; The encoding gene of the terminal Transacetylase of described N-and described adjustable promotor are positioned on the described carrier or are incorporated on the karyomit(e) of described host bacterium;

The encoding gene of described thymosin and adjustable promotor import in the described host bacterium by carrier; The encoding gene of described thymosin and described adjustable promotor are positioned on the described carrier.

4. according to arbitrary described engineering bacteria among the claim 1-3, it is characterized in that: the nucleotide sequence of the encoding gene of the terminal Transacetylase of described N-is the sequence 8 in the sequence table.

5. engineering bacteria according to claim 4 is characterized in that: the protein of described thymosin for holding the aminoacid sequence shown in the 2-29 amino acids residue to be made up of sequence in the sequence table 10 from N.

6. engineering bacteria according to claim 5 is characterized in that: the nucleotide sequence of the encoding gene of described thymosin is the 5 ' terminal 4-87 position of sequence 11 in the sequence table.

7. engineering bacteria according to claim 1 is characterized in that: described host bacterium is intestinal bacteria.

8. engineering bacteria according to claim 7 is characterized in that: described intestinal bacteria are for expressing the intestinal bacteria of t7 rna polymerase; The intestinal bacteria of described expression t7 rna polymerase are BL21 (DE3) or JM109 (DE3).

9. method for preparing the thymosin of N-terminal acetylation modification, arbitrary described engineering bacteria among the claim 1-8 that comprises the steps: to ferment obtains the thymosin of N-terminal acetylation modification.

Images