CN113774079A - Recombinant saccharomyces cerevisiae and construction method and application thereof - Google Patents

Abstract

The invention discloses recombinant saccharomyces cerevisiae and a construction method and application thereof. The construction method of the recombinant saccharomyces cerevisiae comprises the following steps: and (3) introducing a geraniol synthetase gene and/or a limonene synthetase gene into saccharomyces cerevisiae to obtain the recombinant saccharomyces cerevisiae for producing myrcene. The invention provides a powerful strain and a research foundation for the biosynthesis of myrcene, and has important significance for the mining of high-activity myrcene synthase.

Description

Recombinant saccharomyces cerevisiae and construction method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to recombinant saccharomyces cerevisiae as well as a construction method and application thereof.

Background

Monoterpene compounds are terpenes and derivatives thereof that contain two isoprene units in the molecule. The classification by its structure includes: acyclic monoterpenes, monocyclic monoterpenes, polycyclic monoterpenes. Attracts wide attention because of its medicinal value and its great application potential in food, cosmetics and energy industries. At present, monoterpenes are mainly obtained by extraction from natural plants or chemical synthesis, but these methods have low yield and are highly dependent on the availability of raw materials. Meanwhile, the generated waste has complex components, pollutes the environment and brings difficulty to subsequent treatment. With the development of synthetic biology technology and metabolic engineering, microorganisms are modified to become a cell factory for synthesizing high value-added chemicals, and a new green and clean production way is opened for the synthesis of terpenoids.

Disclosure of Invention

The invention aims to provide a construction method of myrcene-producing recombinant saccharomyces cerevisiae.

The invention provides a construction method of myrcene-producing recombinant saccharomyces cerevisiae, which comprises the following steps: and (3) introducing a geraniol synthetase gene and/or a limonene synthetase gene into saccharomyces cerevisiae to obtain the recombinant saccharomyces cerevisiae for producing myrcene.

Geraniol synthase and limonene synthase are collectively referred to as myrcene synthase.

For example, the Saccharomyces cerevisiae is capable of accumulating geranyl diphosphate (GPP), a precursor for myrcene synthesis.

Alternatively, according to the above-mentioned construction method, the geraniol synthase gene is derived from basil and/or perilla; the limonene synthetase gene is derived from wenzhou mandarin orange.

Alternatively, according to the above-described construction method, the amino acid sequence of the geraniol synthase encoded by the geraniol synthase gene is represented by SEQ ID nos. 10 and/or 11; the amino acid sequence of the limonene synthetase encoded by the limonene synthetase gene is shown as SEQ ID No. 12.

The nucleotide sequence of the geraniol synthase gene can be shown as the 777-2414 site of SEQ ID No.6 and/or the 777-2381 site of SEQ ID No. 7; the nucleotide sequence of the limonene synthetase gene can be shown in the 777-2444 position of SEQ ID No. 8.

Optionally, according to the above construction method, the saccharomyces cerevisiae is a bacterium obtained by increasing the content and/or activity of farnesyl pyrophosphate synthetase ERG20, 3-hydroxy-3-methylglutaryl coenzyme AtHMG1, acetyl coenzyme A acyltransferase mvaE, HMG-CoA synthetase mvaS-m, isopentenyl pyrophosphate isomerase IDI1, mevalonate kinase ERG12, MVAP kinase ERG8 and/or MVAPP decarboxylase ERG19, and/or reducing the expression of galactose regulatory gene Gal80 gene in the starting saccharomyces cerevisiae. For example, increasing the enzyme content and/or activity is achieved by increasing the copy number of the corresponding enzyme gene of the starting s.cerevisiae and decreasing the expression of the Gal80 gene is achieved by knocking out the Gal80 gene of the starting s.cerevisiae.

Optionally, the starting saccharomyces cerevisiae is TIB H1, and the registration number of the starting saccharomyces cerevisiae in the common microorganism center of the china committee for culture collection of microorganisms is CGMCC No. 21000.

Optionally, the construction method includes: and (3) carrying out at least one of the following improvements on the starting saccharomyces cerevisiae to obtain the saccharomyces cerevisiae: a1, introduction of farnesyl pyrophosphate synthetase gene 96-position and 127-position double-point mutant gene ERG20^F96W/N127WA gene; a2, introduction of tHMG1 gene; a3, introducing mvaE gene; a4, introducing mvaS-m gene; a5, introduction of IDI1 gene; a6, introduction of ERG12 gene; a7, introduction of ERG8 gene; a8, introduction of ERG19 gene; a9, knock-out Gal80 gene.

Optionally, the ERG20^F96W/N127WGene encoded ERG20^F96W/N127wThe sequence of the protein is shown as SEQ ID No. 13; and/or the sequence of the tHMG1 protein coded by the tHMG1 gene is genbank accession number: the AJS96703.1 sequence is indicated at bits 530-; and/or, the sequence of the mvaE protein coded by the mvaE gene is shown in genbank accession number AAG 02439.1; and/orThe sequence of mvaS-m protein coded by the mvaS-m gene is shown by replacing 110 th alanine of genbank login number AAG02438.1 with glycine; and/or the IDI1 protein coded by the IDI1 gene has a sequence of genbank accession number: NP-015208.1 sequence; and/or the sequence of the ERG12 protein coded by the ERG12 gene is genbank accession number: NP-013935.1 sequence; and/or the sequence of the ERG8 protein coded by the ERG8 gene is genbank accession number: NP-013947.1 sequence; and/or the sequence of the ERG19 protein coded by the ERG19 gene is genbank accession number: NP-014441.1 sequence.

Optionally, the ERG20^F96W/N127WThe gene sequence is shown as the 722-1780 site of SEQ ID No. 1; and/or the sequence of the tHMG1 gene is shown as the 800-2383 position of SEQ ID No. 2; and/or the mvaE gene sequence is shown as the reverse complement of the 270 th and 2681 th positions of SEQ ID No. 3; and/or the sequence of the mvaS-m gene is shown as the 3358-4509 site of SEQ ID No. 3; and/or the IDI1 gene sequence is shown as the reverse complement of the 270-position and 1136-position of SEQ ID No. 4; and/or the ERG12 gene sequence is shown as the 1813-3144 position of SEQ ID No. 4; and/or, the ERG8 gene sequence is shown as the reverse complement of 333-1688 bit of SEQ ID No. 5; and/or the ERG19 gene sequence is shown in the 2365-3555 site of SEQ ID No. 5.

Optionally, according to the above construction method, the introducing of the geraniol synthase gene and/or the limonene synthase gene into the starting saccharomyces cerevisiae is realized by introducing a geraniol synthase gene expression cassette and/or a limonene synthase gene expression cassette into the starting saccharomyces cerevisiae; and/or, the A1 is obtained by introducing ERG20 into the starting Saccharomyces cerevisiae^F96W/N127WGene expression cassette implementation; and/or, said A2 is realized by introducing tHMG1 gene expression cassette into said Saccharomyces cerevisiae; and/or, said a3 is achieved by introducing mvaE gene expression cassettes into said starting saccharomyces cerevisiae; and/or, the A4 is realized by introducing mvaS-m gene expression cassettes into the starting saccharomyces cerevisiae; and/or, said A5 is achieved by introducing IDI1 gene expression cassette into said s.cerevisiae; and/or, the A6 is realized by introducing an ERG12 gene expression cassette into the saccharomyces cerevisiae; and/or the presence of a gas in the gas,the A7 is realized by introducing an ERG8 gene expression cassette into the saccharomyces cerevisiae; and/or, the A8 is realized by introducing an ERG19 gene expression cassette into the saccharomyces cerevisiae; and/or, the A9 is realized by knocking out Gal80 gene in the starting saccharomyces cerevisiae through a CRISPR/CAS9 system.

Optionally, according to the above construction method, the geraniol synthase gene expression cassette and/or the limonene synthase gene expression cassette comprises a promoter, the geraniol synthase gene and/or the limonene synthase gene and a terminator, wherein the promoter is Gal 2; the terminator is CYC 1. For example, the sequence of the geraniol synthase gene expression cassette is shown as 72-2633 of SEQ ID No.6 or 72-2600 of SEQ ID No.7, and the sequence of the limonene synthase gene expression cassette is shown as 72-2663 of SEQ ID No. 8.

Optionally, the ERG20 is constructed according to the method^F96W/N127WThe sequence of the gene expression cassette is shown as 54 th-2141 th site of SEQ ID No. 1; and/or the sequence of the tHMG1 gene expression cassette is shown as 75-2769 of SEQ ID No. 2; and/or the sequence of the mvaE gene expression cassette is shown as the reverse complement of 78 th to 3357 th site of SEQ ID No. 3; and/or the sequence of the mvaS-m gene expression cassette is shown as the 2682-4728 site of SEQ ID No. 3; and/or the IDI1 gene expression cassette sequence is shown as the reverse complement of the 69 th to the 1812 nd positions of SEQ ID No. 4; and/or, the ERG12 gene expression cassette sequence is shown as 1137-3256 of SEQ ID No. 4; and/or the sequence of the ERG8 gene expression cassette is shown as the reverse complement of 74 th to 2364 th positions of SEQ ID No. 5; and/or, the sequence of the ERG19 gene expression cassette is shown as the 1689-3774 site of SEQ ID No. 5.

Specifically, the Gal80 gene in the starting saccharomyces cerevisiae is knocked out by the CRISPR/CAS9 system, namely a CAS9 gene, a gRNA gene and a Gal80 homologous recombination fragment are introduced into the starting saccharomyces cerevisiae, and the CAS9 gene and the gRNA gene are expressed. The gRNA gene encodes a gRNA fragment that targets the Gal80 gene. The homologous recombination fragment of Gal80 can be represented by SEQ ID No.9, for example.

The recombinant saccharomyces cerevisiae constructed by the construction method also belongs to the protection scope of the invention.

It is another object of the present invention to provide a method for producing myrcene.

The invention provides a method for producing myrcene, which comprises the step of culturing the recombinant saccharomyces cerevisiae to obtain a fermentation product, namely myrcene.

The invention also provides any one of the following applications, namely the application of X1 and the construction method in the preparation and production of myrcene products; x2, the use of the above-described method of construction for the production of myrcene; x3, the application of the recombinant saccharomyces cerevisiae in preparing myrcene products; x4, the application of the recombinant saccharomyces cerevisiae in the production of myrcene; the application of X5, geraniol synthase gene or limonene synthase gene in preparing myrcene products; the use of X6, a geraniol synthase gene or a limonene synthase gene for the production of myrcene; the application of X7, geraniol synthase or limonene synthase in preparing myrcene products; use of X8, a geraniol synthase or a limonene synthase for the production of myrcene.

Optionally, in the above application, the geraniol synthase gene is derived from basil and/or perilla; the limonene synthetase gene is derived from wenzhou mandarin orange. For example, the amino acid sequence of the geraniol synthase encoded by the geraniol synthase gene is shown as SEQ ID No.10 and/or SEQ ID No. 11; the amino acid sequence of the limonene synthetase encoded by the limonene synthetase gene is shown as SEQ ID No. 12. As another example, the nucleotide sequence of the geraniol synthase gene can be shown as position 777-2414 of SEQ ID No.6 and/or as position 777-2381 of SEQ ID No. 7; the nucleotide sequence of the limonene synthetase gene can be shown in the 777-2444 position of SEQ ID No. 8.

Myrcene is an aromatic hydrocarbon, an important constituent of many different plant essential oils, and is a monoterpene substance. In the embodiment of the invention, a MVA approach in the saccharomyces cerevisiae is strengthened and geraniol synthase genes or limonene synthase genes are introduced to construct the recombinant saccharomyces cerevisiae for producing myrcene; the screening of the geraniol synthetase and the limonene synthetase can improve the yield of the recombined saccharomyces cerevisiae myrcene; provides a powerful strain and a research foundation for the biosynthesis of myrcene, and has important significance for the excavation of high-activity myrcene synthase.

Deposit description

The strain name is as follows: saccharomyces cerevisiae

Latin name: saccharomyces cerevisiae

The strain number is as follows: TIB H1

The preservation organization: china general microbiological culture Collection center

The preservation organization is abbreviated as: CGMCC (China general microbiological culture Collection center)

Address: xilu No.1 Hospital No.3 of Beijing market facing Yang district

The preservation date is as follows: 11/2020/11/04

Registration number of the preservation center: CGMCC No.21000

Drawings

FIG. 1 shows the myrcene yield of the engineering bacteria of example 3.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The data were processed using SPSS11.5 statistical software and the experimental results are presented as mean values.

Saccharomyces cerevisiae TIB H1, which has been deposited in China general microbiological culture Collection center (CGMCC, No.3 of West Lu 1 of Beijing, Naja, China academy of sciences, institute of microbiology) at 04.11.2020, has been deposited with the accession number of CGMCC No. 21000.

YPD medium comprising per L volume of YPD medium: 20g of peptone, 10g of yeast extract, 20g of glucose, 20g of agar powder (YPD solid medium supplement)

SD plates without uracil addition: SD medium without uracil addition per L volume contained: 8g Ura minus meida (Beijing Pankeno technologies, Ltd.), 20g agar powder, 20g glucose.

SD plates containing 5-fluoroorotic acid, SD containing 5-fluoroorotic acid per L volume contained: 8g Ura minus meida (Beijing Pankeno science and technology Co., Ltd.), 20g of agar powder, 20g of glucose, 60mg of uracil and 1g of 5-fluoroorotic acid.

Delft liquid medium, per L volume Delft liquid medium contains: 20g of glucose, 7.5g of ammonium sulfate, 0.5g of magnesium sulfate heptahydrate, 14.4g of potassium dihydrogen phosphate, 2ml of a trace metal salt mother liquor (3.0 g of iron sulfate heptahydrate, 4.5g of zinc sulfate heptahydrate, 4.5g of calcium chloride dihydrate, 0.84g of manganese chloride dihydrate, 0.3g of cobalt chloride hexahydrate, 0.3g of copper sulfate pentahydrate, 0.4g of sodium molybdate dihydrate, 1.0g of boric acid, 0.1g of potassium iodide, 19.0g of disodium ethylenediaminetetraacetate), 1ml of a vitamin mother liquor (0.05 g D-biotin, 1.0g of 1. 1.0g D-pantothenic acid, 1.0g of vitamin B1, 1.0g of pyridoxine, 1.0g of nicotinic acid, 0.2g of 4-aminobenzoic acid, 25.0g of inositol, 60mg of uracil in 1L volume).

The information on the gene fragments and protein sequences in the examples below is given in the following table.

Information related to gene fragment and protein sequence

Protein-related information

Example 1 preparation of target Gene

1. Acquisition of genes involved in MVA pathway modification

ERG20^F96W-N127W-T_ERG20、tHMG-T_hmgl、IDI1-T_IDI1、ERG8-T_ERG8、ERG12-T_ERG12、ERG19-T_ERG19Genes and the acquisition of Gal1, Gal2, Gal7, Gal10 promoter, ADH, CYC1 terminator, Gal80 upstream segment and Gal80 downstream segment.

Extracting yeast genome DNA as template, amplifying by using primer required by gene amplification in Table 1 to obtain segment with expected size

The PrimSTAR HS DNA polymerase was used to prepare an amplification system (TAKARA) which was: 5 XPS Buffer10 uL, Dntp Mix 4 uL, primer 1 uL each, genomic DNA template 1 uL, HS polymerase (2.5U/> L)0.5 uL, and distilled water to total volume of 50 uL. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 2.5 minutes (30 cycles); extension at 72 ℃ for 10 min (1 cycle).

Table 1 shows the primer sequences

2. Myrcene synthase and acquisition of mvaS-m and mvaE genes

Geraniol synthase and limonene synthase are collectively referred to as myrcene synthase.

The Suzhou Jinzhi Biotechnology Ltd respectively constructs plasmids containing the genes according to GerS _ Pc (geraniol synthase, from Perilla Perilla citriodora), GerS _ Ob (geraniol synthase, from basil Ocimum basilicum), LS _ Cu (limonene synthase, from Citrus unshiu), mvaE (Enterococcus enterobacter) and mvaS-m (Enterococcus) codon-optimized gene sequences through artificial synthesis, and then the double-stranded DNAs are transformed and cloned into a cloning vector pET28a (Suzhou Jinzhi Biotechnology Ltd).

The plasmids are used as templates, primers required by gene amplification in the table 2 are used for amplification, fragments with expected sizes are obtained, and products are recovered and stored through rubber tapping. Thereby obtaining GerS _ Pc gene, GerS _ Ob gene, LS _ Cu gene andmvaEgenes andmvaS-ma gene.

Table 2 shows the primer sequences

3、P_Gal1-ERG20^F96W-N127W-T_Eer20Construction of expression elements

The fragment P obtained above was subjected to the Overlap PCR technique_Gal1，ERG20^F96W-N127W-T_Eer20Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer 10. mu.L, Dntp Mix 4. mu.L, primer P_Gal1mu.L of each of-f and TErg20-r, 1. mu.L of genomic DNA template (P)_Gal1，ERG20^F96W-N127W-T_Eer20The addition molar ratio of each fragment is 1: 1) 0.5. mu.L HS polymerase (2.5U/. mu.L), and distilled water was added thereto to make the total volume 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extension at 72 ℃ for 10 min (1 cycle) and the product recovered by tapping. Obtaining P_Gal1-ERG20^F96W-N127W-T_Eer20An expression element. P_Gal1-ERG20^F96W-N127W-T_Eer20The expression element contains ERG20^F96W-N12TWExpression cassette expressing ERG20^F96W-N127wThe gene, the expression product of which is ERG20^F96W-N127wA protein.

4、P_Gal7-tHMG1-T_hmg1Construction of expression elements

The fragment P obtained above was subjected to the Overlap PCR technique_Gal7，tHMG1-T_hmmg1Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer10 uL, Dntp Mix 4 uL, primer P_aal7mu.L of each of-f and Thmg1-r, 1. mu.L of genomic DNA template (P)_Gal7，tHMG-T_hmg1The molar ratio of each fragment was 1: 1), HS polymerase (2.5U/. mu.L) 0.5. mu.L, and distilled water was added to a total volume of 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain P_Gal7-tHMG1-T_hmg1An expression element. P_Gal7-tHMG1-T_hmg1The expression element contains a tHMG1 expression cassette which expresses a tHMG1 gene, and the expression product is tHMG1 protein.

4、T_ADH-mvaE-P_GAL1-P_GAL10-mvaS-m-T_CYC1Construction of expression elements

The fragment T obtained above was subjected to the Overlap PCR technique_ADH，mvaE，P_GAL1，P_GAL10，mvaS-m，T_CYC1Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer 10. mu.L, Dntp Mix 4. mu.L, primer T_ADH1-rAnd T_CYC1-rmu.L each, 1. mu.L of genomic DNA template (T)_ADH，mvaE，P_GAL1，P_GAL10，mvaS-m，T_CYC1The molar ratio of each fragment was 1: 3: 5: 3: 1), HS polymerase (2.5U/. mu.L) 0.5. mu.L, and distilled water was added thereto to make the total volume 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 6 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain T_ADH-mvaE-P_GAL1-P_GAL10-mvaS-m-T_CYC1An expression element.T_ADH-mvaE-P_GAL1-P_GAL10-mvaS-m-T_CYC1The expression element contains mvaE expression box and mvaS-m expression box. The mvaE expression box expresses mvaE genes, and the expression product is mvaE protein. The mvaS-m expression box expresses mvaS-m gene, and the expression product is mvaS-m protein.

5、T_IDI1-IDI1-P_GAL1-P_GAL10-ERG12-T_ERG12Construction of expression elements

The fragment IDI1-T obtained above was subjected to the Overlap PCR technique_IDI1，P_GAL1，P_GAL10，ERG12-T_ERG12Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer 10. mu.L, Dntp Mix 4. mu.L, primer T_IDI1-rAnd T_ERG20-rmu.L each, 1. mu.L of genomic DNA template (IDI 1-T)_IDI1，P_GAL1，P_GAL10，ERG12-T_ERG12The molar ratio of each fragment was 1: 3: 1), HS polymerase (2.5U/. mu.L) 0.5. mu.L, and distilled water was added to make the total volume 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 6 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain T_IDI1-IDI1-P_GAL1-P_GAL10-ERG12--T_ERG12An expression element. T is_IDI1-IDI1-P_GAL1-P_GAL10-ERG12-T_ERG12The expression element contains IDl1 expression cassette and ERG12 expression cassette. The IDI1 expression cassette expresses IDI1 gene, and the expression product is IDI1 protein. The ERG12 expression cassette expresses ERG12 gene and the expression product is ERG12 protein.

6、T_ERG8-ERG8-P_GAL1-P_GAL10-ERG19-T_ERG19Construction of expression elements

The fragment ERG8-T obtained above was subjected to the Overlap PCR technique_ERG8，P_Gal1，P_Gal10，ERG19-T_ERG19Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer 10. mu.L, Dntp Mix 4. mu.L, primer T_ERG8-rAnd T _CYC1-r1 μ L each, genomeDNA template 1. mu.L (ERG 8-T)_ERG8，P_GAL1，P_GAL10，ERG19-T_ERG19The molar ratio of each fragment was 1: 3: 1), HS polymerase (2.5U/. mu.L) 0.5. mu.L, and distilled water was added to make the total volume 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 6 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain T_ERG8-ERG8-P_GAL1-P_GAL10-ERG19-T_erg19An expression element. T is_ERG8-ERG8-P_GAL1-P_GAL10-ERG19-T_erg19The expression element contains an ERG8 expression cassette and an ERG19 expression cassette. The ERG8 expression cassette expresses ERG8 gene and the expression product is ERG8 protein. The ERG19 expression cassette expresses ERG19 gene and the expression product is ERG19 protein.

P_Gal2-GerS_Pc-T_cyc1Construction of expression elements

The fragment P obtained above was subjected to the Overlap PCR technique_Gal2，GerS_Pc，T_cyc1Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer10 uL, Dntp Mix 4 uL, primers PGa12-f and TCYC1-r each 1 uL, genomic DNA template 1 uL (P)_Gal2GerS _ Pc, Tcyc1 at a molar ratio of 1: 3: 1), HS polymerase (2.5U/> L) 0.5. mu.L, and distilled water was added to a total volume of 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain P_Gal2-GerS_Pc-T_cyc1An expression element. P_Gal2-GerS_Pc-T_cyc1The expression element contains a GerS _ Pc expression cassette, expresses a GerS _ Pc gene and takes the expression product as GerS _ Pc protein.

7、P_Gal2-GerS_Ob-T_cyc1Construction of expression elements

The fragment P obtained above was subjected to the Overlap PCR technique_Gal2，GerS_Ob，T_cyc1Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 times the PS Buffer10 mu L,dntp Mix 4. mu.L, primers PGal2-f and TCYC1-r each 1. mu.L, genomic DNA template 1. mu.L (P)_Gal2GerS _ Ob, Tcyc1 at a 1: 3: 1 molar ratio of fragments), HS polymerase (2.5U/. mu.L) 0.5. mu.L, and distilled water was added to make a total volume of 50. mu.L. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain P_Gal2-GerS_Ob-T_cyc1An expression element. P_Gal2-GerS_Ob-T_cyc1The expression element contains GerS _ Ob expression box to express GerS _ Ob gene, and the expression product is GerS _ Ob protein.

8、P_Gal2-LS_Cu-T_cyc1Construction of expression elements

The fragment P obtained above was subjected to the Overlap PCR technique_Gal2，LS_Cu，T_cyc1Ligation amplification was performed using PrimSTAR HS DNA polymerase with an amplification system (TAKARA) of: 5 XPS Buffer10 uL, Dntp Mix 4 uL, primers PGal2-f and TCYC1-r each 1 uL, genomic DNA template 1 uL (PGal2, LS _ Cu, Tcyc1 each fragment molar ratio 1: 3: 1), HS polymerase (2.5U/. mu.L) 0.5 uL, and distilled water was added to make the total volume 50 uL. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product by tapping to obtain P_Gal2-LS_Cu-T_cyclAn expression element. P_Gal2-LS_Cu-T_cyc1The expression element contains an LS _ Cu expression cassette, expresses an LS _ Cu gene and produces an LS _ Cu protein.

9. Construction of the homologous recombination fragment of Gal80

The fragment Gal80 upstream fragment and Ga180 downstream fragment obtained above were amplified by ligation using the Overlap PCR technique, using PrimSTA HS DNA polymerase configured amplification system (TAKARA) as follows: 5 XPS Buffer10 uL, Dntp Mix 4 uL, primers Gal80-up-f and Gal80-down-r each 1 uL, genomic DNA template 1 uL (Gal80 upstream fragment: Gal80 downstream fragment molar ratio 1: 1), HS polymerase (2.5U/. mu.L) 0.5 uL, and distilled water was added to make the total volume 50 uL. The amplification conditions were: pre-denaturation at 98 ℃ for 3min (1 cycle); denaturation at 98 ℃ for 10 seconds, annealing at 55 ℃ for 5 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); and (3) extending for 10 minutes at 72 ℃ (1 cycle), and recovering and storing the product through tapping to obtain a Gal80 homologous recombination fragment for knocking out the Gal80 gene.

Example 2 construction of recombinant bacterium

1. Preparation of Yeast competence

Starting single colonies were grown overnight at 250rpm in YPD medium at 30 ℃ and the cell density of the overnight cultures was counted to the final OD_600nmCells were inoculated at 0.1 turbidity to 20ml YPD medium. Culturing at 30 ℃ and 250rpm to OD_600nm0.8. Cells were collected by centrifugation at 2500rpm for 5 minutes in a sterile centrifuge tube. The culture medium was discarded, and the cells were suspended in sterile water and centrifuged as above. Discarding water, suspending the cells in 1mL of 100mM lithium acetate, and transferring the suspension to a sterile centrifuge tube; precipitating cells at high speed for a short time, and removing lithium acetate; the cells were suspended in a 4-fold system of 100mM lithium acetate and dispensed to obtain competent cells.

The following recombinant bacteria are constructed according to the principle that an expression element capable of expressing Cas9 protein is transferred into a strain TIB H1 in advance, then a recombinant plasmid (plasmid 1-6) for expressing gRNA and the expression element or a homologous recombination fragment are transformed into the strain together, the recombinant plasmid for expressing the gRNA recognizes and combines a specific PAM region of a corresponding site, and simultaneously activates and guides the Cas9 protein to perform a shearing function, so that double-stranded DNA of the corresponding site is broken, and at the moment, the expression element or the homologous recombination fragment containing a homologous region is integrated into the DNA of the strain through homologous recombination repair.

2. Construction of recombinant plasmid containing gRNA

Construction of plasmid pBGR: amplifying a fragment 1 containing a fragment AmpR expression frame and an ori fragment by using a pET32a vector as a template and using a primer 1 and a primer 3, and amplifying a fragment Ura3 expression cassette by using a saccharomyces cerevisiae TIB H1 genome as a template and using a primer 8 and a primer 9; amplifying gRNA expression frame 1 by using primer 4 and primer 5, amplifying gRNA expression frame 2 by using primer 10 and primer 11, amplifying 2 mu ori by using primer 6 and primer 7, and obtaining fragment 2 by using overlap PCR by using gRNA expression frame 1, gRNA expression frame 2, 2 mu ori fragment as templates by using primer 4 and primer 10 by using P426-SNR52P-gRNA.CAN1.Y-SUP4t (DiCarlo JE, Norville JE, Mali P, et al. genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. nucleic Acids Res2013 b; 41: 4336-43); fragment 1 and fragment 2 were recombined in vitro using the Cloneexpress II kit (Novozam), transformed into DH 5. alpha. competent cells, and amplified to extract a plasmid, thereby obtaining plasmid pBGR.

Plasmid 1: plasmid 1 was obtained by recombining gene fragments gRNA1 and pBGR-2 obtained above by using plasmid pBGR as a template, primers gRNA1-f and gRNA1-r to amplify gene fragment gRNA1, and primers pBGR-2-f to amplify gene fragment pBGR-2, and Cloneexpress II kit (Novozan). Plasmid 1 expresses gRNA1 with a target sequence of tgaaactctaatcctactat, tagaaacgcggacacaggag.

Plasmid 2: plasmid 2 was obtained by using pBGR as a template, amplifying gene fragment gRNA2 with primer gRNA2-f, amplifying gene fragment pBGR-2 with primer pBGR-2-f, and recombining gene fragments gRNA2 and pBGR-2 obtained above with Cloneexpress II kit (Novozam). Plasmid 2 expresses gRNA2 with a target sequence of gcaatgcgatgttagtttag.

Plasmid 3: plasmid 3 was obtained by using pBGR as a template, amplifying gene fragment gRNA3 with primer gRNA3-f, amplifying gene fragment pBGR-2 with primer pBGR-2-f, and recombining gene fragments gRNA3 and pBGR-2 obtained above with Cloneexpress II kit (Novozam). Plasmid 3 expresses gRNA3 with a target sequence of cgccattcaagagcagcaac.

Plasmid 4: the gene fragment gRNA4 was amplified using the primer gRNA4-f and the gene fragment pBGR-2-f using the primer pBGR as a template, and the gene fragments gRNA4 and pBGR-2 obtained above were recombined using Cloneexpress II kit (Novozam) to obtain plasmid 4. Plasmid 4 expresses gRNA4 with a target sequence of ttgtcacagtgtcacatcag.

Plasmid 5: plasmid 5 was obtained by using pBGR as a template, amplifying gene fragment gRNA5 with primer gRNA5-f, amplifying gene fragment pBGR-2 with primer pBGR-2-f, and recombining gene fragments gRNA5 and pBGR-2 obtained above with Cloneexpress II kit (Novozam). Plasmid 5 expresses gRNA5 with a target sequence of tggatgctctgatattacacagg.

Plasmid 6: the gene fragment gRNA6 was amplified using the primer gRNA6-f and the gene fragment pBGR-2-f using the primer pBGR as a template, and the gene fragments gRNA6 and pBGR-2 obtained above were recombined using Cloneexpress II kit (Novozam) to obtain plasmid 6. Plasmid 6 expresses gRNA6 with a target sequence of atatgtctctaattttggaa.

The primers used are shown in Table 3.

TABLE 3 primer sequences

3. Construction of GPP-1 Strain

After overnight culture of the developing saccharomyces cerevisiae TIB H1 in YPD liquid medium, competent cells were prepared and added in the following order: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) DNA (2mg/mL), 50 μ L water and gene (P)_Gal1-ERG20^F96W-N127W-T_Erg20Expression element, P_Gal7-tHMG1-T_hmmg1Expression element, plasmid 1); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu L of sterile water is sucked into a reaction tube, the sterile water is gently suspended and precipitated, an SD plate without uracil addition is coated, after bacterial colonies grow up, the bacterial colonies are selected to be placed on the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as GPP-1 and stored.

4. Construction of GPP-2 Strain

After the saccharomyces cerevisiae GPP-1 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (T)_ADH-mvaE-P_GAL1-P_GAL10-mvaS-m-T_CYc1Expression element, plasmid 2); oscillating vigorously until fineMixing completely, keeping the temperature at 30 deg.C for 30 min, and placing in 4 deg.C water bath for 20 min; centrifuging at 6000-; 100 mu L of sterile water is sucked into a reaction tube, the sterile water is gently suspended and precipitated, an SD plate without uracil addition is coated, after bacterial colonies grow up, the bacterial colonies are selected to be placed on the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as GPP-2 and stored.

5. Construction of GPP-3 Strain

After the saccharomyces cerevisiae GPP-2 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (T)_IDI1-IDI1-P_6AL1-P_GAL10-ERG12-T_ERG12Expression element, plasmid 3); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu L of sterile water is sucked into a reaction tube, the sterile water is gently suspended and precipitated, an SD plate without uracil addition is coated, after bacterial colonies grow up, the bacterial colonies are selected to be placed on the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as GPP-3 and are stored.

6. Construction of GPP-4 Strain

After the saccharomyces cerevisiae GPP-3 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (T)_ERG8-ERG8-P_GAL1-P_GAL10-ERG19-T_ERG19Expression element, plasmid 4); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu L of sterile water is sucked into a reaction tube, the sterile water is gently suspended and precipitated, an SD plate without uracil addition is coated, after bacterial colonies grow up, the bacterial colonies are selected to be placed on the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as GPP-4 and stored.

7. Construction of GPP-5 Strain

After the saccharomyces cerevisiae GPP-4 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (Gal80 homologous recombination fragment, plasmid 5); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu L of sterile water is sucked into a reaction tube, the sterile water is gently suspended and precipitated, an SD plate without uracil addition is coated, after bacterial colonies grow up, the bacterial colonies are selected to be placed on the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as GPP-5 and stored.

8. Construction of SLQ-1 Strain

After the saccharomyces cerevisiae GPP-5 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (P)_Gal2-GerS_Pc-T_cyc1Expression element, plasmid 6); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu.L of sterile water is sucked into a reaction tube, the sediment is gently suspended and coated with an SD plate without uracil addition, when bacterial colonies grow up, the bacterial colonies are picked and dropped into the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as SLQ-1 and stored.

9. Construction of SLQ-2 Strain

After the saccharomyces cerevisiae GPP-5 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (P)_Gal2-GerS_Ob-T_cyc1Expression element, plasmid 6); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu.L of sterile water is sucked into a reaction tube, the sediment is gently suspended and coated with an SD plate without uracil addition, when bacterial colonies grow up, the bacterial colonies are picked and dropped into the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as SLQ-2 and stored.

10. Construction of SLQ-3 Strain

After the saccharomyces cerevisiae GPP-5 which develops bacteria is cultured in a YPD liquid culture medium overnight, competent cells are prepared and added in the following sequence: 240 μ L PEG (50% w/v), 36 μ L1.0 mol/L lithium acetate, 25 μ L salmon sperm DNA (sigma) (2mg/mL), 50 μ L water and gene (P)_Gal2-LS_Cu-T_cyc1Expression element, plasmid 6); oscillating vigorously until the cells are completely mixed, preserving the heat at 30 ℃ for 30 minutes, and placing the mixture in a water bath at 4 ℃ for 20 minutes; centrifuging at 6000-; 100 mu.L of sterile water is sucked into a reaction tube, the sediment is gently suspended and coated with an SD plate without uracil addition, when bacterial colonies grow up, the bacterial colonies are picked and dropped into the SD plate containing 5-fluoroorotic acid, and the bacterial colonies growing up in the plate are named as SLQ-3 and stored.

Example 3 application of recombinant bacteria in myrcene production

1. Engineering bacteria culture and product extraction

Respectively activating the engineered yeast strains SLQ-1, SLQ-2 and SLQ-3 prepared in example 2 in a Delft liquid culture medium, preparing seed solutions (30 ℃, 250rpm, 16h) in the Delft liquid culture medium, inoculating 1% of the seed solutions into a 100mL triangular flask containing 20mL Dellft liquid culture medium and 2mL sec-butylbenzene n-dodecane, culturing for 2-3 days at 30 ℃ and 250rpm, finally, transferring the liquid in the triangular flask to a 50mL centrifuge tube, centrifuging at 5000rpm for 5min, and collecting organic phases for later use.

2. Qualitative and quantitative analysis of myrcene produced by thalli

And (3) diluting the organic phase substance collected in the step (1) by 50 times by using normal hexane, and detecting by using GC-MS. GC-MS measurement conditions: the injection port temperature is 260 ℃, the injection volume is 1 mu L, the flow is not divided, and the solvent is delayed for 3 min; a chromatographic column: HP-5ms (30m 0.25 mM); chromatographic conditions are as follows: keeping the temperature at 60 ℃, 3min, 40 ℃/min to 150 ℃, 20 ℃/min to 220 ℃, 40 ℃/min to 260 ℃ for 2 min; MS conditions: full Scan: 50-750 amu. Qualitative and quantitative determinations were made with a standard of myrcene (Beijing Runzukang Biotech, Inc., M812782). The retention time of the myrcene standard substance corresponding to the peak value of HPCL peak is 8.0min according to the parameters. The organic phase material collected in step 1 peaked at 8.0min, indicating that all the organic phase material collected in step 1 contains myrcene.

The results are shown in FIG. 1, and the yield of each engineering bacterium is as follows when fermented for 3 days:

the yields of myrcene in SLQ-1, SLQ-2 and SLQ-3 were 21.7mg/L, 56.9mg/L and 17.3mg/L, respectively (relative to the fermentation broth).

This example demonstrates that myrcene synthase gene expression in Saccharomyces cerevisiae can produce myrcene; myrcene synthase genes with different host sources are adopted, and the yield of myrcene is different. Compared with the SLQ-1, SLQ-2 and SLQ-3 yields, the yield was the highest using a myrcene synthase gene (GerS Ob gene) derived from Ocimum basilicum after codon optimization.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> recombinant saccharomyces cerevisiae and construction method and application thereof

<130> 212192

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2224

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ataaggttta aaggcactga aacaataggc aagaagtagg cgagagccga catttatatt 60

gaattttcaa aaattcttac tttttttttg gatggacgca aagaagttta ataatcatat 120

tacatggcat taccaccata tacatatcca tatctaatct tacttatatg ttgtggaaat 180

gtaaagagcc ccattatctt agcctaaaaa aaccttctct ttggaacttt cagtaatacg 240

cttaactgct cattgctata ttgaagtacg gattagaagc cgccgagcgg gcgacagccc 300

tccgacggaa gactctcctc cgtgcgtcct cgtcttcacc ggtcgcgttc ctgaaacgca 360

gatgtgcctc gcgccgcact gctccgaaca ataaagattc tacaatacta gcttttatgg 420

ttatgaagag gaaaaattgg cagtaacctg gccccacaaa ccttcaaatt aacgaatcaa 480

attaacaacc ataggatgat aatgcgatta gttttttagc cttatttctg gggtaattaa 540

tcagcgaagc gatgattttt gatctattaa cagatatata aatggaaaag ctgcataacc 600

actttaacta atactttcaa cattttcagt ttgtattact tcttattcaa atgtcataaa 660

agtatcaaca aaaaattgtt aatatacctc tatactttaa cgtcaaggag aaaaaactat 720

aatggcttca gaaaaagaaa ttaggagaga gagattcttg aacgttttcc ctaaattagt 780

agaggaattg aacgcatcgc ttttggctta cggtatgcct aaggaagcat gtgactggta 840

tgcccactca ttgaactaca acactccagg cggtaagcta aatagaggtt tgtccgttgt 900

ggacacgtat gctattctct ccaacaagac cgttgaacaa ttggggcaag aagaatacga 960

aaaggttgcc attctaggtt ggtgcattga gttgttgcag gcttactggt tggtcgccga 1020

tgatatgatg gacaagtcca ttaccagaag aggccaacca tgttggtaca aggttcctga 1080

agttggggaa attgccatct gggacgcatt catgttagag gctgctatct acaagctttt 1140

gaaatctcac ttcagaaacg aaaaatacta catagatatc accgaattgt tccatgaggt 1200

caccttccaa accgaattgg gccaattgat ggacttaatc actgcacctg aagacaaagt 1260

cgacttgagt aagttctccc taaagaagca ctccttcata gttactttca agactgctta 1320

ctattctttc tacttgcctg tcgcattggc catgtacgtt gccggtatca cggatgaaaa 1380

ggatttgaaa caagccagag atgtcttgat tccattgggt gaatacttcc aaattcaaga 1440

tgactactta gactgcttcg gtaccccaga acagatcggt aagatcggta cagatatcca 1500

agataacaaa tgttcttggg taatcaacaa ggcattggaa cttgcttccg cagaacaaag 1560

aaagacttta gacgaaaatt acggtaagaa ggactcagtc gcagaagcca aatgcaaaaa 1620

gattttcaat gacttgaaaa ttgaacagct ataccacgaa tatgaagagt ctattgccaa 1680

ggatttgaag gccaaaattt ctcaggtcga tgagtctcgt ggcttcaaag ctgatgtctt 1740

aactgcgttc ttgaacaaag tttacaagag aagcaaatag aactaacgct aatcgataaa 1800

acattagatt tcaaactaga taaggaccat gtataagaac tatatacttc caatataata 1860

tagtataagc tttaagatag tatctctcga tctaccgttc cacgtgacta gtccaaggat 1920

tttttttaag ccaatgaaaa tgaagaaatg cgtgatcgga aattacgggt agtacgagaa 1980

ggaaacttga gccacccccc aaattttatt catataataa taggaaaagc aacgacctca 2040

tctctcgaac attgtttact tgagcaagtc cgattaagag taagttgtcg tacgttaaat 2100

acaaataatc aacaaaacac tacacaaaaa cttctacgat acacttttca atgaaacgga 2160

tattgatatg ctagtaaaag gacgagctca agagcgaaaa tataagtaaa gaattcgagt 2220

gcac 2224

<210> 2

<211> 2839

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aatctgtaac aagcgccatt tttttttctg tatcgggccc tccttactgc tctccttccg 60

tgtaacgcgt tatgtttgcc agcttactat ccttcttgaa aatatgcact ctatatcttt 120

tagttcttaa ttgcaacaca tagatttgct gtataacgaa ttttatgcta ttttttaaat 180

ttggagttca gtgataaaag tgtcacagcg aatttcctca catgtaggga ccgaattgtt 240

tacaagttct ctgtaccacc atggagacat caaaaattga aaatctatgg aaagatatgg 300

acggtagcaa caagaatata gcacgagccg cggagttcat ttcgttactt ttgatatcac 360

tcacaactat tgcgaagcgc ttcagtgaaa aaatcataag gaaaagttgt aaatattatt 420

ggtagtattc gtttggtaaa gtagaggggg taatttttcc cctttatttt gttcatacat 480

tcttaaattg ctttgcctct ccttttggaa agctatactt cggagcactg ttgagcgaag 540

gctcattaga tatattttct gtcattttcc ttaacccaaa aataagggaa agggtccaaa 600

aagcgctcgg acaactgttg accgtgatcc gaaggactgg ctatacagtg ttcacaaaat 660

agccaagctg aaaataatgt gtagctatgt tcagttagtt tggctagcaa agatataaaa 720

gcaggtcgga aatatttatg ggcattatta tgcagagcat caacatgata aaaaaaaaca 780

gttgaatatt ccctcaaaaa tggctgcaga ccaattggtg aaaactgaag tcaccaagaa 840

gtcttttact gctcctgtac aaaaggcttc tacaccagtt ttaaccaata aaacagtcat 900

ttctggatcg aaagtcaaaa gtttatcatc tgcgcaatcg agctcatcag gaccttcatc 960

atctagtgag gaagatgatt cccgcgatat tgaaagcttg gataagaaaa tacgtccttt 1020

agaagaatta gaagcattat taagtagtgg aaatacaaaa caattgaaga acaaagaggt 1080

cgctgccttg gttattcacg gtaagttacc tttgtacgct ttggagaaaa aattaggtga 1140

tactacgaga gcggttgcgg tacgtaggaa ggctctttca attttggcag aagctcctgt 1200

attagcatct gatcgtttac catataaaaa ttatgactac gaccgcgtat ttggcgcttg 1260

ttgtgaaaat gttataggtt acatgccttt gcccgttggt gttataggcc ccttggttat 1320

cgatggtaca tcttatcata taccaatggc aactacagag ggttgtttgg tagcttctgc 1380

catgcgtggc tgtaaggcaa tcaatgctgg cggtggtgca acaactgttt taactaagga 1440

tggtatgaca agaggcccag tagtccgttt cccaactttg aaaagatctg gtgcctgtaa 1500

gatatggtta gactcagaag agggacaaaa cgcaattaaa aaagctttta actctacatc 1560

aagatttgca cgtctgcaac atattcaaac ttgtctagca ggagatttac tcttcatgag 1620

atttagaaca actactggtg acgcaatggg tatgaatatg atttctaaag gtgtcgaata 1680

ctcattaaag caaatggtag aagagtatgg ctgggaagat atggaggttg tctccgtttc 1740

tggtaactac tgtaccgaca aaaaaccagc tgccatcaac tggatcgaag gtcgtggtaa 1800

gagtgtcgtc gcagaagcta ctattcctgg tgatgttgtc agaaaagtgt taaaaagtga 1860

tgtttccgca ttggttgagt tgaacattgc taagaatttg gttggatctg caatggctgg 1920

gtctgttggt ggatttaacg cacatgcagc taatttagtg acagctgttt tcttggcatt 1980

aggacaagat cctgcacaaa atgttgaaag ttccaactgt ataacattga tgaaagaagt 2040

ggacggtgat ttgagaattt ccgtatccat gccatccatc gaagtaggta ccatcggtgg 2100

tggtactgtt ctagaaccac aaggtgccat gttggactta ttaggtgtaa gaggcccgca 2160

tgctaccgct cctggtacca acgcacgtca attagcaaga atagttgcct gtgccgtctt 2220

ggcaggtgaa ttatccttat gtgctgccct agcagccggc catttggttc aaagtcatat 2280

gacccacaac aggaaacctg ctgaaccaac aaaacctaac aatttggacg ccactgatat 2340

aaatcgtttg aaagatgggt ccgtcacctg cattaaatcc taaacttagt catacgtcat 2400

tggtattctc ttgaaaaaga agcacaacag caccatgtgt tacgtaaaat atttacttta 2460

tagtttgtac gtcataattt cttccatatt acaagttcgt gcatatatag aaagaattct 2520

gttgttgtaa ttgtcataac tattgagctt tacctgaaaa ttcaacgaaa aaaactcaaa 2580

aaccacatgc ttctcttgag tcatgcggtt cctttccctt atgagtgaaa atcttccttt 2640

tttagctatg tgcgccatcc gataaatgta ggagcaatga agcggaaagt caattttttc 2700

atacagtata cattaatatc tagtgtgtat tgactgtgat cgggaagatc ttcagggttg 2760

aattacaact cggcgactct ctcgaaattt ttcttaacgc gtccttgtac tgcgtctaac 2820

gcttttgcca cttggattt 2839

<210> 3

<211> 4779

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccgtgcaccg catcaaactt tctcggagga ttctttgcac cggttttcat tttcttccac 60

ggaataccaa gcccattcat gccggtagag gtgtggtcaa taagagcgac ctcatgctat 120

acctgagaaa gcaacctgac ctacaggaaa gagttactca agaataagaa ttttcgtttt 180

aaaacctaag agtcacttta aaatttgtat acacttattt tttttataac ttatttaata 240

ataaaaatca taaatcataa gaaattcgct cactgctttc taagatcgtt aagaattgca 300

agtgctctat cttggttcat tgtcttctgt cgcttaagtt gctgggccac ggcctcgact 360

tctttcccag tcgctcccac ggtcatagca agtgatcttg cttgaagtgc catgtgaccc 420

ttttgaatac cttctgaaac aagtgctcta agtgctgcca aattctgtgc aagtccaact 480

gctgcaacaa ctcttgaaag ttcctttgca tctgtaactg caagaagatc tgctgctgct 540

tgtgatttag gtagtacctt tgttgctcct ccaactgttg caagtgcaag aggaactgaa 600

atttctccaa taagttgttc tccatcaagt gtccatgatg taagtccttg atatcttcct 660

tctttaactg caaatgcatg acatgatgct gaaactgctc ttgtatcgtt tcctgttgcg 720

agtacgacgg cctctattcc gttcataatt cctttgttat gtgtaactgc tctataagga 780

tcaagtgatg catatcttga tgcaagcacg atcttctctg caatttctct tccgttagaa 840

ccctttgaaa gtcttgaaac aggaatggcc gtcttcattg taacaactga ttctgttgca 900

taattactga ggatgctgaa cagaatcttc tgctcggcga accattccct aaacagctca 960

gcaactcctt caagcattgc gttaacaatg tttgctccca ttgcatcttt aacatccacc 1020

aggaaatcaa cactcacgaa agactcgtcg aaggcgcggt actgcaaatc gcgaagaccg 1080

cctccacgct taacaattga aggatatgaa agttctgcct gctggaagat ttctgtttct 1140

ctaacttgaa gttcatcaat aagtgattct gcatctgcaa cgtcgtagaa gacaatttgt 1200

cctctcataa gtctttgttg gttgacagtc ttaaatcctt gggcgatctt tgctccgttt 1260

gaaagtgctg caataactga aggttcttct gttgccatag gaacaagata atctgtttca 1320

tcaactgtaa gatgaagtcc aactcccata ggaacttctg tttctgaaat ctgattctca 1380

atcatatggt ttgcaatttg tgatgaaagt gccgtattct cgaactcctt ctttgtatct 1440

gctgaaattt gtccttcgtt aagaagtgat gcaagtcttt cttcaggtga catctggtag 1500

aatcttgagt ttttcttctg ttgaggtctt tcaagaagca ttgctaaacc aagacctcca 1560

ccaatacaaa gtgacgcgac tccatatttc ttctccttct ggttaagttg atatgaaagt 1620

gatgtaagaa gacgcgctcc ggtagctccg attgcatgtc caagtgaaat tcctcctcca 1680

taaatattta ccttctcttc aggaagtgca agttctcttt gaacaacaat tgatgttgct 1740

gcaaatgctt cgttaatttc gtagaggtcg atctcctcag ttgtaagttg atttcgagcg 1800

aggagtttct gaattgcttt aataggtgaa attcccatat atgcaggatc aattccaact 1860

tcaactgaat ctctaataat tgcaagataa ggaagtccat gtgcttctgc atattcttgt 1920

gatgcaataa taagtgctga tgctccatcg ttaattgttg atgcgtttcc tgctgtaact 1980

gttccatcct ctttaaacac ggtcttaagt gtccctagct tctcaactga tgagttaggt 2040

ctaattccct cgtccttctc aacaagtgtt cctgaaactt caagaggtgc aatttcgtcg 2100

gcgaagattc cttctgcttg tgcttgtgct gctttaagtt gtgaatgcac agagaattga 2160

tcttgttctt ctcttgtaac gtggtacttc tctgctacat tctctgctgt aagtcccatt 2220

gcttggcccg agaatgcatc tgtaagtcca tcatacatca tagacgagaa aggtgcatca 2280

tatgattctg tttcatagtt aaatctttga agtttaggtg cttgtgacat attctcaatt 2340

cctcctgcaa taagaacttc tgcttctcca agttgaatga gctgctttgc aagaataact 2400

gctttcattc ctgatccaca aacctcattg accgtcatcg caggaatttc atgtgaaagt 2460

cctgagttaa ttgcaatttg tcttgcggga ttctgtccgt tgccggcctg gagtacgttc 2520

ccgaagatga cctggtcgat ttcttcgctg atcgtactgt gacgctttag taactgagtc 2580

gtgacgtggg ttccaagatc aactgctgaa acttgtgaaa gtgatccctt gtactttcca 2640

ataggtgttc taagtgcatc aataataacc acggtcttca tttatattga attttcaaaa 2700

attcttactt tttttttgga tggacgcaaa gaagtttaat aatcatatta catggcatta 2760

ccaccatata catatccata tacatatcca tatctaatct tacttatatg ttgtggaaat 2820

gtaaagagcc ccattatctt agcctaaaaa aaccttctct ttggaacttt cagtaatacg 2880

cttaactgct cattgctata ttgaagtacg gattagaagc cgccgagcgg gtgacagccc 2940

tccgaaggaa gactctcctc cgtgcgtcct cgtcttcacc ggtcgcgttc ctgaaacgca 3000

gatgtgcctc gcgccgcact gctccgaaca ataaagattc tacaatacta gcttttatgg 3060

ttatgaagag gaaaaattgg cagtaacctg gccccacaaa ccttcaaatg aacgaatcaa 3120

attaacaacc ataggatgat aatgcgatta gttttttagc cttatttctg gggtaattaa 3180

tcagcgaagc gatgattttt gatctattaa cagatatata aatgcaaaaa ctgcataacc 3240

actttaacta atactttcaa cattttcggt ttgtattact tcttattcaa atgtaataaa 3300

agtatcaaca aaaaattgtt aatatacctc tatactttaa cgtcaaggag aaaaaacatg 3360

acaattggaa ttgataagat ctcgttcttc gtgccacctt attatattga tatgacagca 3420

cttgcagaag caagaaacgt tgatcctgga aagttccaca ttggaattgg acaagatcaa 3480

atggcagtta accctatttc acaagatatt gttacatttg cagcaaacgc agcagaagca 3540

attcttacaa aggaggacaa agaaggaatt gatatggtta ttgttggaac agaatcatca 3600

attgatgaat caaaggccgc cgcagttgtt cttcatagac ttatgggtat tcaacctttc 3660

gcccgatcat ttgaaattaa agaaggatgt tatggagcaa cagcaggact tcaacttgca 3720

aagaatcacg ttgcacttca tcctgataag aaggtcttgg ttgttgcagc agatattgca 3780

aagtacggcc ttaactcagg aggagaacct acacaaggag ctggcgctgt cgcgatgctg 3840

gttgcatcag aacctagaat acttgccctg aaggaagata acgttatgct tacacaagat 3900

atttatgatt tctggcggcc tacaggacat ccttatccta tggttgatgg acctctttca 3960

aacgaaacat atattcaatc atttgcacaa gtttgggatg aacataagaa gcgcaccgga 4020

cttgatttcg ccgactatga tgcacttgca tttcatattc cttatacaaa gatgggtaag 4080

aaggctctac ttgcaaagat ctccgatcaa acagaagcgg agcaggagcg tattcttgcc 4140

cgttatgagg agagtataat atactcaaga agagttggaa acctttatac aggatcactt 4200

tatcttggac ttatttcact tcttgagaat gccacaacac ttacagcagg aaaccaaatt 4260

ggactcttct cttacggttc aggcgccgtt gctgagttct ttaccggtga acttgttgca 4320

ggatatcaga atcaccttca gaaggagact catcttgcac ttcttgataa cagaacagaa 4380

ctttcaattg cagaatatga agcaatgttt gcagaaacat tagacactga catcgaccag 4440

accttggagg acgagttaaa gtactccatc tctgcaatta acaacacagt tagatcatat 4500

agaaactgaa caggcccctt ttcctttgtc gatatcatgt aattagttat gtcacgctta 4560

cattcacgcc ctcctcccac atccgctcta accgaaaagg aaggagttag acaacctgaa 4620

gtctaggtcc ctatttattt tttttaatag ttatgttagt attaagaacg ttatttatat 4680

ttcaaatttt tctttttttt ctgtacaaac gcgtgtacgc atgtaacaag tttcttggca 4740

ttggcaaatc tctgctaaat gctgcgtaca gacggaaac 4779

<210> 4

<211> 3322

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtacaggat acgctaattg cgctccaact accaaggttg ttgagggaac actggggcaa 60

taggctgtga agagaaaaaa aaaatgtgaa caatcaatgt atattcagag ttctgtaaat 120

aaataaagaa aataaagttt acatattact aaggattttt gtcgcctatt tttactattt 180

ttcaggtgaa atgaaacgtt ttatatcaca ttttgctatg ataacaaagt tattatgatt 240

tttatgtagc ctatattatt gacgcgttgt tatagcattc tatgaatttg cctgtcattt 300

tccacttcag aaaggtcatc taattgctcc caccagttga ataagtaatt ctcgcaaata 360

atcttaaacc aaggcgtaaa cttgtaactt gggtcagcaa acatagtttt caaatcattt 420

ggtgaaaccc atttgaagtc tctaacttca ttgacgtttg ggttgacagt caagttttct 480

ttagcgttga tcttataaaa taggatgtaa tcaatttcat gttcacccca tggttcattg 540

cttggtgcca tgtaatggat tctgtttaaa aagtgaaact taccccttgt cttagtttca 600

tcttctggaa tacctaattc atgatctagt tttctcaccg ccgcagtaat agcgccctta 660

atcttatcgt ctagcttacc cttcaaacct aattcgtcat caatacatag tggatgagag 720

cagcatgtgt tagtccaaag atcagggaaa gttatttttt cagtggctct ttgttgtaaa 780

agtaattcac cttgttcatt gaaaataaag acggagaatg cacgatgtag taaacccttt 840

tcaatatttt ccattaaatg acaaactttc ttggtaccgg caccaatagc attatcgtcc 900

caatccaaaa caatacaatt ttcattcatt aacttaattt gctcctcatc atgaccagaa 960

aaacatgttt ctccgctttc gtcatttgac gtctcactag atcgggtatt aggtctttgt 1020

tgtaatggaa taatttcagg aaactcttcc aaaatgtctt caggtgtttg gttttgcact 1080

aatttggcgt aactagatac tgcaccatgg ggcatactat tgttgtcggc agtcatttat 1140

attgaatttt caaaaattct tacttttttt ttggatggac gcaaagaagt ttaataatca 1200

tattacatgg cattaccacc atatacatat ccatatacat atccatatct aatcttactt 1260

atatgttgtg gaaatgtaaa gagccccatt atcttagcct aaaaaaacct tctctttgga 1320

actttcagta atacgcttaa ctgctcattg ctatattgaa gtacggatta gaagccgccg 1380

agcgggtgac agccctccga aggaagactc tcctccgtgc gtcctcgtct tcaccggtcg 1440

cgttcctgaa acgcagatgt gcctcgcgcc gcactgctcc gaacaataaa gattctacaa 1500

tactagcttt tatggttatg aagaggaaaa attggcagta acctggcccc acaaaccttc 1560

aaatgaacga atcaaattaa caaccatagg atgataatgc gattagtttt ttagccttat 1620

ttctggggta attaatcagc gaagcgatga tttttgatct attaacagat atataaatgc 1680

aaaaactgca taaccacttt aactaatact ttcaacattt tcggtttgta ttacttctta 1740

ttcaaatgta ataaaagtat caacaaaaaa ttgttaatat acctctatac tttaacgtca 1800

aggagaaaaa acatgtcatt accgttctta acttctgcac cgggaaaggt tattattttt 1860

ggtgaacact ctgctgtgta caacaagcct gccgtcgctg ctagtgtgtc tgcgttgaga 1920

acctacctgc taataagcga gtcatctgca ccagatacta ttgaattgga cttcccggac 1980

attagcttta atcataagtg gtccatcaat gatttcaatg ccatcaccga ggatcaagta 2040

aactcccaaa aattggccaa ggctcaacaa gccaccgatg gcttgtctca ggaactcgtt 2100

agtcttttgg atccgttgtt agctcaacta tccgaatcct tccactacca tgcagcgttt 2160

tgtttcctgt atatgtttgt ttgcctatgc ccccatgcca agaatattaa gttttcttta 2220

aagtctactt tacccatcgg tgctgggttg ggctcaagcg cctctatttc tgtatcactg 2280

gccttagcta tggcctactt gggggggtta ataggatcta atgacttgga aaagctgtca 2340

gaaaacgata agcatatagt gaatcaatgg gccttcatag gtgaaaagtg tattcacggt 2400

accccttcag gaatagataa cgctgtggcc acttatggta atgccctgct atttgaaaaa 2460

gactcacata atggaacaat aaacacaaac aattttaagt tcttagatga tttcccagcc 2520

attccaatga tcctaaccta tactagaatt ccaaggtcta caaaagatct tgttgctcgc 2580

gttcgtgtgt tggtcaccga gaaatttcct gaagttatga agccaattct agatgccatg 2640

ggtgaatgtg ccctacaagg cttagagatc atgactaagt taagtaaatg taaaggcacc 2700

gatgacgagg ctgtagaaac taataatgaa ctgtatgaac aactattgga attgataaga 2760

ataaatcatg gactgcttgt ctcaatcggt gtttctcatc ctggattaga acttattaaa 2820

aatctgagcg atgatttgag aattggctcc acaaaactta ccggtgctgg tggcggcggt 2880

tgctctttga ctttgttacg aagagacatt actcaagagc aaattgacag tttcaaaaag 2940

aaattgcaag atgattttag ttacgagaca tttgaaacag acttgggtgg gactggctgc 3000

tgtttgttaa gcgcaaaaaa tttgaataaa gatcttaaaa tcaaatccct agtattccaa 3060

ttatttgaaa ataaaactac cacaaagcaa caaattgacg atctattatt gccaggaaac 3120

acgaatttac catggacttc ataagctaat ttgcgatagg cattatttat tagttgtttt 3180

taatcttaac tgtgtatgaa gttttatgta ataaagatag aaagagaaac aaaaaaaaat 3240

ttttcgtagt atcaatcatg ggaagattcg cttttttttt ttgaattaca atagtatgtc 3300

tgatgtctgc aagaagtaac ag 3322

<210> 5

<211> 3890

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggttctgact cctactgagc tctattggag gtggcagaac cggtaccgga ggagaccgct 60

ataaccggtt tgagtgcaca ctttcaagct accacgcact ttatttatat ttaaatgaca 120

taaagttata tatctagaaa gtttatttat cgttctcagt accatcctca tcctagtatg 180

tatagcttgt acccattaaa cgaattttat catgccgccg aaaggaacaa tttcaagtac 240

tatcggaaga tgaatggtta gatgttaagc gcggtcactt caaacttcac atttataaag 300

atgtcacatg gaccactatt atctacctta agttatttat caagataagt ttccggatct 360

ttttctttcc taacacccca gtcagcctga gttacatcca gccattgaac cttagaaaat 420

cttttgtcat cagcggtttg agccctaaga tcaacatctt gcttagcaat cactgcaatg 480

gcgtcataac caccagcacc aggtattaag caagtaagaa ctccttttaa ggtctggcaa 540

tcatccaata agctagtttg tacgggaggt tcgatatcgg caccagattc tttagttatt 600

tttctaaagg aacgtctaat tgtggcaact gcatctctaa cttctgtgat ctcaggatac 660

ttttgacagg tacagtcatt cctctcaaga gactcaaata tctgatcgct gtaatcgtca 720

tgagtctcgt gtaagcgatc tagtttagat agtccatcca taaatctaga atttgcatga 780

tcgagttctg tatatatttt caagctttcc ggcatatgcg aatcatacca attttttacc 840

ttctggacca gttttactgt ttctgaacca ttcttaatat cgcccatcca taaagttaat 900

cccgaaggta aatggttact tttaatcgtt atattccagt cttcttcatt aaccaaatgc 960

gccagtttac tgccgtaagt agcacttcca atatctggca aattagagat taatgcgggt 1020

gggaatcttc tatatctgat agatccatat gctgccgccg ctacatcaaa cccgcttcca 1080

attttaccct gagcttgaca atgagcaact tgtgataaat tatgaataac ttctctatat 1140

ttgtctacat tattttccag gtccgataca aaaaaggagg ccaaagctgt agttaaaact 1200

gtgactaaac ctgccgagga gcccagccct gttttgggaa cttcttcaat tctgtgcgaa 1260

tgaaaactca atcttctgtt gccacgatgt tcggtaacgc tgtcctcctg agaatggtag 1320

gcatcatcag agaaaatatc aataacgaac aagtttctat tgcagtagtc gtccatgtta 1380

ggcttaaagt agctaaatac gttagcgata actttttcaa tgaaagggtt cttagatccg 1440

cctatcgaaa caggaatgaa gccagtttta ggacttatat ggtacagcca ctccccatct 1500

ttaaattgtt tacttttcac acgcacttca aacttatcag actcttgcaa tgaaccgtaa 1560

ggatgggcta cagcatgcat tcttgccgat aatccgacta caaatgcttc atatttcgga 1620

tctaaaacta aatatccacc agctagtaac gctttccctg gggcactgaa ggctctcaac 1680

tctgacattt atattgaatt ttcaaaaatt cttacttttt ttttggatgg acgcaaagaa 1740

gtttaataat catattacat ggcattacca ccatatacat atccatatac atatccatat 1800

ctaatcttac ttatatgttg tggaaatgta aagagcccca ttatcttagc ctaaaaaaac 1860

cttctctttg gaactttcag taatacgctt aactgctcat tgctatattg aagtacggat 1920

tagaagccgc cgagcgggtg acagccctcc gaaggaagac tctcctccgt gcgtcctcgt 1980

cttcaccggt cgcgttcctg aaacgcagat gtgcctcgcg ccgcactgct ccgaacaata 2040

aagattctac aatactagct tttatggtta tgaagaggaa aaattggcag taacctggcc 2100

ccacaaacct tcaaatgaac gaatcaaatt aacaaccata ggatgataat gcgattagtt 2160

ttttagcctt atttctgggg taattaatca gcgaagcgat gatttttgat ctattaacag 2220

atatataaat gcaaaaactg cataaccact ttaactaata ctttcaacat tttcggtttg 2280

tattacttct tattcaaatg taataaaagt atcaacaaaa aattgttaat atacctctat 2340

actttaacgt caaggagaaa aaacatgacc gtttacacag catccgttac cgcacccgtc 2400

aacatcgcaa cccttaagta ttgggggaaa agggacacga agttgaatct gcccaccaat 2460

tcgtccatat cagtgacttt atcgcaagat gacctcagaa cgttgacctc tgcggctact 2520

gcacctgagt ttgaacgcga cactttgtgg ttaaatggag aaccacacag catcgacaat 2580

gaaagaactc aaaattgtct gcgcgaccta cgccaattaa gaaaggaaat ggaatcgaag 2640

gacgcctcat tgcccacatt atctcaatgg aaactccaca ttgtctccga aaataacttt 2700

cctacagcag ctggtttagc ttcctccgct gctggctttg ctgcattggt ctctgcaatt 2760

gctaagttat accaattacc acagtcaact tcagaaatat ctagaatagc aagaaagggg 2820

tctggttcag cttgtagatc gttgtttggc ggatacgtgg cctgggaaat gggaaaagct 2880

gaagatggtc atgattccat ggcagtacaa atcgcagaca gctctgactg gcctcagatg 2940

aaagcttgtg tcctagttgt cagcgatatt aaaaaggatg tgagttccac tcagggtatg 3000

caattgaccg tggcaacctc cgaactattt aaagaaagaa ttgaacatgt cgtaccaaag 3060

agatttgaag tcatgcgtaa agccattgtt gaaaaagatt tcgccacctt tgcaaaggaa 3120

acaatgatgg attccaactc tttccatgcc acatgtttgg actctttccc tccaatattc 3180

tacatgaatg acacttccaa gcgtatcatc agttggtgcc acaccattaa tcagttttac 3240

ggagaaacaa tcgttgcata cacgtttgat gcaggtccaa atgctgtgtt gtactactta 3300

gctgaaaatg agtcgaaact ctttgcattt atctataaat tgtttggctc tgttcctgga 3360

tgggacaaga aatttactac tgagcagctt gaggctttca accatcaatt tgaatcatct 3420

aactttactg cacgtgaatt ggatcttgag ttgcaaaagg atgttgccag agtgatttta 3480

actcaagtcg gttcaggccc acaagaaaca aacgaatctt tgattgacgc aaagactggt 3540

ctaccaaagg aataaacagg ccccttttcc tttgtcgata tcatgtaatt agttatgtca 3600

cgcttacatt cacgccctcc tcccacatcc gctctaaccg aaaaggaagg agttagacaa 3660

cctgaagtct aggtccctat ttattttttt taatagttat gttagtatta agaacgttat 3720

ttatatttca aatttttctt ttttttctgt acaaacgcgt gtacgcatgt aacactcaga 3780

agtttgacag caagcaagtt catcattcga actagcctta ttgttttagt tcagtgacag 3840

cgaactgccg tactcgatgc tttatttctc acggtagagc ggaagaacag 3890

<210> 6

<211> 2709

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cctaaaaaag acacatctaa ctgattagtt ttccgtttta ggatattgac gccaagcgtg 60

cgtctgattt cctgtactaa tccaaggagg tttacggacc aggggaactt tccagattca 120

gatcacagca atataggact agaaaatatc aggtagccgc actcaacttg taactggcaa 180

ctactttgca tcaaactcca attaaatgcg gtagaatctt ttcacaaaag gtactcaacg 240

tcaattcgga aagcttcctt ccggaatggc ttaagtaggt tgcaatttct ttttctatta 300

gtagctaaaa atgggtcacg tgatctatat tcgaaagggg cggttgcctc aggaaggcac 360

cggcggtctt tcgtccgtgc ggagatatct gcgccgttca ggggtccatg tgccttggac 420

gatattaagg cagaaggcag tatcggggcg gatcactccg aaccgagatt agttaagccc 480

ttcccatctc aagatgggga gcaaatggca ttatactcct gctagaaagt taactgtgca 540

catattctta aattatacaa cattctggag agctattgtt caaaaaacaa acatttcgca 600

ggctaaaatg tggagatagg ataagttttg tagacatata taaacaatca gtaattggat 660

tgaaaatttg gtgttgtgaa ttgctcttca ttatgcacct tattcaatta tcatcaagaa 720

tagtaatagt taagtaaaca caagattaac ataataaaaa aaataattct ttcataatga 780

gaagatctgg caattatcaa ccatctattt gggattttaa ttatgttcaa tccctcaata 840

caccatataa agaagaaaga tatttgacta gacatgctga attgattgtt caagttaaac 900

cattgttgga aaaaaaaatg gagcctgctc agcagttgga attgatagat gatttgaata 960

atttggggct gtcttacttt ttccaagata gaatcaaaca aatactgtct ttcatatatg 1020

atgaaaatca atgttttcat agcaatatca atgaccaagc tgaaaaaaga gatttgtatt 1080

ttactgcttt gggttttaga ttgttgagac aacatggttt tgatgtgtct caagaggttt 1140

ttgattgttt taaaaatgac aatggttctg atttcaaagc ttctttgtct gataatacta 1200

aaggtttgtt gcaattgtat gaagcttctt ttttggttag agaaggtgaa gatactttgg 1260

aacaagctag acagtttgct actaagttct tgagaagaaa gttagatgaa attgatgaca 1320

atcacctatt gtcttgtatt catcattctt tggaaattcc attgcattgg agaattcaaa 1380

gattggaagc tagatggttt ttggatgctt atgctactag acatgacatg aatcctgtta 1440

ttttagagtt ggctaagttg gactttaata ttatacaagc tactcatcaa gaagaattga 1500

aagatgtttc tagatggtgg caaaatacta gattggctga aaaattgcca tttgttagag 1560

atagattggt tgaatcttat ttttgggcta ttgctttgtt tgaaccacat caatatggtt 1620

atcaaagaag agttgctgcc aaaattatta ctttggctac atctattgat gatgtttatg 1680

atatatatgg tactttggat gaattgcagt tgtttactga taattttaga agatgggata 1740

ctgaatcttt gggtagactg ccatattcta tgcaattgtt ttacatggtc attcataact 1800

ttgtttctga attggcttat gaaattttga aagagaaagg tttcattgtc ataccatatt 1860

tgcaaagatc ttgggttgat ttggctgaat cttttttgaa agaagctaat tggtattatt 1920

ctggttatac tccatctttg gaagaatata ttgacaatgg ctctatatct attggtgctg 1980

ttgcagtttt gtctcaagtt tatttcactt tagcaaattc tatagaaaag cccaagattg 2040

agtctatgta taagtatcat catattttga gattgtctgg tttgttggtt agattgcatg 2100

atgatttggg tacttctttg tttgaaaaaa aaagaggtga tgttccaaaa gctgttgaaa 2160

tttgtatgaa agaaagaaat gttactgaag aagaagctga agaacatgtt aaatatttga 2220

ttagagaagc ttggaaagaa atgaatactg ctactactgc tgctggttgt ccatttatgg 2280

atgaattgaa tgttgctgct gctaatttgg gtagagctgc tcaatttgtt tatttggatg 2340

gtgatggtca tggtgttcaa cattctaaaa ttcatcaaca aatgggtggt ttgatgtttg 2400

aaccatatgt ttaaacaggc cccttttcct ttgtcgatat catgtaatta gttatgtcac 2460

gcttacattc acgccctcct cccacatccg ctctaaccga aaaggaagga gttagacaac 2520

ctgaagtcta ggtccctatt tatttttttt aatagttatg ttagtattaa gaacgttatt 2580

tatatttcaa atttttcttt tttttctgta caaacgcgtg tacgcatgta acattttatt 2640

tttgaggatt gggctgatca ttttccttac gtggattgag ccagcaatac agatcattat 2700

taaactgtt 2709

<210> 7

<211> 2676

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cctaaaaaag acacatctaa ctgattagtt ttccgtttta ggatattgac gccaagcgtg 60

cgtctgattt cctgtactaa tccaaggagg tttacggacc aggggaactt tccagattca 120

gatcacagca atataggact agaaaatatc aggtagccgc actcaacttg taactggcaa 180

ctactttgca tcaaactcca attaaatgcg gtagaatctt ttcacaaaag gtactcaacg 240

tcaattcgga aagcttcctt ccggaatggc ttaagtaggt tgcaatttct ttttctatta 300

gtagctaaaa atgggtcacg tgatctatat tcgaaagggg cggttgcctc aggaaggcac 360

cggcggtctt tcgtccgtgc ggagatatct gcgccgttca ggggtccatg tgccttggac 420

gatattaagg cagaaggcag tatcggggcg gatcactccg aaccgagatt agttaagccc 480

ttcccatctc aagatgggga gcaaatggca ttatactcct gctagaaagt taactgtgca 540

catattctta aattatacaa cattctggag agctattgtt caaaaaacaa acatttcgca 600

ggctaaaatg tggagatagg ataagttttg tagacatata taaacaatca gtaattggat 660

tgaaaatttg gtgttgtgaa ttgctcttca ttatgcacct tattcaatta tcatcaagaa 720

tagtaatagt taagtaaaca caagattaac ataataaaaa aaataattct ttcataatgt 780

ctgcttgtac tccattggct tctgctatgc cattgtcttc tactccattg attaatggtg 840

ataactctca aaggaaaaac acaaggcagc atatggaaga gtcttcttct aaaagaagag 900

agtatttgtt ggaggaaact actagaaaat tgcagaggaa tgatactgag agtgtggaga 960

aattgaaatt gattgacaat atccaacagt tgggtattgg ttactatttt gaagatgcta 1020

ttaatgctgt tttgagatct ccattttcta ctggtgaaga agatttgttt actgctgctc 1080

tcagatttag attgttgaga cataatggta ttgaaatttc tcctgaaatt ttcttgaaat 1140

tcaaagatga aagaggtaaa tttgatgaat ctgatacttt gggtttgttg tctttgtatg 1200

aagcttctaa tttgggtgtt gctggtgaag aaatcttgga ggaagccatg gagtttgctg 1260

aagctagatt gagaagatct ttgtctgaac ctgctgctcc attgcatggt gaagttgctc 1320

aagctttgga tgttccaaga catttgagaa tggctagatt ggaagctaga agatttattg 1380

aacaatatgg taaacaatct gatcatgatg gtgatctatt ggagttggct attttggatt 1440

ataatcaagt tcaagctcaa catcaatctg aattgactga aattattaga tggtggaaag 1500

aattgggttt ggttgataaa ttgtcttttg gtagagatag accattggaa tgttttttgt 1560

ggactgttgg tttgttgcct gaaccaaaat attcttctgt tagaattgaa ttggccaaag 1620

ctatatctat tcttttggtt attgatgata tttttgatac ttatggtgaa atggatgatt 1680

tgattttgtt tactgatgct attagaagat gggatttgga ggcaatggag ggtttgcctg 1740

aatatatgaa aatctgttac atggctttgt acaatactac taatgaagtt tgctataaag 1800

ttttgagaga cactggtaga attgttttgt tgaatttgaa gtctacttgg attgatatga 1860

ttgaaggttt tatggaagaa gctaaatggt ttaatggtgg ttctgctcca aaattggaag 1920

aatatattga aaatggtgtt tctactgctg gtgcttatat ggcttttgct catatttttt 1980

ttttgattgg tgaaggtgtt actcatcaaa attctcaatt gtttactcaa aaaccatatc 2040

caaaagtttt ttctgctgct ggtagaatac tgagattgtg ggatgatttg ggtactgcta 2100

aagaagaaca agaaagaggt gatttggctt cttgtgttca attgtttatg aaagaaaaat 2160

ctcttactga agaagaagct agatctagaa tattggaaga aattaaaggt ttgtggaggg 2220

acttaaatgg tgaactagta tataataaaa acttgccatt gtctattatt aaagttgctt 2280

tgaatatggc tagggcttct caagttgtgt ataaacatga tcaagatact tacttttctt 2340

ctgtagataa ttatgttgat gctttgtttt ttactcaata aacaggcccc ttttcctttg 2400

tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcctccc acatccgctc 2460

taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat tttttttaat 2520

agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt ttctgtacaa 2580

acgcgtgtac gcatgtaaca ttttattttt gaggattggg ctgatcattt tccttacgtg 2640

gattgagcca gcaatacaga tcattattaa actgtt 2676

<210> 8

<211> 2739

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cctaaaaaag acacatctaa ctgattagtt ttccgtttta ggatattgac gccaagcgtg 60

cgtctgattt cctgtactaa tccaaggagg tttacggacc aggggaactt tccagattca 120

gatcacagca atataggact agaaaatatc aggtagccgc actcaacttg taactggcaa 180

ctactttgca tcaaactcca attaaatgcg gtagaatctt ttcacaaaag gtactcaacg 240

tcaattcgga aagcttcctt ccggaatggc ttaagtaggt tgcaatttct ttttctatta 300

gtagctaaaa atgggtcacg tgatctatat tcgaaagggg cggttgcctc aggaaggcac 360

cggcggtctt tcgtccgtgc ggagatatct gcgccgttca ggggtccatg tgccttggac 420

gatattaagg cagaaggcag tatcggggcg gatcactccg aaccgagatt agttaagccc 480

ttcccatctc aagatgggga gcaaatggca ttatactcct gctagaaagt taactgtgca 540

catattctta aattatacaa cattctggag agctattgtt caaaaaacaa acatttcgca 600

ggctaaaatg tggagatagg ataagttttg tagacatata taaacaatca gtaattggat 660

tgaaaatttg gtgttgtgaa ttgctcttca ttatgcacct tattcaatta tcatcaagaa 720

tagtaatagt taagtaaaca caagattaac ataataaaaa aaataattct ttcataatgg 780

acagaagatc tgctaactac caaccatcta tctgggatca cgattttttg caatctttga 840

actccaatta cactgatgaa acttacaaga gaagagaaga agaattgaaa ggtaaggtta 900

tgactactat caaggatgtt actgaaccat tgaaccaatt ggaattgatt gactctttgc 960

aaagattggg tttagcctac catttcgaaa ccgaaattag aaacattttg cacgacattt 1020

acaactctaa caacgattat gtctggagaa aggaaaactt gtacgctact tccttagaat 1080

tcagattgtt gagacaacac ggttacccag tttcccaaga agtcttcaac ggtttcaagg 1140

atgaccaagg tggtttcatc tgtgatgatt tcaagggtgt tttatccttg cacgaagctt 1200

cttacttctc tctcgaaggt gaatctatta tggaagaagc ctggcaattc acttcaaagc 1260

acttgaaaga agtcatgatt tctaagtcca agcaaggtga cgtttttgtc gctgaacaag 1320

ccaagcgtgg tttagaatta cctttgcact ggaaggtccc aatgttggaa gctagatggt 1380

tcattgatgt ctacgaaaag agggaagaca agaaccattt gttattagaa ttggctaagt 1440

tggaattcaa tgtcttgcaa gctatttacc aagaagaatt gaaggacgtc tccagatggt 1500

ggaaagatat tggtttgggt gaaaagttat ctttcgccag agactcctta gtcgcctcct 1560

tcgtttggtc catgggtatc gttttcgaac cacaatttgc ttactgccgt agaatcttga 1620

ccatcacttt cgctctaatc tctgttatcg acgacatcta cgacgtttac ggtactctgg 1680

acgaactgga attgtttgcc gatgctgtcg aaagatggga catcaactac gctttgaacc 1740

acttgccaga ctatatgaag atctgtttct tggctttgta caacctcgtt aacgaattca 1800

cctactacgt tttgaagcaa caagatttcg atattttacg ttccatcaag aatgcttggt 1860

tgagaaacat tcaagcttat ttggttgaag ctaaatggta ccacggtaag tacaccccaa 1920

ctttgggtga attcttggaa aacggtttgg tgtctatcgg tggtccaatg gttaccatga 1980

ccgcttactt gtccggtacc aacccaatca tcgaaaaaga gttggaattt ttggaatcga 2040

accaagacat ttcccattgg tctttcaaga ttcttagatt gcaagatgac ttgggcactt 2100

cttctgacga aatcagaaga ggtgacgttc caaagtctat tcaatgttac atgcacgaaa 2160

ccggtgcctc tgaagaagtt gctcgtgaac acatcaagga catgatgaga caaatgtgga 2220

agaaggtcaa cgcttacaga gctgacaagg acttcccatt gtctcaaacc accgtcgagt 2280

tcatcttgaa cgttgtaaga gtttcccact tcatgtacct gcatggtgat ggacacggtg 2340

ctcaaaacca agaaacaatg gatgtcgttt tcactttgtt gttccaacca attccattgg 2400

acgataagca cattgttgct acctctagtc cagtcactaa gggtacaggc cccttttcct 2460

ttgtcgatat catgtaatta gttatgtcac gcttacattc acgccctcct cccacatccg 2520

ctctaaccga aaaggaagga gttagacaac ctgaagtcta ggtccctatt tatttttttt 2580

aatagttatg ttagtattaa gaacgttatt tatatttcaa atttttcttt tttttctgta 2640

caaacgcgtg tacgcatgta acattttatt tttgaggatt gggctgatca ttttccttac 2700

gtggattgag ccagcaatac agatcattat taaactgtt 2739

<210> 9

<211> 600

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acgatgtctc tgtttaaatg gcgcaagttt tccgctttgt aatatatatt tatacccctt 60

tcttctctcc cctgcaatat aatagtttaa ttctaatatt aataatatcc tatattttct 120

tcatttaccg gcgcactctc gcccgaacga cctcaaaatg tctgctacat tcataataac 180

caaaagctca taactttttt ttttgaacct gaatatatat acatcacata tcactgctgg 240

tccttgccga ccagcgtata caatctcgat agttggtttc ccgttctttc cactcccgtc 300

aagcatcttg ccctgtgctt ggcccccagt gcagcgaacg ttataaaaac gaatactgag 360

tatatatcta tgtaaaacaa ccatatcatt tcttgttctg aactttgttt acctaactag 420

ttttaaattt ccctttttcg tgcatgcggg tgttcttatt tattagcata ctacatttga 480

aatatcaaat ttccttagta gaaaagtgag agaaggtgca ctgacacaaa aaataaaatg 540

ctacgtataa ctgtcaaaac tttgcagcag cgggcatcct tccatcatag cttcaaacat 600

<210> 10

<211> 545

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Met Arg Arg Ser Gly Asn Tyr Gln Pro Ser Ile Trp Asp Phe Asn Tyr

1 5 10 15

Val Gln Ser Leu Asn Thr Pro Tyr Lys Glu Glu Arg Tyr Leu Thr Arg

20 25 30

His Ala Glu Leu Ile Val Gln Val Lys Pro Leu Leu Glu Lys Lys Met

35 40 45

Glu Pro Ala Gln Gln Leu Glu Leu Ile Asp Asp Leu Asn Asn Leu Gly

50 55 60

Leu Ser Tyr Phe Phe Gln Asp Arg Ile Lys Gln Ile Leu Ser Phe Ile

65 70 75 80

Tyr Asp Glu Asn Gln Cys Phe His Ser Asn Ile Asn Asp Gln Ala Glu

85 90 95

Lys Arg Asp Leu Tyr Phe Thr Ala Leu Gly Phe Arg Leu Leu Arg Gln

100 105 110

His Gly Phe Asp Val Ser Gln Glu Val Phe Asp Cys Phe Lys Asn Asp

115 120 125

Asn Gly Ser Asp Phe Lys Ala Ser Leu Ser Asp Asn Thr Lys Gly Leu

130 135 140

Leu Gln Leu Tyr Glu Ala Ser Phe Leu Val Arg Glu Gly Glu Asp Thr

145 150 155 160

Leu Glu Gln Ala Arg Gln Phe Ala Thr Lys Phe Leu Arg Arg Lys Leu

165 170 175

Asp Glu Ile Asp Asp Asn His Leu Leu Ser Cys Ile His His Ser Leu

180 185 190

Glu Ile Pro Leu His Trp Arg Ile Gln Arg Leu Glu Ala Arg Trp Phe

195 200 205

Leu Asp Ala Tyr Ala Thr Arg His Asp Met Asn Pro Val Ile Leu Glu

210 215 220

Leu Ala Lys Leu Asp Phe Asn Ile Ile Gln Ala Thr His Gln Glu Glu

225 230 235 240

Leu Lys Asp Val Ser Arg Trp Trp Gln Asn Thr Arg Leu Ala Glu Lys

245 250 255

Leu Pro Phe Val Arg Asp Arg Leu Val Glu Ser Tyr Phe Trp Ala Ile

260 265 270

Ala Leu Phe Glu Pro His Gln Tyr Gly Tyr Gln Arg Arg Val Ala Ala

275 280 285

Lys Ile Ile Thr Leu Ala Thr Ser Ile Asp Asp Val Tyr Asp Ile Tyr

290 295 300

Gly Thr Leu Asp Glu Leu Gln Leu Phe Thr Asp Asn Phe Arg Arg Trp

305 310 315 320

Asp Thr Glu Ser Leu Gly Arg Leu Pro Tyr Ser Met Gln Leu Phe Tyr

325 330 335

Met Val Ile His Asn Phe Val Ser Glu Leu Ala Tyr Glu Ile Leu Lys

340 345 350

Glu Lys Gly Phe Ile Val Ile Pro Tyr Leu Gln Arg Ser Trp Val Asp

355 360 365

Leu Ala Glu Ser Phe Leu Lys Glu Ala Asn Trp Tyr Tyr Ser Gly Tyr

370 375 380

Thr Pro Ser Leu Glu Glu Tyr Ile Asp Asn Gly Ser Ile Ser Ile Gly

385 390 395 400

Ala Val Ala Val Leu Ser Gln Val Tyr Phe Thr Leu Ala Asn Ser Ile

405 410 415

Glu Lys Pro Lys Ile Glu Ser Met Tyr Lys Tyr His His Ile Leu Arg

420 425 430

Leu Ser Gly Leu Leu Val Arg Leu His Asp Asp Leu Gly Thr Ser Leu

435 440 445

Phe Glu Lys Lys Arg Gly Asp Val Pro Lys Ala Val Glu Ile Cys Met

450 455 460

Lys Glu Arg Asn Val Thr Glu Glu Glu Ala Glu Glu His Val Lys Tyr

465 470 475 480

Leu Ile Arg Glu Ala Trp Lys Glu Met Asn Thr Ala Thr Thr Ala Ala

485 490 495

Gly Cys Pro Phe Met Asp Glu Leu Asn Val Ala Ala Ala Asn Leu Gly

500 505 510

Arg Ala Ala Gln Phe Val Tyr Leu Asp Gly Asp Gly His Gly Val Gln

515 520 525

His Ser Lys Ile His Gln Gln Met Gly Gly Leu Met Phe Glu Pro Tyr

530 535 540

Val

545

<210> 11

<211> 534

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Met Ser Ala Cys Thr Pro Leu Ala Ser Ala Met Pro Leu Ser Ser Thr

1 5 10 15

Pro Leu Ile Asn Gly Asp Asn Ser Gln Arg Lys Asn Thr Arg Gln His

20 25 30

Met Glu Glu Ser Ser Ser Lys Arg Arg Glu Tyr Leu Leu Glu Glu Thr

35 40 45

Thr Arg Lys Leu Gln Arg Asn Asp Thr Glu Ser Val Glu Lys Leu Lys

50 55 60

Leu Ile Asp Asn Ile Gln Gln Leu Gly Ile Gly Tyr Tyr Phe Glu Asp

65 70 75 80

Ala Ile Asn Ala Val Leu Arg Ser Pro Phe Ser Thr Gly Glu Glu Asp

85 90 95

Leu Phe Thr Ala Ala Leu Arg Phe Arg Leu Leu Arg His Asn Gly Ile

100 105 110

Glu Ile Ser Pro Glu Ile Phe Leu Lys Phe Lys Asp Glu Arg Gly Lys

115 120 125

Phe Asp Glu Ser Asp Thr Leu Gly Leu Leu Ser Leu Tyr Glu Ala Ser

130 135 140

Asn Leu Gly Val Ala Gly Glu Glu Ile Leu Glu Glu Ala Met Glu Phe

145 150 155 160

Ala Glu Ala Arg Leu Arg Arg Ser Leu Ser Glu Pro Ala Ala Pro Leu

165 170 175

His Gly Glu Val Ala Gln Ala Leu Asp Val Pro Arg His Leu Arg Met

180 185 190

Ala Arg Leu Glu Ala Arg Arg Phe Ile Glu Gln Tyr Gly Lys Gln Ser

195 200 205

Asp His Asp Gly Asp Leu Leu Glu Leu Ala Ile Leu Asp Tyr Asn Gln

210 215 220

Val Gln Ala Gln His Gln Ser Glu Leu Thr Glu Ile Ile Arg Trp Trp

225 230 235 240

Lys Glu Leu Gly Leu Val Asp Lys Leu Ser Phe Gly Arg Asp Arg Pro

245 250 255

Leu Glu Cys Phe Leu Trp Thr Val Gly Leu Leu Pro Glu Pro Lys Tyr

260 265 270

Ser Ser Val Arg Ile Glu Leu Ala Lys Ala Ile Ser Ile Leu Leu Val

275 280 285

Ile Asp Asp Ile Phe Asp Thr Tyr Gly Glu Met Asp Asp Leu Ile Leu

290 295 300

Phe Thr Asp Ala Ile Arg Arg Trp Asp Leu Glu Ala Met Glu Gly Leu

305 310 315 320

Pro Glu Tyr Met Lys Ile Cys Tyr Met Ala Leu Tyr Asn Thr Thr Asn

325 330 335

Glu Val Cys Tyr Lys Val Leu Arg Asp Thr Gly Arg Ile Val Leu Leu

340 345 350

Asn Leu Lys Ser Thr Trp Ile Asp Met Ile Glu Gly Phe Met Glu Glu

355 360 365

Ala Lys Trp Phe Asn Gly Gly Ser Ala Pro Lys Leu Glu Glu Tyr Ile

370 375 380

Glu Asn Gly Val Ser Thr Ala Gly Ala Tyr Met Ala Phe Ala His Ile

385 390 395 400

Phe Phe Leu Ile Gly Glu Gly Val Thr His Gln Asn Ser Gln Leu Phe

405 410 415

Thr Gln Lys Pro Tyr Pro Lys Val Phe Ser Ala Ala Gly Arg Ile Leu

420 425 430

Arg Leu Trp Asp Asp Leu Gly Thr Ala Lys Glu Glu Gln Glu Arg Gly

435 440 445

Asp Leu Ala Ser Cys Val Gln Leu Phe Met Lys Glu Lys Ser Leu Thr

450 455 460

Glu Glu Glu Ala Arg Ser Arg Ile Leu Glu Glu Ile Lys Gly Leu Trp

465 470 475 480

Arg Asp Leu Asn Gly Glu Leu Val Tyr Asn Lys Asn Leu Pro Leu Ser

485 490 495

Ile Ile Lys Val Ala Leu Asn Met Ala Arg Ala Ser Gln Val Val Tyr

500 505 510

Lys His Asp Gln Asp Thr Tyr Phe Ser Ser Val Asp Asn Tyr Val Asp

515 520 525

Ala Leu Phe Phe Thr Gln

530

<210> 12

<211> 556

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Met Asp Arg Arg Ser Ala Asn Tyr Gln Pro Ser Ile Trp Asp His Asp

1 5 10 15

Phe Leu Gln Ser Leu Asn Ser Asn Tyr Thr Asp Glu Thr Tyr Lys Arg

20 25 30

Arg Glu Glu Glu Leu Lys Gly Lys Val Met Thr Thr Ile Lys Asp Val

35 40 45

Thr Glu Pro Leu Asn Gln Leu Glu Leu Ile Asp Ser Leu Gln Arg Leu

50 55 60

Gly Leu Ala Tyr His Phe Glu Thr Glu Ile Arg Asn Ile Leu His Asp

65 70 75 80

Ile Tyr Asn Ser Asn Asn Asp Tyr Val Trp Arg Lys Glu Asn Leu Tyr

85 90 95

Ala Thr Ser Leu Glu Phe Arg Leu Leu Arg Gln His Gly Tyr Pro Val

100 105 110

Ser Gln Glu Val Phe Asn Gly Phe Lys Asp Asp Gln Gly Gly Phe Ile

115 120 125

Cys Asp Asp Phe Lys Gly Val Leu Ser Leu His Glu Ala Ser Tyr Phe

130 135 140

Ser Leu Glu Gly Glu Ser Ile Met Glu Glu Ala Trp Gln Phe Thr Ser

145 150 155 160

Lys His Leu Lys Glu Val Met Ile Ser Lys Ser Lys Gln Gly Asp Val

165 170 175

Phe Val Ala Glu Gln Ala Lys Arg Gly Leu Glu Leu Pro Leu His Trp

180 185 190

Lys Val Pro Met Leu Glu Ala Arg Trp Phe Ile Asp Val Tyr Glu Lys

195 200 205

Arg Glu Asp Lys Asn His Leu Leu Leu Glu Leu Ala Lys Leu Glu Phe

210 215 220

Asn Val Leu Gln Ala Ile Tyr Gln Glu Glu Leu Lys Asp Val Ser Arg

225 230 235 240

Trp Trp Lys Asp Ile Gly Leu Gly Glu Lys Leu Ser Phe Ala Arg Asp

245 250 255

Ser Leu Val Ala Ser Phe Val Trp Ser Met Gly Ile Val Phe Glu Pro

260 265 270

Gln Phe Ala Tyr Cys Arg Arg Ile Leu Thr Ile Thr Phe Ala Leu Ile

275 280 285

Ser Val Ile Asp Asp Ile Tyr Asp Val Tyr Gly Thr Leu Asp Glu Leu

290 295 300

Glu Leu Phe Ala Asp Ala Val Glu Arg Trp Asp Ile Asn Tyr Ala Leu

305 310 315 320

Asn His Leu Pro Asp Tyr Met Lys Ile Cys Phe Leu Ala Leu Tyr Asn

325 330 335

Leu Val Asn Glu Phe Thr Tyr Tyr Val Leu Lys Gln Gln Asp Phe Asp

340 345 350

Ile Leu Arg Ser Ile Lys Asn Ala Trp Leu Arg Asn Ile Gln Ala Tyr

355 360 365

Leu Val Glu Ala Lys Trp Tyr His Gly Lys Tyr Thr Pro Thr Leu Gly

370 375 380

Glu Phe Leu Glu Asn Gly Leu Val Ser Ile Gly Gly Pro Met Val Thr

385 390 395 400

Met Thr Ala Tyr Leu Ser Gly Thr Asn Pro Ile Ile Glu Lys Glu Leu

405 410 415

Glu Phe Leu Glu Ser Asn Gln Asp Ile Ser His Trp Ser Phe Lys Ile

420 425 430

Leu Arg Leu Gln Asp Asp Leu Gly Thr Ser Ser Asp Glu Ile Arg Arg

435 440 445

Gly Asp Val Pro Lys Ser Ile Gln Cys Tyr Met His Glu Thr Gly Ala

450 455 460

Ser Glu Glu Val Ala Arg Glu His Ile Lys Asp Met Met Arg Gln Met

465 470 475 480

Trp Lys Lys Val Asn Ala Tyr Arg Ala Asp Lys Asp Phe Pro Leu Ser

485 490 495

Gln Thr Thr Val Glu Phe Ile Leu Asn Val Val Arg Val Ser His Phe

500 505 510

Met Tyr Leu His Gly Asp Gly His Gly Ala Gln Asn Gln Glu Thr Met

515 520 525

Asp Val Val Phe Thr Leu Leu Phe Gln Pro Ile Pro Leu Asp Asp Lys

530 535 540

His Ile Val Ala Thr Ser Ser Pro Val Thr Lys Gly

545 550 555

<210> 13

<211> 352

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Met Ala Ser Glu Lys Glu Ile Arg Arg Glu Arg Phe Leu Asn Val Phe

1 5 10 15

Pro Lys Leu Val Glu Glu Leu Asn Ala Ser Leu Leu Ala Tyr Gly Met

20 25 30

Pro Lys Glu Ala Cys Asp Trp Tyr Ala His Ser Leu Asn Tyr Asn Thr

35 40 45

Pro Gly Gly Lys Leu Asn Arg Gly Leu Ser Val Val Asp Thr Tyr Ala

50 55 60

Ile Leu Ser Asn Lys Thr Val Glu Gln Leu Gly Gln Glu Glu Tyr Glu

65 70 75 80

Lys Val Ala Ile Leu Gly Trp Cys Ile Glu Leu Leu Gln Ala Tyr Trp

85 90 95

Leu Val Ala Asp Asp Met Met Asp Lys Ser Ile Thr Arg Arg Gly Gln

100 105 110

Pro Cys Trp Tyr Lys Val Pro Glu Val Gly Glu Ile Ala Ile Trp Asp

115 120 125

Ala Phe Met Leu Glu Ala Ala Ile Tyr Lys Leu Leu Lys Ser His Phe

130 135 140

Arg Asn Glu Lys Tyr Tyr Ile Asp Ile Thr Glu Leu Phe His Glu Val

145 150 155 160

Thr Phe Gln Thr Glu Leu Gly Gln Leu Met Asp Leu Ile Thr Ala Pro

165 170 175

Glu Asp Lys Val Asp Leu Ser Lys Phe Ser Leu Lys Lys His Ser Phe

180 185 190

Ile Val Thr Phe Lys Thr Ala Tyr Tyr Ser Phe Tyr Leu Pro Val Ala

195 200 205

Leu Ala Met Tyr Val Ala Gly Ile Thr Asp Glu Lys Asp Leu Lys Gln

210 215 220

Ala Arg Asp Val Leu Ile Pro Leu Gly Glu Tyr Phe Gln Ile Gln Asp

225 230 235 240

Asp Tyr Leu Asp Cys Phe Gly Thr Pro Glu Gln Ile Gly Lys Ile Gly

245 250 255

Thr Asp Ile Gln Asp Asn Lys Cys Ser Trp Val Ile Asn Lys Ala Leu

260 265 270

Glu Leu Ala Ser Ala Glu Gln Arg Lys Thr Leu Asp Glu Asn Tyr Gly

275 280 285

Lys Lys Asp Ser Val Ala Glu Ala Lys Cys Lys Lys Ile Phe Asn Asp

290 295 300

Leu Lys Ile Glu Gln Leu Tyr His Glu Tyr Glu Glu Ser Ile Ala Lys

305 310 315 320

Asp Leu Lys Ala Lys Ile Ser Gln Val Asp Glu Ser Arg Gly Phe Lys

325 330 335

Ala Asp Val Leu Thr Ala Phe Leu Asn Lys Val Tyr Lys Arg Ser Lys

340 345 350

Claims (10)

1. A construction method of recombinant saccharomyces cerevisiae for producing myrcene is characterized by comprising the following steps: the method comprises the following steps: and (3) introducing a geraniol synthetase gene and/or a limonene synthetase gene into saccharomyces cerevisiae to obtain the recombinant saccharomyces cerevisiae for producing myrcene.

2. The construction method according to claim 1, characterized in that: the geraniol synthase gene is derived from basil and/or perilla; the limonene synthetase gene is derived from wenzhou mandarin orange.

3. The construction method according to claim 1 or 2, characterized in that: the amino acid sequence of the geraniol synthase coded by the geraniol synthase gene is shown as SEQ ID No.10 and/or 11; the amino acid sequence of the limonene synthetase encoded by the limonene synthetase gene is shown as SEQ ID No. 12.

4. The construction method according to any one of claims 1 to 3, wherein:

the saccharomyces cerevisiae is capable of accumulating myrcene synthesis precursor geranyl diphosphate GPP.

5. The construction method according to any one of claims 1 to 4, wherein:

the saccharomyces cerevisiae is a bacterium obtained by improving the content and/or activity of farnesyl pyrophosphate synthetase ERG20, 3-hydroxy-3-methylglutaryl coenzyme A tHMG1, acetyl coenzyme A acyltransferase mvaE, HMG-CoA synthetase mvaS-m, isopentenyl pyrophosphate isomerase IDI1, mevalonate kinase ERG12, MVAP kinase ERG8 and/or MVAPP decarboxylase ERG19 in starting saccharomyces cerevisiae and/or reducing the expression of galactose regulator gene Ga180 gene in the starting saccharomyces cerevisiae.

6. The construction method according to any one of claims 1 to 5, wherein: the saccharomyces cerevisiae is obtained by modifying at least one of the following saccharomyces cerevisiae:

a1, introduction of farnesyl pyrophosphate synthetase gene 96-position and 127-position double-point mutant gene ERG20^F96W/N127WA gene;

a2, introduction of tHMG1 gene;

a3, introducing mvaE gene;

a4, introducing mvaS-m gene;

a5, introduction of IDI1 gene;

a6, introduction of ERG12 gene;

a7, introduction of ERG8 gene;

a8, introduction of ERG19 gene;

a9, knock-out Gal80 gene.

7. A recombinant Saccharomyces cerevisiae constructed by the method of any one of claims 1 to 6.

8. A method of producing myrcene, characterized by: comprising culturing the recombinant Saccharomyces cerevisiae of claim 7 to obtain a fermentation product, i.e., myrcene.

9. Any one of the following applications is described below,

use of X1, the method of any one of claims 1 to 7, in the manufacture of a myrcene product;

use of X2, the method of any one of claims 1 to 7, for the production of myrcene;

use of X3, the recombinant saccharomyces cerevisiae of claim 8, for the preparation of a myrcene product;

use of X4, the recombinant saccharomyces cerevisiae according to claim 8, for the production of myrcene.

10. Any one of the following applications is described below,

the application of X5, geraniol synthase gene or limonene synthase gene in preparing myrcene products;

the use of X6, a geraniol synthase gene or a limonene synthase gene for the production of myrcene;

the application of X7, geraniol synthase or limonene synthase in preparing myrcene products;

use of X8, a geraniol synthase or a limonene synthase for the production of myrcene.

Images