CN116875568A

CN116875568A - G61 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof

Info

Publication number: CN116875568A
Application number: CN202310871498.8A
Authority: CN
Inventors: 陈容; 邓龙群; 侯青江; 徐洪健; 许立敏; 孙顺华; 冯阳; 胥南飞
Original assignee: Gevoto LLC
Current assignee: Gevoto LLC
Priority date: 2023-07-17
Filing date: 2023-07-17
Publication date: 2023-10-13

Abstract

The invention discloses a plant glutamine synthetase mutant containing G61 mutation, and a coding gene and application thereof, and relates to the technical field of genetic engineering. The glutamine synthetase mutant is originally derived from plants, has glufosinate resistance after mutation, has good biological enzyme catalytic activity, and the plants transformed by the glutamine synthetase mutant not only have glufosinate resistance, but also can normally grow and develop. The glutamine synthetase mutant provided by the invention enriches a glutamine synthetase mutant library, and provides powerful technical support for cultivating glufosinate-resistant plant varieties.

Description

G61 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a plant glutamine synthetase mutant containing G61 mutation, and a coding gene and application thereof.

Background

Glutamine synthetase (Glutamine synthetase, GS) is a key enzyme for nitrogen metabolism in plants, which catalyzes glutamate (Gln) and NH in the glutamate synthetase cycle ₃ Condensation forms glutamine (Glu), which participates in the metabolism of nitrogen-containing compounds in plants. Depending on distribution and subcellular localization, higher plant GS (class GSII) isoenzymes can be divided into two classes: one which is located in the cytoplasm is called cytoplasmic GS (GS 1), with a molecular weight of 38-40kDa; another type, designated as apoplast GS (GS 2), is located in chloroplasts (or plastids) and has a molecular weight of 44-45kDa.

Glufosinate (glufosinate ammoni μm, trade name Basta) is a glutamine synthetase (GS 1) inhibitor developed by anget corporation (now bayer corporation), and its active ingredient is phosphinothricin (abbreviated PPT), and its chemical name is (RS) -2-amino-4- (hydroxymethylphosphino) ammonium butyrate. The product is marketed in 1986, and sales increase year by year. The target enzyme for glufosinate is GS, which can normally form lambda-glutamyl phosphate from ATP and glutamate. However, after PPT treatment, PPT is first bound to ATP and phosphorylated PPT occupies 8 reaction centers of GS molecules, so that the spatial configuration of GS is changed and GS activity is inhibited. PPT inhibits all known forms of GS.

As a result of inhibition of GS by glufosinate, it can lead to disturbance of nitrogen metabolism in plants, excessive accumulation of ammonium, disintegration of chloroplasts, and thus inhibition of photosynthesis in plants, and in severe cases, death of plants.

At present, the main method for cultivating the glufosinate-resistant variety is to introduce the glufosinate-resistant gene from bacteria into crops by using genetic engineering means, so as to cultivate a new transgenic glufosinate-resistant crop variety. The most widely used anti-glufosinate genes in agriculture today are the bar gene from strain Streptomyces hygroscopicus and the pat gene from strain s. The Bar gene and the pat gene have 80% homology, and can code glufosinate acetylase, and the glufosinate acetylase can be inactivated by the enzyme. The glufosinate-resistant variety has great use value, wherein resistant rape, corn and the like are commercially planted in a large area.

The glufosinate acetylase enzyme coded by Bar gene and pat gene can acetylate glufosinate to inactivate, but before glufosinate contacts GS, the enzyme can hardly inactivate glufosinate completely, because many GS are distributed on cell membranes, so that when the glufosinate is applied to crops with Bar gene and pat gene, nitrogen metabolism of plants can be interfered to different degrees, and normal growth and development of the plants are affected. Overexpression of wild-type GS in plants can reduce the sensitivity of transgenic plants to glufosinate but is not sufficiently tolerant for commercial use.

In view of this, the present invention has been made.

Disclosure of Invention

The invention aims to provide a plant glutamine synthetase mutant containing G61 mutation, and a coding gene and application thereof, and provides powerful technical support for cultivating glufosinate-resistant plant varieties. The plant glutamine synthetase mutant is originally derived from plants, has glufosinate resistance after mutation, and plants transformed by the plant glutamine synthetase mutant not only have glufosinate resistance, but also can grow and develop normally.

Term interpretation:

the "deletion mutation" is a deletion mutation (del). If the amino acid sequence of the target protein is subjected to deletion mutation corresponding to the 61 st amino acid residue of the reference sequence, the amino acid residue corresponding to the 61 st amino acid residue of the reference sequence is deleted.

The term "glufosinate" in the present invention, also known as glufosinate, refers to 2-amino-4- [ hydroxy (methyl) phosphono ] ammonium butyrate.

The invention is realized in the following way:

in a first aspect, the present invention provides a method for obtaining a protein having glufosinate resistance comprising the steps of:

1) A protein having the reference sequence shown in SEQ ID NO.1 or having an amino acid sequence having at least 85% identity to the reference sequence as a target protein;

2) Comparing the amino acid sequence of the target protein with a reference sequence, and mutating the amino acid sequence of the target protein corresponding to the 61 st amino acid residue of the reference sequence to proline or deleting the proline;

3) Proteins with increased glufosinate resistance are selected.

The inventor researches and discovers that the wild type glutamine synthetase of plant origin is compared with a reference sequence, the amino acid position corresponding to the 61 st position of the reference sequence is mutated to proline or deleted, and the protein with glufosinate resistance can be obtained by screening. The protein has good biological enzyme catalytic activity.

In a second aspect, the present invention also provides a plant glutamine synthetase mutant having glufosinate resistance, the plant glutamine synthetase mutant being as follows (1) or (2):

(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with the reference sequence, the n-th position of the wild type glutamine synthetase corresponds to the 61-th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

The n-th amino acid of the plant glutamine synthetase mutant is proline or deletion mutation compared with the wild glutamine synthetase;

(2): which has at least 85% identity with the plant glutamine synthetase mutant shown in (1) and is identical to the amino acid at the n-th position of the plant glutamine synthetase mutant shown in (1).

Comparing the wild type glutamine synthetase from plant with reference sequence, mutating the amino acid site corresponding to 61 th position of the reference sequence to P or deleting, and obtaining plant glutamine synthetase mutant with glufosinate resistance and maintained biological enzyme catalytic activity. The plant or recombinant strain transformed with the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate, and the plant glutamine synthetase mutant not only can be used for cultivating transgenic crops, but also can be used for cultivating glufosinate-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospects.

The reference sequence is wild type glutamine synthetase of rice origin.

The sequence alignment method can use Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) to carry out Protein Blast alignment; the same results can be obtained using other sequence alignment methods or tools well known in the art.

It should be noted that the n-th position of the wild-type glutamine synthetase may be the 61-th position (e.g., corn, soybean, rape, etc.) on its own sequence, but may not be the 61-th position, and the specific position of the n-th position is determined by the alignment of the sequences, so long as the position corresponding to the 61-th position of the reference sequence is the n-th position, i.e., the mutation position, of the present invention after the alignment with the reference sequence.

In a preferred embodiment of the invention, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea or cassava.

All plants have homology to the wild-type glutamine synthetase and essentially identical functions and domains in the plant body. Thus, any plant-derived wild-type glutamine synthetase mutant obtained by making the above-described mutation at position 61 has glufosinate resistance. Therefore, the plant glutamine synthetase mutants obtained by mutating wild type glutamine synthetase of any plant origin are all within the scope of the present invention.

Furthermore, it is known and easily achieved by those skilled in the art that a simple amino acid substitution, deletion, or addition is performed in a non-conserved region of the plant glutamine synthetase mutant shown in (1) and the n-th position is maintained as the above-mentioned mutated amino acid, and that the further mutated plant glutamine synthetase mutant has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% etc.) or more identity with the plant glutamine synthetase mutant shown in (1), and that its functions include the enzyme catalytic activity and glufosinate resistance are equivalent to or slightly decreased or slightly increased or greatly increased as those of the plant glutamine synthetase mutant shown in (1). Therefore, such glutamine synthetases should also fall within the scope of the present invention.

In a preferred embodiment of the invention, the pasture is selected from gramineous pasture or leguminous pasture; leguminous forage includes, but is not limited to: red clover, white clover, alfalfa, arrowhead peas, green peas, lupin yellow, white clover, sweet clover, astragalus root, white milk vetch, white butterfly beans, and the like.

In a preferred embodiment of the invention, the brassica vegetables include, but are not limited to, turnip, cabbage, mustard, cabbage mustard, canola, mustard, cabbage, canola, green vegetables, or beet.

In a preferred embodiment of the present invention, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, wax gourd, luffa, melon, watermelon or melon;

in a preferred embodiment of the invention, leguminous plants include, but are not limited to, mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans;

in a preferred embodiment of the invention, the plant is rice, maize, soybean or canola.

Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No.1:

MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP。

alternatively, in some embodiments of the invention, when the plant is corn, the corn wild-type glutamine synthetase is SEQ ID No.2:

MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP。

Alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No.3:

MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP。

alternatively, in some embodiments of the invention, when the plant is canola, the canola wild-type glutamine synthetase is SEQ ID No.4:

MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP。

the Similarity (Similarity) and Identity (Identity) of the wild-type glutamine synthetases of partial plant origin are shown in the following table, and the partial results of the sequence alignment are shown in FIG. 8, with the arrow indicating amino acid 61.

The above-mentioned Similarity (Similarity) and Identity (Identity) comparison method is as follows: the amino acid sequence of one species is input to the Blast website (https:// Blast. Ncbi. Nlm. Nih. Gov/Blast. Cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of this species and other species to be aligned are looked up from the alignment.

In a third aspect, the invention also provides an isolated nucleic acid molecule encoding a plant glutamine synthetase mutant as described above.

The term "nucleic acid molecule encoding a mutant of a plant glutamine synthetase as described above" may be a polynucleotide comprising a mutant protein of the present invention, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polypeptides or muteins having the same amino acid sequence as the invention. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the mutein encoded thereby.

At present, it is already possible to obtain the DNA sequences encoding the proteins of the invention (or fragments or derivatives thereof) entirely by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining polynucleotides of the invention. In particular, when it is difficult to obtain full-length cDNA from a library, it is preferable to use RACE method (RACE-cDNA end rapid amplification method), and primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above plant glutamine synthetase mutant is easily obtained by a person skilled in the art based on the degeneracy of codons. For example, a nucleic acid sequence encoding a mutant of a plant glutamine synthetase as described above may be obtained by mutating a corresponding nucleotide in a nucleic acid sequence encoding a wild type glutamine synthetase. This is readily accomplished by one skilled in the art.

For example, the rice wild-type glutamine synthetase has a nucleic acid sequence of SEQ ID NO.5:

ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA。

accordingly, on a sequence basis, a mutant encoding rice plant glutamine synthetase as described above can be obtained by performing a corresponding nucleotide mutation at a codon corresponding to position 61 of the encoded amino acid sequence.

The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO.6:

ATGGCCTGCCTCACCGACCTCGTCAACCTCAACCTCTCGGACAACACCGAGAAGATCATCGCGGAATACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAAGCAAGGACCCTCTCCGGCCCGGTGACCGATCCCAGCAAGCTGCCCAAGTGGAACTACGACGGCTCCAGCACGGGCCAGGCCCCCGGCGAGGACAGCGAGGTCATCCTGTACCCGCAGGCCATCTTCAAGGACCCATTCAGGAGGGGCAACAACATCCTTGTGATGTGCGATTGCTACACCCCAGCCGGCGAGCCAATCCCCACCAACAAGAGGTACAACGCCGCCAAGATCTTCAGCAGCCCTGAGGTCGCCGCCGAGGAGCCGTGGTATGGTATTGAGCAGGAGTACACCCTCCTCCAGAAGGACACCAACTGGCCCCTTGGGTGGCCCATCGGTGGCTTCCCCGGCCCTCAGGGTCCTTACTACTGTGGAATCGGCGCCGAAAAGTCGTTCGGCCGCGACATCGTGGACGCCCACTACAAGGCCTGCTTGTATGCGGGCATCAACATCAGTGGCATCAACGGGGAGGTGATGCCAGGGCAGTGGGAGTTCCAAGTCGGGCCTTCCGTGGGTATATCTTCAGGCGACCAGGTCTGGGTCGCTCGCTACATTCTTGAGAGGATCACGGAGATCGCCGGTGTGGTGGTGACGTTCGACCCGAAGCCGATCCCGGGCGACTGGAACGGCGCCGGCGCGCACACCAACTACAGCACGGAGTCGATGAGGAAGGAGGGCGGGTACGAGGTGATCAAGGCGGCCATCGAGAAGCTGAAGCTGCGGCACAGGGAGCACATCGCGGCATACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACGTTCAGCTGGGGCGTGGCCAACCGCGGCGCGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGCCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA。

the encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO.7:

ATGTCGCTGCTCTCAGATCTCATCAACCTTAACCTCTCAGACACTACTGAGAAGGTGATCGCAGAGTACATATGGATCGGTGGATCAGGAATGGACCTGAGGAGCAAAGCAAGGACTCTCCCAGGACCAGTTAGCGACCCTTCAAAGCTTCCCAAGTGGAACTATGATGGTTCCAGCACAGGCCAAGCTCCTGGAGAAGACAGTGAAGTGATTATATACCCACAAGCCATTTTCAGGGATCCATTCAGAAGGGGCAACAATATCTTGGTTATCTGTGATACTTACACTCCAGCTGGAGAACCCATTCCCACTAACAAGAGGCACGATGCTGCCAAGGTTTTCAGCCATCCTGATGTTGTTGCTGAAGAGACATGGTATGGTATTGAGCAGGAATACACCTTGTTGCAGAAAGATATCCAATGGCCTCTTGGGTGGCCTGTTGGTGGTTTCCCTGGACCACAGGGTCCATACTACTGTGGTGTTGGCGCTGACAAGGCTTTTGGCCGTGACATTGTTGACGCACATTACAAAGCCTGTCTTTATGCTGGCATCAACATCAGTGGAATTAATGGAGAAGTGATGCCCGGTCAGTGGGAATTCCAAGTTGGACCTTCAGTTGGAATCTCAGCTGGTGACGAGGTGTGGGCAGCTCGTTACATCTTGGAGAGGATCACTGAGATTGCTGGTGTGGTGGTTTCCTTTGATCCCAAGCCAATTCAGGGTGATTGGAATGGTGCTGGTGCTCACACAAACTACAGCACTAAGTCCATGAGAAATGATGGTGGCTATGAAGTGATCAAAACCGCCATTGAGAAGTTGGGGAAGAGACACAAGGAGCACATTGCTGCTTATGGAGAAGGCAACGAGCGTCGTTTGACAGGGCGCCACGAAACCGCTGACATCAACACCTTCTTATGGGGAGTTGCAAACCGTGGAGCTTCAGTTAGGGTTGGGAGGGACACAGAGAAAGCAGGGAAGGGATATTTTGAGGACAGAAGGCCAGCTTCTAACATGGACCCATATGTGGTTACTTCCATGATTGCAGACACAACCATTCTGTGGAAGCCATGA。

the encoding nucleic acid sequence of the wild type rape glutamine synthetase is SEQ ID NO.8:

ATGAGTCTTCTTACAGATCTCGTTAACCTTAACCTCTCAGAGACCACTGACAAAATCATTGCGGAATACATATGGGTTGGAGGTTCAGGAATGGATATGAGAAGCAAAGCCAGGACTCTTCCTGGACCAGTGAGTGACCCTTCGGAGCTACCAAAGTGGAACTATGATGGCTCAAGCACAGGCCAAGCTCCTGGTGAAGACAGTGAAGTCATCTTATACCCTCAAGCCATATTCAAAGATCCTTTCCGTAGAGGCAACAACATTCTTGTCATGTGCGATGCTTACACTCCAGCGGGCGAACCGATCCCAACAAACAAAAGACACGCTGCGGCTAAGGTCTTTAGCCACCCCGATGTTGTAGCTGAAGTGCCATGGTATGGTATTGAGCAAGAGTATACTTTACTTCAGAAAGATGTGAACTGGCCTCTTGGTTGGCCTATTGGCGGCTTCCCCGGTCCTCAGGGACCATACTATTGTAGTGTTGGAGCAGATAAATCTTTTGGTAGAGACATCGTTGATGCTCACTACAAGGCCTGCTTATACGCTGGCATCAATATTAGTGGCATCAACGGAGAAGTCATGCCTGGTCAGTGGGAGTTCCAAGTTGGTCCAGCTGTTGGTATCTCGGCCGGTGATGAAATTTGGGTCGCACGTTTCATTTTGGAGAGGATCACAGAGATTGCTGGTGTGGTGGTATCTTTTGACCCAAAACCGATTCCCGGTGACTGGAATGGTGCTGGTGCTCACTGCAACTATAGTACCAAGTCAATGAGGGAAGATGGTGGTTACGAGATTATTAAGAAGGCAATCGATAAACTGGGACTGAGACACAAAGAACACATTGCAGCTTACGGTGAAGGCAATGAGCGCCGTCTCACGGGTCACCACGAGACTGCTGACATCAACACTTTCCTCTGGGGTGTTGCGAACCGTGGAGCATCAATCCGTGTAGGACGTGACACAGAGAAAGAAGGGAAAGGATACTTTGAGGATAGGAGGCCAGCTTCGAACATGGATCCTTACATTGTGACTTCCATGATTGCAGAGACCACAATCCTCTGGAAACCTTGA。

in a fourth aspect, the invention also provides a vector comprising the nucleic acid molecule described above.

Vectors include, but are not limited to, expression vectors, shuttle vectors, and integration vectors.

In the present invention, the term "expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements.

In an alternative embodiment, the expression vector further comprises a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

In a fifth aspect, the invention also provides a recombinant bacterium or recombinant cell comprising the nucleic acid molecule as described above or the vector as described above.

The recombinant cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast, plant cells (e.g., ginseng cells).

In a preferred embodiment of the invention, the strain is selected from the group consisting of Agrobacterium and E.coli.

In a sixth aspect, the invention also provides the use of a plant glutamine synthetase mutant, a nucleic acid molecule, a vector or a recombinant bacterium or recombinant cell for breeding a plant variety having glufosinate resistance.

In a preferred embodiment of the application of the present invention, the application includes any of the following uses:

(1) Transforming a target plant with a vector containing a coding gene encoding a plant glutamine synthetase mutant;

(2) Modifying the endogenous glutamine synthetase gene of the target plant by a gene editing method to code a plant glutamine synthetase mutant;

(3) The plant cells, tissues, individuals or populations are subjected to mutagenesis and selection to encode a plant glutamine synthetase mutant.

In preferred embodiments of the invention for use, the gene editing is selected from CRISPR/Cas9, TALEN technology or ZFN technology.

On the basis of the present invention, it is easy for a person skilled in the art to modify a target plant by a conventional gene editing technique in the art, such as a zinc finger endonuclease (ZFN, zinc-finger nucleic acid) technique, transcription activator-like effector nuclease (TALEN, transcription activator-like effector nucleases) technique or CRISPR/Cas 9), a mutation breeding technique (such as chemical, radiation mutagenesis, etc.), etc., to have a gene encoding the plant glutamine synthetase mutant as described above, thereby obtaining glufosinate resistance and enabling normal growth and development, and to obtain a new variety of plants having glufosinate resistance. Therefore, whatever technology is adopted, the plant glutamine synthetase mutant provided by the invention is utilized to endow the plant with glufosinate resistance, and belongs to the protection scope of the invention.

In an alternative embodiment, the plant is subjected to mutagenesis in a physicochemical mutagenesis mode that is mutagenized to a non-lethal dose to obtain plant material.

The above-mentioned non-lethal dose means that the dose is controlled to be within a range of 20% floating above and below the semi-lethal dose.

Physicochemical mutagenesis modes include combinations of one or more of the following physical mutagenesis and chemical mutagenesis modes: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis includes alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; alkylating agent mutagenesis includes ethylcyclomate mutagenesis, diethylsulfate mutagenesis, and ethylenimine mutagenesis.

In a preferred embodiment of the invention, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous plants, pasture, tea or cassava;

in a preferred embodiment of the invention, the pasture is selected from gramineous pasture or leguminous pasture;

In a preferred embodiment of the invention, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage mustard, canola, mustard, engine blue, canola, green vegetables or beet;

in a preferred embodiment of the invention, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, bitter gourd, luffa, melon, watermelon or melon;

in a preferred embodiment of the invention, the leguminous plant is selected from mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans;

In a seventh aspect, the present invention also provides a method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of a plant of interest a gene encoding a plant glutamine synthetase mutant as described above.

In an alternative embodiment, the method of introduction is selected from the group consisting of genetic transformation methods, genome editing methods, or genetic mutation methods.

The above genetic transformation methods include, but are not limited to: individuals with glufosinate resistance are produced by selfing or crossing parent plants with genes of glufosinate resistant plant glutamine synthetase mutants with other plant individuals.

In other embodiments, the methods of transformation described above include, but are not limited to, agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel.

The invention has the following beneficial effects:

(1) The plant glutamine synthetase mutant provided by the invention enriches a plant glutamine synthetase mutant library, and provides powerful technical support for cultivating glufosinate-resistant plant varieties.

(2) The plant glutamine synthetase mutant is originally derived from plants, has glufosinate resistance after mutation, and plants transformed by the plant glutamine synthetase mutant not only have glufosinate resistance, but also can grow and develop normally.

(3) The plant glutamine synthetase mutant has good biological enzyme catalytic activity.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the results of partial alignment of amino acid sequences of rice GS1 mutants OG61P and OG61X and wild type rice GS1 OsGS1_WT provided in example 1 of the present invention;

FIG. 2 is a partial alignment of the amino acid sequences of maize GS1 mutants ZG61P and ZG61X and wild type maize GS1 ZmGS1_WT provided in example 2 of the present invention;

FIG. 3 is a partial alignment of amino acid sequences of soybean GS1 mutants GG61P and GG61X and wild type soybean GS1 GmGS1_WT provided in example 3 of the present invention;

FIG. 4 shows the amino acid sequence part alignment results of the canola GS1 mutants BG61P and BG61X and wild type canola GS1 BnGS1_WT provided in example 4 of the present invention;

FIG. 5 is a schematic diagram of the structure of pADV7 vector provided in Experimental example 1 of the present invention;

FIG. 6 shows the results of E.coli growth on medium containing glufosinate at different concentrations of the rice GS1 mutants OG61P and OG61X and wild-type rice GS1 OsGS1_WT provided in Experimental example 1 of the present invention; growth results of E.coli for maize GS1 mutants ZG61P and ZG61X and wild type maize GS1 ZmGS1_WT on medium containing varying concentrations of glufosinate; growth results of E.coli of soybean GS1 mutants GG61P and GG61X and wild soybean GS1 GmGS1_WT on medium containing glufosinate at different concentrations; growth results of E.coli of the rape GS1 mutants BG61P and BG61X and wild type rape GS1 BnGS1_WT on medium containing glufosinate of different concentrations;

FIG. 7 shows the enzyme kinetic parameters and glufosinate resistance parameters IC of the rice GS1 mutant OG61X, maize GS1 mutant ZG61X, soybean GS1 mutant GG61X, wild-type rice GS1 OsGS1_WT, wild-type maize GS1 ZmGS1_WT and wild-type soybean GS1 GmGS1_WT provided in Experimental example 2 of the present invention ₅₀ ；

FIG. 8 shows the amino acid sequence alignment of wild-type glutamine synthetase from different plants; in the figure: osGS1_WT: wild type rice glutamine synthetase; zmgs1_wt: corn wild type glutamine synthetase; gmgs1_wt: soybean wild type glutamine synthetase; bnGS1_WT: wild type rape glutamine synthetase.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the assays herein, some methods and materials are now described, unless otherwise indicated, the techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.

Unless otherwise indicated, practice of the present invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of one skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); plant physiology (pallidum et al, 2017); the methods are described in the following examples (methods of enzymology) (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M. Weir and C.C. Blackwell, inc.), contemporary molecular biology methods (Current Protocols in Molecular Biology) (F.M. Ausubel et al, 1987), plant molecular genetics (Monica A. Hughes et al), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The features and capabilities of the present invention are described in further detail below in connection with the examples.

Example 1

The rice (Oryza sativa) glutamine synthetase (GS 1) mutant provided in this example is obtained by mutating or deleting the 61 st amino acid residue G of a wild-type rice glutamine synthetase itself (named osgs1_wt, having an amino acid sequence shown in SEQ ID No.1, having a coding nucleotide sequence shown in SEQ ID No. 6), and the obtained rice GS1 mutant is named OG61P and OG61X, respectively, and the amino acid sequences of the rice GS1 mutants OG61P and OG61X and the wild-type rice GS1 are aligned as shown in fig. 1, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each rice GS1 mutant was at the position encoding amino acid 61, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

Amino acids	P	Deletion of
			Codons	CCG	Without any means for

The rice GS1 mutants OG61P and OG61X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 2

The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating 61 st (corresponding to 61 st of the reference sequence (SEQ ID NO. 1)) of wild-type corn GS1 itself (named ZmGS1_WT, the amino acid sequence of which is shown in SEQ ID NO.2, and the encoding nucleotide sequence of which is SEQ ID NO. 6) from amino acid residue G to P or deleting. The resulting maize GS1 mutants were designated ZG61P and ZG61X, respectively.

The amino acid sequence alignment of maize GS1 mutants ZG61P and ZG61X and wild-type maize GS1 is shown in figure 2, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each maize GS1 mutant was at the position encoding amino acid 61, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

Amino acids	Y	Deletion of
			Codons	CCT	Without any means for

The maize GS1 mutants ZG61P and ZG61X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 3

The soybean (Glycine max) GS1 mutant provided in this example was obtained by mutating the 61 st position (corresponding to the 61 st position of the reference sequence (SEQ ID NO. 1)) of wild-type soybean GS1 itself ((designated GmGS 1-WT, the amino acid sequence shown in SEQ ID NO.3, the encoding nucleotide sequence shown in SEQ ID NO. 7) with the amino acid residue G as P or deleting the same.

The amino acid sequence alignment of soybean GS1 mutants GG61P and GG61X and wild type soybean GS1 is shown in fig. 3, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each soybean GS1 mutant was at the position encoding amino acid 61, the codons for the corresponding amino acids were as shown in the following table, and the nucleotides at the remaining positions were identical to the corresponding wild-type coding sequence.

Amino acids	P	Deletion of
			Codons	CCT	Without any means for

The soybean GS1 mutants GG61P and GG61X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Example 4

The rape (Brassica napus) GS1 mutant provided in this example is obtained by mutating or deleting the 61 st (61 st corresponding to the reference sequence (SEQ ID NO. 1)) of the wild type rape GS1 itself (named BnGS 1-WT, the amino acid sequence of which is shown as SEQ ID NO.4, and the encoding nucleotide sequence of which is shown as SEQ ID NO. 8) from the amino acid residue G to P. The obtained canola GS1 mutants were designated BG61P and BG61X, respectively.

The amino acid sequence alignment of the rape GS1 mutants BG61P and BG61X and wild type rape GS1 is shown in FIG. 4, in which: the position indicated by the arrow is the mutation site.

In this example, the coding sequence of each canola GS1 mutant is at the position encoding amino acid 61, the codons for the corresponding amino acids are shown in the following table, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.

The rape GS1 mutants BG61P and BG61X and the nucleic acid molecules encoding them provided in this example can be obtained by chemical synthesis.

Experimental example 1

The experimental example performs a glufosinate resistance test.

The rice GS1 mutants OG61P and OG61X provided in example 1, maize GS1 mutants ZG61P and ZG61X provided in example 2, soybean GS1 mutants GG61P and GG61X provided in example 3, and canola GS1 mutants BG61P and BG61X provided in example 4 were tested for glufosinate resistance, respectively. The specific method comprises the following steps:

according to the sequences of the nucleic acid molecules provided in example 1, example 2, example 3 and example 4, coding genes encoding rice GS1 mutants OG61P and OG61X, corn GS1 mutants ZG61P and ZG61X, soybean GS1 mutants GG61P and GG61X and rape GS1 mutants BG61P and BG61X were synthesized by a chemical synthesis method, enzyme cleavage sites (PacI and SbfI) were introduced into both ends, and after enzyme cleavage, the gene was ligated to expression vectors (e.g., pADV7 vectors, the structures of which are shown in FIG. 5) subjected to the same enzyme cleavage treatment under the action of a ligase, and then glutamine synthetase-deficient E.coli, which was obtained by knocking out glutamine synthetase on the basis of E.coli DH 5. Alpha. By Tianyuxing biological technologies, inc., was transformed respectively. After verification, positive clones are selected, inoculated to M9 culture medium containing glufosinate with different concentrations for growth, and defective E.coli growth is observed.

Detecting glufosinate resistance with the wild-type rice GS1 mutant as a negative control, the glufosinate resistance comprising the GS1 mutant OG61P (G61P, amino acid G at position 61 of rice GS1 mutated to P) and OG61X (g61 Δ); using wild-type maize GS1 mutant as negative control, glufosinate resistance was detected containing GS1 mutants ZG61P (G61P, mutation of amino acid G at position 61 of maize GS1 to P) and ZG61X (g61 Δ); using wild-type soybean GS1 mutant as negative control, glufosinate resistance was detected containing GS1 mutant GG61P (G61P, amino acid G at position 61 of soybean GS1 was mutated to P) and GG61X (g61 Δ); the glufosinate resistance was examined with the wild-type canola GS1 mutant as negative control, containing the GS1 mutants BG61P (G61P, amino acid G at position 61 of canola GS1 was mutated to P) and BG61X (g61 Δ).

The results are shown in FIG. 6: on a culture medium containing 0mM glufosinate (KP 0), the defective strains of the coding genes of the wild type rice GS1 (OsGS 1_WT) and the rice GS1 mutants OG61P and OG61X can grow normally, the defective strains of the coding genes of the wild type corn GS1 (ZmGS1_WT) and the corn GS1 mutants ZG61P and ZG61X can grow normally, the defective strains of the coding genes of the wild type soybean GS1 (GmGS 1_WT) and the soybean GS1 mutants GG61P and GG61X can grow normally, the defective strains of the coding genes of the wild type rape GS1 (BnGS 1_BG) and the rape GS1 mutants 61P can grow normally, and the defective strains of the coding genes of the OG61P, OG61X, ZG61P, ZG61X, GG P, GG61X and the GS1 coded by the BG61P have normal GS1 enzyme activity;

Coli transformed with wild-type corn GS1, wild-type soybean GS1, wild-type canola GS1 could not grow on a medium containing 2mM glufosinate (KP 2), but the E.coli transformed with corn mutant ZG61P, ZG X, soybean mutant GG61P, GG X, canola mutant BG61P, BG X showed significantly better growth than the negative control, indicating that the single mutant containing ZG61P, ZG X showed significantly better resistance to glufosinate than the wild-type zmgs1_wt, the single mutant containing GG61P, GG61X showed significantly better resistance to glufosinate than the wild-type gmggs1_wt, and the single mutant containing BG61P, BG X showed significantly better resistance to glufosinate than the wild-type Bngs1_wt.

Coli transformed with wild-type rice GS1 could not grow on medium containing 5mM glufosinate (KP 5), but the growth of the escherichia coli transformed with rice mutant OG61P, OG X was significantly better than negative control, indicating that the resistance of the single mutant containing OG61P, OG61X to glufosinate was significantly better than that of wild-type osgs1_wt. The capacity of the escherichia coli transformed with the soybean mutant GG61X against glufosinate is obviously better than that of the escherichia coli transformed with the soybean mutant GG 61P. The capacity of the escherichia coli transformed with the rape mutant BG61X for resisting glufosinate is obviously better than that of the escherichia coli transformed with the rape mutant BG 61P.

Coli transformed with wild-type rice GS1 could not grow on medium containing 10mM glufosinate (KP 10), but the growth of the escherichia coli transformed with rice mutant OG61P, OG X was significantly better than negative control, indicating that the resistance of the single mutant containing OG61P, OG61X to glufosinate was significantly better than that of wild-type osgs1_wt. Coli transformed with wild-type corn GS1 failed to grow, but the E.coli transformed with corn mutant ZG61P, ZG61X grew significantly better than the negative control, indicating that the single mutant containing ZG61P, ZG61X was significantly better against glufosinate than the wild-type ZmGS1_WT.

These results demonstrate that single mutants of OG61P, OG61X, ZG61P, ZG61X, GG61P, GG61X, BG61P, BG61X all have resistance to glufosinate.

Experimental example 2

The enzyme kinetic parameters of OG61X provided in example 1, ZG61X provided in example 2, GG61X mutant provided in example 3 and enzyme kinetic parameters in the presence of glufosinate were tested against wild-type rice gs1 osgs1_wt, wild-type maize gs1 zmgs1_wt, wild-type soybean gs1 gmgs1_wt as follows:

1. and (3) constructing a carrier:

the nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the cloning is verified by sequencing.

2.6His protein purification:

the mutant enzyme protein was purified by 6His and the concentration was determined using the Bradford protein concentration determination kit using standard methods and the protein was stored in a protein stock solution.

3. Enzyme activity determination:

(1) Instrument and reagents: enzyme-labeled instrument (De-Fe: HBS-1096A), glufosinate, substrate L-sodium glutamate (CAS: 6106-04-3).

(2) Principle of measurement

Glutamine Synthetase (GS) is the first enzyme to convert inorganic nitrogen to organic nitrogen, catalyzes the binding of ammonia from different sources to glutamate to form glutamine, and liberates Pi, as shown in the following specific reaction scheme:

the invention adopts a phosphomolybdic blue method to measure GS enzyme activity, and the principle of the method is as follows: under suitable acidic conditions, phosphoric acid (Pi) reacts with ammonium molybdate to form ammonium phosphomolybdate, which in turn is reduced by reducing agents (e.g., vitamin C, stannous chloride, etc.) to blue phosphomolybdenum blue, the blue shade of which is proportional to the phosphorus content.

(2) The operation steps are as follows:

the reaction was carried out in a Tris-HCl buffer system at pH7.5 in a total reaction volume of 30uL. The glutamine synthetase enzyme activity determination reaction liquid comprises the following components: 200mM Tris-HCl (pH 7.5), 1.67mM ATP,30mM ammonium chloride, 20mM MgCl ₂ 10mM sodium L-glutamate. After 30ul of reaction solution is uniformly mixed, preheating is carried out for 5min at 35 ℃, mutant protein solution is added for reaction, after reaction is carried out for 30min at 35 ℃, 100 μl of color reaction D solution [ D=2A+B ] is added; and (3) solution A: 12% (W/V) ascorbic acid in 1mol/L hydrochloric acid solution, solution B: 2% (W/V) aqueous solution of ammonium molybdate tetrahydrate ]Color was developed, left to stand for 5 minutes, and 100. Mu.l of a reaction termination F solution (2% sodium citrate, 2% acetic acid aqueous solution) was added thereto, and left to stand for 15 minutes, 200. Mu.l of the light absorption value was measured at 660 nm.

The results are shown in FIG. 7. As can be seen from the results of fig. 7:

relative to the fieldThe Km values of the raw control OsGS1_WT, zmGS1_WT and GmGS1_WT were slightly higher than those of the GS1 mutant, which indicates that the GS mutant slightly reduces the sensitivity to a normal substrate (L-sodium glutamate) while reducing the sensitivity to a glufosinate inhibitor. V of GS1 mutant _max All were higher than the wild type control, indicating that these mutants had improved enzymatic ability. Wild type controls were sensitive to glufosinate, IC ₅₀ IC of the mutants at 0.006mM, 0.005mM, respectively ₅₀ IC's of OG61X, ZG61X, GG61X, all significantly higher than wild-type controls ₅₀ Far higher than the wild-type control, indicating that the mutant is less sensitive to glufosinate. From mutant IC ₅₀ And wild type IC ₅₀ As can also be seen in the multiple relationship of OG61X, ZG61X, GG X ₅₀ Corresponding to wild type GS1 IC ₅₀ These values also indicate that the enzyme activity of the mutants is much higher than that of the wild-type control, 1575-fold, 2124.167-fold, 1778-fold. These data illustrate the mechanism of mutant resistance to glufosinate by enzyme kinetics.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for obtaining a protein having glufosinate resistance comprising the steps of:

2) Comparing the amino acid sequence of the target protein with the reference sequence, and mutating the amino acid sequence of the target protein corresponding to the 61 st amino acid residue of the reference sequence to proline or deleting the proline;

3) Proteins with increased glufosinate resistance are selected.

2. A plant glutamine synthetase mutant having glufosinate resistance, wherein said plant glutamine synthetase mutant is represented by (1) or (2):

(1): it is obtained by mutating the n-th position of wild glutamine synthetase from plant; the position of the nth bit is determined as follows: the wild type glutamine synthetase is aligned with a reference sequence, and the nth position of the wild type glutamine synthetase corresponds to the 61 st position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;

The n-th amino acid of the plant glutamine synthetase mutant is proline or a deletion mutation compared with the wild type glutamine synthetase;

3. The plant glutamine synthetase mutant of claim 1, wherein said plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, crowndaisy, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, pasture, tea, or cassava;

preferably, the pasture is selected from gramineous pasture or leguminous pasture;

preferably, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage mustard, blue, canola, green vegetables or beet;

Preferably, the cucurbitaceae plant is selected from cucumber, pumpkin, white gourd, balsam pear, luffa, melon, watermelon or melon;

preferably, the leguminous plant is selected from mung beans, broad beans, peas, lentils, soybeans, kidney beans, cowpeas or green beans;

preferably, the plant is rice, maize, soybean or canola.

4. An isolated nucleic acid molecule encoding a plant glutamine synthetase mutant according to any one of claims 2-3.

5. A vector comprising the nucleic acid molecule of claim 4.

6. A recombinant bacterium or recombinant cell comprising the nucleic acid molecule of claim 4 or the vector of claim 5.

7. Use of a plant glutamine synthetase mutant according to any one of claims 2-3, a nucleic acid molecule according to claim 4, a vector according to claim 5 or a recombinant bacterium or recombinant cell according to claim 6 for breeding a plant variety having glufosinate resistance.

8. The use according to claim 7, characterized in that the use comprises any one of the following uses:

(1) Transforming a plant of interest with a vector comprising a gene encoding a mutant of said plant glutamine synthetase;

(2) Modifying an endogenous glutamine synthetase gene of a target plant by a gene editing method to code the plant glutamine synthetase mutant;

(3) Mutagenizing and screening plant cells, tissues, individuals or populations to encode said plant glutamine synthetase mutants;

preferably, the gene editing is selected from CRISPR/Cas9, TALEN technology or ZFN technology;

preferably, the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, pasture, tea or cassava;

preferably, the plant is rice, maize, soybean or canola.

9. A method of producing a glufosinate herbicide tolerant plant comprising introducing into the genome of a plant of interest a gene encoding a plant glutamine synthetase mutant of any one of claims 2-3.

10. The method of producing a glufosinate herbicide-tolerant plant of claim 9, wherein the plant is selected from the group consisting of wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, broccoli, tomato, eggplant, capsicum, leek, onion, leek, spinach, celery, amaranth, lettuce, garland chrysanthemum, daylily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, leguminous, pasture, tea, or cassava;

preferably, the plant is rice, maize, soybean or canola.