CN116769739A

CN116769739A - G294 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof

Info

Publication number: CN116769739A
Application number: CN202310883130.3A
Authority: CN
Inventors: 邓龙群; 陈容; 侯青江; 徐洪健; 许立敏; 孙顺华; 冯阳; 胥南飞
Original assignee: Gevoto LLC
Current assignee: Gevoto LLC
Priority date: 2023-07-17
Filing date: 2023-07-17
Publication date: 2023-09-19

Abstract

The invention discloses a plant glutamine synthetase mutant containing G294 mutation, and a coding gene and application thereof, and relates to the technical field of genetic engineering. The method for obtaining the protein with the glufosinate resistance is simple and feasible, has high success rate, and is convenient for people to obtain the protein with the glufosinate resistance quickly and efficiently. The glutamine synthetase mutant provided by the invention is originally derived from plants, has glufosinate resistance after mutation, and has good biological enzyme catalytic activity. Plants transformed with the glutamine synthetase mutant have glufosinate resistance and can grow and develop normally.

Description

G294 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a plant glutamine synthetase mutant containing G294 mutation, and a coding gene and application thereof.

Background

Glutamine synthetase (Glutamine synthetase, GS) is a key enzyme in nitrogen metabolism in plants, which catalyzes the condensation of glutamic acid (gin) with NH3 to form glutamine (Glu) in the glutamate synthetase cycle, participating in the metabolism of nitrogen-containing compounds in plants. Depending on distribution and subcellular localization, higher plant GS (class GSII) isoenzymes can be divided into two classes: one which is located in the cytoplasm is called cytoplasmic GS (GS 1), with a molecular weight of 38-40kDa; another type, designated as apoplast GS (GS 2), is located in chloroplasts (or plastids) and has a molecular weight of 44-45kDa.

Glufosinate (glufosinate ammoni μm, trade name Basta) is a glutamine synthetase (GS 1) inhibitor developed by anget corporation (now bayer corporation), and its active ingredient is phosphinothricin (abbreviated PPT), and its chemical name is (RS) -2-amino-4- (hydroxymethylphosphino) ammonium butyrate. The target enzyme for glufosinate is GS, which can normally form lambda-glutamyl phosphate from ATP and glutamate. However, after PPT treatment, PPT is first bound to ATP and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed and GS activity is inhibited. PPT inhibits all known forms of GS.

As a result of inhibition of GS by glufosinate, it can lead to disturbance of nitrogen metabolism in plants, excessive accumulation of ammonium, disintegration of chloroplasts, inhibition of photosynthesis, and finally death of plants

At present, the main method for cultivating the glufosinate-resistant variety is to introduce the glufosinate-resistant gene from bacteria into crops by using genetic engineering means, so as to cultivate a new transgenic glufosinate-resistant crop variety. The most widely used anti-glufosinate genes in agriculture today are the bar gene from strain Streptomyces hygroscopicus and the pat gene from strain s. The Bar gene and the pat gene have 80% homology, and can code glufosinate acetylase, and the glufosinate acetylase can be inactivated by the enzyme. The glufosinate-resistant variety has great use value, wherein resistant rape, corn and the like are commercially planted in a large area. However, bar and pat genes are derived from microorganisms, not from the crop itself, and are more likely to cause conflicting psychological effects for the consumer.

The glufosinate acetylase enzyme coded by Bar gene and pat gene can acetylate glufosinate to inactivate, but before glufosinate contacts GS, the enzyme can hardly inactivate glufosinate completely, because many GS are distributed on cell membranes, so that when the glufosinate is applied to crops with Bar gene and pat gene, nitrogen metabolism of plants can be interfered to different degrees, and normal growth and development of the plants are affected. Overexpression of wild-type GS in plants can reduce the sensitivity of transgenic plants to glufosinate but is not sufficiently tolerant for commercial use.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide a plant glutamine synthetase mutant containing G294 mutation, and a coding gene and application thereof, so as to obtain a protein with glufosinate resistance, the coding gene of the protein mutant (namely the plant glutamine synthetase mutant) is integrated into bacteria or cells, and a transformed plant can further select and breed a new plant variety with glufosinate resistance. The obtained plant glutamine synthetase mutant has good biological enzyme catalytic activity.

Term interpretation:

"deletion" is a deletion mutation (del) or "deletion mutation". If the amino acid sequence of the target protein is subjected to deletion mutation corresponding to the 61 st amino acid residue of the reference sequence, the amino acid residue corresponding to the 61 st amino acid residue of the reference sequence is deleted.

The invention is realized in the following way:

in a first aspect, the present invention provides a method for obtaining a protein having glufosinate resistance comprising the steps of:

1) A protein having the reference sequence shown in SEQ ID NO.1 or having an amino acid sequence having at least 85% identity to the reference sequence as a target protein;

2) Comparing the amino acid sequence of the target protein with a reference sequence, and mutating the amino acid sequence of the target protein corresponding to 294 amino acid residues of the reference sequence to A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleting;

3) Proteins with increased glufosinate resistance are selected.

The inventor researches and discovers that the wild type glutamine synthetase of plant origin is compared with a reference sequence, and the amino acid position corresponding to 294 th position of the reference sequence is mutated into A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted, so that the protein with glufosinate resistance can be obtained by screening. The protein has good biological enzyme catalytic activity.

In an alternative embodiment, when the target protein is derived from rice, the amino acid residue at position 294 of the target protein corresponding to the reference sequence is mutated to C, D, E, F, H, K, N, P, Q, R, S, V, W, Y or deleted.

In an alternative embodiment, when the protein of interest is derived from maize, the amino acid residue of the protein of interest corresponding to amino acid residue 294 of the reference sequence is mutated to C, E, H, I, K, L, M, N, P, R, W, Y or deleted.

In an alternative embodiment, when the protein of interest is derived from wheat, the amino acid residue of the protein of interest corresponding to amino acid residue 294 of the reference sequence is mutated to A, C, D or N.

In an alternative embodiment, when the protein of interest is derived from canola, the amino acid residue of the protein of interest corresponding to amino acid 294 of the reference sequence is mutated to A, C, E, H, K, M, N, Q, R, T or W.

In a second aspect, the present invention provides a plant glutamine synthetase mutant having glufosinate resistance, the plant glutamine synthetase mutant being as follows (1) or (2):

(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with the reference sequence, the n-th position of the wild type glutamine synthetase corresponds to the 294-th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

The n-th amino acid of the plant glutamine synthetase mutant is A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted compared with the wild glutamine synthetase;

(2): which has at least 85% identity with the plant glutamine synthetase mutant shown in (1) and is identical to the amino acid at the n-th position of the plant glutamine synthetase mutant shown in (1).

The wild type glutamine synthetase from plant source is compared with reference sequence, the amino acid site corresponding to 294 th site of the reference sequence, i.e. n site, is mutated into A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted, and the obtained plant glutamine synthetase mutant has glufosinate resistance and maintains its biological enzyme catalytic activity. The recombinant bacteria or plants transformed with the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospects.

The reference sequence is wild type glutamine synthetase of rice origin.

The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.

It should be noted that the n-th position of the wild-type glutamine synthetase may be 294 (e.g., corn, soybean, wheat, rape, etc.) on its own sequence, but may not be 294, and the specific position of the n-th position may be determined by alignment of the sequences described above, so long as the position corresponding to the 294-th position of the reference sequence is the n-th position according to the present invention, i.e., the mutation position, after alignment with the reference sequence.

The inventors found that mutation of the wild-type glutamine synthetase of various plants to C or N at position 294 of the corresponding reference sequence can produce a plant glutamine synthetase mutant having glufosinate resistance. Thus, C or N is a common mutant amino acid for a variety of plants, and one skilled in the art would be able to expect that mutation of wild-type glutamine synthetase from a variety of plants would result in a plant glutamine synthetase mutant that is glufosinate resistant. The N-th amino acid of the plant glutamine synthetase mutant is C or N.

All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, any plant-derived wild-type glutamine synthetase mutant obtained by the above-described mutation at position 294 has glufosinate resistance. Therefore, the plant glutamine synthetase mutants obtained by mutating wild type glutamine synthetase of any plant origin are all within the scope of the present invention.

In a preferred embodiment of the present invention, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea or cassava.

In a preferred embodiment of the invention, the pasture is selected from gramineous pasture or leguminous pasture; leguminous forage includes, but is not limited to: red clover, white clover, alfalfa, arrowhead peas, green peas, lupin yellow, white clover, sweet clover, astragalus root, white milk vetch, white butterfly beans, and the like.

In a preferred embodiment of the invention, the brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, canola, mustard, cabbage, canola, green vegetables, or beet.

In a preferred embodiment of the present invention, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, wax gourd, luffa, melon, watermelon or melon.

In preferred embodiments of the invention, leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, or green beans.

Furthermore, it is known and easily achieved by those skilled in the art that a simple amino acid substitution, deletion, or addition is performed in a non-conserved region of the plant glutamine synthetase mutant shown in (1) and the n-th position is maintained as the above-mentioned mutated amino acid, and that the further mutated plant glutamine synthetase mutant has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% etc.) or more identity with the plant glutamine synthetase mutant shown in (1), and that its functions include the enzyme catalytic activity and glufosinate resistance are equivalent to or slightly decreased or slightly increased or greatly increased as those of the plant glutamine synthetase mutant shown in (1). Therefore, such glutamine synthetases should also fall within the scope of the present invention.

In an alternative embodiment, when the plant is rice, the amino acid at position n of the plant glutamine synthetase mutant is C, D, E, F, H, K, N, P, Q, R, S, V, W, Y or deleted;

in an alternative embodiment, when the plant is maize, the amino acid at position n of the plant glutamine synthetase mutant is C, E, H, I, K, L, M, N, P, R, W, Y or deleted;

in an alternative embodiment, when the plant is wheat, the amino acid at position N of the plant glutamine synthetase mutant is A, C, D or N;

in an alternative embodiment, when the plant is canola, the n-th amino acid of the plant glutamine synthetase mutant is A, C, E, H, K, M, N, Q, R, T or W.

The studies of the present invention have also found that mutation of the n-th position of glutamine synthetase to an amino acid other than C, N for a different plant source also renders the glutamine synthetase glufosinate resistant.

Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:

MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP。

alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:

MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP。

Alternatively, in some embodiments of the invention, when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No.3:

MALLTDLLNLDLTDSTEKIIAEYIWIGGSGMDLRSKARTLPGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGVPIPTNKRYNAAKIFSNPDVAKEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCSIGADKSFGRDIVDSHYKACLFAGVNISGINGEVMPGQWEFQVGPTVGISAGDQVWVARYLLERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKDGGFKVIVDAVEKLKLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTILWKP。

alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.4:

MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP。

the Similarity (Similarity) and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin are shown in the following table, and the partial results of the sequence alignment are shown in FIG. 11, with the arrow indicating amino acid 294.

The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.

In a third aspect, the invention also provides an isolated nucleic acid molecule encoding a plant glutamine synthetase mutant as described above.

The term "nucleic acid molecule encoding a mutant of a plant glutamine synthetase as described above" may be a polynucleotide comprising a mutant protein of the present invention, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polypeptides or muteins having the same amino acid sequence as the invention. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the mutein encoded thereby.

At present, it is already possible to obtain the DNA sequences encoding the proteins of the invention (or fragments or derivatives thereof) entirely by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining polynucleotides of the invention. In particular, when it is difficult to obtain full-length cDNA from a library, it is preferable to use RACE method (RACE-cDNA end rapid amplification method), and primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above plant glutamine synthetase mutant is easily obtained by a person skilled in the art based on the degeneracy of codons. For example, a nucleic acid sequence encoding a mutant of a plant glutamine synthetase as described above may be obtained by mutating a corresponding nucleotide in a nucleic acid sequence encoding a wild type glutamine synthetase. This is readily accomplished by one skilled in the art.

For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.5:

ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA。

accordingly, on a sequence basis, a mutant encoding rice plant glutamine synthetase as described above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to 294 of the encoded amino acid sequence.

The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.6:

ATGGCCTGCCTCACCGACCTCGTCAACCTCAACCTCTCGGACAACACCGAGAAGATCATCGCGGAATACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAAGCAAGGACCCTCTCCGGCCCGGTGACCGATCCCAGCAAGCTGCCCAAGTGGAACTACGACGGCTCCAGCACGGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCGCAGGCCATCTTCAAGGACCCATTCAGGAGGGGCAACAACATCCTTGTGATGTGCGATTGCTACACCCCAGCCGGCGAGCCAATCCCCACCAACAAGAGGTACAACGCCGCCAAGATCTTCAGCAGCCCTGAGGTCGCCGCCGAGGAGCCGTGGTATGGTATTGAGCAGGAGTACACCCTCCTCCAGAAGGACACCAACTGGCCCCTTGGGTGGCCCATCGGTGGCTTCCCCGGCCCTCAGGGTCCTTACTACTGTGGAATCGGCGCCGAAAAGTCGTTCGGCCGCGACATCGTGGACGCCCACTACAAGGCCTGCTTGTATGCGGGCATCAACATCAGTGGCATCAACGGGGAGGTGATGCCAGGGCAGTGGGAGTTCCAAGTCGGGCCTTCCGTGGGTATATCTTCAGGCGACCAGGTCTGGGTCGCTCGCTACATTCTTGAGAGGATCACGGAGATCGCCGGTGTGGTGGTGACGTTCGACCCGAAGCCGATCCCGGGCGACTGGAACGGCGCCGGCGCGCACACCAACTACAGCACGGAGTCGATGAGGAAGGAGGGCGGGTACGAGGTGATCAAGGCGGCCATCGAGAAGCTGAAGCTGCGGCACAGGGAGCACATCGCGGCATACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACGTTCAGCTGGGGCGTGGCCAACCGCGGCGCGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGCCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA。

the coding nucleic acid sequence of the wheat wild type glutamine synthetase is SEQ ID NO.7:

ATGGCGCTCCTCACCGATCTCCTCAACCTCGACCTCACCGACTCCACGGAGAAGATCATCGCCGAGTACATATGGATCGGCGGATCTGGCATGGATCTCAGGAGCAAAGCCAGGACCCTCCCCGGCCCGGTCACCGACCCCAGCAAGCTGCCCAAGTGGAACTACGACGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCACAGGCCATCTTCAAGGACCCGTTCAGGAAGGGCAACAACATCCTTGTCATGTGCGATTGCTACACCCCAGCTGGAGTGCCAATCCCCACCAACAAGAGATACAACGCTGCCAAGATCTTTAGCAACCCTGATGTTGCCAAGGAGGAGCCATGGTACGGTATCGAGCAGGAGTACACCCTCCTACAGAAGGACATCAACTGGCCTCTCGGCTGGCCTGTTGGTGGATTCCCTGGTCCTCAGGGTCCTTACTACTGTAGTATTGGTGCTGACAAGTCGTTTGGGCGTGACATAGTTGACTCCCACTACAAGGCCTGCCTCTTTGCCGGCGTCAACATCAGTGGCATCAACGGCGAGGTCATGCCCGGACAGTGGGAGTTCCAAGTTGGCCCGACTGTCGGCATCTCTGCTGGTGACCAAGTGTGGGTTGCTCGCTACCTTCTTGAGAGGATCACTGAGATCGCCGGAGTTGTCGTCACATTTGACCCCAAGCCCATCCCAGGCGACTGGAACGGTGCTGGTGCTCACACAAACTACAGTACCGAGTCGATGAGGAAGGACGGCGGGTTCAAGGTCATCGTGGACGCTGTCGAGAAGCTCAAGCTGAAGCACAAGGAGCACATCGCCGCCTACGGCGAGGGCAACGAGCGCCGTCTCACCGGCAAGCACGAAACCGCCGACATCAACACCTTCAGCTGGGGTGTCGCGAACCGTGGCGCGTCGGTGCGCGTGGGACGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCCATGATCGCCGAGACCACCATCCTGTGGAAGCCCTGA。

the encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.8:

ATGAGTCTTCTTACAGATCTCGTTAACCTTAACCTCTCAGAGACCACTGACAAAATCATTGCGGAATACATATGGGTTGGAGGTTCAGGAATGGATATGAGAAGCAAAGCCAGGACTCTTCCTGGACCAGTGAGTGACCCTTCGGAGCTACCAAAGTGGAACTATGATGGCTCAAGCACAGGCCAAGCTCCTGGTGAAGACAGTGAAGTCATCTTATACCCTCAAGCCATATTCAAAGATCCTTTCCGTAGAGGCAACAACATTCTTGTCATGTGCGATGCTTACACTCCAGCGGGCGAACCGATCCCAACAAACAAAAGACACGCTGCGGCTAAGGTCTTTAGCCACCCCGATGTTGTAGCTGAAGTGCCATGGTATGGTATTGAGCAAGAGTATACTTTACTTCAGAAAGATGTGAACTGGCCTCTTGGTTGGCCTATTGGCGGCTTCCCCGGTCCTCAGGGACCATACTATTGTAGTGTTGGAGCAGATAAATCTTTTGGTAGAGACATCGTTGATGCTCACTACAAGGCCTGCTTATACGCTGGCATCAATATTAGTGGCATCAACGGAGAAGTCATGCCTGGTCAGTGGGAGTTCCAAGTTGGTCCAGCTGTTGGTATCTCGGCCGGTGATGAAATTTGGGTCGCACGTTTCATTTTGGAGAGGATCACAGAGATTGCTGGTGTGGTGGTATCTTTTGACCCAAAACCGATTCCCGGTGACTGGAATGGTGCTGGTGCTCACTGCAACTATAGTACCAAGTCAATGAGGGAAGATGGTGGTTACGAGATTATTAAGAAGGCAATCGATAAACTGGGACTGAGACACAAAGAACACATTGCAGCTTACGGTGAAGGCAATGAGCGCCGTCTCACGGGTCACCACGAGACTGCTGACATCAACACTTTCCTCTGGGGTGTTGCGAACCGTGGAGCATCAATCCGTGTAGGACGTGACACAGAGAAAGAAGGGAAAGGATACTTTGAGGATAGGAGGCCAGCTTCGAACATGGATCCTTACATTGTGACTTCCATGATTGCAGAGACCACAATCCTCTGGAAACCTTGA。

in a fourth aspect, the invention also provides a vector comprising the nucleic acid molecule described above.

Vectors include, but are not limited to, expression vectors, shuttle vectors, and integration vectors.

In the present invention, the term "expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements.

In an alternative embodiment, the expression vector further comprises a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

In a fifth aspect, the invention also provides a recombinant bacterium or recombinant cell comprising the nucleic acid molecule or vector described above.

The recombinant cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast, plant cells (e.g., ginseng cells).

In a preferred embodiment of the invention, the strain is Agrobacterium or E.coli.

In a sixth aspect, the invention also provides the use of a plant glutamine synthetase mutant, a nucleic acid molecule, a vector or a recombinant bacterium or recombinant cell as described above for breeding a plant variety having glufosinate resistance.

In a preferred embodiment of the application of the present invention, the application includes any of the following uses:

(1) Transforming a target plant with a vector containing a coding gene encoding a plant glutamine synthetase mutant;

(2) Modifying the endogenous glutamine synthetase gene of the target plant by a gene editing method to code a plant glutamine synthetase mutant;

(3) Mutagenizing and screening plant cells, tissues, individuals or populations to encode a plant glutamine synthetase mutant;

In an alternative embodiment, the gene editing is selected from CRISPR/Cas9, TALEN technology, or ZFN technology.

In preferred embodiments of the invention for use, the gene editing is selected from CRISPR/Cas9, TALEN technology or ZFN technology.

On the basis of the present invention, it is easy for a person skilled in the art to modify a target plant by a conventional gene editing technique in the art, such as a zinc finger endonuclease (ZFN, zinc-finger nucleic acid) technique, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique or CRISPR/Cas 9), a mutation breeding technique (such as chemical, radiation mutagenesis, etc.), etc., to have a gene encoding the plant glutamine synthetase mutant as described above, thereby obtaining glufosinate resistance and enabling normal growth and development, and to obtain a new variety of plants having glufosinate resistance. Therefore, whatever technology is adopted, the plant glutamine synthetase mutant provided by the invention is utilized to endow the plant with glufosinate resistance, and belongs to the protection scope of the invention.

In an alternative embodiment, the plant is subjected to mutagenesis in a physicochemical mutagenesis mode that is mutagenized to a non-lethal dose to obtain plant material.

The above-mentioned non-lethal dose means that the dose is controlled to be within a range of 20% floating above and below the semi-lethal dose.

Physicochemical mutagenesis modes include combinations of one or more of the following physical mutagenesis and chemical mutagenesis modes: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis includes alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; alkylating agent mutagenesis includes ethylcyclomate mutagenesis, diethylsulfate mutagenesis, and ethylenimine mutagenesis.

In an alternative embodiment, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea, or cassava;

In an alternative embodiment, the pasture is selected from gramineous pasture or leguminous pasture;

in an alternative embodiment, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage mustard, canola, mustard, blue, canola, green vegetables, or beet;

in an alternative embodiment, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon or melon;

in an alternative embodiment, the leguminous plant is selected from mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans;

in an alternative embodiment, the plant is maize, wheat, rice or canola.

In a seventh aspect, the present invention also provides a method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of a plant of interest a gene encoding a plant glutamine synthetase mutant as described above.

In an alternative embodiment, the method of introduction is selected from the group consisting of genetic transformation methods, genome editing methods, or genetic mutation methods.

The above genetic transformation methods include, but are not limited to: individuals with glufosinate resistance are produced by selfing or crossing parent plants with genes of glufosinate resistant plant glutamine synthetase mutants with other plant individuals.

In other embodiments, the methods of transformation described above include, but are not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.

In a preferred embodiment of the present invention, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea or cassava;

In an alternative embodiment, the plant is maize, wheat, rice or canola.

The invention has the following beneficial effects:

the method for obtaining the protein with the glufosinate resistance is simple and feasible, has high success rate, and is convenient for people to obtain the protein with the glufosinate resistance quickly and efficiently.

The glutamine synthetase mutant provided by the invention is originally derived from plants, has glufosinate resistance after mutation, and has good biological enzyme catalytic activity. Plants transformed with the glutamine synthetase mutant have glufosinate resistance and can grow and develop normally.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the amino acid sequence part alignment of rice GS1 mutant O294C, O294D, O E, O294F, O H, O294K, O N, O P, O294Q, O294R, O S, O294V, O W, O Y and O294X and wild-type rice GS1 OsGS1_WT provided in example 1;

FIG. 2 shows the results of partial alignment of the amino acid sequences of maize GS1 mutant Z294C, Z E, Z, 294H, Z, I, Z294K, Z, L, Z, M, Z, 294N, Z, P, Z, R, Z, W, Z Y and Z294X provided in example 2 with wild-type maize GS1 ZmGS1_WT;

FIG. 3 is a partial alignment of amino acid sequences of wheat GS1 mutant T294A, T C, T294D, T N and wild-type wheat GS1TaGS1_WT provided in example 2 of the present invention;

FIG. 4 shows the result of the partial alignment of amino acid sequences of the wild type canola GS1 mutant B294A, B294C, B38294H, B294K, B294M, B294N, B Q, B R, B T, B W and wild type canola GS1 BnGS1_WT provided in example 2 of the present invention;

FIG. 5 is a schematic diagram of the structure of pADV7 vector provided in Experimental example 1 of the present invention;

FIG. 6 shows the results of growth of the rice GS1 mutant O294C, O294D, O294E, O294F, O H, O294K, O N, O P, O Q, O294R, O S, O294V, O W, O Y and O294X of the rice GS1 OsGS1_WT of the present invention on a medium containing glufosinate at different concentrations, as provided in Experimental example 1;

FIG. 7 shows the results of E.coli growth on medium containing varying concentrations of glufosinate for corn GS1 mutant Z294C, Z294E, Z294H, Z294I, Z294K, Z L, Z M, Z294N, Z P, Z R, Z294W, Z Y and Z294X and wild-type corn GS1 ZmGS1_WT provided in Experimental example 2;

FIG. 8 shows the results of E.coli growth on medium containing glufosinate at different concentrations of wheat GS1 mutant T294A, T294C, T294D, T N and wild-type wheat GS1 TaGS1_WT provided in Experimental example 3 of the present invention;

FIG. 9 shows the results of E.coli growth on medium containing glufosinate of different concentrations of wild-type canola GS1 mutant B294A, B294C, B294E, B H, B294 6783K, B294M, B N, B294Q, B294R, B T, B W provided by transformation example 4 provided by Experimental example 4;

FIG. 10 shows the enzyme kinetic parameters and glufosinate resistance parameters IC of the rice GS1 mutant O294C, the corn GS1 mutant Z294C, the wheat GS1 mutant T294C, the rape GS1 mutant B294C, the wild-type rice GS1 OsGS1_WT, the wild-type corn GS1 ZmGS1_WT, the wild-type wheat GS1 TaGS1_WT and the wild-type rape GS1 BnGS1_WT provided in Experimental example 5 of the present invention ₅₀ ；

FIG. 11 shows amino acid sequence alignment of wild type glutamine synthetase from different plants; in the figure: osGS1_WT: wild type rice glutamine synthetase; zmgs1_wt: corn wild type glutamine synthetase; taGS1_WT: wheat wild type glutamine synthetase; bnGS1_WT: wild type rape glutamine synthetase.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the assays herein, some methods and materials are now described, unless otherwise indicated, the techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.

Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (methods of enzymology) (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), contemporary molecular biology methods (Current Protocols in Molecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The features and capabilities of the present invention are described in further detail below in connection with the examples.

Example 1

The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in this example is obtained by mutating or deleting the 294-th amino acid residue G of a wild-type rice glutamine synthetase itself (named OsGS 1-WT, the amino acid sequence of which is shown in SEQ ID NO.1, and the encoding nucleotide sequence of which is shown in SEQ ID NO. 5) to C, D, E, F, H, K, N, P, Q, R, S, V, W, Y, and the obtained rice GS1 mutants are named O294C, O294D, O E, O294F, O294H, O K, O294N, O294P, O294Q, O294 97294R, O S, O294V, O W, O Y and O294X, respectively.

The amino acid sequences of the rice GS1 mutant O294C, O, D, O, 294E, O, 294F, O, 294H, O, K, O, 294N, O, P, O, 294Q, O, 294R, O, S, O, V, O, 294W, O Y and O294X are aligned with those of the wild-type rice GS1 as shown in fig. 1, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 294, the codons for the corresponding amino acids were as shown in the following Table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

Amino acids	C	D	E	F	H
						Codons	TGC	GAT	GAG	TTC	CAC
Amino acids	K	N	P	Q	R
						Codons	AAG	AAC	CCC	CAG	CGC
Amino acids	S	V	W	Y	Deletion of
						Codons	TCC	GTC	TGG	TAC	Without any means for

The rice GS1 mutant O294C, O294D, O294E, O294F, O294H, O294K, O294N, O294P, O294Q, O294S, O V, O294W, O294Y and O294X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 2

The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating or deleting the 294 (corresponding to 294 of the reference sequence (SEQ ID No. 1)) of the wild-type corn GS1 itself (named zmgs1_wt, amino acid sequence shown in SEQ ID No.2, encoding nucleotide sequence of SEQ ID No. 6) from the amino acid residue G to C, E, H, I, K, L, M, N, P, R, W, Y. The resulting maize GS1 mutants were named Z294C, Z294E, Z H, Z I, Z294 38294K, Z L, Z294M, Z294N, Z P, Z294R, Z W, Z Y and Z294X, respectively.

The amino acid sequence alignment of maize GS1 mutant Z294C, Z E, Z H, Z294I, Z294K, Z294L, Z M, Z294N, Z P, Z294R, Z W, Z Y and Z294X with wild-type maize GS1 is shown in figure 2, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 294, the codons for the corresponding amino acids were as shown in the following Table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The maize GS1 mutant Z294C, Z, E, Z, H, Z, I, Z, K, Z, L, Z, M, Z, 294N, Z, P, Z, R, Z, 294W, Z Y and Z294X provided in this example, and nucleic acid molecules encoding them, can be obtained by chemical synthesis.

Example 3

The wheat (Triticum aestivum) GS1 mutant provided in this example was obtained by mutating the 294 (corresponding to 294 of the reference sequence (SEQ ID NO. 1)) of the wild-type wheat GS1 itself (designated TaGS 1-WT, the amino acid sequence of which is shown in SEQ ID NO.3, and the coding nucleotide sequence of which is SEQ ID NO. 7) from the amino acid residue G to A, C, D, N. The resulting wheat GS1 mutants were designated T294A, T294C, T294D, T N, respectively.

The amino acid sequence alignment of wheat GS1 mutant T294A, T294C, T D, T294N and wild-type wheat GS1 is shown in fig. 3, where: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each wheat GS1 mutant was at the position encoding amino acid 294, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

Amino acids	A	C	D	N
					Codons	GCT	TGC	GAT	AAC

The wheat GS1 mutant T294A, T294C, T294D, T N and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 4

The mutant of canola (Brassica napus) GS1 provided in this example is obtained by mutating the 294 (corresponding to 294 of the reference sequence (SEQ ID No. 1)) of the wild-type canola GS1 itself (named bngs1_wt, having the amino acid sequence shown in SEQ ID No.5, and having the encoding nucleotide sequence of SEQ ID No. 8) from the amino acid residue G to A, C, E, H, K, M, N, Q, R, T, W. The resulting canola GS1 mutants were designated B294A, B294C, B294E, B H, B294K, B294M, B294N, B294Q, B294R, B294T, B W, respectively.

The amino acid sequence alignment of canola GS1 mutant B294A, B C, B294E, B H, B294K, B294M, B N, B294Q, B294R, B294T, B W and wild-type canola GS1 is shown in fig. 4, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 294, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.

The rape GS1 mutant B294A, B294C, B E, B294H, B294K, B294M, B294N, B294Q, B294R, B294T, B W and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Experimental example 1

This experimental example separately detects glufosinate resistance of rice GS1 mutants O294C, O294D, O E, O294F, O H, O294K, O N, O P, O294Q, O294R, O S, O294V, O W, O Y and O294X provided in example 1 as follows:

according to the sequence of the nucleic acid molecule provided in example 1, coding genes encoding rice GS1 mutant O294C, O294D, O294E, O294F, O H, O294K, O294N, O294P, O294Q, O294R, O294S, O823 294W, O Y and O294X were synthesized by chemical synthesis, enzyme cleavage sites (Pac 1 and Sbf 1) were introduced into both ends, and after enzyme cleavage, the resulting mixture was ligated to an expression vector (e.g., pADV7 vector, the structure of which was shown in FIG. 5) subjected to the same enzyme cleavage treatment, and then glutamine synthetase-deficient E.coli, which was obtained by knocking out glutamine synthetase based on E.coli DH 5. Alpha. By Sichuan Yuxing straw biotechnology Co. After verification, positive clones are selected, inoculated to M9 culture medium containing glufosinate with different concentrations for growth, and defective E.coli growth is observed. The wild-type rice GS1 mutant was used as a negative control, and glufosinate resistance was examined with the GS1 mutant O294C (G294C, amino acid G mutation at position 294 of rice GS1 to C), O294D (G294D), O294E (G294E), O294F (G294F), O294H (G294H), O294K (O294K), O294N (G294N), O294P (G294P), O294Q (G294Q), O294R (G294R), O294S (G294S), O294V (G294V), O294W (G294W), O294Y (G294Y), and O294X (G294X). The results are shown in FIG. 6.

On a medium containing 0mM glufosinate (KP 0), the defective strains encoding the wild-type rice GS1 (OsGs1_WT) and the rice GS1 mutant O294C, O D, O294E, O294F, O H, O294K, O294N, O P, O294Q, O294R, O294S, O294V, O294W, O294Y and O294X were transformed to grow normally, indicating that GS1 encoded by O294C, O294D, O294E, O F, O294K, O294N, O294P, O294Q, O294Q, O Y and O294X both have normal GS1 enzyme activity;

coli transformed with wild-type rice GS1 could not grow on a medium containing 10mM glufosinate (KP 10), but E.coli transformed with rice mutant O294C, O D, O294E, O294F, O H, O294K, O294N, O P, O294Q, O294R, O294S, O294V, O294W, O Y and O294X showed significantly better growth than the negative control, it was demonstrated that the single mutant containing O294C, O294D, O294E, O F, O294K, O294N, O294P, O294Q, O294Q, O294Q, O Y and O294X was significantly better against glufosinate than the wild type.

These results demonstrate that the single mutants of O294C, O294D, O E, O294F, O H, O294K, O N, O P, O294Q, O294R, O S, O294V, O294W, O Y and O294X both have good resistance to glufosinate.

Experimental example 2

Referring to the test method of experimental example 1, the corn GS1 mutant provided in example 2 was tested for glufosinate tolerance.

Specifically, glufosinate resistance was examined for Z294C (G294C, mutation of amino acid G at position 294 of maize GS1 to C), Z294E (G294E), Z294H (G294H), Z294I (G294I), Z294K (G294K), Z294L (G294L), Z294M (G294M), Z294N (G294N), Z294P (G294P), Z294R (G294R), Z294W (G294W), Z294Y (G294Y), and Z294X (G294X), respectively. The results are shown in FIG. 7.

As can be seen from the results of fig. 7:

transformation of a defective strain encoding the wild-type maize GS1 (zmgs1_wt) and maize GS1 mutant Z294C, Z E, Z294H, Z294I, Z294L, Z M, Z K, Z294L, Z M, Z N, Z294P, Z294R, Z294W, Z Y and Z294X both grown normally on medium containing 0mM glufosinate (KP 0), indicating that the GS1 encoded by Z294C, Z294E, Z H, Z294I, Z294K, Z294L, Z M, Z294N, Z294P, Z R, Z294W, Z Y and Z294X both had normal GS1 enzyme activity;

coli transformed with wild-type maize GS1 was essentially incapable of growth on 2mM glufosinate (KP 2), but E.coli transformed with maize mutant Z294C, Z294E, Z294H, Z294K, Z294L, Z294M, Z294N, Z294P, Z294R, Z W, Z Y and Z294X grew significantly better than the negative control, it was demonstrated that the single mutant containing Z294C, Z294E, Z H, Z294I, Z294K, Z294L, Z294M, Z294N, Z P, Z294R, Z294W, Z Y and Z294X was significantly better against glufosinate than the wild type. Coli transformed with maize GS1 mutant Z294C, Z294E, Z294H, Z294I, Z294K, Z294L, Z M, Z294N, Z294P, Z294R, Z W, Z Y and Z294X all grew significantly on higher glufosinate concentrations (10 mm, kp10) medium.

These results demonstrate that the single mutants of Z294C, Z294E, Z294H, Z I, Z294K, Z L, Z294M, Z294N, Z P, Z294R, Z294W, Z Y and Z294X provided in example 2 have resistance to glufosinate.

Experimental example 3

Referring to the test method of experimental example 1, glufosinate resistance of wheat GS1 mutants T294A (G294A, amino acid G at position 294 of wheat GS1 was mutated to a), T294C (G294C), T294D (G294D), and T294N (G294N) provided in example 3 was tested. The results are shown in FIG. 8.

As can be seen from the results of fig. 8:

transformation of defective strains encoding the wild type wheat GS1 (tags1_wt) and the wheat GS1 mutant T294A, T294C, T D, T294N, both grown normally, on a medium containing 0mM glufosinate (KP 0), indicating that the GS1 encoded by T294A, T294C, T294D, T N has normal GS1 enzyme activity;

coli transformed with wild-type wheat GS1 was essentially incapable of growth on medium containing 10mM glufosinate (KP 10), but the growth of the e.coli transformed with wheat mutant T294A, T294C, T D, T N was significantly better than the negative control, indicating that the single mutant containing T294A, T294C, T294D, T N was significantly better than the wild-type.

These results demonstrate that the single mutants of T294A, T294C, T294D, T N all have resistance to glufosinate.

Experimental example 4

Referring to the test method of experimental example 1, glufosinate resistance of canola GS1 mutant B294A (G294A, amino acid G at position 294 of canola GS1 was mutated to a), B294C (G294C), B294E (G294E), B294H (G294H), B294K (G294K), B294M (G294M), B294N (G294N), B294Q (G294Q), B294R (G294R), B294T (G294T), B294W (G294W) provided in example 4 was tested. The results are shown in FIG. 9.

As can be seen from the results of fig. 9:

on a medium containing 0mM glufosinate (KP 0), defective strains encoding wild type canola GS1 (BnGS 1-WT) and canola GS1 mutant B294A, B294C, B294E, B294H, B K, B294M, B294 4639 294R, B294T, B W were transformed to grow normally, shows that the GS1 encoded by B294A, B C, B294 38394H, B294K, B294M, B Q, B294R, B294T, B W has normal GS1 enzyme activity;

coli transformed with wild-type canola GS1 was substantially incapable of growth on 2mM glufosinate (KP 2), but E.coli transformed with canola mutant B294A, B294C, B294E, B294H, B K, B294M, B294N, B294Q, B294R, B294T, B W grew significantly better than the negative control, it was demonstrated that the single mutant containing B294A, B C, B294 38394H, B294K, B294M, B Q, B294R, B294T, B W was significantly better in its ability to resist glufosinate than the wild type.

These results demonstrate that the single mutants of B294A, B294C, B E, B294H, B294K, B294M, B294N, B294Q, B294R, B294T, B W all have resistance to glufosinate.

Experimental example 5

The enzyme kinetic parameters of the O294C provided in example 1, the Z294C provided in example 2, the T294C provided in example 3, the B294C mutant provided in example 4 and the enzyme kinetic parameters in the presence of glufosinate were tested against wild-type rice gs1 osgs1_wt, wild-type maize gs1zmgs1_wt, wild-type wheat gs1 tags1_wt and wild-type canola gs1 bngs1_wt as follows:

1. and (3) constructing a carrier:

the nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.

2.6His protein purification:

the mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.

3. Enzyme activity determination:

(1) Instrument and reagents: enzyme-labeled instrument (De-Fe: HBS-1096A), glufosinate, substrate L-sodium glutamate (CAS: 6106-04-3).

(2) Principle of measurement

Glutamine Synthetase (GS) is the first enzyme to convert inorganic nitrogen to organic nitrogen, catalyzes the binding of ammonia from different sources to glutamate to form glutamine, and liberates Pi, as shown in the following specific reaction scheme:

The invention adopts a phosphomolybdic blue method to measure GS enzyme activity, and the principle of the method is as follows: under suitable acidic conditions, phosphoric acid (Pi) reacts with ammonium molybdate to form ammonium phosphomolybdate, which in turn is reduced by reducing agents (e.g., vitamin C, stannous chloride, etc.) to blue phosphomolybdenum blue, the blue shade of which is proportional to the phosphorus content.

(3) The operation steps are as follows:

the reaction was carried out in a Tris-HCl buffer system at pH7.5 in a total reaction volume of 30uL. The glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 200mM Tris-HCl (pH 7.5), 1.67mM ATP,30mM ammonium chloride, 20mM MgCl ₂ 10mM sodium L-glutamate. After 30ul of reaction solution is uniformly mixed, preheating is carried out for 5min at 35 ℃, mutant protein solution is added for reaction, after reaction is carried out for 30min at 35 ℃, 100 μl of color reaction D solution [ D=2A+B ] is added; and (3) solution A: 12% (W/V) ascorbic acid in 1mol/L hydrochloric acid solution, solution B: 2% (W/V) aqueous solution of ammonium molybdate tetrahydrate]Color was developed, left to stand for 5 minutes, and 100. Mu.l of a reaction termination F solution (2% sodium citrate, 2% acetic acid aqueous solution) was added thereto, and left to stand for 15 minutes, 200. Mu.l of the light absorption value was measured at 660 nm.

The results are shown in fig. 10, and can be seen from the results of fig. 10:

the Km values of the GS1 mutants were slightly higher than those of the wild-type controls osgs1_wt, zmgs1_wt, tags1_wt and bngs1_wt, indicating that the GS mutants reduced sensitivity to glufosinate inhibitors while slightly reduced sensitivity to normal substrates. V of GS1 mutant _max All were higher than the wild type control, indicating that these mutants had improved enzymatic ability.

Wild type controls were sensitive to glufosinate, IC ₅₀ IC of mutants at 0.006mM, 0.002mM, 0.007mM, respectively ₅₀ The IC's of O294C, Z C, T C and B294C are all significantly higher than the wild-type control ₅₀ Far higher than the wild-type control, indicating that the mutant is less sensitive to glufosinate. From mutant IC ₅₀ And wild type IC ₅₀ It can also be seen in the multiple relationship of O294C, Z, 294C, T C and B294C ₅₀ Corresponding to wild type GS1 IC ₅₀ These values also indicate that the enzyme activity of the mutants is much higher than that of the wild-type control, 94.667, 2941.667, 169, 8.143 times. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for obtaining a protein having glufosinate resistance comprising the steps of:

2) Comparing the amino acid sequence of the target protein with the reference sequence, and mutating or deleting the amino acid residue of the target protein corresponding to 294 th amino acid residue of the reference sequence;

3) Selecting a protein with enhanced glufosinate resistance;

preferably, when the target protein is derived from rice, the target protein is mutated to C, D, E, F, H, K, N, P, Q, R, S, V, W, Y or deleted corresponding to the 294 amino acid residue of the reference sequence;

preferably, when the target protein is derived from corn, the target protein is mutated to C, E, H, I, K, L, M, N, P, R, W, Y or deleted corresponding to amino acid residue 294 of the reference sequence;

preferably, when the target protein is derived from wheat, the target protein is mutated to A, C, D or N corresponding to amino acid residue 294 of the reference sequence;

preferably, when the target protein is derived from rape, the amino acid residue at position 294 of the target protein corresponding to the reference sequence is mutated to A, C, E, H, K, M, N, Q, R, T or W.

2. A plant glutamine synthetase mutant having glufosinate resistance, wherein said plant glutamine synthetase mutant is represented by (1) or (2):

(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with a reference sequence, and the nth position of the wild type glutamine synthetase corresponds to the 294 th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

the n-th amino acid of the plant glutamine synthetase mutant is A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted compared with the wild type glutamine synthetase;

3. The plant glutamine synthetase mutant according to claim 2, wherein the amino acid at the N-th position of said plant glutamine synthetase mutant is C or N.

4. The plant glutamine synthetase mutant of claim 2, wherein said plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, pasture, tea, or cassava;

preferably, the pasture is selected from gramineous pasture or leguminous pasture;

preferably, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage mustard, blue, canola, green vegetables or beet;

preferably, the cucurbitaceae plant is selected from cucumber, pumpkin, white gourd, balsam pear, luffa, melon, watermelon or melon;

preferably, the leguminous plant is selected from mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans;

preferably, when the plant is rice, the n-th amino acid of the plant glutamine synthetase mutant is C, D, E, F, H, K, N, P, Q, R, S, V, W, Y or deleted;

Preferably, when the plant is maize, the amino acid at the n-th position of the plant glutamine synthetase mutant is C, E, H, I, K, L, M, N, P, R, W, Y or deleted;

preferably, when the plant is wheat, the N-th amino acid of the plant glutamine synthetase mutant is A, C, D or N;

preferably, when the plant is canola, the n-th amino acid of the plant glutamine synthetase mutant is A, C, E, H, K, M, N, Q, R, T or W.

5. An isolated nucleic acid molecule encoding a plant glutamine synthetase mutant according to any one of claims 2 to 4.

6. A vector comprising the nucleic acid molecule of claim 5.

7. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 5 or the vector of claim 6.

8. Use of a plant glutamine synthetase mutant of any one of claims 2-4, a nucleic acid molecule of claim 5, a vector of claim 6 or a recombinant bacterium or recombinant cell of claim 7 for breeding a plant variety having glufosinate resistance;

preferably, the application comprises any one of the following uses:

(1) Transforming a plant of interest with a vector comprising a gene encoding a mutant of said plant glutamine synthetase;

(2) Modifying an endogenous glutamine synthetase gene of a target plant by a gene editing method to code the plant glutamine synthetase mutant;

(3) Mutagenizing and screening plant cells, tissues, individuals or populations to encode said plant glutamine synthetase mutants;

preferably, the gene editing is selected from CRISPR/Cas9, TALEN technology or ZFN technology;

preferably, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, pasture, tea or cassava;

preferably, the plant is maize, wheat, rice or canola.

9. A method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of a plant of interest a gene encoding a plant glutamine synthetase mutant of any one of claims 2-4.

10. The method of producing a glufosinate herbicide-tolerant plant of claim 9, wherein the plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, garland chrysanthemum, daylily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous, pasture, tea, or cassava;

preferably, the plant is maize, wheat, rice or canola.