CN113957060A

CN113957060A - Glutamine synthetase mutant and application thereof

Info

Publication number: CN113957060A
Application number: CN202111244191.2A
Authority: CN
Inventors: 邓龙群; 张震; 陈容; 候清江; 胥南飞
Original assignee: Gevoto LLC
Current assignee: Gevoto LLC
Priority date: 2021-10-26
Filing date: 2021-10-26
Publication date: 2022-01-21
Anticipated expiration: 2041-10-26
Also published as: WO2023071438A1; CN113957060B

Abstract

The invention discloses a glutamine synthetase mutant and application thereof, relating to the technical field of genetic engineering. The 62 th amino acid site of wild glutamine synthetase from plant sources is mutated into K or deleted, and the obtained glutamine synthetase mutant has glufosinate resistance and keeps own biological enzyme catalytic activity. The plant or recombinant bacteria for transforming the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate-ammonium, and the plant glutamine synthetase mutant can be used for cultivating glufosinate-ammonium-resistant non-transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospect.

Description

Glutamine synthetase mutant and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, and particularly relates to a glutamine synthetase mutant and application thereof.

Background

Glutamine Synthase (GS) is a key enzyme in plant nitrogen metabolism that catalyzes the reaction of glutamic acid (Glu) and NH in the glutamate synthase cycle₃Condensing to form glutamine (Gln), and participating in metabolism of nitrogen-containing compounds in plants.

Glufosinate ammonium (glufosinate ammonium μ M, trade name Basta) is a glutamine synthetase (GS1) inhibitor developed by amplat (now bayer), the active ingredient of which is phosphinothricin (abbreviated as PPT), the chemical name of which is (RS) -2-amino-4- (hydroxymethylphosphinyl) ammonium butyrate. The target enzyme for glufosinate is GS, which normally forms lambda-glutamyl phosphate from ATP and glutamate (glutamate). However, after PPT treatment, PPT is firstly combined with ATP, and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed, and the activity of GS is inhibited. PPT is able to inhibit all known forms of GS.

As a result of inhibition of GS by glufosinate, disturbance of nitrogen metabolism in plants, excessive accumulation of ammonium, disintegration of chloroplasts, and thus inhibition of photosynthesis in plants may be caused, and finally, death of plants may be caused.

At present, the glufosinate-resistant variety is obtained by a method of introducing a glufosinate-resistant gene of bacteria widely applied to agriculture into crops, and the most widely applied glufosinate-resistant gene is known to be a Bar gene and a pat gene, wherein both genes can code glufosinate-ammonium acetylase, and the glufosinate-ammonium acetylase can be acetylated and inactivated by the glufosinate-ammonium acetylase. However, the worldwide acceptance of transgenic crops is still low, and the root is that the bar gene and the pat gene are derived from microorganisms, but not from the crops themselves, which easily causes the psychological conflict of consumers.

The bar gene and pat gene code glufosinate-ammonium acetylase can acetylate glufosinate to be inactivated, but before glufosinate contacts glutamine synthetase, glufosinate-ammonium acetylase can hardly inactivate glufosinate completely, and since many glutamine synthetase is distributed on cell membranes, part of unactivated glufosinate can inhibit the activity of glutamine synthetase on the cell membranes, thereby interfering with nitrogen metabolism of plants. Therefore, when the glufosinate is applied to crops with bar gene and pat gene transfer, the glufosinate interferes with nitrogen metabolism of plants to different degrees, and normal growth and development of the plants are influenced. Although the sensitivity of transgenic plants to glufosinate can be reduced to some extent by overexpression of wild-type glutamine synthetase in plants, the tolerance to glufosinate is far from sufficient for commercial application.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The present invention aims to provide a glutamine synthetase mutant and application thereof to solve the technical problems.

The invention is realized by the following steps:

the invention provides a glutamine synthetase mutant with glufosinate-ammonium resistance, which is shown in the following (1) or (2):

(1): it is obtained by mutating the nth site of wild glutamine synthetase derived from plants; the position of the nth bit is determined as follows: comparing the wild type glutamine synthetase with a reference sequence, wherein the nth position of the wild type glutamine synthetase corresponds to the 62 nd position of the reference sequence, and the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

the amino acid at the n-th position of the glutamine synthetase mutant is X, and X comprises K or deletion;

(2): the mutant has at least 85% identity to the glutamine synthetase mutant shown in (1), has the same amino acid as the glutamine synthetase mutant shown in (1) at the n-th position, and has glufosinate-ammonium resistance.

The inventor researches and discovers that the wild glutamine synthetase derived from plants is compared with a reference sequence, the nth position which is the amino acid position on the sequence corresponding to the 62 th position of the reference sequence is mutated and mutated into K or deleted, and the obtained glutamine synthetase mutant has the glufosinate-ammonium resistance and keeps the own biological enzyme catalytic activity. The plant or recombinant bacteria for transforming the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate-ammonium, the plant glutamine synthetase mutant can be used for cultivating transgenic crops, and can also be used for cultivating glufosinate-ammonium-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and the plant or recombinant bacteria have wide application prospects.

The reference sequence (SEQ ID NO.1) is a rice-derived wild-type glutamine synthetase.

Sequence alignment methods the Protein Blast alignment can be performed using the Blast website (https:// blast.ncbi.nlm.nih.gov/blast.cgi); similar results can be obtained using other sequence alignment methods or tools well known in the art.

It should be noted that the nth position of the wild-type glutamine synthetase may also be the 62 th position (for example, corn, wheat, soybean, rape, etc.) in its own sequence, but may not be the 62 th position (for example, peanut corresponds to 63 th position), and the specific position of the nth position is determined by the aforementioned sequence alignment, as long as the position corresponding to the 62 th position of the reference sequence is the nth position, i.e., mutation position, according to the present invention after the alignment with the reference sequence.

All plants share homology with wild-type glutamine synthetases, and have essentially the same function and domain in plants. Therefore, the glutamine synthetase mutant obtained by the above mutation at the 62-position of the wild-type glutamine synthetase of any plant source has glufosinate-resistance. Therefore, the glutamine synthetase mutants obtained by the above mutation of wild-type glutamine synthetase derived from any plant source fall within the scope of the present invention.

Furthermore, it is known and easily realized by those skilled in the art that the glutamine synthetase mutant obtained by further mutation has at least 85% (for example, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity with the glutamine synthetase mutant shown in (1) while performing a simple operation such as amino acid substitution, deletion, addition, or the like in a non-conserved region of the glutamine synthetase mutant shown in (1) and maintaining the amino acid at the n-th position after the mutation, and that the functions thereof, including the enzyme catalytic activity and the glufosinate-ammonium resistance, are equivalent to, slightly decreased, slightly increased, or greatly increased from the glutamine synthetase mutant shown in (1). Therefore, such glutamine synthetase enzymes should also fall within the scope of the present invention.

In a preferred embodiment of the invention, the plant is selected from wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potatoes, cotton, sesame, sunflower, radish, carrot, pepper, spinach, celery, amaranth, lettuce, garland chrysanthemum, daylily, grape, strawberry, sugar cane, brassica vegetables, cucurbits, leguminous plants, solanaceae plants, allium plants, pasture grasses, tea or cassava.

In one embodiment, the pasture is selected from grassy pasture or leguminous pasture. The grass of Gramineae is selected from timothy grass, Dactylis glomerata, Juniperus gramineus, Amylum Tritici testa, Festuca arundinacea, palm leaf, and Setaria viridis; the leguminous forage is selected from herba Medicaginis, herba Trifolii Pratentis, semen Trigonellae, nidus Vespae, and herba Evervae Cristatae. In addition, in other embodiments, the pasture grass may also be selected from turf grass.

In an alternative embodiment, the brassica vegetable includes, but is not limited to, turnip, cabbage, mustard, cabbage, moss, bitter mustard, pongamia, brassica, broccoli, rape, cauliflower, or beet.

In an alternative embodiment, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, squash, white gourd, bitter gourd, luffa, snake gourd, watermelon, or melon.

In an alternative embodiment, the legume includes, but is not limited to, mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea, peanut, or green bean.

In an alternative embodiment, the above-mentioned Allium plant includes, but is not limited to, Allium tuberosum, Allium fistulosum, Allium cepa, Allium tuberosum or Allium sativum.

In an alternative embodiment, the above-mentioned solanaceous plant includes, but is not limited to, eggplant, tomato, tobacco, pepper, or potato.

The research of the invention also finds that the glutamine synthetase has glufosinate resistance by mutating the n-th position of the glutamine synthetase from different plant sources into K or deleting the n-th position into other amino acids.

For example, in a preferred embodiment of the present invention, when the plant is rice, X is A, C, F, G, I, K, L, M, N, P, R, S, W, Y or deleted;

when the plant is soybean, X is F, K, R, W or deleted;

when the plant is maize, X is F, G, K, L, M, N, P, W, Y or deleted;

when the plant is wheat, X is G, H, I, K, L, R, Y or deleted;

when the plant is canola, X is C, F, G, K, L, M, P, R, W, Y or deleted.

In addition, deletion of X means deletion of the n-th amino acid of the wild-type glutamine synthetase, that is, deletion mutation.

Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No. 1:

MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP。

alternatively, in some embodiments of the invention, when the plant is maize, the maize wild-type glutamine synthetase is SEQ ID No. 2:

MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP。

alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No. 3:

MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP。

alternatively, in some embodiments of the invention, when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No. 4:

MALLTDLLNLDLTDSTEKIIAEYIWIGGSGMDLRSKARTLPGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGVPIPTNKRYNAAKIFSNPDVAKEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCSIGADKSFGRDIVDSHYKACLFAGVNISGINGEVMPGQWEFQVGPTVGISAGDQVWVARYLLERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKDGGFKVIVDAVEKLKLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTILWKP。

alternatively, in some embodiments of the invention, when the plant is oilseed rape, the oilseed rape wild-type glutamine synthetase is SEQ ID No. 5:

MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP。

the Similarity (Similarity) and Identity (Identity) of wild-type glutamine synthetases derived from a part of plants to each other are shown in the following table, and the results of the sequence alignment are shown in FIG. 13 and indicated by an arrow indicating amino acid 62.

The above comparison method of Similarity (Similarity) and Identity (Identity) is as follows: the amino acid sequence of a species is imported into the Blast website (https:// Blast. ncbi. nlm. nih. gov/Blast. cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of the species to other species to be aligned are found from the alignment.

The invention also provides an isolated nucleic acid molecule encoding any of the above glutamine synthetase mutants having glufosinate resistance.

In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant can be easily obtained by those skilled in the art based on the degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant can be obtained by making corresponding nucleotide mutations in a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by those skilled in the art.

For example, the nucleic acid sequence encoding the wild-type glutamine synthetase of rice is SEQ ID No. 6:

atggcttctctcaccgatctcgtcaacctcaacctctccgacaccacggagaagatcatcgccgagtacatatggatcggtggatctggcatggatctcaggagcaaggctaggactctctccggccctgtgactgatcccagcaagctgcccaagtggaactacgatggctccagcaccggccaggcccccggcgaggacagtgaggtcatcctgtacccacaggctatcttcaaggacccattcaggaagggaaacaacatccttgtcatgtgcgattgctacacgccagccggagaaccgatccccaccaacaagaggcacaatgctgccaagatcttcagctcccctgaggttgcttctgaggagccctggtacggtattgagcaagagtacaccctcctccagaaggacatcaactggccccttggctggcctgttggtggcttccctggtcctcagggtccttactactgtggtatcggtgctgacaagtcttttgggcgtgatattgttgactcccactacaaggcttgcctctatgccggcatcaacatcagtggaatcaacggcgaggtcatgccaggacagtgggagttccaagttggcccgtctgtcggcatttctgccggtgatcaggtgtgggttgctcgctacattcttgagaggatcaccgagatcgccggagtcgtcgtctcatttgaccccaagcccatcccgggagactggaacggtgctggtgctcacaccaactacagcaccaagtcgatgaggaacgatggtggctacgagatcatcaagtccgccattgagaagctcaagctcaggcacaaggagcacatctccgcctacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacaccttcagctggggagttgccaaccgcggcgcctcggtccgcgtcggccgggagacggagcagaacggcaagggctacttcgaggatcgccggccggcgtccaacatggacccttacatcgtcacctccatgatcgccgagaccaccatcatctggaagccctga。

thus, on the basis of the sequence, the corresponding nucleotide mutation is carried out on the codon corresponding to the 62 th site of the coded amino acid sequence, and the rice glutamine synthetase mutant coded by the method can be obtained.

The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO. 7:

atggcctgcctcaccgacctcgtcaacctcaacctctcggacaacaccgagaagatcatcgcggaatacatatggatcggtggatctggcatggatctcaggagcaaagcaaggaccctctccggcccggtgaccgatcccagcaagctgcccaagtggaactacgacggctccagcacgggccaggcccccggcgaggacagcgaggtcatcctgtacccgcaggccatcttcaaggacccattcaggaggggcaacaacatccttgtgatgtgcgattgctacaccccagccggcgagccaatccccaccaacaagaggtacaacgccgccaagatcttcagcagccctgaggtcgccgccgaggagccgtggtatggtattgagcaggagtacaccctcctccagaaggacaccaactggccccttgggtggcccatcggtggcttccccggccctcagggtccttactactgtggaatcggcgccgaaaagtcgttcggccgcgacatcgtggacgcccactacaaggcctgcttgtatgcgggcatcaacatcagtggcatcaacggggaggtgatgccagggcagtgggagttccaagtcgggccttccgtgggtatatcttcaggcgaccaggtctgggtcgctcgctacattcttgagaggatcacggagatcgccggtgtggtggtgacgttcgacccgaagccgatcccgggcgactggaacggcgccggcgcgcacaccaactacagcacggagtcgatgaggaaggagggcgggtacgaggtgatcaaggcggccatcgagaagctgaagctgcggcacagggagcacatcgcggcatacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacacgttcagctggggcgtggccaaccgcggcgcgtcggtgcgcgtgggccgggagacggagcagaacggcaagggctacttcgaggaccgccgcccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcatctggaagccctga。

thus, on the basis of the sequence, the corresponding nucleotide mutation is carried out on the codon corresponding to the 62 th position of the coded amino acid sequence, and the corn glutamine synthetase mutant coded as above can be obtained.

The encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO. 8:

atgtcgctgctctcagatctcatcaaccttaacctctcagacactactgagaaggtgatcgcagagtacatatggatcggtggatcaggaatggacctgaggagcaaagcaaggactctcccaggaccagttagcgacccttcaaagcttcccaagtggaactatgatggttccagcacaggccaagctcctggagaagacagtgaagtgattatatacccacaagccattttcagggatccattcagaaggggcaacaatatcttggttatctgtgatacttacactccagctggagaacccattcccactaacaagaggcacgatgctgccaaggttttcagccatcctgatgttgttgctgaagagacatggtatggtattgagcaggaatacaccttgttgcagaaagatatccaatggcctcttgggtggcctgttggtggtttccctggaccacagggtccatactactgtggtgttggcgctgacaaggcttttggccgtgacattgttgacgcacattacaaagcctgtctttatgctggcatcaacatcagtggaattaatggagaagtgatgcccggtcagtgggaattccaagttggaccttcagttggaatctcagctggtgacgaggtgtgggcagctcgttacatcttggagaggatcactgagattgctggtgtggtggtttcctttgatcccaagccaattcagggtgattggaatggtgctggtgctcacacaaactacagcactaagtccatgagaaatgatggtggctatgaagtgatcaaaaccgccattgagaagttggggaagagacacaaggagcacattgctgcttatggagaaggcaacgagcgtcgtttaacagggcgccacgaaaccgctgacatcaacaccttcttatggggagttgcaaaccgtggagcttcagttagggttgggagggacacagagaaagcagggaagggatattttgaggacagaaggccagcttctaacatggacccatatgtggttacttccatgattgcagacacaaccattctgtggaagccatga。

thus, based on the above sequence, the soybean glutamine synthetase mutant encoding the above-mentioned amino acid sequence can be obtained by performing corresponding nucleotide mutation at the codon corresponding to the 62 th position of the encoded amino acid sequence.

The encoding nucleic acid sequence of the wheat wild type glutamine synthetase is SEQ ID NO. 9:

atggcgctcctcaccgatctcctcaacctcgacctcaccgactccacggagaagatcatcgccgagtacatatggatcggcggatctggcatggatctcaggagcaaagccaggaccctccccggcccggtcaccgaccccagcaagctgcccaagtggaactacgacggctccagcaccggccaggcccccggcgaggacagcgaggtcatcctgtacccacaggccatcttcaaggacccgttcaggaagggcaacaacatccttgtcatgtgcgattgctacaccccagctggagtgccaatccccaccaacaagagatacaacgctgccaagatctttagcaaccctgatgttgccaaggaggagccatggtacggtatcgagcaggagtacaccctcctacagaaggacatcaactggcctctcggctggcctgttggtggattccctggtcctcagggtccttactactgtagtattggtgctgacaagtcgtttgggcgtgacatagttgactcccactacaaggcctgcctctttgccggcgtcaacatcagtggcatcaacggcgaggtcatgcccggacagtgggagttccaagttggcccgactgtcggcatctctgctggtgaccaagtgtgggttgctcgctaccttcttgagaggatcactgagatcgccggagttgtcgtcacatttgaccccaagcccatcccaggcgactggaacggtgctggtgctcacacaaactacagtaccgagtcgatgaggaaggacggcgggttcaaggtcatcgtggacgctgtcgagaagctcaagctgaagcacaaggagcacatcgccgcctacggcgagggcaacgagcgccgtctcaccggcaagcacgaaaccgccgacatcaacaccttcagctggggtgtcgcgaaccgtggcgcgtcggtgcgcgtgggacgggagacggagcagaacggcaagggctacttcgaggaccgccggccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcctgtggaagccctga。

thus, on the basis of the above sequence, the wheat glutamine synthetase mutant encoding the above-mentioned amino acid sequence can be obtained by carrying out corresponding nucleotide mutation at the codon corresponding to the 62 th position of the encoded amino acid sequence.

The encoding nucleic acid sequence of the rape wild type glutamine synthetase is SEQ ID NO. 10:

atgagtcttcttacagatctcgttaaccttaacctctcagagaccactgacaaaatcattgcggaatacatatgggttggaggttcaggaatggatatgagaagcaaagccaggactcttcctggaccagtgagtgacccttcggagctaccaaagtggaactatgatggctcaagcacaggccaagctcctggtgaagacagtgaagtcatcttataccctcaagccatattcaaagatcctttccgtagaggcaacaacattcttgtcatgtgcgatgcttacactccagcgggcgaaccgatcccaacaaacaaaagacacgctgcggctaaggtctttagccaccccgatgttgtagctgaagtgccatggtatggtattgagcaagagtatactttacttcagaaagatgtgaactggcctcttggttggcctattggcggcttccccggtcctcagggaccatactattgtagtgttggagcagataaatcttttggtagagacatcgttgatgctcactacaaggcctgcttatacgctggcatcaatattagtggcatcaacggagaagtcatgcctggtcagtgggagttccaagttggtccagctgttggtatctcggccggtgatgaaatttgggtcgcacgtttcattttggagaggatcacagagattgctggtgtggtggtatcttttgacccaaaaccgattcccggtgactggaatggtgctggtgctcactgcaactatagtaccaagtcaatgagggaagatggtggttacgagattattaagaaggcaatcgataaactgggactgagacacaaagaacacattgcagcttacggtgaaggcaatgagcgccgtctcacgggtcaccacgagactgctgacatcaacactttcctctggggtgttgcgaaccgtggagcatcaatccgtgtaggacgtgacacagagaaagaagggaaaggatactttgaggataggaggccagcttcgaacatggatccttacattgtgacttccatgattgcagagaccacaatcctctggaaaccttga。

thus, on the basis of the above sequence, the corresponding nucleotide mutation is carried out at the codon corresponding to the 62 th position of the encoded amino acid sequence, so as to obtain the mutant of rape glutamine synthetase encoding the above.

The invention also provides a vector comprising the nucleic acid molecule described above.

The invention provides a recombinant bacterium or a recombinant cell, which contains a nucleic acid molecule or a vector. The recombinant bacteria can be selected from agrobacterium; the recombinant cell may be a competent cell.

The invention also provides application of the glutamine synthetase mutant, the nucleic acid molecule, the vector or the recombinant bacterium or the recombinant cell with the glufosinate-ammonium resistance in cultivating plant varieties with the glufosinate-ammonium resistance.

The application comprises at least one of the following application modes:

delivering an isolated nucleic acid molecule into a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a glutamine synthetase mutant;

transforming a target plant with a vector containing a coding gene encoding a glutamine synthetase mutant;

or, the recombinant bacterium or the recombinant cell is introduced into a target plant, and the recombinant bacterium or the recombinant cell contains a coding gene for the glutamine synthetase mutant.

The isolated nucleic acid molecule may be a plasmid or DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by particle gun methods.

Transformation methods include, but are not limited to, Agrobacterium-mediated gene transformation, particle gun transformation, pollen tube channel.

The recombinant bacteria or recombinant cells can be introduced into a target plant body by an infection mode.

In a preferred embodiment of the present invention, the application includes: an endogenous glutamine synthetase gene of a target plant is modified to encode a glutamine synthetase mutant.

Based on the glutamine synthetase mutants provided by the present invention, those skilled in the art can easily think that the target plant can be modified by the conventional transgenic technology in the field, gene editing technology (such as by zinc-finger endonucleases (ZFNs), transcription activator-like effector nucleases (TALENs) or CRISPR/Cas9), mutation breeding technology (such as chemical, radiation mutagenesis, etc.), etc. to have the gene encoding the glutamine synthetase mutant, thereby obtaining a new plant variety with glufosinate resistance and capable of normal growth and development. Therefore, any technique that can be used to confer glufosinate-resistance to plants using the glutamine synthetase mutant provided by the present invention is within the scope of the present invention.

In a preferred embodiment of the present invention, the application includes: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.

In an alternative embodiment, the plant is mutagenized by physicochemical mutagenesis in a non-lethal dose to obtain plant material.

The non-lethal dose mentioned above refers to a dose controlled within a range of 20% of the semi-lethal dose.

The physical and chemical mutagenesis mode comprises one or more of the following physical mutagenesis and chemical mutagenesis modes in combination: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis including alkylating agent mutagenesis, azide mutagenesis, base analog mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis, intercalating dye mutagenesis; alkylating agent mutagenesis includes ethyl methylcyclooate mutagenesis, diethyl sulfate mutagenesis, and ethyleneimine mutagenesis.

Plants include, but are not limited to, wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, sunflower, radish, carrot, chili, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, daylily, grape, strawberry, sugarcane, brassica vegetables, cucurbits, leguminous plants, solanaceae plants, allium plants, pasture grasses, tea, or cassava.

The invention has the following beneficial effects:

the glutamine synthetase mutant provided by the invention has application potentials for constructing an expression vector for transforming plants and cultivating glufosinate-resistant crops. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more easily accepted by consumers. The mutant has good glufosinate-ammonium resistance, and the plant transformed with the glutamine synthetase mutant not only has glufosinate-ammonium resistance suitable for commercial application, but also can keep normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development requirements of the plant.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the partial alignment of amino acid sequences of rice GS1 mutants, OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X (X is a deletion) provided in example 1 of the present invention and wild-type rice GS1 OWT 1;

FIG. 2 shows the partial alignment of the amino acid sequences of soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W and GQ62X (X is deletion) provided in example 2 of the present invention and wild-type soybean GS1 GWT 1;

FIG. 3 shows the partial alignment of the amino acid sequences of maize GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X (X is deleted) and wild-type maize GS1 ZWT1 provided in example 2 of the present invention;

FIG. 4 shows the partial alignment of the amino acid sequences of wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X (X is a deletion) provided in example 2 of the present invention and wild-type wheat GS1 TWT 1;

FIG. 5 shows the results of partial alignment of amino acid sequences of mutants BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X (X is a deletion) of Brassica napus GS1 BWT1 provided in example 2 of the present invention;

FIG. 6 is a schematic structural diagram of pADV7 vector provided in Experimental example 1 of the present invention;

FIG. 7 shows the growth results of E.coli of transformed rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X provided in Experimental example 1 of the present invention and wild-type rice GS1 OWT1 on culture media containing glufosinate ammonium at different concentrations;

FIG. 8 shows the growth results of Escherichia coli transformed with soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W and GQ62X provided in Experimental example 2 of the present invention and wild-type soybean GS1 GWT1 on media containing glufosinate ammonium at different concentrations;

FIG. 9 shows the growth results of E.coli strains of maize GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X provided in transformation example 3 of the present invention and wild-type maize GS1 ZWT1 in media containing glufosinate ammonium at different concentrations;

FIG. 10 shows the growth results of Escherichia coli of wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y, TQ62X and wild-type wheat GS1 TWT1 provided in transformation example 4 of the present invention on culture media containing glufosinate ammonium at different concentrations;

FIG. 11 shows the results of growth of E.coli transformed with Brassica napus GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X provided in Experimental example 5 of the present invention on culture media containing glufosinate ammonium at different concentrations in wild-type Brassica napus GS1 BWT 1;

FIG. 12 shows the enzyme kinetic parameters and glufosinate resistance IC parameters of rice GS1 mutant OQ62X, soybean GS1 mutant GQ62X, corn GS1 mutant ZQ62X, wheat GS1 mutant TQ62X, rape GS1 mutant BQ62X, wild-type rice GS1 OWT1, wild-type soybean GS1 GWT1, wild-type corn GS1 ZWT1, wild-type wheat GS1 TWT1 and wild-type rape GS1 BWT1 provided in Experimental example 6 of the present invention₅₀；

FIG. 13 shows the alignment of amino acid sequences of wild-type glutamine synthetases of different plants; in the figure: TWT 1: wild-type glutamine synthetase body of wheat; OWT 1: rice wild-type glutamine synthetase; ZWT 1: corn wild-type glutamine synthetase; GWT 1: soybean wild-type glutamine synthetase; BWT 1: rape wild-type glutamine synthetase.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the formulations or unit dosages herein, some are now described. Unless otherwise indicated, the techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are well explained in the literature, e.g. "molecular cloning: a Laboratory Manual, second edition (Sambrook et al, 1989); oligonucleotide Synthesis (oligo Synthesis) (eds. m.j. goal, 1984); plant physiology (Cangjing et al, 2017); methods in Enzymology (Methods in Enzymology), Academic Press Inc. (Academic Press, Inc.), "Handbook of Experimental Immunology" ("D.M.Weir and C.C.Black well)," Current Protocols in Molecular Biology "(F.M.Ausubel et al, 1987)," plant Molecular genetics "(Monica A.Hughes et al)," PCR: Polymerase Chain Reaction (PCR: The Polymer Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

The mutant of the rice (Oryza sativa) glutamine synthetase (GS1) provided in this example is obtained by mutating or deleting amino acid residue Q at position 62 of wild-type rice glutamine synthetase (named as OWT1, the amino acid sequence of which is shown in SEQ ID No.1 and the encoding nucleotide sequence of which is SEQ ID No.6) to A, C, F, G, I, K, L, M, N, P, R, S, W, Y, and the obtained rice GS1 mutants are named as OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X, respectively.

The alignment of the amino acid sequences of rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y, OQ62X and wild-type rice GS1 is shown in fig. 1: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rice GS1 mutant is shown in the following table at the position of coding amino acid 62, the codon used for the corresponding amino acid is shown in the table, and the nucleotide at the other positions is the corresponding wild type coding sequence.

Amino acids	A	C	F	G	I
						Codons	GCC	TGC	TTC	GGC	ATC
Amino acids	K	L	M	N	P
						Codons	AAG	CTC	ATG	AAC	CCC
Amino acids	R	S	W	Y	Deleting
						Codons	CGG	TCT	TGG	TAC	Is free of

The rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X provided by the embodiment and the nucleic acid molecules for coding the same can be obtained by a chemical synthesis method.

Example 2

The soybean (Glycine max) GS1 mutant provided in this example is obtained by mutating F, K, R, W or deleting F, K, R, W from amino acid residue Q at position 62 (position 62 corresponding to the reference sequence (SEQ ID NO. 1)) of wild-type soybean GS1 per se (named GWT1, wherein the amino acid sequence is shown in SEQ ID NO.3, and the coding nucleotide sequence is SEQ ID NO. 8). the obtained soybean GS1 mutants of rice are named GQ62F, GQ62K, GQ62R, GQ62W and GQ62X, respectively.

The amino acid sequence alignment of soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W, GQ62X and wild-type soybean GS1 is shown in fig. 2, in which: the position indicated by the arrow is the mutation site.

The coding sequences of soybean GS1 mutants GQ62F, GQ62K, GQ62R, GQ62W and GQ62X provided in this example correspond to SEQ ID No. 3.

In this example, the coding sequence of each soybean GS1 mutant is shown in the following table at the position encoding amino acid 62, the codon for the corresponding amino acid is shown in the table, and the nucleotides at the other positions are the same as the corresponding wild-type coding sequence.

Amino acids	F	K	R	W	Deleting
						Codons	TTC	AAG	CGG	TGG	Is free of

The soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W and GQ62X provided by the embodiment and nucleic acid molecules for encoding the same can be obtained by a chemical synthesis method.

Example 3

The maize (Zea mays) GS1 mutant provided in this example was obtained by mutating amino acid residue Q to F, G, K, L, M, N, P, W, Y or deleting at position 62 (corresponding to position 62 of the reference sequence (SEQ ID No. 1)) of wild type maize GS1 itself (designated as ZWT1, amino acid sequence shown as SEQ ID No.2, encoding nucleotide sequence SEQ ID No. 7). The resulting maize GS1 mutants were named ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y, and ZQ62X, respectively.

The amino acid sequence alignment of maize GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y, ZQ62X and wild-type maize GS1 is shown in figure 3, where: the position indicated by the arrow is the mutation site.

In this example, the coding sequence for each maize GS1 mutant was shown in the table below for the codon encoding amino acid 62, with the remaining nucleotides being identical to the corresponding wild-type coding sequence.

Amino acids	F	G	K	L	M
						Codons	TTC	GGC	AAG	CTC	ATG
Amino acids	N	P	W	Y	Deleting
						Codons	AAC	CCC	TGG	TAC	Is free of

The maize GS1 mutants provided in this example, ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X, and the nucleic acid molecules encoding them, can all be obtained by chemical synthesis.

Example 4

The wheat (Triticum aestivum) GS1 mutant provided in this example is obtained by mutating amino acid residue Q to G, H, I, K, L, R, Y or deleting at position 62 (corresponding to position 62 of the reference sequence (SEQ ID No. 1)) of wild type wheat GS1 (named as TWT1, and the amino acid sequence is shown in SEQ ID No.4 and the coding nucleotide sequence is SEQ ID No. 9). The resulting wheat GS1 mutants were named TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X, respectively.

Alignment of amino acid sequences of wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y, TQ62X and wild type wheat GS1 is shown in fig. 4, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each wheat GS1 mutant is shown in the following table at the position encoding amino acid 62, the codon for the corresponding amino acid is shown in the table, and the nucleotides at the other positions are identical to the corresponding wild-type coding sequence.

The wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X provided by the embodiment and nucleic acid molecules encoding the same can be obtained by a chemical synthesis method.

Example 5

The rape (Brassica napus) GS1 mutant provided by the embodiment is obtained by mutating or deleting amino acid residue Q to C, F, G, K, L, M, P, R, W, Y at the 62 th position (corresponding to the 62 th position of a reference sequence (SEQ ID NO. 1)) of wild-type rape GS1 (named as BWT1, wherein the amino acid sequence is shown as SEQ ID NO.5 and the coding nucleotide sequence is SEQ ID NO. 10). The obtained rape GS1 mutants are named as BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X respectively.

The amino acid sequence alignment of rape GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y, BQ62X and wild-type rape GS1 is shown in fig. 5, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rape GS1 mutant is shown in the following table at the position encoding amino acid 62, the codon for the corresponding amino acid is shown in the table, and the nucleotides at the other positions are the same as the corresponding wild type coding sequence.

The mutants of rape GS1, BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X, and the nucleic acid molecules for coding the mutants can be obtained by chemical synthesis.

Experimental example 1

The mutant rice GS1 provided in example 1, OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X, were each tested for glufosinate resistance. The glufosinate-ammonium resistance detection method is as follows:

coding genes encoding rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X were synthesized by chemical synthesis based on the sequences of the nucleic acid molecules provided in example 1, and enzyme cleavage sites (Pac1 and Sbf1) were introduced at both ends of the coding genes, and after enzyme cleavage, the coding genes were ligated to an expression vector (for example, a pADV7 vector, the structure of which is shown in FIG. 6) subjected to the same enzyme cleavage treatment, and then glutamine synthetase-deficient E.coli was transformed, after verification, a positive clone was selected and inoculated to M9 medium containing glufosinate ammonium at different concentrations to grow, and the growth of the deficient E.coli was observed. The wild-type rice GS1 mutant was used as a negative control to test glufosinate resistance containing GS1 mutant OQ62A (Q62A, in which amino acid Q at position 62 of rice GS1 was mutated to a), OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X (Q62X, amino acid Q deletion at position 62 of rice GS 1). The results are shown in FIG. 7.

On a medium containing 0mM glufosinate ammonium (KP0), defective strains of coding genes encoding wild-type rice GS1(OWT1) and rice GS1 mutants, OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X all grew normally, indicating that the genes encoded by OQ62A, OQ 69562 62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62 367, OQ62M, OQ62N, OQ62 GS 36 62L 2 and OQ62N all have normal enzyme activity.

Coli transformed with wild-type rice GS1 could not grow on medium containing 10mM glufosinate ammonium (KP10), but escherichia coli transformed with rice mutants OQ62A, OQ62C and OQ62C were significantly better than the negative control, indicating that escherichia coli containing OQ62C, OQ62C and OQ62C were significantly better than the wild-type glufosinate ammonium-resistant mutants.

Coli transformed with the rice GS1 mutant OQ62A, OQ62F, OQ62G, OQ62I, OQ62K, OQ62N, OQ62P, OQ62R, OQ62W, OQ62Y and OQ62X all showed significant growth in medium with better glufosinate concentration (20mM, KP 20).

These results indicate that single mutants of OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ62Y and OQ62X all have resistance to glufosinate.

Experimental example 2

With reference to the detection method of experimental example 1, the glufosinate-ammonium resistance of the soybean GS1 mutant GQ62F (Q62F, in which the amino acid Q at position 62 of soybean GS1 is mutated to F), GQ62K, GQ62R, GQ62W, and GQ62X (Q62X, in which the amino acid Q at position 62 of soybean GS1 is deleted) provided in example 2 was verified. The results are shown in FIG. 8.

From the results of fig. 8, it can be seen that:

on a culture medium containing 0mM glufosinate ammonium (KP0), the deficient strains of coding genes of wild soybean GS1(GWT1) and soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W and GQ62X are transformed to grow normally, which shows that the GS1 coded by GQ62F, GQ62K, GQ62R, GQ62W and GQ62X has normal GS1 enzyme activity;

on a culture medium containing 1mM glufosinate ammonium (KP1), Escherichia coli transformed with wild-type soybean GS1 can not grow basically, but Escherichia coli transformed with soybean mutants GQ62F, GQ62K, GQ62R, GQ62W and GQ62X grow obviously better than a negative control, which shows that the single mutants containing GQ62F, GQ62K, GQ62R, GQ62W and GQ62X have glufosinate ammonium resistance obviously better than the wild type; coli transformed with the soybean GS1 mutant GQ62X also showed significant growth on medium with higher glufosinate concentration (20mM, KP 20).

These results indicate that the single mutants of GQ62F, GQ62K, GQ62R, GQ62W and GQ62X all have glufosinate resistance, and the soybean GS1 mutant, GQ62X, has stronger glufosinate resistance.

Experimental example 3

With reference to the detection method of experimental example 1, glufosinate resistance of the maize GS1 mutant ZQ62F (Q62F, where the amino acid Q at position 62 of maize GS1 is mutated to F), ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y, and ZQ62X (Q62X, where the amino acid Q at position 62 of maize GS1 is deleted) provided in example 3 was verified. The results are shown in FIG. 9.

From the results of fig. 9, it can be seen that:

transformation of defective strains encoding genes encoding wild-type maize GS1(ZWT1) and maize GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X all grew normally on medium containing 0mM glufosinate ammonium (KP0), indicating that GS1 encoded by ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X all had normal GS1 enzyme activity;

coli transformed with wild-type maize GS1 was substantially unable to grow on medium containing 2mM glufosinate (KP2), but coli transformed with maize mutants ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X grew significantly better than the negative control, indicating that single mutants containing ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y and ZQ62X had significantly better glufosinate resistance than the wild-type; coli transformed with the maize GS1 mutants ZQ62K and ZQ62X also grew significantly on medium with higher glufosinate concentrations (20mM, KP 20).

These results indicate that single mutants of ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ62Y, and ZQ62X all have resistance to glufosinate.

Experimental example 4

With reference to the test method of experimental example 1, glufosinate resistance of the wheat GS1 mutant TQ62G provided in example 4 (Q62G, where the amino acid Q at position 62 of wheat GS1 is mutated to G), TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X (Q62X, where the amino acid Q at position 62 of wheat GS1 is deleted) was verified. The results are shown in FIG. 10.

From the results of fig. 10, it can be seen that:

on a culture medium containing 0mM glufosinate ammonium (KP0), defective strains transformed with coding genes encoding wild-type wheat GS1(TWT1) and wheat GS1 mutants TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X all grew normally, indicating that GS1 encoded by TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X all have normal GS1 enzyme activity;

on a culture medium containing 2mM glufosinate ammonium (KP2), Escherichia coli transformed with wild type wheat GS1 can not grow basically, but Escherichia coli transformed with wheat mutants TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X are obviously superior to negative control in growth, and the single mutants containing TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X are obviously superior to wild type in glufosinate ammonium resistance; coli transformed with the wheat GS1 mutants TQ62G, TQ62H, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X all also grew significantly on medium with higher glufosinate concentrations (20mM, KP 20).

These results indicate that the single mutants of TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X all have glufosinate resistance, and the wheat GS1 mutants TQ62G, TQ62H, TQ62K, TQ62L, TQ62R, TQ62Y and TQ62X have stronger glufosinate resistance.

Experimental example 5

With reference to the test method of experimental example 1, glufosinate resistance of the mutant BQ62C of canola GS1 (Q62C, amino acid Q at position 62 of canola GS1 was mutated to C), BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X (Q62X, amino acid Q at position 62 of canola GS1 was deleted) provided in example 5 was verified. The results are shown in FIG. 11.

From the results of fig. 11, it can be seen that:

on a culture medium containing 0mM glufosinate ammonium (KP0), defective strains of coding genes for wild-type rape GS1(BWT1) and rape GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X are transformed to grow normally, which shows that the GS1 coded by BQ62C, BQ62F, BQ62G, BQ62K, BQ62 GS 62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X have normal enzyme activity of 1;

coli transformed with wild type canola GS1 was substantially unable to grow on medium containing 1mM glufosinate (KP1), but e.coli transformed with canola mutants BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X grew significantly better than the negative control, indicating that single mutants containing BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X had significantly better glufosinate resistance than the wild type; coli transformed with the oilseed rape GS1 mutant BQ62P, BQ62R and BQ62X all also showed significant growth on medium with higher glufosinate concentrations (20mM, KP 20).

These results indicate that the single mutants of BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X all have glufosinate-resistant ability, and the mutants of canola GS1, BQ62P, BQ62R and BQ62X, have stronger glufosinate-resistant ability.

Experimental example 6

The enzyme kinetic parameters of OQ62X provided in example 1, GQ62X provided in example 2, ZQ62X provided in example 3, TQ62X provided in example 4 and BQ62X mutant provided in example 5 and the enzyme kinetic parameters in the presence of glufosinate were examined separately, with wild-type rice GS1 OWT1, wild-type soybean GS1 GWT1, wild-type corn GS1 ZWT1, wild-type wheat GS1 t1 and wild-type rape GS1 BWT1 as controls, respectively, as follows:

vector construction:

the nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the clone is verified through sequencing.

6His protein purification:

the mutant enzyme protein was purified by 6His and by standard methods, and the concentration was determined by the Bradford method protein concentration determination kit, and the protein was stored in a protein stock solution.

And (3) enzyme activity determination:

1. instruments and reagents: microplate reader (DeFei: HBS-1096A), glufosinate-ammonium (Rier chemical Co., Ltd.), substrate L-sodium glutamate (CAS: 6106-04-3).

2. The method comprises the following operation steps:

the components of the reaction liquid for measuring the enzyme activity of the glutamine synthetase are as follows: 100mM Tris-HCl (pH7.5), 5mM ATP, 10mM sodium L-glutamate, 30mM hydroxyethylamine, 20mM MgCl₂. Mixing 100 μ L reaction solution, preheating at 35 deg.C for 5min, adding 1 μ L mutant protein solution (protein concentration of 200ug/ml) to start reaction, reacting at 35 deg.C for 60min, adding 110 μ L reaction termination solution (55g/L FeCl)₃·6H₂O, 20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) and left to stand for 10 min. Centrifugation at 5000 Xg for 10min, and measurement of light absorption at 500nm using 200. mu.l.

The results are shown in FIG. 12.

From the results of fig. 12, it can be seen that:

the higher Km values of the GS1 mutant compared to the wild-type controls OWT1, GWT1, ZWT1, TWT1 and BWT1 all indicate that the GS mutant has reduced sensitivity to normal substrates while reducing sensitivity to glufosinate inhibitors. The Vmax of GS1 mutant is higher than that of wild type control, which shows that the enzyme catalytic ability of the mutants is improved. Wild type controls are sensitive to glufosinate-ammonium, IC₅₀7.93. mu.M, 13.55. mu.M, 8.92. mu.M, 7.22. mu.M and 1.53. mu.M, respectively, IC of the mutant₅₀All significantly higher than the IC of the wild type control, GQ62X, ZQ62X, TQ62X and BQ62X₅₀Much higher than the wild-type control, indicating that the mutant is less sensitive to glufosinate-ammonium.

From mutant IC₅₀And wild type IC₅₀In a multiple relation ofAs can be seen, the ICs of OQ62X, GQ62X, ZQ62X, TQ62X and BQ62X₅₀3.70-, 20.88-, 22.05-, 28.38-and 110.56-fold respectively compared to the IC50 of the corresponding wild-type GS1, which also indicates that the enzyme activity of the mutant is much higher than that of the wild-type control. These data demonstrate the glufosinate-resistance mechanism of the mutants from enzyme kinetics.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Sichuan Yu Xing He Biotech Co., Ltd

<120> glutamine synthetase mutant and application thereof

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 356

<212> PRT

<213> Artificial sequence

<400> 1

Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr

1 5 10 15

Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys

100 105 110

Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly

130 135 140

Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys

260 265 270

Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu

305 310 315 320

Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Ile Trp Lys Pro

355

<210> 2

<211> 356

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr

1 5 10 15

Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys

100 105 110

Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly

130 135 140

Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser

245 250 255

Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys

260 265 270

Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu

305 310 315 320

Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Ile Trp Lys Pro

355

<210> 3

<211> 356

<212> PRT

<213> Artificial sequence

<400> 3

Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr

1 5 10 15

Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys

100 105 110

Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly

130 135 140

Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys

260 265 270

Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp

305 310 315 320

Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile

340 345 350

Leu Trp Lys Pro

355

<210> 4

<211> 356

<212> PRT

<213> Artificial sequence

<400> 4

Met Ala Leu Leu Thr Asp Leu Leu Asn Leu Asp Leu Thr Asp Ser Thr

1 5 10 15

Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Thr Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr

85 90 95

Pro Ala Gly Val Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys

100 105 110

Ile Phe Ser Asn Pro Asp Val Ala Lys Glu Glu Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly

130 135 140

Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser

145 150 155 160

Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr

165 170 175

Lys Ala Cys Leu Phe Ala Gly Val Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Thr Val Gly Ile

195 200 205

Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Leu Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser

245 250 255

Met Arg Lys Asp Gly Gly Phe Lys Val Ile Val Asp Ala Val Glu Lys

260 265 270

Leu Lys Leu Lys His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Lys His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu

305 310 315 320

Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Leu Trp Lys Pro

355

<210> 5

<211> 356

<212> PRT

<213> Artificial sequence

<400> 5

Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr

1 5 10 15

Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp

20 25 30

Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser

35 40 45

Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys

100 105 110

Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly

130 135 140

Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser

145 150 155 160

Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile

195 200 205

Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys

260 265 270

Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp

305 310 315 320

Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Leu Trp Lys Pro

355

<210> 6

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 6

atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60

gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120

tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180

ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240

ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300

ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360

tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420

tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480

atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540

tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600

caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660

cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720

ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780

ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840

atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900

atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960

acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020

tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071

<210> 7

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 7

atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60

gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120

tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180

ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240

ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300

ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360

gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420

tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480

atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540

tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600

caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660

cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720

ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780

ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840

atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900

atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960

acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020

tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071

<210> 8

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 8

atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60

gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120

ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180

ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240

ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300

cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360

gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420

tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480

gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540

tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600

caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660

ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720

ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780

ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840

attgctgctt atggagaagg caacgagcgt cgtttaacag ggcgccacga aaccgctgac 900

atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960

acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020

tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071

<210> 9

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 9

atggcgctcc tcaccgatct cctcaacctc gacctcaccg actccacgga gaagatcatc 60

gccgagtaca tatggatcgg cggatctggc atggatctca ggagcaaagc caggaccctc 120

cccggcccgg tcaccgaccc cagcaagctg cccaagtgga actacgacgg ctccagcacc 180

ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cacaggccat cttcaaggac 240

ccgttcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggagtg 300

ccaatcccca ccaacaagag atacaacgct gccaagatct ttagcaaccc tgatgttgcc 360

aaggaggagc catggtacgg tatcgagcag gagtacaccc tcctacagaa ggacatcaac 420

tggcctctcg gctggcctgt tggtggattc cctggtcctc agggtcctta ctactgtagt 480

attggtgctg acaagtcgtt tgggcgtgac atagttgact cccactacaa ggcctgcctc 540

tttgccggcg tcaacatcag tggcatcaac ggcgaggtca tgcccggaca gtgggagttc 600

caagttggcc cgactgtcgg catctctgct ggtgaccaag tgtgggttgc tcgctacctt 660

cttgagagga tcactgagat cgccggagtt gtcgtcacat ttgaccccaa gcccatccca 720

ggcgactgga acggtgctgg tgctcacaca aactacagta ccgagtcgat gaggaaggac 780

ggcgggttca aggtcatcgt ggacgctgtc gagaagctca agctgaagca caaggagcac 840

atcgccgcct acggcgaggg caacgagcgc cgtctcaccg gcaagcacga aaccgccgac 900

atcaacacct tcagctgggg tgtcgcgaac cgtggcgcgt cggtgcgcgt gggacgggag 960

acggagcaga acggcaaggg ctacttcgag gaccgccggc cggcgtccaa catggacccc 1020

tacgtggtca cctccatgat cgccgagacc accatcctgt ggaagccctg a 1071

<210> 10

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 10

atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60

gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120

cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180

ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240

cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300

ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360

gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420

tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480

gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540

tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600

caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660

ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720

ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780

ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840

attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900

atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960

acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020

tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims

1. A glufosinate-resistant glutamine synthetase mutant characterized in that it is represented by the following (1) or (2):

(1): it is obtained by mutating the nth site of wild glutamine synthetase derived from plants; the position of the nth bit is determined as follows: the wild-type glutamine synthetase is aligned with a reference sequence, the nth position of the wild-type glutamine synthetase corresponds to the 62 th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

the amino acid at the nth position of the glutamine synthetase mutant is X, and X comprises K or deletion;

2. The glufosinate-resistant glutamine synthetase mutant according to claim 1, wherein the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, sunflower, radish, carrot, chili, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugar cane, brassica vegetables, cucurbits, leguminous plants, solanaceae plants, allium plants, pasture grass, tea or cassava;

preferably, the pasture is selected from grassy pasture or leguminous pasture;

preferably, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage, moss, bitter mustard, cabbage, brassica, cabbage, rape, cauliflower or beet;

preferably, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, balsam pear, towel gourd, snake melon, watermelon or melon;

preferably, the leguminous plant is selected from mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea, peanut, or green soy bean;

the Allium plant is selected from folium Allii tuberosi, herba Alii Fistulosi, Bulbus Allii Cepae, leek or Bulbus Allii;

the Solanaceae plant is selected from eggplant, tomato, tobacco, pepper or potato.

3. The glufosinate-resistant glutamine synthetase mutant according to claim 1 or 2, wherein when the plant is rice, X is A, C, F, G, I, K, L, M, N, P, R, S, W, Y or deleted;

when the plant is soybean, X is F, K, R, W or deleted;

when the plant is maize, X is F, G, K, L, M, N, P, W, Y or deleted;

when the plant is wheat, X is G, H, I, K, L, R, Y or deleted;

when the plant is canola, X is C, F, G, K, L, M, P, R, W, Y or deleted.

4. An isolated nucleic acid molecule encoding a glufosinate-resistant glutamine synthetase mutant according to any of claims 1-3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A recombinant bacterium or a recombinant cell comprising the nucleic acid molecule according to claim 4 or the vector according to claim 5.

7. Use of a glufosinate-resistant glutamine synthetase mutant according to any of claims 1-3, a nucleic acid molecule according to claim 4, a vector according to claim 5 or a recombinant bacterium or recombinant cell according to claim 6 for breeding of a plant variety that is glufosinate-resistant.

8. The use according to claim 7, characterized in that it comprises at least one of the following modes of application:

delivering an isolated nucleic acid molecule comprising a gene encoding said glutamine synthetase mutant into a plant cell of interest;

transforming a plant of interest with the vector, the vector containing a coding gene encoding the glutamine synthetase mutant;

or, the recombinant bacterium or the recombinant cell is introduced into a target plant, and the recombinant bacterium or the recombinant cell contains a coding gene for coding the glutamine synthetase mutant.

9. Use according to claim 7, characterized in that it comprises: modifying an endogenous glutamine synthetase gene of a plant of interest to encode the glutamine synthetase mutant.

10. Use according to claim 8 or 9, characterized in that it comprises: mutagenizing and screening a plant cell, tissue, individual or population to encode said glutamine synthetase mutant;

the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, sunflower, radish, carrot, capsicum, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugar cane, brassica vegetable, cucurbitaceae, leguminous plant, solanaceae plant, allium plant, pasture grass, tea or cassava;

preferably, the pasture is selected from grassy pasture or leguminous pasture;