CN113736757B - Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application - Google Patents

Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application Download PDF

Info

Publication number
CN113736757B
CN113736757B CN202111083393.3A CN202111083393A CN113736757B CN 113736757 B CN113736757 B CN 113736757B CN 202111083393 A CN202111083393 A CN 202111083393A CN 113736757 B CN113736757 B CN 113736757B
Authority
CN
China
Prior art keywords
glutamine synthetase
gly
mutant
amino acid
ile
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111083393.3A
Other languages
Chinese (zh)
Other versions
CN113736757A (en
Inventor
邓龙群
张震
陈容
侯青江
胥南飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gevoto LLC
Original Assignee
Gevoto LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gevoto LLC filed Critical Gevoto LLC
Priority to CN202111083393.3A priority Critical patent/CN113736757B/en
Publication of CN113736757A publication Critical patent/CN113736757A/en
Priority to PCT/CN2022/113148 priority patent/WO2023040565A1/en
Application granted granted Critical
Publication of CN113736757B publication Critical patent/CN113736757B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)

Abstract

The invention discloses a glutamine synthetase mutant with glufosinate resistance, a nucleic acid molecule and application thereof, and relates to the technical field of genetic engineering. The inventors found that mutation at the n-th position of the wild type glutamine synthetase can result in a glutamine synthetase mutant, which is C, E, F, I, M, N, P, S, Y or deleted after mutation, and the mutation can endow the glutamine synthetase with glufosinate resistance suitable for commercial application. The glutamine synthetase mutant has application potential for constructing an expression vector of a transformed plant and cultivating glufosinate-resistant crops.

Description

Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a glutamine synthetase mutant with glufosinate resistance, a nucleic acid molecule and application.
Background
Glufosinate, also known as glufosinate, is commercially available under the names of basta, baiston, chemical name 4- [ hydroxy (methyl) phosphono ] -DL-homoalanine or 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate. Broad spectrum contact biocidal herbicides developed by bayer corporation. By inhibiting the activity of glutamine synthetase (Glutamine synthetase, GS), the synthesis of glutamine in plants is blocked, and then the nitrogen metabolism in plants is disturbed, the synthesis of substances such as protein, nucleotide and the like is reduced, the photosynthesis is blocked, and the chlorophyll synthesis is reduced. At the same time, the content of ammonium ions in the cells is increased, so that cell membranes are destroyed, chloroplasts are disintegrated, and the death of plants is finally caused.
Because the glufosinate has the characteristics of broad weed control spectrum, rapid inactivation and degradation in soil and low toxicity to non-target organisms, the crop can be made to generate resistance to the glufosinate by a transgenic technology, so that the weeds can be selectively killed to the glufosinate without damaging the crop. The most widely used anti-glufosinate genes in agriculture today are the bar gene from strain Streptomyces hygroscopicus and the pat gene from strain s. The bar gene and the pat gene have 80% homology, and can code glufosinate acetylase, and the enzyme can be used for inactivating glufosinate acetylase. Glufosinate resistance genes have been introduced into 20 or more crops including rice, wheat, corn, beet, tobacco, soybean, cotton, potato, tomato, canola, sugarcane, etc., where resistant canola, corn, etc. have been grown commercially over a large area.
Studies have shown that glufosinate acetylases encoded by the bar and pat genes can inactivate glufosinate acetylases, but that glufosinate acetylases have difficulty in completely inactivating glufosinate before it contacts GS, and that part of the undegraded glufosinate can inhibit the activity of GS on cell membranes due to the distribution of many GSs on the cell membranes, thereby interfering with nitrogen metabolism in plants. Therefore, when the glufosinate is applied to crops with the bar gene and the pat gene, nitrogen metabolism of plants can be disturbed to different degrees, and normal growth and development of the plants can be influenced. Although transgenic plants can be somewhat less susceptible to glufosinate by over-expressing wild-type GS in plants, their tolerance to glufosinate is far from adequate for commercial use.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims at providing a glutamine synthetase mutant with glufosinate resistance, a nucleic acid molecule and application.
The invention is realized in the following way:
the invention provides a glutamine synthetase mutant with glufosinate resistance, which is shown in the following (1) or (2):
(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with the reference sequence, the n-th position of the wild type glutamine synthetase corresponds to the 57-th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;
the n-th amino acid of the glutamine synthetase mutant is X, wherein X comprises C, E, F, I, M, N, P, S, Y or deletion;
(2): which has at least 85% identity with the glutamine synthetase mutant shown in (1), is identical to the glutamine synthetase mutant shown in (1) in the n-th amino acid, and has glufosinate resistance.
The inventor finds that the wild type glutamine synthetase from plant source is compared with a reference sequence, the amino acid site corresponding to the 57 th site of the reference sequence, namely the nth site, is mutated into C, E, F, I, M, N, P, S, Y or deleted, and the obtained glutamine synthetase mutants have glufosinate resistance and can keep the normal catalytic activity of the glutamine synthetase. The plant or recombinant bacteria transformed by the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospects.
The reference sequence shown in SEQ ID NO.1 is wild type glutamine synthetase of rice origin.
The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.
It should be noted that the nth position of the wild-type glutamine synthetase may be the 57 th position (for example, corn, wheat, soybean, rape, etc.) on its own sequence, but may not be the 57 th position (for example, peanut corresponds to 58 th position), and the specific position of the nth position is determined according to the alignment of the sequences, so long as the position corresponding to the 57 th position of the reference sequence is the nth position, that is, the mutation position, after the comparison with the reference sequence.
All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, any wild-type glutamine synthetase of plant origin, after the above-described mutation at position 57, resulted in a mutant of glutamine synthetase having glufosinate resistance. That is, the mutant glutamine synthetase obtained by mutating a wild type glutamine synthetase of any plant origin is also within the scope of the present invention.
Furthermore, it is known and easily achieved by those skilled in the art that a glutamine synthetase mutant represented by (1) is subjected to a simple amino acid substitution, deletion, addition, or the like in a non-conserved region thereof, and the n-th position is maintained as an amino acid after the above mutation, and the glutamine synthetase mutant obtained by further mutation has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.) or more identity with the glutamine synthetase mutant represented by (1), and its functions include an enzyme catalytic activity and a glufosinate resistance which are equivalent to or slightly decreased or slightly increased or greatly increased as those of the glutamine synthetase mutant represented by (1). Therefore, such glutamine synthetases should also fall within the scope of the present invention.
In a preferred embodiment of the present invention, the plant of interest is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea, and cassava.
In an alternative embodiment, the pasture is selected from gramineous pasture or leguminous pasture. Gramineous forage grass is selected from timothy grass, festuca arundinacea, june grass, wheat middling, festuca arundinacea, brown leaf, green bristlegrass and the like; the leguminous forage is selected from alfalfa, clover bean, green Chinese herb, corn grass, etc. In addition, in other embodiments, the pasture may be selected from turf grass.
In an alternative embodiment, brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, wasabi, canola, cabbage or beet.
In an alternative embodiment, cucurbitaceae plants include, but are not limited to, cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon, or melon.
In an alternative embodiment, leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, or green beans.
In a preferred embodiment of the present invention, the inventors have also found that in addition to mutating or deleting the nth position of glutamine synthetase of different plant origin to C, E, F, I, M, N, P, S, Y, mutating the nth position to another amino acid also renders the glutamine synthetase glufosinate resistant.
When the plant of interest is rice, x= A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, V, W, Y or deleted;
when the plant is soybean, corn, rape, x= C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted;
when the plant is wheat, x= C, E, F, I, M, N, P, S, T, Y or deleted.
Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:
MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP。
alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:
MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP。
alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3:
MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP。
alternatively, in some embodiments of the invention, when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No.4:
MALLTDLLNLDLTDSTEKIIAEYIWIGGSGMDLRSKARTLPGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGVPIPTNKRYNAAKIFSNPDVAKEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCSIGADKSFGRDIVDSHYKACLFAGVNISGINGEVMPGQWEFQVGPTVGISAGDQVWVARYLLERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKDGGFKVIVDAVEKLKLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTILWKP。
alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.5:
MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP。
the Similarity and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin are shown in the following table, and the partial results of the sequence alignment are shown in FIG. 13, with the arrow indicating amino acid 57.
The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.
The invention also provides an isolated nucleic acid molecule encoding a glufosinate-resistant glutamine synthetase mutant as described above.
In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant is easily obtained by a person skilled in the art based on degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant may be obtained by mutating a corresponding nucleotide to a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by one skilled in the art.
For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.6:
atggcttctctcaccgatctcgtcaacctcaacctctccgacaccacggagaagatcatcgccgagtacatatggatcggtggatctggcatggatctcaggagcaaggctaggactctctccggccctgtgactgatcccagcaagctgcccaagtggaactacgatggctccagcaccggccaggcccccggcgaggacagtgaggtcatcctgtacccacaggctatcttcaaggacccattcaggaagggaaacaacatccttgtcatgtgcgattgctacacgccagccggagaaccgatccccaccaacaagaggcacaatgctgccaagatcttcagctcccctgaggttgcttctgaggagccctggtacggtattgagcaagagtacaccctcctccagaaggacatcaactggccccttggctggcctgttggtggcttccctggtcctcagggtccttactactgtggtatcggtgctgacaagtcttttgggcgtgatattgttgactcccactacaaggcttgcctctatgccggcatcaacatcagtggaatcaacggcgaggtcatgccaggacagtgggagttccaagttggcccgtctgtcggcatttctgccggtgatcaggtgtgggttgctcgctacattcttgagaggatcaccgagatcgccggagtcgtcgtctcatttgaccccaagcccatcccgggagactggaacggtgctggtgctcacaccaactacagcaccaagtcgatgaggaacgatggtggctacgagatcatcaagtccgccattgagaagctcaagctcaggcacaaggagcacatctccgcctacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacaccttcagctggggagttgccaaccgcggcgcctcggtccgcgtcggccgggagacggagcagaacggcaagggctacttcgaggatcgccggccggcgtccaacatggacccttacatcgtcacctccatgatcgccgagaccaccatcatctggaagccctga。
accordingly, on a sequence basis, a rice glutamine synthetase mutant encoding the above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to position 57 of the encoded amino acid sequence.
The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.7:
atggcctgcctcaccgacctcgtcaacctcaacctctcggacaacaccgagaagatcatcgcggaatacatatggatcggtggatctggcatggatctcaggagcaaagcaaggaccctctccggcccggtgaccgatcccagcaagctgcccaagtggaactacgacggctccagcacgggccaggcccccggcgaggacagcgaggtcatcctgtacccgcaggccatcttcaaggacccattcaggaggggcaacaacatccttgtgatgtgcgattgctacaccccagccggcgagccaatccccaccaacaagaggtacaacgccgccaagatcttcagcagccctgaggtcgccgccgaggagccgtggtatggtattgagcaggagtacaccctcctccagaaggacaccaactggccccttgggtggcccatcggtggcttccccggccctcagggtccttactactgtggaatcggcgccgaaaagtcgttcggccgcgacatcgtggacgcccactacaaggcctgcttgtatgcgggcatcaacatcagtggcatcaacggggaggtgatgccagggcagtgggagttccaagtcgggccttccgtgggtatatcttcaggcgaccaggtctgggtcgctcgctacattcttgagaggatcacggagatcgccggtgtggtggtgacgttcgacccgaagccgatcccgggcgactggaacggcgccggcgcgcacaccaactacagcacggagtcgatgaggaaggagggcgggtacgaggtgatcaaggcggccatcgagaagctgaagctgcggcacagggagcacatcgcggcatacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacacgttcagctggggcgtggccaaccgcggcgcgtcggtgcgcgtgggccgggagacggagcagaacggcaagggctacttcgaggaccgccgcccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcatctggaagccctga。
the encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO.8:
atgtcgctgctctcagatctcatcaaccttaacctctcagacactactgagaaggtgatcgcagagtacatatggatcggtggatcaggaatggacctgaggagcaaagcaaggactctcccaggaccagttagcgacccttcaaagcttcccaagtggaactatgatggttccagcacaggccaagctcctggagaagacagtgaagtgattatatacccacaagccattttcagggatccattcagaaggggcaacaatatcttggttatctgtgatacttacactccagctggagaacccattcccactaacaagaggcacgatgctgccaaggttttcagccatcctgatgttgttgctgaagagacatggtatggtattgagcaggaatacaccttgttgcagaaagatatccaatggcctcttgggtggcctgttggtggtttccctggaccacagggtccatactactgtggtgttggcgctgacaaggcttttggccgtgacattgttgacgcacattacaaagcctgtctttatgctggcatcaacatcagtggaattaatggagaagtgatgcccggtcagtgggaattccaagttggaccttcagttggaatctcagctggtgacgaggtgtgggcagctcgttacatcttggagaggatcactgagattgctggtgtggtggtttcctttgatcccaagccaattcagggtgattggaatggtgctggtgctcacacaaactacagcactaagtccatgagaaatgatggtggctatgaagtgatcaaaaccgccattgagaagttggggaagagacacaaggagcacattgctgcttatggagaaggcaacgagcgtcgtttaacagggcgccacgaaaccgctgacatcaacaccttcttatggggagttgcaaaccgtggagcttcagttagggttgggagggacacagagaaagcagggaagggatattttgaggacagaaggccagcttctaacatggacccatatgtggttacttccatgattgcagacacaaccattctgtggaagccatga。
the coding nucleic acid sequence of the wheat wild type glutamine synthetase is SEQ ID NO.9:
atggcgctcctcaccgatctcctcaacctcgacctcaccgactccacggagaagatcatcgccgagtacatatggatcggcggatctggcatggatctcaggagcaaagccaggaccctccccggcccggtcaccgaccccagcaagctgcccaagtggaactacgacggctccagcaccggccaggcccccggcgaggacagcgaggtcatcctgtacccacaggccatcttcaaggacccgttcaggaagggcaacaacatccttgtcatgtgcgattgctacaccccagctggagtgccaatccccaccaacaagagatacaacgctgccaagatctttagcaaccctgatgttgccaaggaggagccatggtacggtatcgagcaggagtacaccctcctacagaaggacatcaactggcctctcggctggcctgttggtggattccctggtcctcagggtccttactactgtagtattggtgctgacaagtcgtttgggcgtgacatagttgactcccactacaaggcctgcctctttgccggcgtcaacatcagtggcatcaacggcgaggtcatgcccggacagtgggagttccaagttggcccgactgtcggcatctctgctggtgaccaagtgtgggttgctcgctaccttcttgagaggatcactgagatcgccggagttgtcgtcacatttgaccccaagcccatcccaggcgactggaacggtgctggtgctcacacaaactacagtaccgagtcgatgaggaaggacggcgggttcaaggtcatcgtggacgctgtcgagaagctcaagctgaagcacaaggagcacatcgccgcctacggcgagggcaacgagcgccgtctcaccggcaagcacgaaaccgccgacatcaacaccttcagctggggtgtcgcgaaccgtggcgcgtcggtgcgcgtgggacgggagacggagcagaacggcaagggctacttcgaggaccgccggccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcctgtggaagccctga。
the encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.10:
atgagtcttcttacagatctcgttaaccttaacctctcagagaccactgacaaaatcattgcggaatacatatgggttggaggttcaggaatggatatgagaagcaaagccaggactcttcctggaccagtgagtgacccttcggagctaccaaagtggaactatgatggctcaagcacaggccaagctcctggtgaagacagtgaagtcatcttataccctcaagccatattcaaagatcctttccgtagaggcaacaacattcttgtcatgtgcgatgcttacactccagcgggcgaaccgatcccaacaaacaaaagacacgctgcggctaaggtctttagccaccccgatgttgtagctgaagtgccatggtatggtattgagcaagagtatactttacttcagaaagatgtgaactggcctcttggttggcctattggcggcttccccggtcctcagggaccatactattgtagtgttggagcagataaatcttttggtagagacatcgttgatgctcactacaaggcctgcttatacgctggcatcaatattagtggcatcaacggagaagtcatgcctggtcagtgggagttccaagttggtccagctgttggtatctcggccggtgatgaaatttgggtcgcacgtttcattttggagaggatcacagagattgctggtgtggtggtatcttttgacccaaaaccgattcccggtgactggaatggtgctggtgctcactgcaactatagtaccaagtcaatgagggaagatggtggttacgagattattaagaaggcaatcgataaactgggactgagacacaaagaacacattgcagcttacggtgaaggcaatgagcgccgtctcacgggtcaccacgagactgctgacatcaacactttcctctggggtgttgcgaaccgtggagcatcaatccgtgtaggacgtgacacagagaaagaagggaaaggatactttgaggataggaggccagcttcgaacatggatccttacattgtgacttccatgattgcagagaccacaatcctctggaaaccttga。
the invention also provides a vector which contains the nucleic acid molecule.
The invention also provides a recombinant bacterium or recombinant cell, which contains the nucleic acid molecule or the vector.
The recombinant bacteria may be selected from agrobacterium; the recombinant cell may be a competent cell.
The invention also provides application of the glutamine synthetase mutant, the nucleic acid molecule, the vector, the recombinant bacterium or the recombinant cell with the glufosinate resistance in cultivation of plant varieties with the glufosinate resistance.
In a preferred embodiment of the application of the present invention, the application includes at least one of the following application modes:
delivering an isolated nucleic acid molecule to a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a mutant glutamine synthetase;
transforming a target plant with a vector containing a gene encoding a glutamine synthetase mutant;
Introducing recombinant bacteria or recombinant cells into the target plant, wherein the recombinant bacteria or recombinant cells contain a coding gene for a glutamine synthetase mutant.
The isolated nucleic acid molecule may be a plasmid or a DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by gene gun methods.
The transformation method includes, but is not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.
Recombinant bacteria or recombinant cells can be introduced into the plant of interest by means of infection.
In a preferred embodiment of the application of the present invention, the application includes: the endogenous glutamine synthetase gene of the plant of interest is modified to encode a glutamine synthetase mutant.
In a preferred embodiment of the application of the present invention, the application includes: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.
On the basis of the present invention, it is easy for the person skilled in the art to modify the target plant by means of the conventional transgenic technique, gene editing technique (e.g. by zinc finger endonuclease (ZFN) technique, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique or CRISPR/Cas 9), mutation breeding technique (e.g. chemical, radiation mutagenesis, etc.), etc. in this field, to have the gene encoding the above glutamine synthetase mutant, thereby obtaining a new plant variety that is glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.
In an alternative embodiment, the plant of interest is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea, or cassava.
In an alternative embodiment, the pasture is selected from gramineous pasture or leguminous pasture.
In an alternative embodiment, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage mustard, canola, mustard, cabbage, mustard, or beet.
In an alternative embodiment, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon or melon.
In an alternative embodiment, the leguminous plant is selected from mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans.
The invention has the following beneficial effects:
The glutamine synthetase mutant with glufosinate resistance provided by the invention has application potential for constructing an expression vector for transforming plants and cultivating glufosinate resistant crops. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more acceptable to consumers. By having glufosinate resistance after mutation, the plants transformed with the glutamine synthetase mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development of plants.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the amino acid sequence part alignment results of the rice GS1 mutant OG57A, OG57C, OG57D, OG57E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X and wild type rice GS1 OWT provided in example 1 of the present invention;
FIG. 2 shows the amino acid sequence part alignment of soybean GS1 mutant GG57C, GG57D, GG57E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG Y and GG57X and wild type soybean GS1 GWT provided in example 2 of the present invention;
FIG. 3 shows the amino acid sequence part alignment of maize GS1 mutant ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG N, ZG57P, ZG57Q, ZG57R, ZG57S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X and wild type maize GS1 ZWT provided in example 3 of the present invention;
FIG. 4 shows the amino acid sequence part alignment results of the wheat GS1 mutant TG57C, TG57E, TG F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X and wild-type wheat GS1 TWT provided in example 4 of the present invention;
FIG. 5 shows the amino acid sequence part alignment results of the canola GS1 mutant BG57C, BG57D, BG57E, BG57F, BG57H, BG57I, BG57K, BG57L, BG57M, BG N, BG57P, BG57Q, BG57R, BG57S, BG57T, BG57V, BG57W, BG Y and BG57X and wild type canola GS1 BWT provided in example 5 of the present invention;
FIG. 6 is a schematic diagram of the structure of pADV7 vector provided in Experimental example 1 of the present invention;
FIG. 7 shows the results of growth of rice GS1 mutant OG57A, OG57C, OG57D, OG57E, OG57F, OG57 6757I, OG57 3787 57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X and wild type rice GS1 OWT E.coli on medium containing glufosinate at different concentrations provided in Experimental example 1 of the present invention;
FIG. 8 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant GG57C, GG57D, GG57E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57 3957V, GG57 4639Y and GG57X and wild-type soybean GS1 GWT provided in Experimental example 2 of the present invention;
FIG. 9 shows the results of E.coli growth on medium containing glufosinate at different concentrations for maize GS1 mutant ZG57C, ZG57D, ZG E, ZG57F, ZG57H, ZG57 6757K, ZG57 3787 57L, ZG57N, ZG57P, ZG57Q, ZG57R, ZG57 3757S, ZG57 3957V, ZG57 4639Y and ZG57X and wild type maize GS1 ZWT provided in Experimental example 3 of the present invention;
FIG. 10 shows the results of E.coli growth on medium containing glufosinate of different concentrations of wheat GS1 mutant TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X and wild-type wheat GS1 TWT provided in Experimental example 4 of the present invention;
FIG. 11 shows the results of E.coli growth on medium containing glufosinate with different concentrations of the wild type canola GS1 mutant BG57C, BG57D, BG57E, BG F, BG57H, BG57I, BG57K, BG57L, BG57M, BG57N, BG57P, BG57Q, BG57R, BG57S, BG57T, BG57V, BG57W, BG57Y and BG57X provided in Experimental example 5 of the present invention and wild type canola GS1 BWT;
FIG. 12 shows glufosinate resistance parameters IC of rice GS1 mutant OG57P, soybean GS1 mutant GG57P, corn GS1 mutant ZG57P, wheat GS1 mutant TG57P, canola GS1 mutant BG57P, wild-type rice GS1 OWT, wild-type soybean GS1 GWT, wild-type corn GS1 ZWT, wild-type wheat GS1 TWT and wild-type canola GS1 BWT provided in Experimental example 6 of the present invention 50 ；
FIG. 13 shows amino acid sequence alignment of wild type glutamine synthetase from different plants; in the figure: TWT: wheat wild type glutamine synthetase; OWT: wild type rice glutamine synthetase; ZWT: corn wild type glutamine synthetase; GWT: soybean wild type glutamine synthetase; BWT: wild type rape glutamine synthetase.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of formulations or unit doses herein, some methods and materials are now described. Unless otherwise indicated, techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.
Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: ALaboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (methods of enzymology) (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), contemporary molecular biology methods (Current Protocols in Molecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
In this example and experimental example, x=deletion means that the n-th amino acid of the wild-type glutamine synthetase is deleted, i.e., deletion mutation.
Example 1
The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in the example is obtained by mutating or deleting the 57 th amino acid residue G of wild type rice glutamine synthetase itself (named OWT, the amino acid sequence is shown as SEQ ID NO.1, the encoding nucleotide sequence is shown as SEQ ID NO. 6) to A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, V, W, Y, and the obtained rice GS1 mutants are named OG57A, OG57C, OG57D, OG57E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57 3557Q, OG57R, OG57S, OG57V, OG57 6757W, OG57Y and OG57X respectively.
The amino acid sequence alignment of the rice GS1 mutant OG57A, OG57C, OG D, OG E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X and wild-type rice GS1 OWT is shown in fig. 1, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 57, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
The rice GS1 mutant OG57A, OG57C, OG57D, OG57E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57N, OG57 3723 57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 2
The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 57 th position (corresponding to 57 th position of the reference sequence (SEQ ID NO. 1)) of the wild type soybean GS1 itself (designated GWT, the amino acid sequence shown as SEQ ID NO.3, the encoding nucleotide sequence of SEQ ID NO. 8) from the amino acid residue G to C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleting. The resulting soybean GS1 mutants were named GG57C, GG57D, GG57E, GG F, GG57H, GG 6757I, GG57K, GG57L, GG57M, GG57N, GG P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG Y and GG57X, respectively.
The amino acid sequence alignment of soybean GS1 mutant GG57C, GG57D, GG E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG Y and GG57X and wild type soybean GS1 GWT is shown in fig. 2, in which: the position indicated by the arrow is the mutation site.
The coding sequences of the soybean GS1 mutant GG57C, GG57D, GG57E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG57Y and GG57X provided in this example correspond to SEQ ID No.3.
In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 57, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
/>
The soybean GS1 mutant GG57C, GG57D, GG57E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG57Y and GG57X and the nucleic acid molecules encoding them provided in this example can be obtained by a chemical synthesis method.
Example 3
The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating or deleting the 57 th position (corresponding to 57 th position of the reference sequence (SEQ ID NO. 1)) of the wild type corn GS1 itself (named ZWT, the amino acid sequence of which is shown in SEQ ID NO.2, the coding nucleotide sequence of which is SEQ ID NO. 7) from the amino acid residue G to C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y. The resulting maize GS1 mutants were named ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X, respectively.
The amino acid sequence alignment of maize GS1 mutant ZG57C, ZG57D, ZG E, ZG F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG57S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X and wild-type maize GS1 ZWT is shown in fig. 3, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 57, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
The maize GS1 mutant ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57P, ZG57 3723 57Q, ZG57R, ZG57S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 4
The wheat (Triticum aestivum) GS1 mutant provided in this example is obtained by mutating or deleting the 57 th position (57 th position corresponding to the reference sequence (SEQ ID NO. 1)) of wild-type wheat GS1 itself (named TWT, amino acid sequence shown as SEQ ID NO.4, encoding nucleotide sequence SEQ ID NO. 9) from the amino acid residue G to C, E, F, I, M, N, P, S, T, Y. The resulting wheat GS1 mutants were named TG57C, TG E, TG57 3557F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X, respectively.
The amino acid sequence alignment of wheat GS1 mutant TG57C, TG57E, TG F, TG I, TG57M, TG57N, TG57P, TG57S, TG57T, TG57Y and TG57X and wild-type wheat GS1 TWT is shown in fig. 4, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each wheat GS1 mutant was at the position encoding amino acid 57, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.
/>
The wheat GS1 mutants TG57C, TG E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Example 5
The present example provides a canola (Brassica napus) GS1 mutant obtained by mutating or deleting amino acid residue G at position 57 (corresponding to position 57 of the reference sequence (SEQ ID No. 1)) of wild-type canola GS1 itself (designated BWT, amino acid sequence shown in SEQ ID No.5, encoding nucleotide sequence of SEQ ID No. 10). The obtained rape GS1 mutants were named BG57C, BG57D, BG57E, BG57F, BG57H, BG57I, BG57K, BG57L, BG57M, BG57N, BG57P, BG57Q, BG57R, BG S, BG57T, BG57V, BG57W, BG Y and BG57X, respectively.
The amino acid sequence alignment of the canola GS1 mutant BG57C, BG57D, BG57E, BG F, BG57H, BG57I, BG57K, BG57L, BG57M, BG57N, BG57P, BG57Q, BG57R, BG57S, BG57T, BG57V, BG57W, BG Y and BG57X and wild-type canola GS1 BWT is shown in fig. 5, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 57, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.
The rape GS1 mutant BG57C, BG D, BG57E, BG57F, BG57H, BG57I, BG57K, BG57L, BG57M, BG57N, BG57P, BG Q, BG57R, BG57S, BG57T, BG57V, BG57W, BG Y and BG57X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.
Experimental example 1
The glufosinate resistance of the rice GS1 mutants OG57A, OG57C, OG57D, OG E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X provided in example 1 was tested as follows:
according to the sequence of the nucleic acid molecule provided in example 1, coding genes encoding rice GS1 mutant OG57A, OG57C, OG57D, OG57E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG57Y and OG57X were synthesized by a chemical synthesis method, enzyme cleavage sites (Pac 1 and Sbf 1) were introduced at both ends, and after enzyme cleavage, the two were ligated to expression vectors (such as pADV7 vectors, the structure of which is shown in FIG. 6) subjected to the same enzyme cleavage treatment under the action of a ligase, then glutamine synthetase-deficient E.coli was transformed, after verification, positive clones were picked up, inoculated onto M9 medium containing glufosinate at different concentrations and grown, and defective E.coli growth was observed. The glufosinate resistance was examined with the wild-type rice GS1 mutant as negative control, containing the GS1 mutant OG57A (G57A, amino acid G at position 57 of rice GS1 mutated to a), OG57C (G57C), OG57D (G57D), OG57E (G57E), OG57F (G57F), OG57H (G57H), OG57I (G57I), OG57K (G57K), OG57L (G57L), OG57M (G57M), OG57N (G57N), OG57P (G57P), OG57Q (G57Q), OG57R (G57R), OG57S (G57S), OG57V (G57V), OG57W (G57W), OG57Y (G57Y) and OG57X (G57, amino acid G deletion at position 57 of rice GS 1). The results are shown in FIG. 7.
On a medium containing 0mM glufosinate (KP 0), the defective strains encoding wild-type rice GS1 (OWT) and rice GS1 mutants OG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and OG57X both grow normally, indicating that GS1 encoded by OG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and OG57X both have normal GS1 enzyme activity;
coli transformed with wild-type rice GS1 OWT failed to grow on 5mM glufosinate (KP 5) containing medium, but the rice mutants OG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and OG57X grew significantly better than negative controls, indicating that the single mutants containing OG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and OG57X were significantly better than wild-type against glufosinate; coli transformed with rice GS1 mutant OG57D, OG57E, OG L, OG57F, OG57H, OG57I, OG57L, OG57M, OG57P, OG57Q, OG57S, OG57V, OG57W, OG Y and OG57X also grew significantly on the medium with better glufosinate concentration (20 mm, kp20).
These results demonstrate that single mutants of OG57A, OG57C, OG57D, OG57E, OG57F, OG57H, OG57I, OG57K, OG57L, OG57M, OG57N, OG57P, OG57Q, OG57R, OG57S, OG57V, OG57W, OG Y and OG57X have glufosinate resistance.
Experimental example 2
Referring to the detection method of experimental example 1, the glufosinate resistance of soybean GS1 mutants GG57C (G57C, amino acid G at position 57 of soybean GS1 was confirmed to be C), GG57D (G57D), GG57E (G57E), GG57F (G57F), GG57H (G57H), GG57I (G57I), GG57K (G57K), GG57L (G57L), GG57M (G57M), GG57N (G57N), GG57P (G57P), GG57Q (G57Q), GG57R (G57R), GG57S (G57S), GG57T (G57T), GG57V (G57V), GG57W (G57W), GG57Y (G57Y) and GG57X (G57 Δ, amino acid G deletion at position 57 of soybean GS 1) was confirmed. The results are shown in FIG. 8.
As can be seen from the results of fig. 8:
on a medium containing 0mM glufosinate (KP 0), defective strains encoding wild-type soybean GS1 (GWT) and soybean GS1 mutant GG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y encoding genes were both grown normally, indicating that GS1 encoded by GG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y has normal GS1 enzyme activity;
Coli transformed with wild-type soybean GS1 was substantially incapable of growth on medium containing 1mM glufosinate (KP 1), but the soybean mutants GG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and GG57X were significantly better grown than negative controls, indicating that single mutants containing GG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and GG57X were significantly better resistant to glufosinate than wild-type; coli transformed with soybean GS1 mutants GG57P and GG57T also grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that the single mutants of GG57C, GG57D, GG57E, GG57F, GG57H, GG57I, GG57K, GG57L, GG57M, GG57N, GG57P, GG57Q, GG57R, GG57S, GG57T, GG57V, GG57W, GG Y and GG57X both have glufosinate resistance and that the soybean GS1 mutants GG57P and GG57T are more glufosinate resistant.
Experimental example 3
Referring to the detection method of experimental example 1, the maize GS1 mutant ZG57C (G57C, maize GS1 was verified for glufosinate resistance by the amino acid G mutation at position 57 of maize GS1 to C), ZG57D (G57D), ZG57E (G57E), ZG57F (G57F), ZG57H (G57H), ZG57I (G57I), ZG57K (G57K), ZG57L (G57L), ZG57M (G57M), ZG57N (G57N), ZG57P (G57P), ZG57Q (G57Q), ZG57R (G57R), ZG57S (G57S), ZG57T (G57T), ZG57V (G57W), ZG57Y (G57Y) and ZG57X (G57 Δ, deletion of amino acid G at position 57 of maize GS 1). The results are shown in FIG. 9.
As can be seen from the results of fig. 9:
on a medium containing 0mM glufosinate (KP 0), transformation coding wild type maize GS1 (ZWT) and maize GS1 mutant ZG57C, ZG57D, ZG57E, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG the defective strains of the coding genes of 57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57Y can grow normally, indicating that the ZG57F, ZG57F, ZG57 and F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG57F, ZG Y the GS1 encoded by 57F, ZG Y has normal GS1 enzyme activity;
coli transformed with wild-type maize GS1 failed to grow on medium containing 5mM glufosinate (KP 5), but the transformed maize mutants ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG57S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X grew significantly better than the negative control, indicating that the single mutants containing ZG57C, ZG57D, ZG E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG57S, ZG57T, ZG57 3557V, ZG57W, ZG57Y and ZG57X were significantly better than the wild-type; coli transformed with maize GS1 mutant ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG T, ZG57V, ZG57W, ZG57Y and ZG57X also grew significantly on medium with higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that single mutants of ZG57C, ZG57D, ZG57E, ZG57F, ZG57H, ZG57I, ZG57K, ZG57L, ZG57M, ZG57N, ZG57P, ZG57Q, ZG57R, ZG57S, ZG57T, ZG57V, ZG57W, ZG Y and ZG57X have glufosinate resistance.
Experimental example 4
Referring to the test method of experimental example 1, the wheat GS1 mutant TG57C (G57C, with mutation of amino acid G at position 57 of wheat GS1 to C), TG57E (G57E), TG57F (G57F), TG57I (G57I), TG57M (G57M), TG57N (G57N), TG57P (G57P), TG57S (G57S), TG57T (G57T), TG57Y (G57Y) and TG57X (g57 Δ, deletion of amino acid G at position 57 of wheat GS 1) provided in example 4 were verified for glufosinate resistance. The results are shown in FIG. 10.
As can be seen from the results of fig. 10:
on a medium containing 0mM glufosinate (KP 0), defective strains, which are transformed with the coding genes of wild-type wheat GS1 (TWT) and wheat GS1 mutants TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X, were able to grow normally, indicating that GS1 encoded by TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG57Y and TG57X had normal GS1 enzyme activity;
coli transformed with wild-type wheat GS1 was essentially incapable of growth on medium containing 1mM glufosinate (KP 1), but the escherichia coli transformed with wheat mutants TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X were significantly better grown than the negative control, indicating that the single mutants containing TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG Y and TG57X were significantly better able to resist glufosinate than the wild-type; coli transformed with wheat GS1 mutant TG57C, TG57E, TG 3557F, TG M, TG57N, TG57P, TG S, TG57Y and TG57X also grew significantly on the medium at higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that both the single mutants of TG57C, TG57E, TG57F, TG57I, TG57M, TG57N, TG57P, TG57S, TG57T, TG57Y and TG57X have resistance to glufosinate.
Experimental example 5
Referring to the test method of experimental example 1, glufosinate resistance of the canola GS1 mutant BG57C (G57C, amino acid G at position 57 of canola GS1 was verified as provided in example 5, which was mutated to C), BG57D (G57D), BG57E (G57E), BG57F (G57F), BG57H (G57H), BG57I (G57I), BG57K (G57K), BG57L (G57L), BG57M (G57M), BG57N (G57N), BG57P (G57P), BG57Q (G57Q), BG57R (G57R), BG57S (G57S), BG57T (G57T), BG57V (G57V), BG57W (G57W), BG57Y (G57Y) and BG57X (G57 Δ, amino acid G at position 57 of canola GS1 was deleted). The results are shown in FIG. 11.
As can be seen from the results of fig. 11:
on a medium containing 0mM glufosinate (KP 0), defective strains encoding wild type rape GS1 (BWT) and rape GS1 mutant BG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and the defective strains encoding genes can grow normally, which shows that GS1 encoded by BG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y has normal GS1 enzyme activity;
Coli transformed with wild-type canola GS1 was substantially incapable of growth on medium containing 1mM glufosinate (KP 1), but the E.coli transformed with canola mutants BG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and BG57X were grown significantly better than the negative control, indicating that single mutants containing BG57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57Y and BG57X were significantly better than wild-type; coli transformed with canola GS1 mutant BG57C, BG57D, BG57E, BG57F, BG57K, BG57L, BG57M, BG57N, BG57P, BG57Q, BG57R, BG W and BG57X had significant growth in medium at higher glufosinate concentrations (20 mm, kp20).
These results demonstrate that single mutants of BG57C, BG57D, BG57E, BG57H, BG57I, BG57K, BG57L, BG57M, BG57N, BG57P, BG57Q, BG57R, BG57S, BG57T, BG57V, BG57V, BG Y and BG57X have glufosinate resistance, and the rape GS1 mutant BG57V, BG57V, BG57V, BG57V, BG57V, BG57V, BG57V, BG57V, BG57W and BG57X are more resistant to glufosinate.
Experimental example 6
The enzyme kinetic parameters of the OG57P provided in example 1, GG57P provided in example 2, ZG57P provided in example 3, TG57P provided in example 4 and BG57P mutant provided in example 5 in the presence of glufosinate were examined as follows, with reference to wild-type rice GS1 OWT, wild-type soybean GS1GWT, wild-type maize GS1 ZWT, wild-type wheat GS1 TWT and wild-type canola GS1 BWT:
and (3) constructing a carrier:
the nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.
Purification of 6His protein:
the mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.
Enzyme activity determination:
1. instrument and reagents: enzyme-labeled instrument (De Fe: HBS-1096A), glufosinate (Lier Chemie Co., ltd.), substrate sodium L-glutamate (CAS: 6106-04-3).
2. The operation steps are as follows:
the glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 100mM Tris-HCl (pH 7.5), 5mM ATP,10mM sodium L-glutamate, 30mM hydroxylamine,20mM MgCl 2 . After 100. Mu.l of the reaction solution was mixed uniformly and preheated at 35℃for 5 minutes, 1. Mu.l of the mutant protein solution (protein concentration: 200 ug/ml) was added to start the reaction, and after 60 minutes at 35℃110. Mu.l of the reaction termination solution (55 g/L FeCl) was added 3 ·6H 2 O,20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) was stopped, and the reaction was allowed to stand for 10 minutes. Centrifuge at 5000 Xg for 10min, take 200. Mu.l and determine the light absorption at 500 nm.
The results are shown in FIG. 12.
As can be seen from the results of fig. 12:
wild type control OWT, GWT, ZWT, TWT, BWT was sensitive to glufosinate, IC 50 IC's of mutants OG57P, GG57P, ZG P, TG57P and BG57P of 7.93. Mu.M, 13.55. Mu.M, 8.92. Mu.M, 7.22. Mu.M and 1.53. Mu.M, respectively 50 Far higher than the wild-type control, indicating that the mutant is less sensitive to glufosinate. From mutant IC 50 And wild type IC 50 As can also be seen in the multiple relationship of OG57P, GG57P, ZG57P, TG57P and BG57P 50 Corresponding to wild type GS1 IC 50 These data showed that the mutant glutamine synthetase enzyme activity remained high in terms of enzyme kinetics and also demonstrated the glufosinate-resistant mechanism, by a factor of 74.36, 61.20, 44.24, 20.60 and 481.95.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Sichuan Yuxing He biotechnology Co.Ltd
<120> Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 356
<212> PRT
<213> artificial sequence
<400> 1
Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 2
<211> 356
<212> PRT
<213> artificial sequence
<400> 2
Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 3
<211> 356
<212> PRT
<213> artificial sequence
<400> 3
Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys
260 265 270
Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 4
<211> 356
<212> PRT
<213> artificial sequence
<400> 4
Met Ala Leu Leu Thr Asp Leu Leu Asn Leu Asp Leu Thr Asp Ser Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Val Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Asn Pro Asp Val Ala Lys Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Phe Ala Gly Val Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Thr Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Leu Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Asp Gly Gly Phe Lys Val Ile Val Asp Ala Val Glu Lys
260 265 270
Leu Lys Leu Lys His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Lys His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 5
<211> 356
<212> PRT
<213> artificial sequence
<400> 5
Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr
1 5 10 15
Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp
20 25 30
Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys
260 265 270
Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 6
<211> 1071
<212> DNA
<213> artificial sequence
<400> 6
atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120
tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180
ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240
ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300
ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360
tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420
tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480
atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540
tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600
caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660
cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720
ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780
ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840
atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960
acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020
tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 7
<211> 1071
<212> DNA
<213> artificial sequence
<400> 7
atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60
gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120
tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240
ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300
ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360
gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420
tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480
atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540
tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600
caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660
cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720
ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780
ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840
atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 8
<211> 1071
<212> DNA
<213> artificial sequence
<400> 8
atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60
gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120
ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180
ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240
ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300
cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360
gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420
tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480
gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540
tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600
caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660
ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720
ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780
ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840
attgctgctt atggagaagg caacgagcgt cgtttaacag ggcgccacga aaccgctgac 900
atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960
acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020
tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071
<210> 9
<211> 1071
<212> DNA
<213> artificial sequence
<400> 9
atggcgctcc tcaccgatct cctcaacctc gacctcaccg actccacgga gaagatcatc 60
gccgagtaca tatggatcgg cggatctggc atggatctca ggagcaaagc caggaccctc 120
cccggcccgg tcaccgaccc cagcaagctg cccaagtgga actacgacgg ctccagcacc 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cacaggccat cttcaaggac 240
ccgttcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggagtg 300
ccaatcccca ccaacaagag atacaacgct gccaagatct ttagcaaccc tgatgttgcc 360
aaggaggagc catggtacgg tatcgagcag gagtacaccc tcctacagaa ggacatcaac 420
tggcctctcg gctggcctgt tggtggattc cctggtcctc agggtcctta ctactgtagt 480
attggtgctg acaagtcgtt tgggcgtgac atagttgact cccactacaa ggcctgcctc 540
tttgccggcg tcaacatcag tggcatcaac ggcgaggtca tgcccggaca gtgggagttc 600
caagttggcc cgactgtcgg catctctgct ggtgaccaag tgtgggttgc tcgctacctt 660
cttgagagga tcactgagat cgccggagtt gtcgtcacat ttgaccccaa gcccatccca 720
ggcgactgga acggtgctgg tgctcacaca aactacagta ccgagtcgat gaggaaggac 780
ggcgggttca aggtcatcgt ggacgctgtc gagaagctca agctgaagca caaggagcac 840
atcgccgcct acggcgaggg caacgagcgc cgtctcaccg gcaagcacga aaccgccgac 900
atcaacacct tcagctgggg tgtcgcgaac cgtggcgcgt cggtgcgcgt gggacgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccggc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcctgt ggaagccctg a 1071
<210> 10
<211> 1071
<212> DNA
<213> artificial sequence
<400> 10
atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60
gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120
cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180
ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240
cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300
ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360
gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420
tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480
gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540
tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600
caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660
ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720
ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780
ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840
attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900
atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960
acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020
tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims (7)

1. A glutamine synthetase mutant having glufosinate resistance, wherein the glutamine synthetase mutant is any of the following:
(1) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 57 th position of a wild rice glutamine synthetase; the amino acid at position 57 of the glutamine synthetase mutant after mutation is A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, V, W, Y or deleted;
(2) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 57 th position of a wild soybean glutamine synthetase; the amino acid at position 57 of the glutamine synthetase mutant after mutation is C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted;
(3) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 57 th position of wild corn glutamine synthetase; the amino acid at position 57 of the glutamine synthetase mutant after mutation is C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted;
(4) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 57 th position of wild rape glutamine synthetase; the amino acid at position 57 of the glutamine synthetase mutant after mutation is C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y or deleted;
(5) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 57 th position of wild wheat glutamine synthetase; the amino acid at position 57 of the glutamine synthetase mutant after mutation is C, E, F, I, M, N, P, S, T, Y or deleted;
the amino acid sequence of the wild rice glutamine synthetase is shown as SEQ ID NO. 1; the amino acid sequence of the wild corn glutamine synthetase is shown as SEQ ID NO. 2; the amino acid sequence of the wild soybean glutamine synthetase is shown as SEQ ID NO. 3; the amino acid sequence of the wild wheat glutamine synthetase is shown as SEQ ID NO. 4; the amino acid sequence of the wild rape glutamine synthetase is shown as SEQ ID NO. 5.
2. An isolated nucleic acid molecule encoding a glufosinate-resistant glutamine synthetase mutant of claim 1.
3. A vector comprising the nucleic acid molecule of claim 2.
4. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 2 or the vector of claim 3, wherein the recombinant cell is a non-plant cell.
5. Use of the glufosinate-resistant glutamine synthetase mutant of claim 1, the nucleic acid molecule of claim 2, the vector of claim 3 or the recombinant bacterium or recombinant cell of claim 4 for breeding a glufosinate-resistant plant variety.
6. The use according to claim 5, characterized in that it comprises any one of the following modes of application:
delivering said isolated nucleic acid molecule to a plant cell of interest, said isolated nucleic acid molecule comprising a gene encoding said glutamine synthetase mutant;
transforming a plant of interest with said vector comprising a gene encoding said glutamine synthetase mutant;
or, introducing the recombinant bacterium or recombinant cell into a plant of interest, wherein the recombinant bacterium or recombinant cell contains a gene encoding the glutamine synthetase mutant.
7. Use according to claim 5, characterized in that it comprises: modifying the endogenous glutamine synthetase gene of the plant of interest to encode said glutamine synthetase mutant.
CN202111083393.3A 2021-09-15 2021-09-15 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application Active CN113736757B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111083393.3A CN113736757B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
PCT/CN2022/113148 WO2023040565A1 (en) 2021-09-15 2022-08-17 Glutamine synthetase mutant having glufosinate-ammonium resistance, nucleic acid molecule and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111083393.3A CN113736757B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application

Publications (2)

Publication Number Publication Date
CN113736757A CN113736757A (en) 2021-12-03
CN113736757B true CN113736757B (en) 2023-12-15

Family

ID=78739166

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111083393.3A Active CN113736757B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application

Country Status (2)

Country Link
CN (1) CN113736757B (en)
WO (1) WO2023040565A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113736757B (en) * 2021-09-15 2023-12-15 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757033A (en) * 2013-12-25 2014-04-30 上海市农业科学院 Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
CN111635892A (en) * 2020-06-29 2020-09-08 合肥戬谷生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7910805B2 (en) * 2006-06-08 2011-03-22 Athenix Corp. Bacterial glutamine synthetases and methods of use
CA3026528A1 (en) * 2017-12-15 2019-06-15 Monsanto Technology Llc Methods and compositions for ppo herbicide tolerance
CN113736757B (en) * 2021-09-15 2023-12-15 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757033A (en) * 2013-12-25 2014-04-30 上海市农业科学院 Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof
CN110229794A (en) * 2019-07-01 2019-09-13 四川天豫兴禾生物科技有限公司 Glutamine synthelase mutant and its application and breeding method with glufosinate resistance
CN111635892A (en) * 2020-06-29 2020-09-08 合肥戬谷生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections;Tosapon Pornprom 等人;Pest management science;第65卷(第2期);第216-222页 *
水稻草铵膦耐性突变体的筛选及其耐性机制;任艳 等人;生物学杂志;第38卷(第2期);第51-55页 *

Also Published As

Publication number Publication date
WO2023040565A1 (en) 2023-03-23
CN113736757A (en) 2021-12-03

Similar Documents

Publication Publication Date Title
CN112574967B (en) Glutamine synthetase mutant with glufosinate resistance of plant origin, nucleic acid molecule and application
CN110229794B (en) Glutamine synthetase mutant with glufosinate-ammonium resistance and application and cultivation method thereof
AU2018218386B2 (en) Method for producing HSL protein having improved catalytic activity for 2-oxoglutaric acid-dependently oxidizing 4-HPPD inhibitor
CN110526993B (en) Nucleic acid construct for gene editing
CN110527695A (en) A kind of nucleic acid constructs for site-directed point mutation
CN113736757B (en) Glutamine synthetase mutant with glufosinate resistance, nucleic acid molecule and application
CN114107234B (en) Glutamine synthetase mutant with glufosinate resistance, recombinant gene, recombinant vector and application thereof
CN102775484B (en) Gene improving cadmium tolerance of plant and application thereof
EP3837970A1 (en) Herbicide tolerance genes and methods of use thereof
CN114058600B (en) Glutamine synthetase mutant with glufosinate resistance and application thereof
CN112175058B (en) Cloning, identification and application of salt tolerance related gene splice
CN109182291A (en) A kind of plant EPSPS mutant of the mutation containing K85 and its encoding gene and application
CN110713994B (en) Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof
REN et al. Overexpression of a modified AM79 aroA gene in transgenic maize confers high tolerance to glyphosate
CN114774375B (en) Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant
CN113604443B (en) Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety
CN113957060B (en) Glutamine synthetase mutant and application thereof
CN114807064B (en) Method for obtaining protein with glufosinate resistance and mutant thereof
WO2023071438A1 (en) Glutamine synthetase mutant and application
WO2023207669A1 (en) Method for acquiring protein with glufosinate resistance and glutamine synthetase mutant
CN114807064A (en) Method for obtaining protein with glufosinate-ammonium resistance and mutant thereof
CN113604443A (en) Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety
US9650616B2 (en) Methods for increasing grain yield
CN114621933B (en) accD mutant protein and application thereof
Chattopadhyay et al. Molecular aspects of bacterial blight resistance in rice: recent advancement

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant