CN114807064B - Method for obtaining protein with glufosinate resistance and mutant thereof - Google Patents

Method for obtaining protein with glufosinate resistance and mutant thereof Download PDF

Info

Publication number
CN114807064B
CN114807064B CN202210630247.6A CN202210630247A CN114807064B CN 114807064 B CN114807064 B CN 114807064B CN 202210630247 A CN202210630247 A CN 202210630247A CN 114807064 B CN114807064 B CN 114807064B
Authority
CN
China
Prior art keywords
glutamine synthetase
amino acid
mutant
glufosinate
wild
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210630247.6A
Other languages
Chinese (zh)
Other versions
CN114807064A (en
Inventor
邓龙群
胡江博
陈容
张震
侯青江
胥南飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gevoto LLC
Original Assignee
Gevoto LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gevoto LLC filed Critical Gevoto LLC
Priority to CN202210630247.6A priority Critical patent/CN114807064B/en
Publication of CN114807064A publication Critical patent/CN114807064A/en
Application granted granted Critical
Publication of CN114807064B publication Critical patent/CN114807064B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277Phosphinotricin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002Glutamate-ammonia ligase (6.3.1.2)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a method for obtaining a protein with glufosinate-ammonium resistance and a mutant thereof, and relates to the technical field of genetic engineering. The glutamine synthetase mutant provided by the invention has application potential for constructing an expression vector of a transformed plant and cultivating glufosinate-resistant crops. Compared with the anti-glufosinate genes such as pat or bar derived from bacteria, the glutamine synthetase mutant provided by the invention is more easily accepted by consumers. By having glufosinate resistance after mutation, the plants transformed with the glutamine synthetase mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development of plants.

Description

Method for obtaining protein with glufosinate resistance and mutant thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a method for obtaining a protein with glufosinate resistance and a mutant thereof.
Background
Glutamine synthetase (Glutamine synthetase, GS) is a key enzyme in nitrogen metabolism in plants, which catalyzes the condensation of glutamic acid (Glu) with NH 3 to form glutamine (gin) in the glutamate synthetase cycle, involved in the metabolism of nitrogen-containing compounds in plants. According to glutamine synthetase distribution and subcellular localization, higher plant GS (belonging to GSII class) isozymes can be divided into two classes: one is located in the cytoplasm called cytoplasmic GS (GS 1), with a molecular weight of 38-40kDa; another type, designated as apoplast GS (GS 2), is located in chloroplasts (or plastids) and has a molecular weight of 44-45kDa.
Glufosinate (glufosinate ammonium, trade name basta) is a glutamine synthetase (GS 1) inhibitor developed by anget, now bayer, and its active ingredient is phosphinothricin (PPT) and its chemical name is (RS) -2-amino-4- (hydroxymethylphosphino) ammonium butyrate. The product is marketed in 1986, and sales increase year by year. The target enzyme for glufosinate is GS, which can normally form lambda-glutamyl phosphate from ATP and glutamate. However, after PPT treatment, PPT is first bound to ATP and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed and GS activity is inhibited. PPT has been shown to inhibit all known forms of GS.
As a result of the inhibition of GS by glufosinate, it can lead to disturbances of nitrogen metabolism in plants, excessive accumulation of ammonium, chloroplast disintegration, and thus to inhibition of photosynthesis, ultimately leading to death of plants.
At present, the main method for cultivating the glufosinate-resistant variety is to introduce the glufosinate-resistant gene from bacteria into crops by using genetic engineering means, so as to cultivate a new transgenic glufosinate-resistant crop variety. The most widely used glufosinate-resistant genes in agriculture at this stage are the bar gene from strain Streptomyces hygroscopicus and the pat gene from strain s. The bar gene and the pat gene have 80% homology, and can code glufosinate acetylase, and the enzyme can be used for inactivating glufosinate acetylase. The glufosinate-resistant variety has great use value, wherein resistant rape, corn and the like are commercially planted in a large area.
However, due to the wave of the transgene, transgenic crops are still less accepted worldwide, and even in america where the transgenic crops are planted in the largest areas, the transgene is mainly limited to several crops such as corn, soybean, cotton, etc. In particular the bar and pat genes are derived from microorganisms, not from the crop itself, and are more likely to cause conflicting psychological effects for the consumer.
The glufosinate acetylases encoded by the bar and pat genes can acetylate glufosinate to deactivate it, but it is difficult for the enzyme to completely deactivate glufosinate before it contacts the GS, because many GS are distributed on cell membranes, so that the use of glufosinate on bar and pat gene crops interferes with nitrogen metabolism in plants to varying degrees, as well as normal growth and development of plants. Although overexpression of wild-type GS in plants can reduce the sensitivity of transgenic plants to glufosinate, the degree of tolerance is insufficient for commercial use.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a method for obtaining a protein with glufosinate resistance and a mutant thereof so as to solve the technical problems.
The invention is realized in the following way:
The present invention provides a method for obtaining a protein having glufosinate resistance comprising the steps of:
1) A protein having the reference sequence shown in SEQ ID NO.1 or having an amino acid sequence having at least 85% identity to the reference sequence as a target protein;
2) Aligning the amino acid sequence of the target protein with a reference sequence, and mutating the amino acid sequence of the target protein corresponding to the 58 th amino acid residue S and/or the 65 th amino acid residue G of the reference sequence;
3) Proteins with increased glufosinate resistance are selected.
The inventors found that proteins with increased glufosinate resistance can be obtained by aligning the amino acid sequence of the target protein with a reference sequence, mutating the amino acid residue S (Ser, serine) at position 58 and/or the amino acid residue G (Gly, glycine) at position 65 of the sequence corresponding to the reference sequence. Including without limitation: simultaneously mutating S at position 58 and G at position 65 of the target protein, mutating S at position 58 of the target protein or mutating G at position 65 of the target protein.
In an alternative embodiment, the amino acid sequence of the target protein is A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X, X being deleted, corresponding to the amino acid at amino acid 58 of the reference sequence.
In an alternative embodiment, the amino acid sequence of the protein of interest corresponds to the deletion of amino acid 65 of the reference sequence.
Through the mutation, the target protein has glufosinate resistance, and can maintain the own biological enzyme catalytic activity, thereby meeting the normal nitrogen metabolism of plants and maintaining the normal growth and development of the plants.
The plant or recombinant bacteria transformed with the glufosinate-resistant protein provided by the invention can normally grow and develop in the presence of glufosinate, and the glufosinate-resistant protein mutant can be used for culturing transgenic crops and non-transgenic plants resistant to glufosinate. Including without limitation: rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like have wide application prospects.
The reference sequence is wild type glutamine synthetase from rice.
The sequence alignment method can use Blast website:
(https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) performing a Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.
The target proteins include, but are not limited to: proteins having a sequence similar to that of a natural plant protein (e.g., artificial design and synthesis), and wild-type glutamine synthetase derived from a plant. By mutating the amino acid residues at the above-mentioned sites, a protein having enhanced glufosinate resistance can be obtained.
The above 85% identity, for example, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
The term "glufosinate" in the present invention, also known as glufosinate, refers to 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate.
The invention also provides a glufosinate-resistant glutamine synthetase mutant having an amino acid sequence of at least one of:
(1) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the n-th position of the wild glutamine synthetase; the position of the nth bit is determined as follows: the wild-type glutamine synthetase is aligned with the reference sequence, and the nth position of the wild-type glutamine synthetase corresponds to the 58 th position of the reference sequence;
The n-th amino acid of the mutated glutamine synthetase mutant is X1, and X1 = A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X, and X is deleted;
(2) The glutamine synthetase mutant has at least 85% identity with the glutamine synthetase mutant shown in (1) in amino acid sequence, and has glufosinate resistance with the glutamine synthetase mutant shown in (1) in the n-th amino acid;
(3) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the m-th position of the wild glutamine synthetase; the position of the mth bit is determined as follows: the wild-type glutamine synthetase is aligned with the reference sequence, and the m-th position of the wild-type glutamine synthetase corresponds to the 65-th position of the reference sequence;
The m-th amino acid of the mutated glutamine synthetase mutant is X2, and X2 = X; x is deletion;
(4) The amino acid sequence of the glutamine synthetase mutant has at least 85% identity with the glutamine synthetase mutant shown in (3), is the same as the amino acid at m position of the glutamine synthetase mutant shown in (3), and has glufosinate resistance;
the reference sequence is shown as SEQ ID NO.1, and is wild type glutamine synthetase derived from rice. The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.
According to the research of the invention, the wild type glutamine synthetase of plant origin is compared with a reference sequence, and the amino acid site corresponding to the 58 th site of the reference sequence, namely the nth site, is mutated to A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X; or mutating the amino acid site (the m position) corresponding to the 65 th position of the reference sequence to X, wherein the obtained glutamine synthetase mutant has glufosinate resistance and maintains the biological enzyme catalytic activity. The plant or recombinant bacteria transformed with the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate. Therefore, the plant glutamine synthetase mutant can be used for cultivating transgenic crops and can also be used for cultivating glufosinate-resistant non-transgenic plants. Including without limitation: rice, tobacco, soybean, corn, cotton, sorghum and the like, and has wide application prospect.
It should be noted that the nth position of the wild-type glutamine synthetase may be the 58 th position (for example, corn, wheat, soybean, rape, etc.) on its own sequence, but may not be the 58 th position, and the specific position of the nth position is determined according to the alignment of the sequences, so long as the position corresponding to the 58 th position of the reference sequence is the nth position, that is, the mutation position, when the position is aligned with the reference sequence.
It should be noted that the mth position of the wild-type glutamine synthetase may be the 65 th position (e.g., corn, wheat, soybean, rape, etc.) on its own sequence, but may not be the 65 th position, and the specific position of the mth position is determined according to the alignment of the sequences, so long as the position corresponding to the 65 th position of the reference sequence is the mth position, i.e., the mutation position, according to the present invention after the alignment with the reference sequence.
All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, the mutant glutamine synthetase obtained by making the above mutation at position 58 or 65 is glufosinate resistant to any wild-type glutamine synthetase of plant origin. Therefore, the glutamine synthetase mutants obtained by making the above mutation by wild glutamine synthetase of any plant source are all within the protection scope of the present invention.
Furthermore, it is known and easily achieved by those skilled in the art that a glutamine synthetase mutant represented by (1) or (3) has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.) identity with a glutamine synthetase mutant represented by (1) (or (3)) by performing simple amino acid substitution, deletion, or addition, etc. in a non-conserved region of the glutamine synthetase mutant and maintaining the n-th position as the above-mentioned mutated amino acid, and that the glutamine synthetase mutant obtained by further mutation has an equivalent or slightly decreased or slightly increased or greatly increased enzymatic activity and glufosinate resistance, etc. as compared with the glutamine synthetase mutant represented by (1) or (3). Therefore, such glutamine synthetases should also fall within the scope of the present invention.
When the wild-type glutamine synthetase plant is rice, x1= A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X, X is a deletion; x2=x, X being a deletion.
When the wild-type glutamine synthetase plant is soybean, x1= D, E, P or R; x2=x, X being a deletion.
When the wild-type glutamine synthetase plant is corn, x1= D, E, I, K, P, R or X; x2=x, X being a deletion.
When the wild type glutamine synthetase plant is canola, x1= D, E, I, P, Q or R; x2=x, X being a deletion.
Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:
MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP.
alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:
MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP.
alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3:
MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP.
Alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.4:
MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP.
The Similarity and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin to each other are shown in the following table. FIG. 1 shows the amino acid sequence alignment of wild-type glutamine synthetase from different plants; in the figure: osGS1-WT: rice wild type glutamine synthetase; zmGS1-WT: corn wild type glutamine synthetase; gmGS1-WT: soybean wild type glutamine synthetase; bnGS1-WT: wild type glutamine synthetase of rape, the arrow shows amino acid 58 and 65 respectively.
The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.
The invention provides a nucleic acid molecule which codes for the glutamine synthetase mutant.
In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant is easily obtained by a person skilled in the art based on degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant may be obtained by mutating a corresponding nucleotide to a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by one skilled in the art.
For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.5:
ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA.
Accordingly, on a sequence basis, a rice glutamine synthetase mutant encoding the above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to the 58 th or 65 th position of the encoded amino acid sequence.
The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.6:
ATGGCCTGCCTCACCGACCTCGTCAACCTCAACCTCTCGGACAACACCGAGAAGATCATCGCGGAATACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAAGCAAGGACCCTCTCCGGCCCGGTGACCGATCCCAGCAAGCTGCCCAAGTGGAACTACGACGGCTCCAGCACGGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCGCAGGCCATCTTCAAGGACCCATTCAGGAGGGGCAACAACATCCTTGTGATGTGCGATTGCTACACCCCAGCCGGCGAGCCAATCCCCACCAACAAGAGGTACAACGCCGCCAAGATCTTCAGCAGCCCTGAGGTCGCCGCCGAGGAGCCGTGGTATGGTATTGAGCAGGAGTACACCCTCCTCCAGAAGGACACCAACTGGCCCCTTGGGTGGCCCATCGGTGGCTTCCCCGGCCCTCAGGGTCCTTACTACTGTGGAATCGGCGCCGAAAAGTCGTTCGGCCGCGACATCGTGGACGCCCACTACAAGGCCTGCTTGTATGCGGGCATCAACATCAGTGGCATCAACGGGGAGGTGATGCCAGGGCAGTGGGAGTTCCAAGTCGGGCCTTCCGTGGGTATATCTTCAGGCGACCAGGTCTGGGTCGCTCGCTACATTCTTGAGAGGATCACGGAGATCGCCGGTGTGGTGGTGACGTTCGACCCGAAGCCGATCCCGGGCGACTGGAACGGCGCCGGCGCGCACACCAACTACAGCACGGAGTCGATGAGGAAGGAGGGCGGGTACGAGGTGATCAAGGCGGCCATCGAGAAGCTGAAGCTGCGGCACAGGGAGCACATCGCGGCATACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACGTTCAGCTGGGGCGTGGCCAACCGCGGCGCGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGCCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA.
the encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO.7:
ATGTCGCTGCTCTCAGATCTCATCAACCTTAACCTCTCAGACACTACTGAGAAGGTGATCGCAGAGTACATATGGATCGGTGGATCAGGAATGGACCTGAGGAGCAAAGCAAGGACTCTCCCAGGACCAGTTAGCGACCCTTCAAAGCTTCCCAAGTGGAACTATGATGGTTCCAGCACAGGCCAAGCTCCTGGAGAAGACAGTGAAGTGATTATATACCCACAAGCCATTTTCAGGGATCCATTCAGAAGGGGCAACAATATCTTGGTTATCTGTGATACTTACACTCCAGCTGGAGAACCCATTCCCACTAACAAGAGGCACGATGCTGCCAAGGTTTTCAGCCATCCTGATGTTGTTGCTGAAGAGACATGGTATGGTATTGAGCAGGAATACACCTTGTTGCAGAAAGATATCCAATGGCCTCTTGGGTGGCCTGTTGGTGGTTTCCCTGGACCACAGGGTCCATACTACTGTGGTGTTGGCGCTGACAAGGCTTTTGGCCGTGACATTGTTGACGCACATTACAAAGCCTGTCTTTATGCTGGCATCAACATCAGTGGAATTAATGGAGAAGTGATGCCCGGTCAGTGGGAATTCCAAGTTGGACCTTCAGTTGGAATCTCAGCTGGTGACGAGGTGTGGGCAGCTCGTTACATCTTGGAGAGGATCACTGAGATTGCTGGTGTGGTGGTTTCCTTTGATCCCAAGCCAATTCAGGGTGATTGGAATGGTGCTGGTGCTCACACAAACTACAGCACTAAGTCCATGAGAAATGATGGTGGCTATGAAGTGATCAAAACCGCCATTGAGAAGTTGGGGAAGAGACACAAGGAGCACATTGCTGCTTATGGAGAAGGCAACGAGCGTCGTTTGACAGGGCGCCACGAAACCGCTGACATCAACACCTTCTTATGGGGAGTTGCAAACCGTGGAGCTTCAGTTAGGGTTGGGAGGGACACAGAGAAAGCAGGGAAGGGATATTTTGAGGACAGAAGGCCAGCTTCTAACATGGACCCATATGTGGTTACTTCCATGATTGCAGACACAACCATTCTGTGGAAGCCATGA.
the encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.8:
ATGAGTCTTCTTACAGATCTCGTTAACCTTAACCTCTCAGAGACCACTGACAAAATCATTGCGGAATACATATGGGTTGGAGGTTCAGGAATGGATATGAGAAGCAAAGCCAGGACTCTTCCTGGACCAGTGAGTGACCCTTCGGAGCTACCAAAGTGGAACTATGATGGCTCAAGCACAGGCCAAGCTCCTGGTGAAGACAGTGAAGTCATCTTATACCCTCAAGCCATATTCAAAGATCCTTTCCGTAGAGGCAACAACATTCTTGTCATGTGCGATGCTTACACTCCAGCGGGCGAACCGATCCCAACAAACAAAAGACACGCTGCGGCTAAGGTCTTTAGCCACCCCGATGTTGTAGCTGAAGTGCCATGGTATGGTATTGAGCAAGAGTATACTTTACTTCAGAAAGATGTGAACTGGCCTCTTGGTTGGCCTATTGGCGGCTTCCCCGGTCCTCAGGGACCATACTATTGTAGTGTTGGAGCAGATAAATCTTTTGGTAGAGACATCGTTGATGCTCACTACAAGGCCTGCTTATACGCTGGCATCAATATTAGTGGCATCAACGGAGAAGTCATGCCTGGTCAGTGGGAGTTCCAAGTTGGTCCAGCTGTTGGTATCTCGGCCGGTGATGAAATTTGGGTCGCACGTTTCATTTTGGAGAGGATCACAGAGATTGCTGGTGTGGTGGTATCTTTTGACCCAAAACCGATTCCCGGTGACTGGAATGGTGCTGGTGCTCACTGCAACTATAGTACCAAGTCAATGAGGGAAGATGGTGGTTACGAGATTATTAAGAAGGCAATCGATAAACTGGGACTGAGACACAAAGAACACATTGCAGCTTACGGTGAAGGCAATGAGCGCCGTCTCACGGGTCACCACGAGACTGCTGACATCAACACTTTCCTCTGGGGTGTTGCGAACCGTGGAGCATCAATCCGTGTAGGACGTGACACAGAGAAAGAAGGGAAAGGATACTTTGAGGATAGGAGGCCAGCTTCGAACATGGATCCTTACATTGTGACTTCCATGATTGCAGAGACCACAATCCTCTGGAAACCTTGA.
the present invention provides an expression cassette or vector comprising the nucleic acid molecule described above.
In an alternative embodiment, the expression cassette is linked to regulatory sequences for regulating the expression of the nucleic acid molecule, including, but not limited to, promoters, enhancers, signal peptide coding sequences, selectable marker genes, terminators, and the like.
The invention provides a recombinant bacterium or recombinant cell comprising the nucleic acid molecule or the expression cassette or vector.
The recombinant bacteria may be selected from agrobacterium; the recombinant cell may be a competent cell, e.g. selected from e.coli or yeast competent cells.
The present invention provides a method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of the plant a gene encoding a glufosinate resistant glutamine synthetase mutant as described above.
In an alternative embodiment, the method of introduction is selected from the group consisting of genetic transformation methods, genome editing methods, or genetic mutation methods.
The above genetic transformation methods include, but are not limited to: individuals with glufosinate resistance are produced by selfing or crossing parent plants with genes for glufosinate resistant glutamine synthetase mutants with other plant individuals.
In other embodiments, the methods of transformation described above include, but are not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.
Genome editing methods or gene mutation methods refer to those skilled in the art who readily contemplate modification of a target plant to have a gene encoding a glutamine synthetase mutant as above by a transgenic technique, a gene editing technique (e.g., by a zinc finger endonuclease (ZFN, zinc-finger nucleases) technique, a transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique, or CRISPR/cas 9), a mutation breeding technique (e.g., chemical, radiation mutagenesis, etc.), or the like, so as to obtain a new plant variety that is glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.
In an alternative embodiment, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea, or cassava.
In an alternative embodiment, the pasture includes, but is not limited to, gramineous pasture or leguminous pasture. Gramineous pastures include, but are not limited to: grass for lawn. Leguminous forage includes, but is not limited to: red clover, white clover, alfalfa, arrowhead peas, green peas, lupin yellow, white clover, sweet clover, astragalus root, white milk vetch, white butterfly beans, and the like.
In an alternative embodiment, brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, wasabi, canola, cabbage or beet.
In an alternative embodiment, cucurbitaceae plants include, but are not limited to, cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon, or melon.
In an alternative embodiment, leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, or green beans.
The application of the glutamine synthetase mutant, the nucleic acid molecule, the expression cassette or the vector, or the recombinant bacterium or the recombinant cell in cultivating the plant variety with glufosinate resistance.
The above applications include: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.
In an alternative embodiment, the plant is subjected to mutagenesis in a physicochemical mutagenesis mode that is mutagenized to a non-lethal dose to obtain plant material.
The above-mentioned non-lethal dose means that the dose is controlled to be within a range of 20% floating above and below the semi-lethal dose.
Physicochemical mutagenesis modes include combinations of one or more of the following physical mutagenesis and chemical mutagenesis modes: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis includes alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; alkylating agent mutagenesis includes ethylcyclomate mutagenesis, diethylsulfate mutagenesis, and ethylenimine mutagenesis.
The above applications include: the endogenous glutamine synthetase gene of the plant of interest is modified to encode a glutamine synthetase mutant.
Modification of the endogenous glutamine synthetase gene of the plant of interest means that the person skilled in the art will readily recognize that the plant of interest is engineered to have a gene encoding a glutamine synthetase mutant as described above by means of conventional transgenic techniques in the art, gene editing techniques, such as by zinc finger endonuclease (ZFN, zinc-finger nucleases) techniques, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) techniques or CRISPR/cas9, mutagenesis breeding techniques, such as chemical, radiation mutagenesis, etc., to obtain a new variety of plants that are glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.
In a preferred embodiment of the application of the present invention, the application includes at least one of the following application modes:
delivering an isolated nucleic acid molecule to a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a mutant glutamine synthetase;
transforming a target plant with a vector containing a gene encoding a glutamine synthetase mutant;
Introducing recombinant bacteria or recombinant cells into the target plant, wherein the recombinant bacteria or recombinant cells contain a coding gene for a glutamine synthetase mutant.
The isolated nucleic acid molecule may be a plasmid or a DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by gene gun methods.
The invention has the following beneficial effects:
The glutamine synthetase mutant provided by the invention has application potential for constructing an expression vector of a transformed plant and cultivating glufosinate-resistant crops. Compared with the anti-glufosinate genes such as pat or bar derived from bacteria, the glutamine synthetase mutant provided by the invention is more easily accepted by consumers. By having glufosinate resistance after mutation, the plants transformed with the glutamine synthetase mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development of plants and the normal nitrogen metabolism of plants.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the amino acid sequence alignment of wild-type glutamine synthetase from different plants; in the figure: osGS1-WT: rice wild type glutamine synthetase; zmGS1-WT: corn wild type glutamine synthetase; gmGS1-WT: soybean wild type glutamine synthetase; bnGS1-WT: wild type rape glutamine synthetase;
FIG. 2 shows the amino acid sequence part alignment results of the rice GS1 mutant OS58A, OS58C, OS 3458 58 3776 58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS P, OS58Q, OS58R, OS58T, OS58Y, OS X and the wild type rice GS1 OsGS1-WT provided in example 1 of the present invention;
FIG. 3 is a partial alignment of amino acid sequences of soybean GS1 mutant GS58D, GS58E, GS58P, GS R and wild type soybean GS1 GmGS1-WT provided in example 2 of the present invention;
FIG. 4 is a partial alignment of amino acid sequences of maize GS1 mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS R, ZS X and wild-type maize GS1 ZmGS1-WT provided in example 3 of the present invention;
FIG. 5 shows the amino acid sequence part alignment of the canola GS1 mutant BS58D, BS58E, BS58I, BS58P, BS58Q, BS R and the wild type canola GS1BnGS1-WT provided in example 4 of the present invention;
FIG. 6 shows the results of partial alignment of amino acid sequences of the rice GS1 mutant OG65X and wild-type rice GS1 OsGS1-WT provided in example 5 of the present invention.
FIG. 7 shows the amino acid sequence part alignment of soybean GS1 mutant GG65X and wild-type soybean GS1 GmGS-WT provided in example 6 of the present invention.
FIG. 8 is a partial alignment of the amino acid sequences of maize GS1 mutant ZG65X and wild-type maize GS1 ZmGS-WT provided in example 7 of the present invention.
FIG. 9 is a partial alignment of amino acid sequences of the canola GS1 mutant BG65X and wild-type canola GS1 BnGS-WT provided in example 8 of the present invention.
FIG. 10 is a schematic diagram showing the structure of pADV7 vector according to Experimental example 1 of the present invention;
FIG. 11 shows the results of E.coli growth on medium containing glufosinate with different concentrations of GS1 mutant OS58A, OS58C, OS58D, OS58E, OS58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS58P, OS Q, OS58R, OS58T, OS58Y, OS X and wild-type rice GS1 OsGS1-WT provided in Experimental example 1;
FIG. 12 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant GS58D, GS58E, GS58P, GS R and wild-type soybean GS1 GmGS-WT provided in Experimental example 2 of the present invention;
FIG. 13 shows the results of E.coli growth on medium containing glufosinate at different concentrations of corn GS1 mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS58R, ZS X and wild-type corn GS1 ZmGS-WT provided in Experimental example 3 of the present invention;
FIG. 14 shows the results of E.coli growth on medium containing glufosinate of different concentrations of the canola GS1 mutant BS58D, BS58E, BS58I, BS58P, BS58Q, BS R and wild-type canola GS1 BnGS-WT provided in Experimental example 4 of the present invention;
FIG. 15 shows the enzyme kinetic parameters and glufosinate resistance parameters IC 50 of the rice GS1 mutant OS58D, soybean GS1 mutant GS58D, corn GS1 mutant ZS58D, rape GS1 mutant BS58D, wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type corn GS1 ZmGS-WT and wild-type rape GS1BnGS1-WT provided in Experimental example 5 of the present invention;
FIG. 16 shows the results of E.coli growth on medium containing glufosinate of different concentrations of both the rice GS1 mutant OG65X and the wild-type rice GS1 OsGS1-WT provided in Experimental example 5 of the present invention;
FIG. 17 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant GG65X and wild-type soybean GS1 GmGS-WT provided in Experimental example 6 of the present invention;
FIG. 18 shows the results of E.coli growth on medium containing glufosinate at different concentrations for corn GS1 mutant ZG64X and wild-type corn GS1 ZmGS-WT provided in Experimental example 7 of the present invention;
FIG. 19 shows the results of E.coli growth on medium containing glufosinate of different concentrations for the canola GS1 mutant BG65X and wild-type canola GS1 BnGS-WT provided in Experimental example 8 of the present invention;
FIG. 20 shows the enzyme kinetic parameters and glufosinate resistance parameters IC 50 of the rice GS1 mutant OG65X, soybean GS1 mutant GG65X, corn GS1 mutant ZG65X, rape GS1 mutant BG65X, wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type corn GS1 ZmGS-WT and wild-type rape GS1 BnGS1-WT provided in Experimental example 10.
Detailed Description
Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of formulations or unit doses herein, some methods and materials are now described. Unless otherwise indicated, techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.
Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait, eds., 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (A) and (B) in the following general references, (Methods in Enzymology) methods of enzymology (academic Press Co., ltd (ACADEMIC PRESS, inc.), manual of experimental immunology (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), methods of contemporary molecular biology (Current Protocols in Molecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in the example is obtained by mutating the 58 th amino acid residue S of wild type rice glutamine synthetase itself (named as OsGS1-WT, the amino acid sequence is shown as SEQ ID NO.1, the encoding nucleotide sequence is shown as SEQ ID NO. 5) to A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or deleting (X), and the obtained rice GS1 mutant is named as OS58A, OS58C, OS58D, OS58E, OS58G, OS58I, OS58K, OS58L, OS58K, OS58M, OS58 9626Q, OS58R, OS58T, OS Y, OS X.
The amino acid sequence alignment of OS58A, OS58C, OS58D, OS58 3758G, OS58H, OS58I, OS58K, OS L, OS58M, OS58P, OS58Q, OS58R, OS58 5858T, OS58Y, OS X and wild-type rice GS1 is shown in fig. 2, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 58, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
The rice GS1 mutant OS58A, OS58C, OS58D, OS58E, OS58G, OS58H, OS58I, OS58K, OS58L, OS 3558M, OS58P, OS58Q, OS58R, OS58T, OS58Y, OS X and the nucleic acid molecule encoding them provided in this example can be obtained by chemical synthesis.
Example 2
The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 58 th position (corresponding to the 58 th position of the reference sequence (SEQ ID NO. 1)) of wild-type soybean GS1 itself ((designated GmGS-WT, amino acid sequence shown as SEQ ID NO.3, encoding nucleotide sequence SEQ ID NO. 7) with the amino acid residue S D, E, P, R, and the obtained soybean GS1 mutants were designated GS58D, GS58E, GS P, GS R, respectively.
The amino acid sequence alignment of soybean GS1 mutant GS58D, GS58E, GS P, GS R and wild type soybean GS1 is shown in fig. 3, where: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 58, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids D E P R
Codons GAC GAA CCG CGC
The soybean GS1 mutant GS58D, GS58E, GS58P, GS R and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 3
The corn (Zea mays) GS1 mutant provided in this example was obtained by mutating the 58 th position (corresponding to the 58 th position of the reference sequence (SEQ ID NO. 1)) of wild-type corn GS1 itself (designated ZmGS-WT, the amino acid sequence shown as SEQ ID NO.2, the coding nucleotide sequence shown as SEQ ID NO. 6) with the amino acid residue S D, E, I, K, P, R or deleting (X). The obtained corn GS1 mutants were named ZS58D, ZS58E, ZS58I, ZS K, ZS58P, ZS58R, ZS X, respectively.
The amino acid sequence alignment of maize GS1 mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS R, ZS58X and wild-type maize GS1 is shown in fig. 4, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 58, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids D E I K P R Deletion of
Codons GAC GAG ATC AAG CCA CGC Without any means for
The maize GS1 mutant ZS58D, ZS58E, ZS58I, ZS K, ZS58P, ZS58R, ZS X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 4
The rape (Brassica napus) GS1 mutant provided in the example is obtained by mutating the 58 th site (corresponding to the 58 th site of the reference sequence (SEQ ID NO. 1)) of the wild type rape GS1 itself (named BnGS-WT, the amino acid sequence is shown as SEQ ID NO.4, and the coding nucleotide sequence is shown as SEQ ID NO. 8) from the amino acid residue S to D, E, I, P, Q or R. The obtained rape GS1 mutants are named BS58D, BS58E, BS58I, BS58P, BS58Q, BS R respectively.
The amino acid sequence alignment of the canola GS1 mutant BS58D, BS58E, BS58I, BS P, BS58Q, BS R and the wild-type canola GS1 is shown in fig. 5, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 58, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.
Amino acids D E I P Q R
Codons GAC GAA ATC CCA CAA AGA
The rape GS1 mutant BS58D, BS58E, BS58I, BS58K, BS58P, BS58R, BS X and the nucleic acid molecules encoding the same provided in the present example can be obtained by chemical synthesis.
Example 5
The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in this example is obtained by mutating the 65 th amino acid residue G of a wild-type rice glutamine synthetase itself (named OsGS1-WT, the amino acid sequence is shown as SEQ ID No.1, the encoding nucleotide sequence is shown as SEQ ID No. 5) to X, the obtained rice GS1 mutant is named OG65X, and the amino acid sequence of the rice GS1 mutant OG65X and the amino acid sequence of the wild-type rice GS1 are compared as shown in fig. 6, wherein: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 65, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids Deletion of
Codons Without any means for
The rice GS1 mutant OG65X and the nucleic acid molecule encoding them provided in this example can be obtained by chemical synthesis.
Example 6
The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 65 th site (corresponding to the 65 th site of the reference sequence (SEQ ID NO. 1)) of the wild-type soybean GS1 itself ((designated GmGS-WT, the amino acid sequence shown in SEQ ID NO.3, the encoding nucleotide sequence shown in SEQ ID NO. 7) with the amino acid residue G to X, and the obtained rice soybean GS1 mutants were designated GG64X and wild-type soybean GS1 GmGS1-WT, respectively.
The amino acid sequence alignment of soybean GS1 mutant GG65X and wild-type soybean GS1 is shown in fig. 7, where: the position indicated by the arrow is the mutation site.
The coding sequence of the soybean GS1 mutant GG65X provided in this example corresponds to SEQ ID NO.3.
In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 65, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids Deletion of
Codons Without any means for
The soybean GS1 mutant GG65X and the nucleic acid molecule encoding the same can be obtained by chemical synthesis.
Example 7
The corn (Zea mays) GS1 mutant provided in this example was obtained by mutating the 65 th position (corresponding to the 65 th position of the reference sequence (SEQ ID NO. 1)) of wild-type corn GS1 itself (designated ZmGS-WT, the amino acid sequence shown as SEQ ID NO.2, the coding nucleotide sequence shown as SEQ ID NO. 6) from the amino acid residue G to X. The resulting maize GS1 mutant was designated ZG65X.
The amino acid sequence alignment of maize GS1 mutant ZG65X and wild-type maize GS1 is shown in figure 8, where: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 65, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
Amino acids Deletion of
Codons Without any means for
The maize GS1 mutant ZG65X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 8
The mutant of the rape (Brassica napus) GS1 provided in the example is obtained by mutating 65 th site (65 th site corresponding to reference sequence (SEQ ID NO. 1)) of wild type rape GS1 (named BnGS-WT, the amino acid sequence is shown as SEQ ID NO.4, the encoding nucleotide sequence is shown as SEQ ID NO. 8) from amino acid residue G to X. The obtained canola GS1 mutants were designated BG65X, respectively.
The amino acid sequence alignment of the canola GS1 mutant BG65X and the wild type canola GS1 is shown in fig. 9, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 65, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.
Amino acids Deletion of
Codons Without any means for
The rape GS1 mutant BG65X and the nucleic acid molecules encoding the same provided in this example can be obtained by chemical synthesis.
Experimental example 1
The glufosinate resistance of the rice GS1 mutant OS58A, OS 3458 58D, OS58 3758 58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS58P, OS58Q, OS R, OS58Y, OS X provided in example 1 was tested as follows:
According to the sequence of the nucleic acid molecule provided in example 1, a chemical synthesis method is adopted to synthesize a coding gene for encoding a rice GS1 mutant OS58A, OS58C, OS58D, OS58 3758G, OS58H, OS58I, OS58K, OS58L, OS58 3858P, OS58Q, OS58Y, OS X, enzyme cutting sites (Pac 1 and Sbf 1) are introduced into two ends, after enzyme cutting, the coding gene is connected to an expression vector (such as pADV7 vector with the structure shown in figure 10) subjected to the same enzyme cutting treatment under the action of ligase, glutamine synthetase defective escherichia coli is transformed respectively, positive clones are picked up after verification, and the positive clones are inoculated to M9 culture media containing glufosinate with different concentrations for growth, and defective escherichia coli growth is observed. The wild-type rice GS1 mutant was used as a negative control to detect glufosinate resistance containing the GS1 mutant OS58A (OS 58A, amino acid S mutation at position 58 of rice GS1 to A), OS58C, OS58D, OS58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS58P, OS58Q, OS58R, OS58T, OS58Y, OS X. The results are shown in FIG. 11.
On a medium containing 0mM glufosinate (KP 0), the defective strains encoding wild type rice GS1 (OsGS 1-WT) and rice GS1 mutant OS58A, OS58C, OS58D, OS58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS58M, OS58M, OS58M, OS58M, OS58M, OS58M, OS X can grow normally, it is shown that the GS1 encoded by the OS58M, OS58M, OS58M, OS58M, OS58M, OS58M, OS58M, OS58M, OS58X has normal GS1 enzyme activity.
Coli transformed with wild-type rice GS1 failed to grow on medium containing 10mM glufosinate (KP 10), but the escherichia coli transformed with rice mutants OS58A, OS58C, OS58D, OS58E, OS58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS P, OS58Q, OS58R, OS T, OS Y and OS58X grew significantly better than the negative control, indicating that the single mutants containing OS58A, OS58C, OS58D, OS E, OS58G, OS58H, OS58I, OS58K, OS58L, OS58M, OS58P, OS58Q, OS58R, OS58T, OS Y and OS58X were significantly better than the wild-type; coli transformed with the rice GS1 mutant OS58D, OS58E, OS58G, OS58H, OS58I, OS K, OS58L, OS M, OS58P, OS58Q, OS R, OS T and OS58X also grew significantly on the medium with better glufosinate concentration (20 mM, KP20).
These results demonstrate that the single mutants of OS58A, OS58C, OS58D, OS58E, OS G, OS58 9758 9795 58 58H, OS58K, OS58L, OS58M, OS58 58 58Q, OS58R, OS58T, OS Y and OS58X both have glufosinate resistance, and that the rice GS1 mutant OS58D, OS58E, OS58G, OS58H, OS58I, OS58K, OS L, OS58M, OS58P, OS58Q, OS58R, OS T and OS58X are more resistant to glufosinate.
Experimental example 2
Referring to the test method of experimental example 1, the soybean GS1 mutant GS58D (GS 58D, amino acid S at position 58 of soybean GS1 was mutated to D), GS58E, GS58 and P, GS R provided in example 2 were verified for glufosinate resistance. The results are shown in FIG. 12.
As can be seen from the results of fig. 12:
Transformation of defective strains encoding the wild-type soybean GS1 (GmGS 1-WT) and soybean GS1 mutant GS58D, GS58E, GS58P, GS R both grew normally on a medium containing 0mM glufosinate (KP 0), indicating that GS1 encoded by GS58D, GS58E, GS58P, GS R had normal GS1 enzyme activity;
Coli transformed with wild-type soybean GS1 was essentially incapable of growth on 2mM glufosinate (KP 2), but the growth of the soybean mutant GS58D, GS58E, GS58P, GS R was significantly better than that of the negative control, indicating that the single mutant containing GS58D, GS58E, GS P and GS58R was significantly better than the wild-type. Coli transformed with soybean GS1 mutants GS58D, GS, E, GS P and GS58R also grew significantly on the medium with better glufosinate concentrations (5 mm, kp5).
These results demonstrate that both single mutants of GS58D, GS, E, GS P and GS58R have resistance to glufosinate.
Experimental example 3
With reference to the detection method of experimental example 1, glufosinate resistance of maize GS1 mutant ZS58D (ZS 58D, mutation of amino acid S at position 58 of maize GS1 to D), ZS58E, ZS58I, ZS K, ZS58P, ZS58R, ZS X provided in example 3 was verified. The results are shown in FIG. 13.
As can be seen from the results of fig. 13:
transformation of defective strains encoding the wild-type maize GS1 (ZmGS 1-WT) and maize GS1 mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS58R, ZS X, both grown normally, on a medium containing 0mM glufosinate (KP 0), indicating that the GS1 encoded by ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS58R, ZS X has normal GS1 enzyme activity;
Coli transformed with wild-type maize GS1 was essentially incapable of growth on 2mM glufosinate (KP 2) but the escherichia coli transformed with maize mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS58P, ZS58R, ZS X grew significantly better than the negative control, indicating that the single mutant containing ZS58D, ZS58E, ZS I, ZS58K, ZS58P, ZS58R, ZS X was significantly better against glufosinate than the wild-type; coli transformed with maize GS1 mutant ZS58D, ZS58E, ZS58I, ZS58K, ZS 3558P, ZS58R, ZS X also grew significantly on the medium with higher glufosinate concentration (10 mm, kp10).
These results demonstrate that both single mutants of ZS58D, ZS58E, ZS58I, ZS K, ZS58P, ZS58R, ZS X have resistance to glufosinate.
Experimental example 4
Referring to the test method of experimental example 1, glufosinate resistance of the canola GS1 mutant BS58D (BS 58D, amino acid S at position 58 of canola GS1 was mutated to D), BS58E, BS58I, BS58P, BS Q, BS R provided in example 4 was verified. The results are shown in FIG. 14.
As can be seen from the results of fig. 14:
transformation of defective strains encoding the wild type canola GS1 (BnGS 1-WT) and the canola GS1 mutant BS58D, BS58E, BS58I, BS58P, BS58Q, BS R, both grown normally, on a medium containing 0mM glufosinate (KP 0), indicating that GS1 encoded by BS58D, BS58E, BS58I, BS58P, BS58Q, BS R has normal GS1 enzyme activity;
Coli transformed with wild-type canola GS1 was substantially incapable of growth on 2mM glufosinate (KP 2) containing medium, but the growth of the transformed canola mutant BS58D, BS58E, BS58I, BS58P, BS Q, BS R was significantly better than that of the negative control, indicating that the single mutant containing BS58D, BS58E, BS58I, BS P, BS58Q, BS R was significantly better than the wild-type; coli transformed with canola GS1 mutant BS58D, BS58E, BS58I, BS58P, BS Q also grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that the single mutants of BS58D, BS58E, BS58I, BS58P, BS58Q, BS R all have glufosinate resistance and that the canola GS1 mutant BS58D, BS58E, BS58I, BS58P, BS Q has greater glufosinate resistance.
Experimental example 5
The enzyme kinetic parameters of OS58D provided in example 1, GS58D provided in example 2, ZS58D provided in example 3 and BS58D mutant provided in example 4 and enzyme kinetic parameters in the presence of glufosinate were tested against wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type maize GS1ZmGS1-WT and wild-type canola GS1 BnGS-WT by the following methods:
and (3) constructing a carrier:
The nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.
Purification of 6His protein:
The mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.
Enzyme activity determination:
1. instrument and reagents: enzyme-labeled instrument (De-Fe: HBS-1096A), glufosinate, substrate L-sodium glutamate (CAS: 6106-04-3).
2. The operation steps are as follows:
The glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 100mM Tris-HCl (pH 7.5), 5mM ATP,10mM sodium L-glutamate, 30mM hydroxylamine,20mM MgCl 2. After 100. Mu.l of the reaction solution was mixed well and preheated at 35℃for 5 minutes, 1. Mu.l of the mutant protein solution (protein concentration: 200 ug/ml) was added to start the reaction, after 60 minutes at 35℃the reaction was stopped by adding 110. Mu.l of the reaction stop solution (55 g/L FeCl 3·6H2 O,20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) and allowed to stand for 10 minutes. Centrifuge at 5000Xg for 10min, take 200. Mu.l and determine the light absorbance at 500 nm.
The results are shown in FIG. 15.
As can be seen from the results of fig. 15:
The lower Km values of the GS1 mutants relative to the wild-type controls OsGS1-WT, zmGS1-WT and BnGS-WT indicate that the GS mutants have improved substrate binding. The slightly higher Km value of GS58D for the GS1 mutant relative to the wild-type control GmGS-WT, indicated that the GS mutant GS58D reduced sensitivity to the glufosinate inhibitor, while slightly reducing sensitivity to normal substrates. The Vmax of the GS1 mutants were lower than the wild-type control, indicating that these mutants had reduced enzymatic capacity. The wild type control was very sensitive to glufosinate and IC 50 was 0.006mM, 0.005mM, 0.006mM and 0.007mM, respectively, and the mutant had significantly higher IC 50 than the wild type control and IC 50 of OS58D, GS58D, ZS D and BS58D were much higher than the wild type control, indicating that the mutant was much less sensitive to glufosinate. It can also be seen from the fold relationship between mutant IC 50 and wild-type IC 50 that IC 50 of OS58D, GS58D, ZS D and BS58D were 114.434-fold, 16.62-fold, 11.734-fold and 43.757-fold, respectively, of the corresponding wild-type GS1 IC50, which also indicated that the mutant had significantly higher enzymatic activity than the wild-type control. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.
Experimental example 6
Referring to the detection method of experimental example 1, the glufosinate resistance of the rice GS1 mutant OG65X provided in example 5 was verified by using the wild-type rice GS1 mutant as a negative control, and the results are shown in fig. 16.
On a culture medium containing 0mM glufosinate (KP 0), the defective strain of the coding genes of the transformed coding wild type rice GS1 (OsGS 1-WT) and the rice GS1 mutant OG65X can normally grow, which shows that the GS1 coded by the OG65X has normal GS1 enzyme activity;
Coli transformed with wild-type rice GS1 could not grow on medium containing 5mM glufosinate (KP 5), but the growth of the escherichia coli transformed with rice mutant OG65X was significantly better than that of the negative control, indicating that the capacity of single mutant glufosinate-resistant with OG65X was significantly better than that of wild-type, and that the escherichia coli transformed with rice GS1 mutant OG65X also grew significantly on medium with higher glufosinate concentration (20 mM, KP 20). These results demonstrate that single mutants of OG65X have resistance to glufosinate.
Experimental example 7
Referring to the test method of experimental example 1, glufosinate resistance of soybean GS1 mutant GG65X provided in example 6 was verified. The results are shown in FIG. 17.
As can be seen from the results of fig. 17:
transforming defective strains of the encoding genes encoding wild type soybean GS1 (GmGS 1-WT) and soybean GS1 mutant GG65X on a medium containing 0mM glufosinate (KP 0) can grow normally, indicating that GS1 encoded by GG65X has normal GS1 enzyme activity;
Coli transformed with wild-type soybean GS1 was essentially incapable of growth on medium containing 1mM glufosinate (KP 1), but the growth of the soybean mutant GG 65X-transformed was significantly better than negative control, indicating that the single mutant GG 65X-containing glufosinate-resistant was significantly better than wild-type, and that the soybean GS1 mutant GG 65X-transformed E.coli also grew significantly on medium with higher glufosinate concentration (2 mM, KP 2). These results demonstrate that single mutants of GG65X have resistance to glufosinate.
Experimental example 8
Referring to the test method of experimental example 1, glufosinate resistance of maize GS1 mutant ZG65X provided in example 7 was verified. The results are shown in FIG. 18.
As can be seen from the results of fig. 18:
On a culture medium containing 0mM glufosinate (KP 0), the defective strains of coding genes of the wild corn GS1 (ZmGS-WT) and corn GS1 mutant ZG65X can grow normally, which shows that GS1 coded by ZG65X has normal GS1 enzyme activity;
Coli transformed with wild-type maize GS1 was essentially incapable of growth on medium containing 5mM glufosinate (KP 5), but the growth of the escherichia coli transformed with maize mutant ZG65X was significantly better than negative control, indicating that the ability of the single mutant containing ZG65X to resist glufosinate was significantly better than wild-type; coli transformed with maize GS1 mutant ZG65X also grew significantly on medium with high glufosinate concentration (10 mm, kp10). These results demonstrate that single mutants of ZG65X have resistance to glufosinate.
Experimental example 9
Referring to the detection method of experimental example 1, glufosinate resistance of the rape GS1 mutant BG65X provided in example 8 was verified. The results are shown in FIG. 19.
As can be seen from the results of fig. 19:
on a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the transformed coding wild rape GS1 (BnGS-WT) and the rape GS1 mutant BG65X can grow normally, which shows that GS1 coded by BG65X has normal GS1 enzyme activity;
On a culture medium containing 1mM glufosinate (KP 1), the escherichia coli transformed with wild-type rape GS1 can not grow basically, but the escherichia coli transformed with rape mutant BG65X grows obviously better than a negative control, which shows that the capacity of the single mutant containing BG65X for resisting glufosinate is obviously better than that of the wild-type rape; coli transformed with canola GS1 mutant BG65X also grew significantly on medium with higher glufosinate concentrations (10 mm, kp10). These results demonstrate that BG65X single mutants have resistance to glufosinate.
Experimental example 10
Referring to the detection method of experimental example 4, the enzyme kinetic parameters of the OG65X provided in example 5, the GG65X provided in example 6, the ZG65X provided in example 7, the BG65X mutant provided in example 8 and the enzyme kinetic parameters in the presence of glufosinate were detected as controls with wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type maize GS1 ZmGS1-WT and wild-type canola GS1 BnGS 1-WT. The results are shown in FIG. 20.
As can be seen from the results of fig. 20:
The higher Km values of the GS1 mutants relative to the wild-type controls OsGS1-WT, gmGS1-WT, zmGS1-W and BnGS-WT indicate that the GS mutants have slightly reduced sensitivity to normal substrates while reducing sensitivity to glufosinate inhibitors. The Vmax of both rice and soybean GS1 mutants is higher than that of the wild type control, and the Vmax of the corn and rape GS1 mutants is slightly higher than that of the wild type control, which shows that the enzyme catalytic ability of the mutants is improved. The wild type control was very sensitive to glufosinate and IC 50 was 0.006mM, 0.005mM, 0.006mM and 0.007mM, respectively, and the mutant had significantly higher IC 50 than the wild type control, and the OG65X, GG65X, ZG X and BG65X had significantly higher IC 50 than the wild type control, indicating that the mutant was less sensitive to glufosinate. It can also be seen from the fold relationship between mutant IC 50 and wild type IC 50 that IC 50 of OG65X, GG X, ZG X and BG65X was 16.3648 fold, 18.62 fold, 131.6 fold and 153.77 fold, respectively, of corresponding wild type GS1 IC 50, which also indicated that the mutant had higher enzymatic activity than the wild type control. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics. .
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Sichuan Yuxing He biotechnology Co.Ltd
<120> A method for obtaining a protein having glufosinate resistance and mutants thereof
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 356
<212> PRT
<213> Artificial sequence
<400> 1
Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 2
<211> 356
<212> PRT
<213> Artificial sequence
<400> 2
Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 3
<211> 356
<212> PRT
<213> Artificial sequence
<400> 3
Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys
260 265 270
Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 4
<211> 356
<212> PRT
<213> Artificial sequence
<400> 4
Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr
1 5 10 15
Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp
20 25 30
Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys
260 265 270
Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 5
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 5
atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120
tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180
ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240
ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300
ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360
tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420
tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480
atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540
tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600
caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660
cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720
ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780
ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840
atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960
acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020
tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 6
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 6
atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60
gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120
tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240
ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300
ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360
gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420
tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480
atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540
tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600
caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660
cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720
ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780
ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840
atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 7
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 7
atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60
gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120
ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180
ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240
ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300
cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360
gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420
tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480
gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540
tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600
caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660
ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720
ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780
ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840
attgctgctt atggagaagg caacgagcgt cgtttgacag ggcgccacga aaccgctgac 900
atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960
acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020
tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071
<210> 8
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 8
atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60
gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120
cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180
ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240
cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300
ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360
gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420
tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480
gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540
tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600
caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660
ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720
ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780
ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840
attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900
atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960
acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020
tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims (15)

1. A method for obtaining a protein having glufosinate resistance comprising the steps of:
1) The glutamine synthetase was mutated by any of the following methods:
mutating the 58 th amino acid S of the glutamine synthetase of rice with the amino acid sequence shown as SEQ ID NO.1 to A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X, wherein X is deleted or mutating the 65 th amino acid G to delete;
mutating the 58 th amino acid S of the glutamine synthetase of the soybean with the amino acid sequence shown as SEQ ID NO.3 into D, E, P or R, or mutating the 65 th amino acid G into deletion;
mutating the 58 th amino acid S of the glutamine synthetase of corn with the amino acid sequence shown as SEQ ID NO.2 to D, E, I, K, P, R or X, wherein X is deleted or mutating the 65 th amino acid G to delete;
The 58 th amino acid S of the glutamine synthetase of rape with the amino acid sequence shown as SEQ ID NO.4 is mutated into D, E, I, P, Q or R, or the 65 th amino acid G is mutated into deletion;
2) Proteins with increased glufosinate resistance are selected.
2. A glufosinate-resistant glutamine synthetase mutant characterized by an amino acid sequence of any one of the following:
(1) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 58 th position of wild rice glutamine synthetase; the 58 th amino acid of the mutated glutamine synthetase mutant is A, C, D, E, G, H, I, K, L, M, P, Q, R, T, Y or X, and X is deleted; the amino acid sequence of the wild rice glutamine synthetase is shown as SEQ ID NO. 1;
(2) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 58 th position of wild soybean glutamine synthetase; the amino acid at position 58 of the glutamine synthetase mutant after mutation is D, E, P or R; the amino acid sequence of the wild soybean glutamine synthetase is shown as SEQ ID NO. 3;
(3) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 58 th position of wild corn glutamine synthetase; the 58 th amino acid of the mutated glutamine synthetase mutant is D, E, I, K, P, R or X, and X is deleted; the amino acid sequence of the wild corn glutamine synthetase is shown as SEQ ID NO. 2;
(4) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 58 th position of wild rape glutamine synthetase; the amino acid at position 58 of the glutamine synthetase mutant after mutation is D, E, I, P, Q or R; the amino acid sequence of the wild rape glutamine synthetase is shown as SEQ ID NO. 4;
(5) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 65 th position of a wild rice glutamine synthetase; the 65 th amino acid of the glutamine synthetase mutant after mutation is mutated to be deleted; the amino acid sequence of the wild rice glutamine synthetase is shown as SEQ ID NO. 1;
(6) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 65 th position of a wild soybean glutamine synthetase; the 65 th amino acid of the mutated glutamine synthetase mutant is mutated to be deleted, and the amino acid sequence of the wild soybean glutamine synthetase is shown as SEQ ID NO. 3;
(7) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 65 th position of wild corn glutamine synthetase; the 65 th amino acid of the mutated glutamine synthetase mutant is mutated to be deleted, and the amino acid sequence of the wild corn glutamine synthetase is shown as SEQ ID NO. 2;
(8) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 65 th position of wild rape glutamine synthetase; the 65 th amino acid of the glutamine synthetase mutant after mutation is mutated to be deleted; the amino acid sequence of the wild rape glutamine synthetase is shown as SEQ ID NO. 4.
3. A nucleic acid molecule encoding the glutamine synthetase mutant of claim 2.
4. An expression cassette or vector comprising the nucleic acid molecule of claim 3.
5. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 3, or the expression cassette or vector of claim 4, wherein the recombinant cell is a non-plant cell.
6. A method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of the plant a gene encoding a glufosinate-resistant glutamine synthetase mutant of claim 2.
7. The method of producing a glufosinate herbicide tolerant plant of claim 6 wherein the method of introduction is selected from genetic transformation methods, genome editing methods or genetic mutation methods.
8. The method of producing a glufosinate herbicide-tolerant plant of claim 6, wherein the plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, peanut, sunflower, radish, carrot, tomato, eggplant, pepper, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, daylily, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, tea, or cassava.
9. The method of producing a glufosinate herbicide-tolerant plant of claim 8, wherein the brassica vegetable is selected from the group consisting of turnip, cabbage, mustard, cabbage mustard, canola, mustard, green, broccoli, canola, or beet.
10. The method of producing a glufosinate-herbicide tolerant plant of claim 8, wherein the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, balsam pear, luffa, melon, watermelon or melon.
11. The method of producing a glufosinate-herbicide tolerant plant of claim 8, wherein the leguminous plant is selected from mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea or green bean.
12. The method of producing a glufosinate-herbicide tolerant plant of claim 6 wherein the plant is selected from pasture.
13. The method of producing a glufosinate-herbicide tolerant plant of claim 12, wherein the pasture is selected from gramineous pasture or leguminous pasture.
14. Use of a glutamine synthetase mutant of claim 2, a nucleic acid molecule of claim 3, an expression cassette or vector of claim 4, or a recombinant bacterium or recombinant cell of claim 5 for breeding a plant variety having glufosinate resistance.
15. Use according to claim 14, characterized in that it comprises: modifying the endogenous glutamine synthetase gene of the plant of interest to encode said glutamine synthetase mutant.
CN202210630247.6A 2022-06-06 2022-06-06 Method for obtaining protein with glufosinate resistance and mutant thereof Active CN114807064B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210630247.6A CN114807064B (en) 2022-06-06 2022-06-06 Method for obtaining protein with glufosinate resistance and mutant thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210630247.6A CN114807064B (en) 2022-06-06 2022-06-06 Method for obtaining protein with glufosinate resistance and mutant thereof

Publications (2)

Publication Number Publication Date
CN114807064A CN114807064A (en) 2022-07-29
CN114807064B true CN114807064B (en) 2024-04-19

Family

ID=82520854

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210630247.6A Active CN114807064B (en) 2022-06-06 2022-06-06 Method for obtaining protein with glufosinate resistance and mutant thereof

Country Status (1)

Country Link
CN (1) CN114807064B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104164441A (en) * 2014-05-17 2014-11-26 上海市农业科学院 Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application
CN113604443A (en) * 2021-09-15 2021-11-05 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety
CN113736757A (en) * 2021-09-15 2021-12-03 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance, nucleic acid molecule and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7910805B2 (en) * 2006-06-08 2011-03-22 Athenix Corp. Bacterial glutamine synthetases and methods of use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104164441A (en) * 2014-05-17 2014-11-26 上海市农业科学院 Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application
CN113604443A (en) * 2021-09-15 2021-11-05 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety
CN113736757A (en) * 2021-09-15 2021-12-03 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance, nucleic acid molecule and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
A naturally evolved mutation (Ser59Gly) in glutamine synthetase confers glufosinate resistance in plants;Chun Zhang等;J Exp Bot.;第73卷(第7期);参见摘要 *
Target-site mutation associated with glufosinate resistance in Italian ryegrass (Lolium perenne L. ssp. multiflorum);Wilson V Avila-Garcia等;Pest Manag Sci.;第68卷(第9期);参见摘要 *

Also Published As

Publication number Publication date
CN114807064A (en) 2022-07-29

Similar Documents

Publication Publication Date Title
CN112574967B (en) Glutamine synthetase mutant with glufosinate resistance of plant origin, nucleic acid molecule and application
CN113604443B (en) Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety
WO2021000870A1 (en) Glutamine synthetase mutant having glufosinate ammonium resistance and application thereof and cultivation method therefor
JP4469422B2 (en) Herbicide-tolerant products designed based on structure
CN107828794A (en) A kind of method for creating of Rice Salt gene OsRR22 mutant, its amino acid sequence encoded, plant and the mutant
CN113736757B (en) Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
CN102282262B (en) Auxotrophic agrobacterium for plant transformation and methods thereof
CN114774375B (en) Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant
CN113957060B (en) Glutamine synthetase mutant and application thereof
CN114107234B (en) Glutamine synthetase mutant with glufosinate resistance, recombinant gene, recombinant vector and application thereof
CN114058600B (en) Glutamine synthetase mutant with glufosinate resistance and application thereof
CN102775484B (en) Gene improving cadmium tolerance of plant and application thereof
CN114807064B (en) Method for obtaining protein with glufosinate resistance and mutant thereof
REN et al. Overexpression of a modified AM79 aroA gene in transgenic maize confers high tolerance to glyphosate
CN104561036A (en) Plant salt-tolerance related gene PpSIG1 as well as encoding protein and application of gene
CN116875568A (en) G61 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
CN117363633A (en) Nucleic acid molecule, vector, recombinant bacterium, GS mutant and application thereof
CN116769739A (en) G294 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
Chompoo et al. RT-PCR based detection of resistance conferred by an insensitive GS in glufosinate-resistant maize cell lines
Petersen et al. Biosafety considerations for selectable and scorable markers used in cassava (Manihot esculenta Crantz) biotechnology
Zhu et al. Identification and characterization of a phosphinothricin N-acetyltransferase from Enterobacter LSJC7
US20230127011A1 (en) Methods and compositions for herbicide tolerance in plants
US20030115638A1 (en) Plants having increased amino acids content and methods for producing the same
Shah et al. Genetic engineering of herbicide resistance genes
EP3146056A2 (en) Methods for increasing grain yield

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant