CN113957060B - Glutamine synthetase mutant and application thereof - Google Patents

Glutamine synthetase mutant and application thereof Download PDF

Info

Publication number
CN113957060B
CN113957060B CN202111244191.2A CN202111244191A CN113957060B CN 113957060 B CN113957060 B CN 113957060B CN 202111244191 A CN202111244191 A CN 202111244191A CN 113957060 B CN113957060 B CN 113957060B
Authority
CN
China
Prior art keywords
gly
glutamine synthetase
mutant
ile
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111244191.2A
Other languages
Chinese (zh)
Other versions
CN113957060A (en
Inventor
邓龙群
张震
陈容
候清江
胥南飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gevoto LLC
Original Assignee
Gevoto LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gevoto LLC filed Critical Gevoto LLC
Priority to CN202111244191.2A priority Critical patent/CN113957060B/en
Publication of CN113957060A publication Critical patent/CN113957060A/en
Priority to PCT/CN2022/113149 priority patent/WO2023071438A1/en
Application granted granted Critical
Publication of CN113957060B publication Critical patent/CN113957060B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277—Phosphinotricin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a glutamine synthetase mutant and application thereof, and relates to the technical field of genetic engineering. The wild type glutamine synthetase 62 th site of plant source is mutated into K or deleted, and the obtained glutamine synthetase mutant has glufosinate resistance and simultaneously maintains the own biological enzyme catalytic activity. The plant or recombinant bacteria transformed by the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant can be used for cultivating glufosinate-resistant non-transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has a wide application prospect.

Description

Glutamine synthetase mutant and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a glutamine synthetase mutant and application thereof.
Background
Glutamine synthetase (Glutamine synthetase, GS) is a key enzyme in nitrogen metabolism in plants, which catalyzes the condensation of glutamic acid (Glu) with NH 3 to form glutamine (gin) in the glutamate synthetase cycle, involved in the metabolism of nitrogen-containing compounds in plants.
Glufosinate (glufosinate ammoni. Mu.M), commercially available from Basta, is a glutamine synthetase (GS 1) inhibitor developed by Anvant (now Bayer), the active ingredient of which is phosphinothricin (PPT for short), the chemical name of which is (RS) -2-amino-4- (hydroxymethylphosphino) ammonium butyrate. The target enzyme for glufosinate is GS, which can normally form lambda-glutamyl phosphate (lambda-glutamyl phosphate) from ATP and glutamate (glutamate). However, after PPT treatment, PPT is first bound to ATP and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed and GS activity is inhibited. PPT inhibits all known forms of GS.
As a result of the inhibition of GS by glufosinate, it can lead to nitrogen metabolism disorders in plants, excessive accumulation of ammonium, chloroplast disintegration, and thus inhibition of photosynthesis in plants, and ultimately, death of plants.
At present, the method for introducing the glufosinate-resistant genes of bacteria into crops is widely used in agriculture to obtain the glufosinate-resistant varieties, and the glufosinate-resistant genes with the most wide application are Bar genes and pat genes, wherein the Bar genes and the pat genes can code glufosinate acetylase, and the glufosinate acetylase can be inactivated by the enzyme. However, the acceptance of transgenic crops worldwide is still low, the root cause being that bar and pat genes are derived from microorganisms, not from the crops themselves, which easily cause contradiction to consumers.
Although the glufosinate acetylases encoded by the bar and pat genes can inactivate glufosinate, it is difficult for glufosinate acetylases to inactivate glufosinate completely before it contacts glutamine synthetase, and since many glutamine synthetases are distributed on the cell membrane, part of the undegraded glufosinate can inhibit the activity of glutamine synthetase on the cell membrane, thereby interfering with nitrogen metabolism of plants. Therefore, when the glufosinate is applied to crops with the bar gene and the pat gene, nitrogen metabolism of plants can be disturbed to different degrees, and normal growth and development of the plants can be influenced. Although the sensitivity of transgenic plants to glufosinate can be reduced to some extent by overexpressing wild-type glutamine synthetase in plants, the degree of tolerance to glufosinate is far from adequate for commercial use.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a glutamine synthetase mutant and application thereof to solve the technical problems.
The invention is realized in the following way:
The invention provides a glutamine synthetase mutant with glufosinate resistance, which is shown in the following (1) or (2):
(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with a reference sequence, the nth position of the wild type glutamine synthetase corresponds to the 62 th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;
the n-th amino acid of the glutamine synthetase mutant is X, wherein X comprises K or deletion;
(2): which has at least 85% identity with the glutamine synthetase mutant shown in (1), is identical to the glutamine synthetase mutant shown in (1) in the n-th amino acid, and has glufosinate resistance.
The inventor researches and discovers that the wild type glutamine synthetase of plant origin is compared with a reference sequence, the amino acid site corresponding to the 62 th site of the reference sequence, namely the nth site, is mutated into K or deleted, and the obtained glutamine synthetase mutant has glufosinate resistance and maintains own biological enzyme catalytic activity. The plant or recombinant bacteria transformed with the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospects.
The above reference sequence (SEQ ID NO. 1) is a wild-type glutamine synthetase of rice origin.
The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.
It should be noted that the nth position of the wild-type glutamine synthetase may be the 62 nd position (for example, corn, wheat, soybean, rape, etc.) on its own sequence, but may not be the 62 nd position (for example, peanut corresponds to the 63 rd position), and the specific position of the nth position is determined according to the alignment of the sequences, so long as the position corresponding to the 62 th position of the reference sequence is the nth position, that is, the mutation position, after the comparison with the reference sequence.
All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, the mutant glutamine synthetase obtained after the above mutation at position 62 of any plant-derived wild type glutamine synthetase has glufosinate resistance. Thus, the mutant glutamine synthetase obtained by mutating a wild type glutamine synthetase of any plant origin falls within the scope of the present invention.
Furthermore, it is known and easily achieved by those skilled in the art that a glutamine synthetase mutant represented by (1) is subjected to a simple amino acid substitution, deletion, addition, or the like in a non-conserved region thereof, and the n-th position is maintained as an amino acid after the above mutation, and the glutamine synthetase mutant obtained by further mutation has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.) or more identity with the glutamine synthetase mutant represented by (1), and its functions include an enzyme catalytic activity and a glufosinate resistance which are equivalent to or slightly decreased or slightly increased or greatly increased as those of the glutamine synthetase mutant represented by (1). Therefore, such glutamine synthetases should also fall within the scope of the present invention.
In a preferred embodiment of the present invention, the plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, sunflower, radish, carrot, capsicum, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugarcane, brassica vegetables, cucurbitaceae, leguminous plants, solanaceae, allium plants, pasture, tea, and cassava.
In one embodiment, the pasture is selected from gramineous pasture or leguminous pasture. Gramineous forage grass is selected from timothy grass, festuca arundinacea, june grass, wheat middling, festuca arundinacea, brown leaf, green bristlegrass and the like; the leguminous forage is selected from alfalfa, clover bean, green Chinese herb, corn grass, etc. In addition, in other embodiments, the pasture may be selected from turf grass.
In an alternative embodiment, the brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, canola, rape, cauliflower, or beet.
In an alternative embodiment, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, wax gourd, bitter gourd, towel gourd, melon, watermelon, or melon.
In an alternative embodiment, the leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, peanuts, or green beans.
In an alternative embodiment, the Allium plant includes, but is not limited to, leek, welsh onion, leek, or garlic.
In an alternative embodiment, the aforementioned solanaceous plants include, but are not limited to, eggplant, tomato, tobacco, pepper, or potato.
The studies of the present invention have also found that mutation of the n-th position of glutamine synthetase to K or deletion, in addition to other amino acids, also renders the glutamine synthetase resistant to glufosinate.
For example, in a preferred embodiment of the invention, when the plant is rice, x= A, C, F, G, I, K, L, M, N, P, R, S, W, Y or a deletion;
When the plant is soybean, x= F, K, R, W or deleted;
When the plant is maize, x= F, G, K, L, M, N, P, W, Y or delete;
when the plant is wheat, x= G, H, I, K, L, R, Y or delete;
When the plant is canola, x= C, F, G, K, L, M, P, R, W, Y or deleted.
X=deletion means that the n-th amino acid of the wild-type glutamine synthetase is deleted, i.e., a deletion mutation.
Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:
MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP.
alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:
MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP.
Alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3:
MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP.
Alternatively, in some embodiments of the invention, when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No.4:
MALLTDLLNLDLTDSTEKIIAEYIWIGGSGMDLRSKARTLPGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGVPIPTNKRYNAAKIFSNPDVAKEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCSIGADKSFGRDIVDSHYKACLFAGVNISGINGEVMPGQWEFQVGPTVGISAGDQVWVARYLLERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKDGGFKVIVDAVEKLKLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTILWKP.
Alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.5:
MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP.
The Similarity and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin are shown in the following table, and the partial results of the sequence alignment are shown in FIG. 13, with the arrow indicating amino acid 62.
The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.
The invention also provides an isolated nucleic acid molecule encoding any of the glufosinate-resistant glutamine synthetase mutants described above.
In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant is easily obtained by a person skilled in the art based on degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant may be obtained by mutating a corresponding nucleotide to a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by one skilled in the art.
For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.6:
atggcttctctcaccgatctcgtcaacctcaacctctccgacaccacggagaagatcatcgccgagtacatatggatcggtggatctggcatggatctcaggagcaaggctaggactctctccggccctgtgactgatcccagcaagctgcccaagtggaactacgatggctccagcaccggccaggcccccggcgaggacagtgaggtcatcctgtacccacaggctatcttcaaggacccattcaggaagggaaacaacatccttgtcatgtgcgattgctacacgccagccggagaaccgatccccaccaacaagaggcacaatgctgccaagatcttcagctcccctgaggttgcttctgaggagccctggtacggtattgagcaagagtacaccctcctccagaaggacatcaactggccccttggctggcctgttggtggcttccctggtcctcagggtccttactactgtggtatcggtgctgacaagtcttttgggcgtgatattgttgactcccactacaaggcttgcctctatgccggcatcaacatcagtggaatcaacggcgaggtcatgccaggacagtgggagttccaagttggcccgtctgtcggcatttctgccggtgatcaggtgtgggttgctcgctacattcttgagaggatcaccgagatcgccggagtcgtcgtctcatttgaccccaagcccatcccgggagactggaacggtgctggtgctcacaccaactacagcaccaagtcgatgaggaacgatggtggctacgagatcatcaagtccgccattgagaagctcaagctcaggcacaaggagcacatctccgcctacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacaccttcagctggggagttgccaaccgcggcgcctcggtccgcgtcggccgggagacggagcagaacggcaagggctacttcgaggatcgccggccggcgtccaacatggacccttacatcgtcacctccatgatcgccgagaccaccatcatctggaagccctga.
Accordingly, on a sequence basis, a rice glutamine synthetase mutant encoding the above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to position 62 of the encoded amino acid sequence.
The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.7:
atggcctgcctcaccgacctcgtcaacctcaacctctcggacaacaccgagaagatcatcgcggaatacatatggatcggtggatctggcatggatctcaggagcaaagcaaggaccctctccggcccggtgaccgatcccagcaagctgcccaagtggaactacgacggctccagcacgggccaggcccccggcgaggacagcgaggtcatcctgtacccgcaggccatcttcaaggacccattcaggaggggcaacaacatccttgtgatgtgcgattgctacaccccagccggcgagccaatccccaccaacaagaggtacaacgccgccaagatcttcagcagccctgaggtcgccgccgaggagccgtggtatggtattgagcaggagtacaccctcctccagaaggacaccaactggccccttgggtggcccatcggtggcttccccggccctcagggtccttactactgtggaatcggcgccgaaaagtcgttcggccgcgacatcgtggacgcccactacaaggcctgcttgtatgcgggcatcaacatcagtggcatcaacggggaggtgatgccagggcagtgggagttccaagtcgggccttccgtgggtatatcttcaggcgaccaggtctgggtcgctcgctacattcttgagaggatcacggagatcgccggtgtggtggtgacgttcgacccgaagccgatcccgggcgactggaacggcgccggcgcgcacaccaactacagcacggagtcgatgaggaaggagggcgggtacgaggtgatcaaggcggccatcgagaagctgaagctgcggcacagggagcacatcgcggcatacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacacgttcagctggggcgtggccaaccgcggcgcgtcggtgcgcgtgggccgggagacggagcagaacggcaagggctacttcgaggaccgccgcccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcatctggaagccctga.
Accordingly, on a sequence basis, a corresponding nucleotide mutation is carried out at the codon corresponding to the 62 th position of the coded amino acid sequence, and the corn glutamine synthetase mutant coded as described above can be obtained.
The encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO.8:
atgtcgctgctctcagatctcatcaaccttaacctctcagacactactgagaaggtgatcgcagagtacatatggatcggtggatcaggaatggacctgaggagcaaagcaaggactctcccaggaccagttagcgacccttcaaagcttcccaagtggaactatgatggttccagcacaggccaagctcctggagaagacagtgaagtgattatatacccacaagccattttcagggatccattcagaaggggcaacaatatcttggttatctgtgatacttacactccagctggagaacccattcccactaacaagaggcacgatgctgccaaggttttcagccatcctgatgttgttgctgaagagacatggtatggtattgagcaggaatacaccttgttgcagaaagatatccaatggcctcttgggtggcctgttggtggtttccctggaccacagggtccatactactgtggtgttggcgctgacaaggcttttggccgtgacattgttgacgcacattacaaagcctgtctttatgctggcatcaacatcagtggaattaatggagaagtgatgcccggtcagtgggaattccaagttggaccttcagttggaatctcagctggtgacgaggtgtgggcagctcgttacatcttggagaggatcactgagattgctggtgtggtggtttcctttgatcccaagccaattcagggtgattggaatggtgctggtgctcacacaaactacagcactaagtccatgagaaatgatggtggctatgaagtgatcaaaaccgccattgagaagttggggaagagacacaaggagcacattgctgcttatggagaaggcaacgagcgtcgtttaacagggcgccacgaaaccgctgacatcaacaccttcttatggggagttgcaaaccgtggagcttcagttagggttgggagggacacagagaaagcagggaagggatattttgaggacagaaggccagcttctaacatggacccatatgtggttacttccatgattgcagacacaaccattctgtggaagccatga.
accordingly, on the basis of the above sequence, a mutation of the corresponding nucleotide is performed at the codon corresponding to position 62 of the encoded amino acid sequence, thereby obtaining a mutant encoding a soybean glutamine synthetase as described above.
The coding nucleic acid sequence of the wheat wild type glutamine synthetase is SEQ ID NO.9:
atggcgctcctcaccgatctcctcaacctcgacctcaccgactccacggagaagatcatcgccgagtacatatggatcggcggatctggcatggatctcaggagcaaagccaggaccctccccggcccggtcaccgaccccagcaagctgcccaagtggaactacgacggctccagcaccggccaggcccccggcgaggacagcgaggtcatcctgtacccacaggccatcttcaaggacccgttcaggaagggcaacaacatccttgtcatgtgcgattgctacaccccagctggagtgccaatccccaccaacaagagatacaacgctgccaagatctttagcaaccctgatgttgccaaggaggagccatggtacggtatcgagcaggagtacaccctcctacagaaggacatcaactggcctctcggctggcctgttggtggattccctggtcctcagggtccttactactgtagtattggtgctgacaagtcgtttgggcgtgacatagttgactcccactacaaggcctgcctctttgccggcgtcaacatcagtggcatcaacggcgaggtcatgcccggacagtgggagttccaagttggcccgactgtcggcatctctgctggtgaccaagtgtgggttgctcgctaccttcttgagaggatcactgagatcgccggagttgtcgtcacatttgaccccaagcccatcccaggcgactggaacggtgctggtgctcacacaaactacagtaccgagtcgatgaggaaggacggcgggttcaaggtcatcgtggacgctgtcgagaagctcaagctgaagcacaaggagcacatcgccgcctacggcgagggcaacgagcgccgtctcaccggcaagcacgaaaccgccgacatcaacaccttcagctggggtgtcgcgaaccgtggcgcgtcggtgcgcgtgggacgggagacggagcagaacggcaagggctacttcgaggaccgccggccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcctgtggaagccctga.
Accordingly, on the basis of the above sequence, a corresponding nucleotide mutation is performed at the codon corresponding to position 62 of the encoded amino acid sequence, thereby obtaining the wheat glutamine synthetase mutant encoded as described above.
The encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.10:
atgagtcttcttacagatctcgttaaccttaacctctcagagaccactgacaaaatcattgcggaatacatatgggttggaggttcaggaatggatatgagaagcaaagccaggactcttcctggaccagtgagtgacccttcggagctaccaaagtggaactatgatggctcaagcacaggccaagctcctggtgaagacagtgaagtcatcttataccctcaagccatattcaaagatcctttccgtagaggcaacaacattcttgtcatgtgcgatgcttacactccagcgggcgaaccgatcccaacaaacaaaagacacgctgcggctaaggtctttagccaccccgatgttgtagctgaagtgccatggtatggtattgagcaagagtatactttacttcagaaagatgtgaactggcctcttggttggcctattggcggcttccccggtcctcagggaccatactattgtagtgttggagcagataaatcttttggtagagacatcgttgatgctcactacaaggcctgcttatacgctggcatcaatattagtggcatcaacggagaagtcatgcctggtcagtgggagttccaagttggtccagctgttggtatctcggccggtgatgaaatttgggtcgcacgtttcattttggagaggatcacagagattgctggtgtggtggtatcttttgacccaaaaccgattcccggtgactggaatggtgctggtgctcactgcaactatagtaccaagtcaatgagggaagatggtggttacgagattattaagaaggcaatcgataaactgggactgagacacaaagaacacattgcagcttacggtgaaggcaatgagcgccgtctcacgggtcaccacgagactgctgacatcaacactttcctctggggtgttgcgaaccgtggagcatcaatccgtgtaggacgtgacacagagaaagaagggaaaggatactttgaggataggaggccagcttcgaacatggatccttacattgtgacttccatgattgcagagaccacaatcctctggaaaccttga.
accordingly, on the basis of the above sequence, a nucleotide mutation corresponding to the 62 th codon of the encoded amino acid sequence is carried out to obtain a mutant encoding the rape glutamine synthetase as described above.
The invention also provides a vector which contains the nucleic acid molecule.
The present invention provides a recombinant bacterium or recombinant cell comprising a nucleic acid molecule or vector. The recombinant bacteria may be selected from agrobacterium; the recombinant cell may be a competent cell.
The invention also provides application of the glutamine synthetase mutant, the nucleic acid molecule, the vector or the recombinant bacterium or the recombinant cell with the glufosinate resistance in cultivating plant varieties with the glufosinate resistance.
The application comprises at least one of the following application modes:
Delivering an isolated nucleic acid molecule to a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a mutant glutamine synthetase;
Transforming a target plant with a vector containing a gene encoding a glutamine synthetase mutant;
Or, introducing a recombinant bacterium or recombinant cell containing a gene encoding a glutamine synthetase mutant into a plant of interest.
The isolated nucleic acid molecule may be a plasmid or a DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by gene gun methods.
The transformation method includes, but is not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.
Recombinant bacteria or recombinant cells can be introduced into the plant of interest by means of infection.
In a preferred embodiment of the application of the present invention, the application includes: the endogenous glutamine synthetase gene of the plant of interest is modified to encode a glutamine synthetase mutant.
On the basis of the present invention, it is easy for the person skilled in the art to modify the target plant by means of the conventional transgenic technique in the art, gene editing technique (e.g. by means of zinc finger endonuclease (ZFN, zinc-finger nucleases) technique, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique or CRISPR/Cas 9), mutation breeding technique (e.g. chemical, radiation mutagenesis, etc.), etc., so as to have the gene encoding the above glutamine synthetase mutant, thereby obtaining a new plant variety which is glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.
In a preferred embodiment of the application of the present invention, the application includes: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.
In an alternative embodiment, the plant is subjected to mutagenesis in a physicochemical mutagenesis mode that is mutagenized to a non-lethal dose to obtain plant material.
The above-mentioned non-lethal dose means that the dose is controlled to be within a range of 20% floating above and below the semi-lethal dose.
Physicochemical mutagenesis modes include combinations of one or more of the following physical mutagenesis and chemical mutagenesis modes: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis includes alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; alkylating agent mutagenesis includes ethylcyclomate mutagenesis, diethylsulfate mutagenesis, and ethylenimine mutagenesis.
Plants include, but are not limited to, wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, sunflower, radish, carrot, capsicum, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, day lily, grape, strawberry, sugarcane, brassica vegetables, cucurbitaceae, leguminous plants, solanaceae plants, allium plants, pasture, tea, or cassava.
In one embodiment, the pasture is selected from gramineous pasture or leguminous pasture. Gramineous forage grass is selected from timothy grass, festuca arundinacea, june grass, wheat middling, festuca arundinacea, brown leaf, green bristlegrass and the like; the leguminous forage is selected from alfalfa, clover bean, green Chinese herb, corn grass, etc. In addition, in other embodiments, the pasture may be selected from turf grass.
In an alternative embodiment, the brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, canola, rape, cauliflower, or beet.
In an alternative embodiment, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, wax gourd, bitter gourd, towel gourd, melon, watermelon, or melon.
In an alternative embodiment, the leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, peanuts, or green beans.
In an alternative embodiment, the Allium plant includes, but is not limited to, leek, welsh onion, leek, or garlic.
In an alternative embodiment, the aforementioned solanaceous plants include, but are not limited to, eggplant, tomato, tobacco, pepper, or potato.
The invention has the following beneficial effects:
The glutamine synthetase mutant provided by the invention has application potential for constructing an expression vector of a transformed plant and cultivating glufosinate-resistant crops. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more acceptable to consumers. The mutant has good glufosinate resistance after mutation, and plants transformed with the mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development demands of the plants.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the amino acid sequence part alignment results of the rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62 3862P, OQ62R, OQ62S, OQ62W, OQ Y and OQ62X (X is deletion) provided in example 1 of the present invention and wild type rice GS1 OWT 1;
FIG. 2 shows the amino acid sequence part alignment results of soybean GS1 mutant GQ62F, GQ, K, GQ, R, GQ W and GQ62X (X is deleted) and wild soybean GS1 GWT1 provided in example 2 of the present invention;
FIG. 3 shows the results of partial alignment of the amino acid sequences of corn GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62 62M, ZQ62N, ZQ62P, ZQ62W, ZQ Y and ZQ62X (X is deleted) and wild type corn GS1 ZWT1 provided in example 2 of the present invention;
FIG. 4 shows the amino acid sequence part alignment of wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62 62L, TQ62R, TQ Y and TQ62X (X is deleted) and wild type wheat GS1 TWT1 provided in example 2 of the present invention;
FIG. 5 shows the result of partial alignment of amino acid sequences of the canola GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62 62 62 3242 62M, BQ P, BQ62 62 62R, BQ62 62 62Y and BQ62X (X is deleted) and wild type canola GS1 BWT1 provided in example 2 of the present invention;
FIG. 6 is a schematic diagram of the structure of pADV7 vector provided in Experimental example 1 of the present invention;
FIG. 7 shows the results of growth of E.coli containing different concentrations of glufosinate in the medium of Gs-1 OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62 3462N, OQ62 3424 62 62R, OQ62S, OQ M, OQ W, OQ Y and OQ62X and wild-type Gs-1 OWT1 of rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62 62N, OQ62P, OQ62S, OQ W, OQ Y provided in Experimental example 1 of the present invention;
FIG. 8 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ W and GQ62X and wild-type soybean GS1 GWT1 provided in Experimental example 2 of the present invention;
FIG. 9 shows the results of E.coli growth on medium containing glufosinate at different concentrations of ZQ62F, ZQ62G, ZQ K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ Y and ZQ62X and wild-type corn GS1 ZWT1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ provided in Experimental example 3 of the present invention;
FIG. 10 shows the results of E.coli growth on medium containing varying concentrations of glufosinate for wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62 62L, TQ R, TQ Y and TQ62X and wild-type wheat GS1 TWT1 provided in Experimental example 4 of the present invention;
FIG. 11 shows the transformation example 5 of the invention, which provides the rape GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ of transformation example 5 growth results of E.coli of 62R, BQ62W, BQ Y and BQ62X and wild type rape GS1 BWT1 on medium containing glufosinate in different concentrations;
FIG. 12 shows the enzyme kinetic parameters and glufosinate resistance parameters IC 50 of the rice GS1 mutant OQ62X, soybean GS1 mutant GQ62X, corn GS1 mutant ZQ62X, wheat GS1 mutant TQ62X, canola GS1 mutant BQ62X, wild-type rice GS1 OWT1, wild-type soybean GS1 GWT1, wild-type corn GS1 ZWT1, wild-type wheat GS1 TWT1 and wild-type canola GS1 BWT1 provided in Experimental example 6 of the present invention;
FIG. 13 shows amino acid sequence alignment of wild type glutamine synthetase from different plants; in the figure: TWT1: wheat wild type glutamine synthetase; OWT1: wild type rice glutamine synthetase; ZWT1: corn wild type glutamine synthetase; GWT1: soybean wild type glutamine synthetase; BWT1: wild type rape glutamine synthetase.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of formulations or unit doses herein, some methods and materials are now described. Unless otherwise indicated, techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.
Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait, eds., 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (A) and (B) in the following general references, (Methods in Enzymology) methods of enzymology (academic Press Co., ltd (ACADEMIC PRESS, inc.), manual of experimental immunology (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), methods of contemporary molecular biology (Current Protocols in Molecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in the example is obtained by mutating or deleting the 62 th amino acid residue Q of wild type rice glutamine synthetase itself (named OWT1, the amino acid sequence is shown as SEQ ID NO.1, the encoding nucleotide sequence is shown as SEQ ID NO. 6) to A, C, F, G, I, K, L, M, N, P, R, S, W, Y, and the obtained rice GS1 mutants are named OQ62A, OQ62C, OQ62F, OQ62G, OQ62K, OQ62L, OQ62N, OQ62 3762L, OQ62N, OQ P, OQ62R, OQ62S, OQ62W, OQ Y and OQ62X respectively.
The amino acid sequence of the rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62 3862N, OQ62P, OQ62R, OQ62S, OQ62W, OQ Y, OQ62X and the wild type rice GS1 is aligned as shown in FIG. 1, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 62, the codons corresponding to the amino acids were as shown in the following Table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids A C F G I
Codons GCC TGC TTC GGC ATC
Amino acids K L M N P
Codons AAG CTC ATG AAC CCC
Amino acids R S W Y Deletion of
Codons CGG TCT TGG TAC Without any means for
The rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ Y and OQ62X and the nucleic acid molecules encoding the same can be obtained by chemical synthesis.
Example 2
The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 62 nd position (corresponding to the 62 nd position of the reference sequence (SEQ ID NO. 1)) of wild-type soybean GS1 itself ((designated GWT1, the amino acid sequence shown in SEQ ID NO.3, the coding nucleotide sequence shown in SEQ ID NO. 8) with the amino acid residue Q F, K, R, W or deleting the same, and the obtained rice soybean GS1 mutants were designated GQ62F, GQ K, GQ R, GQ W and GQ62X, respectively.
The amino acid sequence alignment of soybean GS1 mutant GQ62F, GQ62K, GQ62R, GQ62W, GQ X and wild type soybean GS1 is shown in fig. 2, in which: the position indicated by the arrow is the mutation site.
The coding sequences of the soybean GS1 mutants GQ62F, GQ62K, GQ62R, GQ W and GQ62X provided in this example correspond to SEQ ID NO.3.
In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 62, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids F K R W Deletion of
Codons TTC AAG CGG TGG Without any means for
The soybean GS1 mutant GQ62F, GQ62K, GQ R, GQ W and GQ62X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 3
The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating or deleting the 62 nd (62 nd corresponding to the 62 nd of the reference sequence (SEQ ID NO. 1)) of the wild type corn GS1 itself (named ZWT1, the amino acid sequence of which is shown in SEQ ID NO.2, the coding nucleotide sequence of which is SEQ ID NO. 7) from the amino acid residue Q to F, G, K, L, M, N, P, W, Y. The obtained corn GS1 mutants were named ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ P, ZQ W, ZQ62Y and ZQ62X, respectively.
The amino acid sequence alignment of maize GS1 mutant ZQ62F, ZQ62G, ZQ K, ZQ62L, ZQ62M, ZQ N, ZQ62P, ZQ62W, ZQ62Y, ZQ X and wild-type maize GS1 is shown in figure 3, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 62, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids F G K L M
Codons TTC GGC AAG CTC ATG
Amino acids N P W Y Deletion of
Codons AAC CCC TGG TAC Without any means for
The corn GS1 mutant ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ P, ZQ W, ZQ62Y and ZQ62X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 4
The wheat (Triticum aestivum) GS1 mutant provided in this example is obtained by mutating or deleting the 62 th site (corresponding to the 62 th site of the reference sequence (SEQ ID NO. 1)) of wild-type wheat GS1 itself (named TWT1, amino acid sequence shown as SEQ ID NO.4, encoding nucleotide sequence SEQ ID NO. 9) from the amino acid residue Q to G, H, I, K, L, R, Y. The resulting wheat GS1 mutants were named TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ Y and TQ62X, respectively.
The amino acid sequence alignment of wheat GS1 mutant TQ62G, TQ H, TQ, I, TQ62K, TQ62L, TQ62R, TQ62Y, TQ X and wild-type wheat GS1 is shown in fig. 4, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each wheat GS1 mutant was at the position encoding amino acid 62, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
The wheat GS1 mutant TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ Y and TQ62X and the nucleic acid molecules encoding the same can be obtained by a chemical synthesis method.
Example 5
The rape (Brassica napus) GS1 mutant provided in this example is obtained by mutating or deleting the 62 nd (62 nd corresponding to the 62 nd of the reference sequence (SEQ ID No. 1)) of the wild type rape GS1 itself (named BWT1, amino acid sequence shown in SEQ ID No.5, encoding nucleotide sequence of SEQ ID No. 10) from the amino acid residue Q to C, F, G, K, L, M, P, R, W, Y. The obtained rape GS1 mutants are named BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ P, BQ62R, BQ62W, BQ Y and BQ62X respectively.
The amino acid sequence alignment of canola GS1 mutant BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y, BQ X and wild-type canola GS1 is shown in fig. 5, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 62, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.
The rape GS1 mutant BQ62C, BQ and F, BQ62 and G, BQ62 and K, BQ62 and L, BQ and M, BQ and P, BQ and 62 and R, BQ and 3462 and W, BQ Y and BQ62X provided in this example and nucleic acid molecules encoding them can be obtained by chemical synthesis.
Experimental example 1
The rice GS1 mutants OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ P, OQ62R, OQ S, OQ62W, OQ Y and OQ62X provided in example 1 were examined for glufosinate resistance, respectively. The glufosinate resistance detection method comprises the following steps:
According to the sequence of the nucleic acid molecule provided in example 1, coding genes encoding rice GS1 mutant OQ62A, OQ62C, OQ62F, OQ G, OQ62I, OQ K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ Y and OQ62X are synthesized by adopting a chemical synthesis method, enzyme cutting sites (Pac 1 and Sbf 1) are introduced into two ends, after enzyme cutting, the genes are connected to expression vectors (such as pADV7 vectors with the structure shown in figure 6) subjected to the same enzyme cutting treatment under the action of ligase, glutamine synthetase defect type escherichia coli is transformed respectively, positive clones are picked up after verification, and the positive clones are inoculated to M9 culture media containing glufosinate-ammonium with different concentrations for growth, and defective escherichia coli growth is observed. The wild-type rice GS1 mutant was used as a negative control to detect glufosinate resistance containing GS1 mutant OQ62A (Q62A, amino acid Q at position 62 of rice GS1 was mutated to a), OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ W, OQ Y and OQ62X (Q62X, amino acid Q at position 62 of rice GS1 was deleted). The results are shown in FIG. 7.
On a medium containing 0mM glufosinate (KP 0), defective strains encoding wild-type rice GS1 (OWT 1) and rice GS1 mutants OQ62A, OQ62C, OQ62F, OQ62 62 62 62I, OQ K, OQ L, OQ62 62 62M, OQ62N, OQ62 62 62 62P, OQ62R, OQ S, OQ62W, OQ Y and OQ62X were transformed, indicating that the GS1 encoded by OQ62A, OQ62C, OQ62 82348 62G, OQ I, OQ62K, OQ62L, OQ62M, OQ62N, OQ62 62N, OQ62Y and OQ62X had normal GS1 enzyme activities.
Coli transformed with wild-type rice GS1 could not grow on medium containing 10mM glufosinate (KP 10), but the rice mutants OQ62 62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ 42 62 62 62M, OQ62N, OQ62P, OQ62R, OQ62S, OQ 5243 62W, OQ Y and OQ62X showed significantly better growth than the negative control, indicating that the single mutants containing OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ62 62M, OQ62N, OQ62N, OQ62 62N, OQ62N, OQ62N, OQ62Y and OQ62X had significantly better capacity against glufosinate than the wild-type.
Coli transformed with rice GS1 mutant OQ62A, OQ62F, OQ62G, OQ62I, OQ62K, OQ62N, OQ62P, OQ62R, OQ W, OQ Y and OQ62X also grew significantly on the medium with better glufosinate concentration (20 mM, KP20).
These results demonstrate that the single mutants of OQ62A, OQ62C, OQ62F, OQ62G, OQ62I, OQ62K, OQ62L, OQ M, OQ62N, OQ62P, OQ62R, OQ62S, OQ62W, OQ Y and OQ62X all have glufosinate resistance.
Experimental example 2
Referring to the detection method of experimental example 1, glufosinate resistance of soybean GS1 mutants GQ62F (Q62F, mutation of amino acid Q at position 62 of soybean GS1 to F), GQ62K, GQ62R, GQ W and GQ62X (Q62X, deletion of amino acid Q at position 62 of soybean GS 1) provided in example 2 was verified. The results are shown in FIG. 8.
As can be seen from the results of fig. 8:
Transformation of defective strains encoding the wild type soybean GS1 (GWT 1) and soybean GS1 mutant GQ62F, GQ62K, GQ R, GQ W and GQ62X both grew normally on a medium containing 0mM glufosinate (KP 0), indicating that GS1 encoded by GQ62F, GQ62K, GQ R, GQ W and GQ62X both had normal GS1 enzyme activity;
Coli transformed with wild-type soybean GS1 was essentially incapable of growth on medium containing 1mM glufosinate (KP 1), but the growth of the soybean mutants GQ62F, GQ62K, GQ62R, GQ W and GQ62X was significantly better than negative controls, indicating that the single mutants containing GQ62F, GQ62K, GQ62R, GQ W and GQ62X were significantly better than wild-type against glufosinate; coli transformed with soybean GS1 mutant GQ62X also grew significantly on medium with higher glufosinate concentration (20 mm, kp20).
These results demonstrate that both single mutants of GQ62F, GQ, K, GQ, R, GQ W and GQ62X have glufosinate resistance and that soybean GS1 mutant GQ62X has greater glufosinate resistance.
Experimental example 3
Referring to the test method of experimental example 1, the maize GS1 mutant ZQ62F provided in example 3 (Q62F, mutation of amino acid Q at position 62 of maize GS1 to F), ZQ62G, ZQ62K, ZQ62 62L, ZQ62M, ZQ62N, ZQ62 62P, ZQ W, ZQ Y and ZQ62X (Q62X, deletion of amino acid Q at position 62 of maize GS 1) were validated for glufosinate resistance. The results are shown in FIG. 9.
As can be seen from the results of fig. 9:
On a medium containing 0mM glufosinate (KP 0), defective strains, which are transformed with the coding genes of wild-type maize GS1 (ZWT 1) and maize GS1 mutants ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62 62M, ZQ62N, ZQ P, ZQ62W, ZQ62Y and ZQ62X, were able to grow normally, indicating that GS1 encoded by both ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ P, ZQ62W, ZQ Y and ZQ62X has normal GS1 enzyme activity;
Coli transformed with wild-type maize GS1 was essentially incapable of growth on 2mM glufosinate (KP 2), but the escherichia coli transformed with maize mutants ZQ62F, ZQ62G, ZQ K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ Y and ZQ62X grew significantly better than the negative control, indicating that the single mutants containing ZQ62F, ZQ62G, ZQ62K, ZQ62L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ Y and ZQ62X were significantly better able to resist glufosinate than the wild-type; coli transformed with maize GS1 mutants ZQ62K and ZQ62X also grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that both single mutants of ZQ62F, ZQ62G, ZQ62K, ZQ L, ZQ62M, ZQ62N, ZQ62P, ZQ62W, ZQ Y and ZQ62X have resistance to glufosinate.
Experimental example 4
Referring to the test method of experimental example 1, the wheat GS1 mutant TQ62G (Q62G, mutation of amino acid Q at position 62 of wheat GS1 to G), TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ Y and TQ62X (Q62X, deletion of amino acid Q at position 62 of wheat GS 1) provided in example 4 were verified for glufosinate resistance. The results are shown in FIG. 10.
As can be seen from the results of fig. 10:
transformation of defective strains encoding wild-type wheat GS1 (TWT 1) and wheat GS1 mutants TQ62G, TQ62H, TQ I, TQ62K, TQ62L, TQ62R, TQ Y and TQ62X both grew normally on media containing 0mM glufosinate (KP 0), indicating that GS1 encoded by TQ62G, TQ62H, TQ I, TQ62K, TQ62L, TQ R, TQ Y and TQ62X both had normal GS1 enzyme activity;
Coli transformed with wild-type wheat GS1 was essentially incapable of growth on medium containing 2mM glufosinate (KP 2), but the E.coli transformed with wheat mutants TQ62G, TQ62H, TQ62I, TQ62K, TQ L, TQ62R, TQ Y and TQ62X were grown significantly better than the negative control, indicating that the single mutant containing TQ62G, TQ62H, TQ 3462I, TQ62K, TQ62L, TQ R, TQ Y and TQ62X was significantly better than the wild-type; coli transformed with wheat GS1 mutant TQ62G, TQ62H, TQ62K, TQ62L, TQ 3562R, TQ Y and TQ62X all grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that both single mutants of TQ62G, TQ62H, TQ62I, TQ62K, TQ62L, TQ62R, TQ Y and TQ62X have glufosinate resistance and that the wheat GS1 mutant TQ62G, TQ62H, TQ K, TQ62L, TQ62R, TQ Y and TQ62X have greater glufosinate resistance.
Experimental example 5
Referring to the test method of experimental example 1, the glufosinate resistance of the canola GS1 mutant BQ62C (Q62C, amino acid Q at position 62 of canola GS1 was mutated to C), BQ62F, BQ62G, BQ, K, BQ62, M, BQ62P, BQ, 62R, BQ, 62Y and BQ62X (Q62X, amino acid Q at position 62 of canola GS1 was deleted) provided in example 5 was verified. The results are shown in FIG. 11.
As can be seen from the results of fig. 11:
On a medium containing 0mM glufosinate (KP 0), defective strains which code for wild type canola GS1 (BWT 1) and canola GS1 mutants BQ62C, BQ62F, BQ62G, BQ62K, BQ62M, BQ62P, BQ62R, BQ62 3226Y and BQ62X both grow normally, indicating that GS1 encoded by BQ62C, BQ62F, BQ62G, BQ K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ Y and BQ62X has normal GS1 enzyme activity;
Coli transformed with wild-type canola GS1 was substantially incapable of growth on medium containing 1mM glufosinate (KP 1), but the growth of escherichia coli transformed with canola mutants BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62 62P, BQ62R, BQ W, BQ Y and BQ62X was significantly better than that of the negative control, indicating that single mutants containing BQ62C, BQ62 62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ Y and BQ62X were significantly better than wild-type; coli transformed with canola GS1 mutants BQ62P, BQ R and BQ62X also grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that the single mutants of BQ62C, BQ62F, BQ62G, BQ62K, BQ62L, BQ62M, BQ62P, BQ62R, BQ62W, BQ62Y and BQ62X both have glufosinate resistance and that the canola GS1 mutants BQ62P, BQ62R and BQ62X are more glufosinate resistant.
Experimental example 6
The enzymatic kinetic parameters of OQ62X provided in example 1, GQ62X provided in example 2, ZQ62X provided in example 3, TQ62X provided in example 4 and BQ62X mutant provided in example 5 and the enzymatic kinetic parameters in the presence of glufosinate were measured against wild-type rice GS1 OWT1, wild-type soybean GS1 GWT1, wild-type maize GS1 ZWT1, wild-type wheat GS1 TWT1 and wild-type canola GS1 BWT1, respectively, as follows:
And (3) constructing a carrier:
The nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.
Purification of 6His protein:
The mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.
Enzyme activity determination:
1. Instrument and reagents: enzyme-labeled instrument (De Fe: HBS-1096A), glufosinate (Lier Chemie Co., ltd.), substrate sodium L-glutamate (CAS: 6106-04-3).
2. The operation steps are as follows:
The glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 100mM Tris-HCl (pH 7.5), 5mM ATP,10mM sodium L-glutamate, 30mM hydroxylamine,20mM MgCl 2. After 100. Mu.l of the reaction solution was mixed well and preheated at 35℃for 5 minutes, 1. Mu.l of the mutant protein solution (protein concentration: 200 ug/ml) was added to start the reaction, after 60 minutes at 35℃the reaction was stopped by adding 110. Mu.l of the reaction stop solution (55 g/L FeCl 3·6H2 O,20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) and allowed to stand for 10 minutes. Centrifuge at 5000 Xg for 10min, take 200. Mu.l and determine the light absorption at 500 nm.
The results are shown in FIG. 12.
As can be seen from the results of fig. 12:
The Km values of the GS1 mutants were all higher relative to the wild-type controls OWT1, GWT1, ZWT1, TWT1 and BWT1, indicating that the GS mutants reduced sensitivity to glufosinate inhibitors while reducing sensitivity to normal substrates. The Vmax of the GS1 mutants was higher than that of the wild-type control, indicating that the mutants had improved enzymatic ability. Wild type controls were very sensitive to glufosinate, IC 50 was 7.93 μm, 13.55 μm, 8.92 μm, 7.22 μm and 1.53 μm respectively, IC 50 of the mutant was significantly higher than the wild type controls, IC 50 of GQ62X, ZQ62X, TQ X and BQ62X was much higher than the wild type controls, indicating that the mutant was much less sensitive to glufosinate.
It can also be seen from the fold relationship between mutant IC 50 and wild-type IC 50 that IC 50 of OQ62X, GQ62X, ZQ62X, TQ X and BQ62X were 3.70-fold, 20.88-fold, 22.05-fold, 28.38-fold and 110.56-fold, respectively, of the corresponding wild-type GS1 IC50, which also indicated that the mutant had significantly higher enzymatic activity than the wild-type control. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Sichuan Yuxing He biotechnology Co.Ltd
<120> Glutamine synthetase mutant and use thereof
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 356
<212> PRT
<213> Artificial sequence
<400> 1
Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 2
<211> 356
<212> PRT
<213> Artificial sequence
<400> 2
Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 3
<211> 356
<212> PRT
<213> Artificial sequence
<400> 3
Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys
260 265 270
Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 4
<211> 356
<212> PRT
<213> Artificial sequence
<400> 4
Met Ala Leu Leu Thr Asp Leu Leu Asn Leu Asp Leu Thr Asp Ser Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Val Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Asn Pro Asp Val Ala Lys Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Phe Ala Gly Val Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Thr Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Leu Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Asp Gly Gly Phe Lys Val Ile Val Asp Ala Val Glu Lys
260 265 270
Leu Lys Leu Lys His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Lys His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 5
<211> 356
<212> PRT
<213> Artificial sequence
<400> 5
Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr
1 5 10 15
Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp
20 25 30
Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys
260 265 270
Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 6
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 6
atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120
tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180
ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240
ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300
ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360
tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420
tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480
atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540
tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600
caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660
cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720
ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780
ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840
atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960
acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020
tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 7
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 7
atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60
gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120
tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240
ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300
ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360
gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420
tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480
atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540
tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600
caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660
cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720
ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780
ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840
atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 8
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 8
atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60
gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120
ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180
ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240
ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300
cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360
gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420
tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480
gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540
tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600
caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660
ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720
ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780
ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840
attgctgctt atggagaagg caacgagcgt cgtttaacag ggcgccacga aaccgctgac 900
atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960
acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020
tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071
<210> 9
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 9
atggcgctcc tcaccgatct cctcaacctc gacctcaccg actccacgga gaagatcatc 60
gccgagtaca tatggatcgg cggatctggc atggatctca ggagcaaagc caggaccctc 120
cccggcccgg tcaccgaccc cagcaagctg cccaagtgga actacgacgg ctccagcacc 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cacaggccat cttcaaggac 240
ccgttcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggagtg 300
ccaatcccca ccaacaagag atacaacgct gccaagatct ttagcaaccc tgatgttgcc 360
aaggaggagc catggtacgg tatcgagcag gagtacaccc tcctacagaa ggacatcaac 420
tggcctctcg gctggcctgt tggtggattc cctggtcctc agggtcctta ctactgtagt 480
attggtgctg acaagtcgtt tgggcgtgac atagttgact cccactacaa ggcctgcctc 540
tttgccggcg tcaacatcag tggcatcaac ggcgaggtca tgcccggaca gtgggagttc 600
caagttggcc cgactgtcgg catctctgct ggtgaccaag tgtgggttgc tcgctacctt 660
cttgagagga tcactgagat cgccggagtt gtcgtcacat ttgaccccaa gcccatccca 720
ggcgactgga acggtgctgg tgctcacaca aactacagta ccgagtcgat gaggaaggac 780
ggcgggttca aggtcatcgt ggacgctgtc gagaagctca agctgaagca caaggagcac 840
atcgccgcct acggcgaggg caacgagcgc cgtctcaccg gcaagcacga aaccgccgac 900
atcaacacct tcagctgggg tgtcgcgaac cgtggcgcgt cggtgcgcgt gggacgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccggc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcctgt ggaagccctg a 1071
<210> 10
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 10
atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60
gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120
cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180
ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240
cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300
ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360
gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420
tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480
gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540
tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600
caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660
ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720
ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780
ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840
attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900
atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960
acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020
tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims (7)

1. A glufosinate-resistant glutamine synthetase mutant characterized by the following:
It is obtained by mutating the 62 th site of wild type glutamine synthetase derived from plants, and the amino acid of the 62 th site of the glutamine synthetase mutant is X; the plant is rice, soybean, corn, wheat or rape;
When the plant is rice, the rice wild type glutamine synthetase is SEQ ID NO.1, X= A, C, F, G, I, K, L, M, N, P, R, S, W, Y or deleted;
When the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3, x= F, K, R, W or deleted;
When the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2, x= F, G, K, L, M, N, P, W, Y or deleted;
when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No.4, x= G, H, I, K, L, R, Y or deleted;
When the plant is rape, the wild type glutamine synthetase of rape is SEQ ID NO.5, X= C, F, G, K, L, M, P, R, W, Y or deleted.
2. An isolated nucleic acid molecule encoding a glufosinate-resistant glutamine synthetase mutant of claim 1.
3. A vector comprising the nucleic acid molecule of claim 2.
4. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 2 or the vector of claim 3, wherein the recombinant cell is a non-plant cell.
5. Use of the glufosinate-resistant glutamine synthetase mutant of claim 1, the nucleic acid molecule of claim 2, the vector of claim 3 or the recombinant bacterium or recombinant cell of claim 4 for breeding a glufosinate-resistant plant variety.
6. The use according to claim 5, characterized in that it comprises at least one of the following modes of application:
Delivering an isolated nucleic acid molecule to a plant cell of interest, said isolated nucleic acid molecule comprising a gene encoding said glutamine synthetase mutant;
transforming a plant of interest with said vector comprising a gene encoding said glutamine synthetase mutant;
or, introducing the recombinant bacterium or recombinant cell into a plant of interest, wherein the recombinant bacterium or recombinant cell contains a gene encoding the glutamine synthetase mutant.
7. Use according to claim 5, characterized in that it comprises: modifying the endogenous glutamine synthetase gene of the plant of interest to encode said glutamine synthetase mutant.
CN202111244191.2A 2021-10-26 2021-10-26 Glutamine synthetase mutant and application thereof Active CN113957060B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111244191.2A CN113957060B (en) 2021-10-26 2021-10-26 Glutamine synthetase mutant and application thereof
PCT/CN2022/113149 WO2023071438A1 (en) 2021-10-26 2022-08-17 Glutamine synthetase mutant and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111244191.2A CN113957060B (en) 2021-10-26 2021-10-26 Glutamine synthetase mutant and application thereof

Publications (2)

Publication Number Publication Date
CN113957060A CN113957060A (en) 2022-01-21
CN113957060B true CN113957060B (en) 2024-04-23

Family

ID=79467065

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111244191.2A Active CN113957060B (en) 2021-10-26 2021-10-26 Glutamine synthetase mutant and application thereof

Country Status (2)

Country Link
CN (1) CN113957060B (en)
WO (1) WO2023071438A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113957060B (en) * 2021-10-26 2024-04-23 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757033A (en) * 2013-12-25 2014-04-30 上海市农业科学院 Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104164441A (en) * 2014-05-17 2014-11-26 上海市农业科学院 Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
CN111635892B (en) * 2020-06-29 2021-10-08 合肥戬谷生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN113957060B (en) * 2021-10-26 2024-04-23 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757033A (en) * 2013-12-25 2014-04-30 上海市农业科学院 Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
WO2021000870A1 (en) * 2019-07-01 2021-01-07 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant having glufosinate ammonium resistance and application thereof and cultivation method therefor
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections;Tosapon Pornprom 等;《Pest Manag Sci》;全文 *
Target-site mutation associated with glufosinate resistance in Italian ryegrass (Lolium perenne L. ssp. multiflorum);Wilson V Avila-Garcia 等;《Pest Manag Sci》;全文 *
水稻草铵膦耐性突变体的筛选及其耐性机制;任艳 等;《生物学杂志》;全文 *

Also Published As

Publication number Publication date
WO2023071438A1 (en) 2023-05-04
CN113957060A (en) 2022-01-21

Similar Documents

Publication Publication Date Title
CN113604443B (en) Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety
CN112574967B (en) Glutamine synthetase mutant with glufosinate resistance of plant origin, nucleic acid molecule and application
WO2021000870A1 (en) Glutamine synthetase mutant having glufosinate ammonium resistance and application thereof and cultivation method therefor
JP4469422B2 (en) Herbicide-tolerant products designed based on structure
CN113736757B (en) Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
CN113957060B (en) Glutamine synthetase mutant and application thereof
CN114774375B (en) Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant
CN105102474A (en) Constitutive soybean promoters
CN114058600B (en) Glutamine synthetase mutant with glufosinate resistance and application thereof
CN114107234B (en) Glutamine synthetase mutant with glufosinate resistance, recombinant gene, recombinant vector and application thereof
Poyet et al. Isolation and characterization of a cDNA clone encoding the pokeweed antiviral protein II from Phytolacca americana and its expression in E. coli
CN102775484A (en) Gene improving cadmium tolerance of plant and application thereof
CN114807064B (en) Method for obtaining protein with glufosinate resistance and mutant thereof
Saroha et al. Glyphosate-tolerant crops: genes and enzymes
Ren et al. Overexpression of a modified AM79 aroA gene in transgenic maize confers high tolerance to glyphosate
EP1218517B1 (en) Gst sequences from soybean and their use in the production of herbicide resistant plants
CN117363633A (en) Nucleic acid molecule, vector, recombinant bacterium, GS mutant and application thereof
CN116875568A (en) G61 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
CN116769739A (en) G294 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
US9650616B2 (en) Methods for increasing grain yield
CN111886344A (en) Biological nitrogen fixation in crops
CN114196644B (en) Protein palmitoyl transferase DHHC16 and application thereof in improving salt tolerance of rice
CN114621933B (en) accD mutant protein and application thereof
Gholizadeh et al. Cloning and expression of small cDNA fragment encoding strong antiviral peptide from Celosia cristata in Escherichia coli
CN110819608B (en) Hydrolysis method of zearalenone and derivatives thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant