CN114774375B

CN114774375B - Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant

Info

Publication number: CN114774375B
Application number: CN202210442671.8A
Authority: CN
Inventors: 陈容; 邓龙群; 卢远根; 付颖钊; 张震; 侯青江; 胥南飞
Original assignee: Gevoto LLC
Current assignee: Gevoto LLC
Priority date: 2022-04-25
Filing date: 2022-04-25
Publication date: 2024-04-19
Anticipated expiration: 2042-04-25
Also published as: WO2023207669A1; CN114774375A

Abstract

The invention discloses a method for obtaining a protein with glufosinate resistance and a glutamine synthetase mutant, and relates to the technical field of genetic engineering. The method comprises the steps of comparing an amino acid sequence of a target protein with a reference sequence, and mutating the amino acid sequence of the target protein to 55 th amino acid residue Y and/or 64 th amino acid residue P of the reference sequence; proteins with increased glufosinate resistance are selected. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more acceptable to consumers. By having glufosinate resistance after mutation, the plants transformed with the glutamine synthetase mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development of plants.

Description

Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for obtaining a protein with glufosinate resistance and a glutamine synthetase mutant.

Background

Glutamine synthetase (Glutamine synthetase, GS) is a key enzyme in nitrogen metabolism in plants, which catalyzes the condensation of glutamic acid (Glu) with NH ₃ to form glutamine (gin) in the glutamate synthetase cycle, involved in the metabolism of nitrogen-containing compounds in plants. Depending on distribution and subcellular localization, higher plant GS (class GSII) isoenzymes can be divided into two classes: one which is located in the cytoplasm is called cytoplasmic GS (GS 1), with a molecular weight of 38-40kDa; another type, designated as apoplast GS (GS 2), is located in chloroplasts (or plastids) and has a molecular weight of 44-45kDa.

Glufosinate (glufosinate ammonium, trade name basta) is a glutamine synthetase (GS 1) inhibitor developed by anget, now bayer, and its active ingredient is phosphinothricin (PPT) and its chemical name is (RS) -2-amino-4- (hydroxymethylphosphino) ammonium butyrate. The product is marketed in 1986, and sales increase year by year. The target enzyme for glufosinate is GS, which can normally form lambda-glutamyl phosphate from ATP and glutamate. However, after PPT treatment, PPT is first bound to ATP and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed and GS activity is inhibited. PPT inhibits all known forms of GS.

As a result of the inhibition of GS by glufosinate, it can lead to disturbances of nitrogen metabolism in plants, excessive accumulation of ammonium, chloroplast disintegration, and thus to inhibition of photosynthesis, ultimately leading to death of plants.

At present, the main method for cultivating the glufosinate-resistant variety is to introduce the glufosinate-resistant gene from bacteria into crops by using genetic engineering means, so as to cultivate a new transgenic glufosinate-resistant crop variety. The most widely used anti-glufosinate genes in agriculture today are the bar gene from strain Streptomyces hygroscopicus and the pat gene from strain s. The bar gene and the pat gene have 80% homology, and can code glufosinate acetylase, and the enzyme can be used for inactivating glufosinate acetylase. The glufosinate-resistant variety has great use value, wherein resistant rape, corn and the like are commercially planted in a large area.

However, due to the wave of the transgene, transgenic crops are still less accepted worldwide, and even in america where the transgenic crops are planted in the largest areas, the transgene is mainly limited to several crops such as corn, soybean, cotton, etc. In particular the bar and pat genes are derived from microorganisms, not from the crop itself, and are more likely to cause conflicting psychological effects for the consumer.

The glufosinate acetylases encoded by the bar and pat genes can acetylate glufosinate to deactivate it, but it is difficult for the enzyme to completely deactivate glufosinate before it contacts the GS, because many GS are distributed on cell membranes, so that the use of glufosinate on bar and pat gene crops interferes with nitrogen metabolism in plants to varying degrees, as well as normal growth and development of plants. Although overexpression of wild-type GS in plants can reduce the sensitivity of transgenic plants to glufosinate, the degree of tolerance is insufficient for commercial use.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide a method for obtaining a protein with glufosinate resistance and a glutamine synthetase mutant so as to solve the technical problems.

The invention is realized in the following way:

the invention provides a method for obtaining a protein with glufosinate resistance, comprising the following steps:

1) A protein having the reference sequence shown in SEQ ID NO.1 or having an amino acid sequence having at least 85% identity to the reference sequence as a target protein;

2) Aligning the amino acid sequence of the target protein with a reference sequence, and mutating the amino acid sequence of the target protein corresponding to the 55 th amino acid residue Y and/or the 64 th amino acid residue P of the reference sequence;

3) Proteins with increased glufosinate resistance are selected.

The inventors found that the protein with enhanced glufosinate resistance can be obtained by comparing the amino acid sequence of the target protein with the reference sequence, mutating the amino acid residue Y at position 55 and/or the amino acid residue P at position 64 of the sequence corresponding to the reference sequence.

The protein has glufosinate resistance, and can maintain the own biological enzyme catalytic activity, thereby meeting the normal nitrogen metabolism of plants and maintaining the normal growth and development of the plants.

The plant or recombinant bacteria transformed with the glufosinate-resistant protein provided by the invention can normally grow and develop in the presence of glufosinate, and the glufosinate-resistant protein mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospects.

The reference sequence is wild type glutamine synthetase from rice.

The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.

The target proteins include, but are not limited to: proteins having a sequence similar to that of a natural plant protein (e.g., artificial design and synthesis), and wild-type glutamine synthetase derived from a plant. By mutating the above amino acid residue positions, a protein having enhanced glufosinate resistance can be obtained.

The above 85% identity, for example, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

The term "glufosinate" in the present invention, also known as glufosinate, refers to 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate.

The invention also provides a glufosinate-resistant glutamine synthetase mutant having an amino acid sequence of at least one of:

(1) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the n-th position of the wild glutamine synthetase; the position of the nth bit is determined as follows: the wild-type glutamine synthetase is aligned with the reference sequence, and the nth position of the wild-type glutamine synthetase corresponds to the 55 th position of the reference sequence;

The n-th amino acid of the mutated glutamine synthetase mutant is X1, and X1 = D, L or T;

(2) The glutamine synthetase mutant has at least 85% identity with the glutamine synthetase mutant shown in (1) in amino acid sequence, and has glufosinate resistance with the glutamine synthetase mutant shown in (1) in the n-th amino acid;

(3) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the m-th position of the wild glutamine synthetase; the position of the mth bit is determined as follows: the wild-type glutamine synthetase is aligned with the reference sequence, and the m-th position of the wild-type glutamine synthetase corresponds to the 64-th position of the reference sequence;

the m-th amino acid of the mutated glutamine synthetase mutant is X2, and X2 = Q, R, S, T, V, W, A, D, F, M, Y or X; x is deletion;

(4) The amino acid sequence of the glutamine synthetase mutant has at least 85% identity with the glutamine synthetase mutant shown in (3), is the same as the amino acid at m position of the glutamine synthetase mutant shown in (3), and has glufosinate resistance;

The reference sequence is shown as SEQ ID NO. 1.

According to the research of the invention, the wild type glutamine synthetase of plant origin is compared with a reference sequence, and the amino acid site corresponding to the 55 th site of the reference sequence, namely the nth site, is mutated to D, L or T; or the amino acid site corresponding to the 64 th site of the reference sequence, namely the m site, is mutated into Q, R, S, T, V, W, A, D, F, M, Y or X, and the obtained glutamine synthetase mutant has glufosinate resistance and simultaneously maintains the biological enzyme catalytic activity of the mutant. The plant or recombinant bacteria transformed with the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, cotton, sorghum and the like, and has wide application prospects.

The reference sequence is wild type glutamine synthetase of rice origin.

It should be noted that the nth position of the wild-type glutamine synthetase may be the 55 th position (for example, corn, wheat, soybean, rape, etc.) on its own sequence, but may not be the 55 th position, and the specific position of the nth position is determined according to the alignment of the sequences, so long as the position corresponding to the 55 th position of the reference sequence is the nth position, that is, the mutation position, when the position is aligned with the reference sequence.

It should be noted that the m-th position of the wild-type glutamine synthetase may be the 64-th position (e.g., corn, wheat, soybean, canola, etc.) on its own sequence, but may not be the 64-th position, and the specific position of the m-th position is determined by alignment of the sequences as long as the position corresponding to the 64-th position of the reference sequence is the m-th position, i.e., the mutation position, of the present invention after alignment with the reference sequence.

All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, the mutant glutamine synthetase obtained by mutating the wild type glutamine synthetase of any plant origin at position 55 or 64 has glufosinate resistance. Thus, the mutant glutamine synthetase obtained by mutating a wild type glutamine synthetase of any plant origin falls within the scope of the present invention.

Furthermore, it is known and easily achieved by those skilled in the art that a glutamine synthetase mutant represented by (1) or (3) has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, etc.) identity with a glutamine synthetase mutant represented by (1) (or (3)) by performing simple amino acid substitution, deletion, or addition, etc. in a non-conserved region of the glutamine synthetase mutant and maintaining the n-th position as the above-mentioned mutated amino acid, and that the glutamine synthetase mutant obtained by further mutation has an equivalent or slightly decreased or slightly increased or greatly increased enzymatic activity and glufosinate resistance, etc. as compared with the glutamine synthetase mutant represented by (1) or (3). Therefore, such glutamine synthetases should also fall within the scope of the present invention.

When the wild-type glutamine synthetase plant is rice, x1= D, L or T; x2= Q, R, S, T, V, W or X, X is a deletion;

When the wild-type glutamine synthetase plant is soybean or corn, x1=d; x2=t or X, X being a deletion;

When the wild-type glutamine synthetase plant is canola, x2= A, D, F, M, Q, W, Y or X, X is deleted.

Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:

MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP.

alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:

MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP.

alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3:

MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP.

Alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.4:

MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP.

the Similarity and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin to each other are shown in the following table. FIG. 1 shows the amino acid sequence alignment of wild-type glutamine synthetase from different plants; in the figure: osGS1-WT: wild type rice glutamine synthetase; zmGS1-WT: corn wild type glutamine synthetase; gmGS1-WT: soybean wild type glutamine synthetase; bnGS1-WT: wild type glutamine synthetase of rape, the arrow shows amino acid 55 and 64 respectively.

The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.

The invention also provides a nucleic acid molecule which codes for the glutamine synthetase mutant.

In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant is easily obtained by a person skilled in the art based on degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant may be obtained by mutating a corresponding nucleotide to a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by one skilled in the art.

For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.5:

ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA.

accordingly, on a sequence basis, a rice glutamine synthetase mutant encoding the above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to the 55 th or 64 th position of the encoded amino acid sequence.

The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.6:

ATGGCCTGCCTCACCGACCTCGTCAACCTCAACCTCTCGGACAACACCGAGAAGATCATCGCGGAATACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAAGCAAGGACCCTCTCCGGCCCGGTGACCGATCCCAGCAAGCTGCCCAAGTGGAACTACGACGGCTCCAGCACGGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCGCAGGCCATCTTCAAGGACCCATTCAGGAGGGGCAACAACATCCTTGTGATGTGCGATTGCTACACCCCAGCCGGCGAGCCAATCCCCACCAACAAGAGGTACAACGCCGCCAAGATCTTCAGCAGCCCTGAGGTCGCCGCCGAGGAGCCGTGGTATGGTATTGAGCAGGAGTACACCCTCCTCCAGAAGGACACCAACTGGCCCCTTGGGTGGCCCATCGGTGGCTTCCCCGGCCCTCAGGGTCCTTACTACTGTGGAATCGGCGCCGAAAAGTCGTTCGGCCGCGACATCGTGGACGCCCACTACAAGGCCTGCTTGTATGCGGGCATCAACATCAGTGGCATCAACGGGGAGGTGATGCCAGGGCAGTGGGAGTTCCAAGTCGGGCCTTCCGTGGGTATATCTTCAGGCGACCAGGTCTGGGTCGCTCGCTACATTCTTGAGAGGATCACGGAGATCGCCGGTGTGGTGGTGACGTTCGACCCGAAGCCGATCCCGGGCGACTGGAACGGCGCCGGCGCGCACACCAACTACAGCACGGAGTCGATGAGGAAGGAGGGCGGGTACGAGGTGATCAAGGCGGCCATCGAGAAGCTGAAGCTGCGGCACAGGGAGCACATCGCGGCATACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACGTTCAGCTGGGGCGTGGCCAACCGCGGCGCGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGCCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA.

the encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO.7:

ATGTCGCTGCTCTCAGATCTCATCAACCTTAACCTCTCAGACACTACTGAGAAGGTGATCGCAGAGTACATATGGATCGGTGGATCAGGAATGGACCTGAGGAGCAAAGCAAGGACTCTCCCAGGACCAGTTAGCGACCCTTCAAAGCTTCCCAAGTGGAACTATGATGGTTCCAGCACAGGCCAAGCTCCTGGAGAAGACAGTGAAGTGATTATATACCCACAAGCCATTTTCAGGGATCCATTCAGAAGGGGCAACAATATCTTGGTTATCTGTGATACTTACACTCCAGCTGGAGAACCCATTCCCACTAACAAGAGGCACGATGCTGCCAAGGTTTTCAGCCATCCTGATGTTGTTGCTGAAGAGACATGGTATGGTATTGAGCAGGAATACACCTTGTTGCAGAAAGATATCCAATGGCCTCTTGGGTGGCCTGTTGGTGGTTTCCCTGGACCACAGGGTCCATACTACTGTGGTGTTGGCGCTGACAAGGCTTTTGGCCGTGACATTGTTGACGCACATTACAAAGCCTGTCTTTATGCTGGCATCAACATCAGTGGAATTAATGGAGAAGTGATGCCCGGTCAGTGGGAATTCCAAGTTGGACCTTCAGTTGGAATCTCAGCTGGTGACGAGGTGTGGGCAGCTCGTTACATCTTGGAGAGGATCACTGAGATTGCTGGTGTGGTGGTTTCCTTTGATCCCAAGCCAATTCAGGGTGATTGGAATGGTGCTGGTGCTCACACAAACTACAGCACTAAGTCCATGAGAAATGATGGTGGCTATGAAGTGATCAAAACCGCCATTGAGAAGTTGGGGAAGAGACACAAGGAGCACATTGCTGCTTATGGAGAAGGCAACGAGCGTCGTTTGACAGGGCGCCACGAAACCGCTGACATCAACACCTTCTTATGGGGAGTTGCAAACCGTGGAGCTTCAGTTAGGGTTGGGAGGGACACAGAGAAAGCAGGGAAGGGATATTTTGAGGACAGAAGGCCAGCTTCTAACATGGACCCATATGTGGTTACTTCCATGATTGCAGACACAACCATTCTGTGGAAGCCATGA.

the encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.8:

ATGAGTCTTCTTACAGATCTCGTTAACCTTAACCTCTCAGAGACCACTGACAAAATCATTGCGGAATACATATGGGTTGGAGGTTCAGGAATGGATATGAGAAGCAAAGCCAGGACTCTTCCTGGACCAGTGAGTGACCCTTCGGAGCTACCAAAGTGGAACTATGATGGCTCAAGCACAGGCCAAGCTCCTGGTGAAGACAGTGAAGTCATCTTATACCCTCAAGCCATATTCAAAGATCCTTTCCGTAGAGGCAACAACATTCTTGTCATGTGCGATGCTTACACTCCAGCGGGCGAACCGATCCCAACAAACAAAAGACACGCTGCGGCTAAGGTCTTTAGCCACCCCGATGTTGTAGCTGAAGTGCCATGGTATGGTATTGAGCAAGAGTATACTTTACTTCAGAAAGATGTGAACTGGCCTCTTGGTTGGCCTATTGGCGGCTTCCCCGGTCCTCAGGGACCATACTATTGTAGTGTTGGAGCAGATAAATCTTTTGGTAGAGACATCGTTGATGCTCACTACAAGGCCTGCTTATACGCTGGCATCAATATTAGTGGCATCAACGGAGAAGTCATGCCTGGTCAGTGGGAGTTCCAAGTTGGTCCAGCTGTTGGTATCTCGGCCGGTGATGAAATTTGGGTCGCACGTTTCATTTTGGAGAGGATCACAGAGATTGCTGGTGTGGTGGTATCTTTTGACCCAAAACCGATTCCCGGTGACTGGAATGGTGCTGGTGCTCACTGCAACTATAGTACCAAGTCAATGAGGGAAGATGGTGGTTACGAGATTATTAAGAAGGCAATCGATAAACTGGGACTGAGACACAAAGAACACATTGCAGCTTACGGTGAAGGCAATGAGCGCCGTCTCACGGGTCACCACGAGACTGCTGACATCAACACTTTCCTCTGGGGTGTTGCGAACCGTGGAGCATCAATCCGTGTAGGACGTGACACAGAGAAAGAAGGGAAAGGATACTTTGAGGATAGGAGGCCAGCTTCGAACATGGATCCTTACATTGTGACTTCCATGATTGCAGAGACCACAATCCTCTGGAAACCTTGA.

The invention also provides an expression cassette or vector containing the nucleic acid molecule.

In an alternative embodiment, the expression cassette is linked to regulatory sequences for regulating the expression of the nucleic acid molecule.

The invention also provides a recombinant bacterium or recombinant cell, which contains the nucleic acid molecule, or an expression cassette or a vector.

The recombinant bacteria may be selected from agrobacterium; the recombinant cell may be a competent cell.

The present invention also provides a method for producing a glufosinate herbicide tolerant plant comprising introducing into the genome of the plant a gene encoding a glufosinate resistant glutamine synthetase mutant as described above.

In an alternative embodiment, the method of introduction is selected from the group consisting of genetic transformation methods, genome editing methods, or genetic mutation methods.

The above genetic transformation methods include, but are not limited to: individuals with glufosinate resistance are produced by selfing or crossing parent plants with genes for glufosinate resistant glutamine synthetase mutants with other plant individuals.

In other embodiments, the methods of transformation described above include, but are not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.

Genome editing methods or gene mutation methods refer to those skilled in the art who readily contemplate modification of a target plant to have a gene encoding a glutamine synthetase mutant as above by a transgenic technique, a gene editing technique (e.g., by a zinc finger endonuclease (ZFN, zinc-finger nucleases) technique, a transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique, or CRISPR/cas 9), a mutation breeding technique (e.g., chemical, radiation mutagenesis, etc.), or the like, so as to obtain a new plant variety that is glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.

In an alternative embodiment, the plants include, but are not limited to, wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, pepper, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, daylily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea, or cassava.

In an alternative embodiment, the pasture includes, but is not limited to, gramineous pasture or leguminous pasture. Gramineous pastures include, but are not limited to: grass for lawn.

In an alternative embodiment, brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, wasabi, canola, cabbage or beet.

In an alternative embodiment, cucurbitaceae plants include, but are not limited to, cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon, or melon.

In an alternative embodiment, leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas, or green beans.

The invention also provides application of the glutamine synthetase mutant, the nucleic acid molecule, the expression cassette or the vector, or the recombinant bacterium or the recombinant cell in cultivating a plant variety with glufosinate resistance.

In a preferred embodiment of the application of the present invention, the application includes: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.

In an alternative embodiment, the plant is subjected to mutagenesis in a physicochemical mutagenesis mode that is mutagenized to a non-lethal dose to obtain plant material.

The above-mentioned non-lethal dose means that the dose is controlled to be within a range of 20% floating above and below the semi-lethal dose.

Physicochemical mutagenesis modes include combinations of one or more of the following physical mutagenesis and chemical mutagenesis modes: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis includes alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; alkylating agent mutagenesis includes ethylcyclomate mutagenesis, diethylsulfate mutagenesis, and ethylenimine mutagenesis.

In a preferred embodiment of the application of the present invention, the application further includes: the endogenous glutamine synthetase gene of the plant of interest is modified to encode a glutamine synthetase mutant.

Modification of the endogenous glutamine synthetase gene of the plant of interest means that the person skilled in the art will readily recognize that the plant of interest is engineered to have a gene encoding a glutamine synthetase mutant as described above by means of conventional transgenic techniques in the art, gene editing techniques, such as by zinc finger endonuclease (ZFN, zinc-finger nucleases) techniques, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) techniques or CRISPR/cas9, mutagenesis breeding techniques, such as chemical, radiation mutagenesis, etc., to obtain a new variety of plants that are glufosinate resistant and capable of normal growth and development. Therefore, whatever technology is adopted, the glutamine synthetase mutant provided by the invention is used for endowing plants with glufosinate resistance, and belongs to the protection scope of the invention.

In a preferred embodiment of the application of the present invention, the application includes at least one of the following application modes:

delivering an isolated nucleic acid molecule to a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a mutant glutamine synthetase;

transforming a target plant with a vector containing a gene encoding a glutamine synthetase mutant;

Introducing recombinant bacteria or recombinant cells into the target plant, wherein the recombinant bacteria or recombinant cells contain a coding gene for a glutamine synthetase mutant.

The isolated nucleic acid molecule may be a plasmid or a DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by gene gun methods.

The invention has the following beneficial effects:

The glutamine synthetase mutant and the protein with glufosinate resistance provided by the invention have application potential for constructing an expression vector of a transformed plant and cultivating glufosinate-resistant crops. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more acceptable to consumers. By having glufosinate resistance after mutation, the plants transformed with the glutamine synthetase mutant not only have glufosinate resistance suitable for commercial application, but also can maintain the normal enzyme catalytic activity of the glutamine synthetase, and can meet the normal growth and development of plants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the amino acid sequence alignment of wild-type glutamine synthetase from different plants; in the figure: osGS1-WT: wild type rice glutamine synthetase; zmGS1-WT: corn wild type glutamine synthetase; gmGS1-WT: soybean wild type glutamine synthetase; bnGS1-WT: wild type rape glutamine synthetase;

FIG. 2 shows the results of partial alignment of amino acid sequences of the rice GS1 mutant R55D, R, T, R L and wild-type rice GS1 OsGS1-WT provided in example 1 of the present invention;

FIG. 3 is a partial alignment of amino acid sequences of soybean GS1 mutant G55D and wild soybean GS1 GmGS-WT provided in example 2 of the present invention;

FIG. 4 is a partial alignment of amino acid sequences of maize GS1 mutant Z55D and wild-type maize GS1 ZmGS-WT provided in example 3 of the present invention;

FIG. 5 shows the result of partial alignment of amino acid sequences of the rice GS1 mutant R64Q, R64R, R64S, R64T, R64V, R W, R X and wild-type rice GS1 OsGS1-WT provided in example 4 of the present invention;

FIG. 6 is a partial alignment of amino acid sequences of soybean GS1 mutant G64X and wild type soybean GS1 GmGS-WT provided in example 5 of the present invention;

FIG. 7 is a partial alignment of the amino acid sequences of maize GS1 mutant Z64X and wild-type maize GS1 ZmGS-WT provided in example 6 of the present invention;

FIG. 8 shows the amino acid sequence part alignment of the canola GS1 mutant B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X and wild type canola GS1 BnGS1-WT provided in example 7 of the present invention;

FIG. 9 is a schematic diagram of the structure of pADV7 vector provided in Experimental example 1 of the present invention;

FIG. 10 shows the results of E.coli growth on medium containing glufosinate with different concentrations of both the rice GS1 mutant R55D, R and T, R L provided in Experimental example 1 and wild-type rice GS1 OsGS 1-WT;

FIG. 11 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant G55D and wild-type soybean GS1 GmGS-WT provided in Experimental example 2 of the present invention;

FIG. 12 shows the results of E.coli growth on medium containing glufosinate at different concentrations for maize GS1 mutant Z55D and wild-type maize GS1 ZmGS-WT provided in Experimental example 3 of the present invention;

FIG. 13 shows the enzyme kinetic parameters and the glufosinate resistance parameters IC50 of the rice GS1 mutant R55D, the soybean GS1 mutant G55D, the corn GS1 mutant Z55D, the wild-type rice GS1 OsGS1-WT, the wild-type soybean GS1 GmGS-WT and the wild-type corn GS1 ZmGS-WT provided in Experimental example 4 of the present invention;

FIG. 14 shows the results of E.coli growth on medium containing glufosinate with different concentrations of GS1 mutant R64Q, R64R, R64S, R64T, R V, R64W, R X and wild-type rice GS1 OsGS1-WT provided in Experimental example 4;

FIG. 15 shows the results of E.coli growth on medium containing glufosinate at different concentrations of soybean GS1 mutant G64X and wild-type soybean GS1 GmGS-WT provided in Experimental example 6 of the present invention;

FIG. 16 shows the results of E.coli growth on medium containing glufosinate at different concentrations for maize GS1 mutant Z64X and wild-type maize GS1 ZmGS-WT provided in Experimental example 6 of the present invention;

FIG. 17 shows the results of E.coli growth on medium containing glufosinate of different concentrations for the canola GS1 mutant B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X and wild-type canola GS1 BnGS1-WT provided in Experimental example 7 of the present invention;

FIG. 18 shows the enzyme kinetic parameters and glufosinate resistance parameters IC50 of the rice GS1 mutant R64X, soybean GS1 mutant G64X, corn GS1 mutant Z64X, rape GS1 mutant B64X, wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type corn GS1 ZmGS1-WT and wild-type rape GS1 BnGS1-WT provided in Experimental example 9 of the present invention.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of formulations or unit doses herein, some methods and materials are now described. Unless otherwise indicated, techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.

Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait, eds., 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (A) and (B) in the following general references, (Methods in Enzymology) methods of enzymology (academic Press Co., ltd (ACADEMIC PRESS, inc.), manual of experimental immunology (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), methods of contemporary molecular biology (Current Protocols inMolecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The features and capabilities of the present invention are described in further detail below in connection with the examples.

Example 1

The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in the example comprises wild-type rice glutamine synthetase itself (named as OsGS1-WT, the amino acid sequence is shown as SEQ ID NO.1, the 55 th amino acid residue Y of the coding nucleotide sequence is shown as SEQ ID NO. 5) mutated to D, T, L, and the obtained rice GS1 mutants are named as R55D, R55T, R L respectively.

The amino acid sequence alignment of the rice GS1 mutant R55D, R, T, R L and the wild-type rice GS1 is shown in FIG. 2, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 55, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The rice GS1 mutants R55D, R T and R55L and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 2

The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 55 th position (corresponding to the 55 th position of the reference sequence (SEQ ID NO. 1)) of wild-type soybean GS1 itself ((designated GmGS-WT, amino acid sequence shown as SEQ ID NO.3, encoding nucleotide sequence SEQ ID NO. 7) from the amino acid residue Y to D, and the obtained soybean GS1 mutants were designated as G55D, respectively.

The amino acid sequence alignment of soybean GS1 mutant G55D and wild-type soybean GS1 is shown in fig. 3, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 55, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The soybean GS1 mutant G55D and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 3

The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating the 55 th position (corresponding to the 55 th position of the reference sequence (SEQ ID NO. 1)) of wild type corn GS1 itself (designated ZmGS-WT, the amino acid sequence of which is shown as SEQ ID NO.2, and the coding nucleotide sequence of which is SEQ ID NO. 6) from the amino acid residue Y to D. The resulting maize GS1 mutants were designated as Z55D, respectively.

The amino acid sequence alignment of maize GS1 mutant Z55D and wild-type maize GS1 is shown in figure 4, where: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 55, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The maize GS1 mutant Z55D and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 4

The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in the example is obtained by mutating the 64 th amino acid residue P of wild type rice glutamine synthetase itself (named as OsGS1-WT, the amino acid sequence is shown as SEQ ID NO.1, the encoding nucleotide sequence is shown as SEQ ID NO. 5) to Q, R, S, T, V, W or deleting (X), and the obtained rice GS1 mutants are named as R64Q, R64R, R64S, R64T, R64V, R W, R64X.

The amino acid sequence alignment of the rice GS1 mutant R64Q, R64R, R64S, R64T, R64V, R64W, R64X and the wild type rice GS1 is shown in FIG. 5, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 64, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The rice GS1 mutant R64Q, R64R, R64S, R T, R64V, R64W, R X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 5

The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 64 th site (corresponding to the 64 th site of the reference sequence (SEQ ID NO. 1)) of the wild-type soybean GS1 itself ((designated GmGS-WT, amino acid sequence shown as SEQ ID NO.3, encoding nucleotide sequence SEQ ID NO. 7) with the amino acid residue P as X. The obtained soybean GS1 mutant was designated as G64X and wild-type soybean GS1 GmGS-WT, respectively.

The amino acid sequence alignment of soybean GS1 mutant G64X and wild-type soybean GS1 is shown in fig. 6, where: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 64, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

The soybean GS1 mutants G64X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 6

The corn (Zea mays) GS1 mutant provided in this example was obtained by mutating the 64 th position (corresponding to the 64 th position of the reference sequence (SEQ ID NO. 1)) of wild-type corn GS1 itself (designated ZmGS-WT, amino acid sequence shown as SEQ ID NO.2, encoding nucleotide sequence SEQ ID NO. 6) from the amino acid residue P to X. The resulting maize GS1 mutant was designated Z64X.

The amino acid sequence alignment of maize GS1 mutant Z64X and wild-type maize GS1 is shown in figure 7, where: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of the maize GS1 mutant is at the position encoding amino acid 64, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.

The maize GS1 mutant Z64X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 7

The rape (Brassica napus) GS1 mutant provided in the example is obtained by mutating the 64 th site (64 th site corresponding to the reference sequence (SEQ ID NO. 1)) of wild type rape GS1 itself (named BnGS-WT, the amino acid sequence is shown as SEQ ID NO.4, the coding nucleotide sequence is shown as SEQ ID NO. 8) from the amino acid residue P to A, D, F, M, Q, Y, W, X. The obtained rape GS1 mutant is named as B64A, B64D, B64F, B M, B64Q, B64Y, B64W, B X respectively.

The amino acid sequence alignment of canola GS1 mutant B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X and wild type canola GS1 is shown in fig. 8, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 64, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.

The rape GS1 mutant B64A, B64D, B64F, B M, B64Q, B64Y, B W and B64X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Experimental example 1

The glufosinate resistance of the rice GS1 mutants R55D, R T and R55L provided in example 1 was tested as follows:

according to the sequence of the nucleic acid molecule provided in example 1, coding genes for rice GS1 mutant R55D, R T and R55L are synthesized by adopting a chemical synthesis method, enzyme cutting sites (Pac 1 and Sbf 1) are introduced into two ends of the coding genes, the coding genes are connected to an expression vector (such as pADV7 vector with the structure shown in figure 9) subjected to the same enzyme cutting treatment under the action of ligase after enzyme cutting, then glutamine synthetase-deficient escherichia coli is respectively transformed, positive clones are selected after verification, and the coding genes are inoculated to M9 culture media containing glufosinate with different concentrations for growth, and the growth condition of defective escherichia coli is observed. The glufosinate resistance was examined with the wild-type rice GS1 mutant as negative control, containing the GS1 mutants R55D (S55D, amino acid Y mutation at position 55 of rice GS1 to D), R55T (Y55T) and R55L (Y55L). The results are shown in FIG. 10.

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild-type rice GS1 (OsGS 1-WT) and the rice GS1 mutants R55D, R T and R55L can grow normally, which shows that the GS1 coded by R55D, R T and R55L has normal GS1 enzyme activity;

Coli transformed with wild-type rice GS1 could not grow on a medium containing 1mM glufosinate (KP 1), but the growth of the escherichia coli transformed with rice mutants R55D, R T and R55L was significantly better than that of the negative control, indicating that the resistance of the single mutant containing R55D, R T and R55L to glufosinate was significantly better than that of the wild-type; coli transformed with the rice GS1 mutant R55D also grew significantly on the medium with better glufosinate concentration (20 mM, KP 20).

These results demonstrate that both the single mutants of R55D, R T and R55L have resistance to glufosinate and that the rice GS1 mutant R55D has greater resistance to glufosinate.

Experimental example 2

Referring to the test method of experimental example 1, glufosinate resistance of soybean GS1 mutant G55D (Y55D, amino acid Y at position 55 of soybean GS1 was mutated to D) provided in example 2 was verified. The results are shown in FIG. 11.

As can be seen from the results of fig. 11:

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild type soybean GS1 (GmGS-WT) and the soybean GS1 mutant G55D can grow normally, which shows that the GS1 coded by G55D has normal GS1 enzyme activity;

Coli transformed with wild-type soybean GS1 was essentially incapable of growth on 2mM glufosinate (KP 2) containing medium, but the transformed soybean mutant G55D was significantly better grown than the negative control, indicating that the G55D containing single mutant was significantly better resistant to glufosinate than the wild-type.

These results demonstrate that the single mutants of G55D all have resistance to glufosinate.

Experimental example 3

Referring to the test method of experimental example 1, glufosinate resistance of maize GS1 mutant Z55D (Y55D, mutation of amino acid Y at position 55 of maize GS1 to D) provided in example 3 was verified. The results are shown in FIG. 12.

As can be seen from the results of fig. 12:

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild corn GS1 (ZmGS-WT) and the corn GS1 mutant Z55D can grow normally, which shows that the GS1 coded by Z55D has normal GS1 enzyme activity;

Coli transformed with wild-type maize GS1 was essentially incapable of growth on a medium containing 2mM glufosinate (KP 2), but the growth of the escherichia coli transformed with maize mutant Z55D was significantly better than that of the negative control, indicating that the ability of the single mutant containing Z55D to resist glufosinate was significantly better than that of the wild-type; coli transformed with maize GS1 mutant Z55D also grew significantly on medium with higher glufosinate concentration (10 mm, kp10).

These results demonstrate that both single mutants of Z55D have resistance to glufosinate.

Experimental example 4

The enzyme kinetic parameters of R55D provided in example 1, G55D provided in example 2, Z55D mutant provided in example 3 and enzyme kinetic parameters in the presence of glufosinate were tested against wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS-WT, wild-type maize GS1 ZmGS-WT as follows:

and (3) constructing a carrier:

The nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.

Purification of 6His protein:

The mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.

Enzyme activity determination:

1. Instrument and reagents: enzyme-labeled instrument (De-Fe: HBS-1096A), glufosinate, substrate L-sodium glutamate (CAS: 6106-04-3).

2. The operation steps are as follows:

The glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 100mM Tris-HCl (pH 7.5), 5mM ATP,10mM sodium L-glutamate, 30mM hydroxylamine,20mM MgCl ₂. After 100. Mu.l of the reaction solution was mixed well and preheated at 35℃for 5 minutes, 1. Mu.l of the mutant protein solution (protein concentration: 200 ug/ml) was added to start the reaction, after 60 minutes at 35℃the reaction was stopped by adding 110. Mu.l of the reaction stop solution (55 g/L FeCl ₃·6H₂ O,20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) and allowed to stand for 10 minutes. Centrifuge at 5000Xg for 10min, take 200. Mu.l and determine the light absorbance at 500 nm.

The results are shown in FIG. 13.

As can be seen from the results of fig. 13:

The slightly higher Km values of the GS1 mutants relative to the wild-type controls OsGS1-WT, gmGS1-WT and ZmGS-WT indicate that the GS mutants have slightly reduced sensitivity to normal substrates while having reduced sensitivity to glufosinate inhibitors. The GS1 mutants all had V _max lower than the wild type control, indicating a reduced enzymatic capacity of these mutants. The wild type control was very sensitive to glufosinate, IC ₅₀ was 0.006mM, 0.005mM and 0.006mM respectively, IC ₅₀ of the mutant was significantly higher than the wild type control, and IC ₅₀ of R55D, G D and Z55D was much higher than the wild type control, indicating that the mutant was much less sensitive to glufosinate. It can also be seen from the fold relationship between mutant IC ₅₀ and wild-type IC ₅₀ that IC ₅₀ for R55D, G D and Z55D are 441.667, 2567.8 and 75066.667 times, respectively, that for wild-type GS1 IC ₅₀, which also indicate that the enzymatic activity of the mutant is much higher than that of the wild-type control. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.

Experimental example 5

Referring to the detection method of experimental example 1, glufosinate resistance of the rice GS1 mutant R64Q (P64Q, amino acid P mutation at position 64 of rice GS1 to Q), R64R (P64R), R64S (P64S), R64T (P64T), R64V (P64V), R64W (P64W) and R64X (P64X) provided in example 4 was verified. The results are shown in FIG. 14.

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild type rice GS1 (OsGS 1-WT) and the rice GS1 mutant R64Q, R64R, R64S, R64T, R64V, R W and R64X can grow normally, which shows that the GS1 coded by R64Q, R R, R64S, R64T, R64V, R W and R64X has normal GS1 enzyme activity;

Coli transformed with wild-type rice GS1 could not grow on a medium containing 10mM glufosinate (KP 10), but E.coli transformed with rice mutants R64Q, R64R, R64S, R64T, R64V, R W and R64X grew significantly better than the negative control, indicating that the single mutants containing R64Q, R64R, R S, R64T, R V, R64W and R64X were significantly better against glufosinate than the wild-type, and these results indicated that the single mutants of R64Q, R64R, R64S, R64T, R64V, R W and R64X had resistance against glufosinate.

Experimental example 6

Referring to the test method of experimental example 1, glufosinate resistance of the soybean GS1 mutant G64X (P64X, the amino acid P at position 64 of soybean GS1 was mutated to X) provided in example 5 was verified. The results are shown in FIG. 15.

As can be seen from the results of fig. 15:

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild type soybean GS1 (GmGS-WT) and the soybean GS1 mutant G64X can grow normally, which shows that the GS1 coded by G64X has normal GS1 enzyme activity;

Coli transformed with wild-type soybean GS1 was essentially incapable of growth on 2mM glufosinate (KP 2) containing medium, but the growth of the soybean mutant G64X-transformed was significantly better than that of the negative control, indicating that the G64X-containing single mutant was significantly better against glufosinate than the wild-type. These results demonstrate that all single mutants of G64X have resistance to glufosinate.

Experimental example 7

Referring to the test method of experimental example 1, glufosinate resistance of the maize GS1 mutant Z64X (P64X, mutation of amino acid P at position 64 of maize GS1 to X) provided in example 6 was verified. The results are shown in FIG. 16.

As can be seen from the results of fig. 16:

On a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild corn GS1 (ZmGS-WT) and the corn GS1 mutant Z64X can grow normally, which shows that the GS1 coded by Z64X has normal GS1 enzyme activity;

coli transformed with wild-type maize GS1 was essentially incapable of growth on a medium containing 2mM glufosinate (KP 2), but the growth of the escherichia coli transformed with maize mutant Z64X was significantly better than that of the negative control, indicating that the resistance of the single mutant containing Z64X to glufosinate was significantly better than that of the wild-type; coli transformed with maize GS1 mutant Z64X also grew significantly on medium with high glufosinate concentration (5 mM, KP 5).

These results demonstrate that both single mutants of Z64X have resistance to glufosinate.

Experimental example 8

Referring to the detection method of experimental example 1, glufosinate resistance of canola GS1 mutant B64A (P64A, amino acid P mutation at position 64 of canola GS1 to a), B64D (P64D), B64F, (P64F), B64M (P64M), B64Q (P64Q), B64Y (P64Y), B64W (P64W), B64X (P64X) provided in example 7 was verified. The results are shown in FIG. 17.

As can be seen from the results of fig. 17:

On a culture medium containing 0mM glufosinate (KP 0), the defective strains which are used for transforming and encoding wild rape GS1 (BnGS 1-WT) and rape GS1 mutant B64A, B64 64D, B F, B64M, B64Q, B64Y, B64W, B X can grow normally, which shows that GS1 encoded by B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X has normal GS1 enzyme activity;

Coli transformed with wild-type canola GS1 was substantially incapable of growth on medium containing 1mM glufosinate (KP 1), but the growth of the transformed canola mutant B64A, B64D, B64F, B64M, B Q, B64Y, B64W, B X was significantly better than that of the negative control, indicating that the single mutant containing B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X was significantly better than the wild-type; coli transformed with canola GS1 mutant B64W, B X also grew significantly on medium with glufosinate concentration (5 mm, kp5).

These results demonstrate that the single mutants of B64A, B64D, B64F, B64M, B64Q, B64Y, B64W, B X all have glufosinate resistance and that the canola GS1 mutant B64W, B X has strong glufosinate resistance.

Experimental example 9

Referring to the detection method of experimental example 4, the enzyme kinetic parameters of R64X provided in example 4, G64X provided in example 5, Z64X provided in example 6, B64X mutant provided in example 7 and enzyme kinetic parameters in the presence of glufosinate were examined with reference to wild-type rice GS1 OsGS1-WT, wild-type soybean GS1 GmGS1-WT, wild-type maize GS1 ZmGS1-WT and wild-type canola GS1 BnGS 1-WT. The results are shown in FIG. 18.

As can be seen from the results of fig. 18:

The slightly higher Km values of the GS1 mutants relative to the wild-type controls OsGS1-WT, gmGS1-WT, zmGS1-W and BnGS-WT indicate that the GS mutants have slightly reduced sensitivity to normal substrates while reducing sensitivity to glufosinate inhibitors. Both rice and soybean GS1 mutants have higher V _max than the wild-type control, indicating an increase in the enzymatic capacity of these mutants. The wild type control was very sensitive to glufosinate and IC ₅₀ was 0.006mM, 0.005mM, 0.006mM and 0.007mM, respectively, the mutant had significantly higher IC ₅₀ than the wild type control and the R64X, G64X, Z X and B64X IC ₅₀ was much higher than the wild type control, indicating that the mutant was much less sensitive to glufosinate. It can also be seen from the fold relationship between mutant IC ₅₀ and wild-type IC ₅₀ that IC ₅₀ of R64X, G64X, Z X and B64X was 2.167 fold, 4.6 fold, 10.167 fold and 2.714 fold, respectively, of the corresponding wild-type GS1 IC ₅₀, which also indicated that the mutant had higher enzymatic activity than the wild-type control. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Sichuan Yuxing He biotechnology Co.Ltd

<120> A method for obtaining a protein having glufosinate resistance and a mutant glutamine synthetase

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 356

<212> PRT

<213> Artificial sequence

<400> 1

Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr

1 5 10 15

Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys

100 105 110

Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly

130 135 140

Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys

260 265 270

Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu

305 310 315 320

Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Ile Trp Lys Pro

355

<210> 2

<211> 356

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr

1 5 10 15

Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys

100 105 110

Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly

130 135 140

Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser

245 250 255

Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys

260 265 270

Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu

305 310 315 320

Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Ile Trp Lys Pro

355

<210> 3

<211> 356

<212> PRT

<213> Artificial sequence

<400> 3

Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr

1 5 10 15

Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp

20 25 30

Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser

35 40 45

Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys

100 105 110

Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly

130 135 140

Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly

145 150 155 160

Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile

195 200 205

Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys

260 265 270

Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp

305 310 315 320

Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile

340 345 350

Leu Trp Lys Pro

355

<210> 4

<211> 356

<212> PRT

<213> Artificial sequence

<400> 4

Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr

1 5 10 15

Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp

20 25 30

Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser

35 40 45

Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro

50 55 60

Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp

65 70 75 80

Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr

85 90 95

Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys

100 105 110

Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile

115 120 125

Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly

130 135 140

Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser

145 150 155 160

Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr

165 170 175

Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu

180 185 190

Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile

195 200 205

Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile

210 215 220

Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro

225 230 235 240

Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser

245 250 255

Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys

260 265 270

Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn

275 280 285

Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe

290 295 300

Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp

305 310 315 320

Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser

325 330 335

Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile

340 345 350

Leu Trp Lys Pro

355

<210> 5

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 5

atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60

gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120

tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180

ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240

ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300

ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360

tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420

tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480

atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540

tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600

caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660

cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720

ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780

ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840

atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900

atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960

acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020

tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071

<210> 6

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 6

atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60

gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120

tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180

ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240

ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300

ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360

gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420

tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480

atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540

tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600

caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660

cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720

ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780

ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840

atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900

atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960

acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020

tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071

<210> 7

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 7

atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60

gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120

ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180

ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240

ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300

cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360

gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420

tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480

gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540

tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600

caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660

ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720

ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780

ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840

attgctgctt atggagaagg caacgagcgt cgtttgacag ggcgccacga aaccgctgac 900

atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960

acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020

tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071

<210> 8

<211> 1071

<212> DNA

<213> Artificial sequence

<400> 8

atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60

gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120

cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180

ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240

cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300

ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360

gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420

tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480

gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540

tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600

caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660

ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720

ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780

ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840

attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900

atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960

acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020

tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims

1. A method for obtaining a protein having glufosinate resistance comprising the steps of:

1) The glutamine synthetase was mutated by any of the following methods:

mutating the 55 th amino acid Y of the glutamine synthetase of the paddy rice with the amino acid sequence shown as SEQ ID NO.1 into D, L or T, or mutating the 64 th amino acid P into Q, R, S, T, V, W or X, wherein X is deleted;

mutating the 55 th amino acid Y of the glutamine synthetase of the soybean with the amino acid sequence shown as SEQ ID NO.3 into D, or deleting the 64 th amino acid P;

mutating the 55 th amino acid Y of the glutamine synthetase of corn with the amino acid sequence shown as SEQ ID NO.2 into D or deleting mutation of the 64 th amino acid P;

and, mutating the 64 th amino acid P of the glutamine synthetase of rape with the amino acid sequence shown as SEQ ID NO.4 to A, D, F, M, Q, W, Y or X; x is deletion;

2) Proteins with increased glufosinate resistance are selected.

2. A glufosinate-resistant glutamine synthetase mutant characterized by an amino acid sequence of any one of the following:

(1) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 55 th position of a wild rice glutamine synthetase; the 55 th amino acid of the mutated glutamine synthetase mutant is D, L or T;

(2) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 55 th position of a wild soybean glutamine synthetase; the 55 th amino acid of the mutated glutamine synthetase mutant is D;

(3) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 55 th position of wild corn glutamine synthetase; the 55 th amino acid of the mutated glutamine synthetase mutant is D;

(4) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 64 th site of wild rice glutamine synthetase; the 64 th amino acid of the mutated glutamine synthetase mutant is Q, R, S, T, V, W or X, and X is deleted;

(5) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 64 th site of wild soybean glutamine synthetase; the 64 th amino acid of the glutamine synthetase mutant after mutation is deleted;

(6) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 64 th site of wild corn glutamine synthetase; the 64 th amino acid of the glutamine synthetase mutant after mutation is deleted;

(7) The amino acid sequence of the glutamine synthetase mutant is obtained by mutating the 64 th site of wild rape glutamine synthetase; the 64 th amino acid of the mutated glutamine synthetase mutant is mutated to A, D, F, M, Q, W, Y or X; x is deletion;

the amino acid sequence of the wild type rice glutamine synthetase is shown as SEQ ID NO.1, the amino acid sequence of the wild type soybean glutamine synthetase is shown as SEQ ID NO.3, the amino acid sequence of the wild type corn glutamine synthetase is shown as SEQ ID NO.2, and the amino acid sequence of the wild type rape glutamine synthetase is shown as SEQ ID NO. 4.

3. A nucleic acid molecule encoding the glutamine synthetase mutant of claim 2.

4. An expression cassette or vector comprising the nucleic acid molecule of claim 3.

5. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 3, or the expression cassette or vector of claim 4, wherein the recombinant cell is a non-plant cell.

6. A method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of the plant a gene encoding a glufosinate-resistant glutamine synthetase mutant of claim 2.

7. The method of producing a glufosinate herbicide tolerant plant of claim 6 wherein the method of introduction is selected from genetic transformation methods, genome editing methods or genetic mutation methods.

8. The method of producing a glufosinate herbicide-tolerant plant of claim 6, wherein the plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, sesame, peanut, sunflower, radish, carrot, tomato, eggplant, pepper, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, daylily, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, tea, or cassava.

9. The method of producing a glufosinate-herbicide tolerant plant of claim 6 wherein the plant is selected from the group consisting of grasses selected from gramineous grasses and leguminous grasses.

10. The method of producing a glufosinate herbicide-tolerant plant of claim 8, wherein the brassica vegetable is selected from any one of turnip, cabbage, mustard, cabbage mustard, canola, mustard, green, canola, rape, cauliflower, and beet.

11. The method of producing a glufosinate-herbicide tolerant plant of claim 8, wherein the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, balsam pear, luffa, melon, watermelon or melon.

12. The method of producing a glufosinate-herbicide tolerant plant of claim 8, wherein the leguminous plant is selected from mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea or green bean.

13. Use of a glutamine synthetase mutant of claim 2, a nucleic acid molecule of claim 3, an expression cassette or vector of claim 4, or a recombinant bacterium or recombinant cell of claim 5 for breeding a plant variety having glufosinate resistance.

14. Use according to claim 13, characterized in that it comprises: modifying the endogenous glutamine synthetase gene of the plant of interest to encode said glutamine synthetase mutant.