CN113604443A - Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety - Google Patents

Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety Download PDF

Info

Publication number
CN113604443A
CN113604443A CN202111083960.5A CN202111083960A CN113604443A CN 113604443 A CN113604443 A CN 113604443A CN 202111083960 A CN202111083960 A CN 202111083960A CN 113604443 A CN113604443 A CN 113604443A
Authority
CN
China
Prior art keywords
glutamine synthetase
plant
gly
mutant
ile
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111083960.5A
Other languages
Chinese (zh)
Other versions
CN113604443B (en
Inventor
陈容
侯青江
邓龙群
张震
胥南飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gevoto LLC
Original Assignee
Gevoto LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gevoto LLC filed Critical Gevoto LLC
Priority to CN202111083960.5A priority Critical patent/CN113604443B/en
Publication of CN113604443A publication Critical patent/CN113604443A/en
Priority to PCT/CN2022/113146 priority patent/WO2023040564A1/en
Application granted granted Critical
Publication of CN113604443B publication Critical patent/CN113604443B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277—Phosphinotricin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a glutamine synthetase mutant and application thereof in cultivating a plant variety resisting glufosinate-ammonium. The inventors have found that mutation at the n-th position of a wild-type glutamine synthetase to A, G, M, N, Q, S, T, V or deletion can result in a glutamine synthetase mutant that can confer glufosinate-ammonium resistance to glutamine synthetase suitable for commercial use. The glutamine synthetase mutant has application potential for constructing an expression vector for transforming plants and cultivating glufosinate-resistant crops.

Description

Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant varieties.
Background
Glufosinate ammonium (trade name Basta) is a glutamine synthetase (GS1) inhibitor developed by Bayer corporation, and its active ingredient is phosphinothricin (abbreviated as PPT) and is chemically named as (RS) -2-amino-4- (hydroxymethyl phosphinyl) ammonium butyrate. By inhibiting the activity of Glutamine Synthetase (GS), the synthesis of Glutamine in plants is hindered, the nitrogen metabolism in plants is disordered, the synthesis of substances such as protein and nucleotide is reduced, the photosynthesis is hindered, and the chlorophyll synthesis is reduced. Meanwhile, the content of ammonium ions in cells is increased, so that cell membranes are damaged, chloroplasts are disintegrated, and finally plants die.
At present, the plant for obtaining the glufosinate-resistant plants mainly enables target plants to express glufosinate-ammonium acetylase through a transgenic technology, and the glufosinate-ammonium acetylase can acetylate the glufosinate so as to be inactivated. However, before glufosinate comes into contact with glutamine synthetase, glufosinate-ammonium acetylase hardly inactivates glufosinate completely, and since many glutamine synthetase enzymes are distributed on cell membranes, part of the unactivated glufosinate can inhibit the activity of glutamine synthetase on the cell membranes, thereby interfering with nitrogen metabolism of plants. Therefore, when the glufosinate is applied to crops with bar gene and pat gene transfer, the glufosinate interferes with nitrogen metabolism of plants to different degrees, and normal growth and development of the plants are influenced. Although the sensitivity of transgenic plants to glufosinate can be reduced to some extent by overexpression of wild-type glutamine synthetase in plants, the tolerance to glufosinate is far from sufficient for commercial application.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a glutamine synthetase mutant and application thereof in cultivating a plant variety resistant to glufosinate so as to solve the technical problems.
The invention is realized by the following steps:
the invention provides a glutamine synthetase mutant, which has glufosinate resistance and is shown as the following (1) or (2):
(1): it is obtained by mutating the n-th amino acid of wild glutamine synthetase derived from plants; the position of the nth bit is determined as follows: comparing the wild type glutamine synthetase with a reference sequence, wherein the nth position of the wild type glutamine synthetase corresponds to the 69 th position of the reference sequence, and the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;
the amino acid at position n of the glutamine synthetase mutant is X, which comprises A, G, M, N, Q, S, T, V or deletion;
(2): the mutant has at least 85% identity to the glutamine synthetase mutant shown in (1), has the same amino acid as the glutamine synthetase mutant shown in (1) at the n-th position, and has glufosinate-ammonium resistance.
The inventor finds that the wild glutamine synthetase derived from plants is compared with a reference sequence, the amino acid site on the sequence, which corresponds to the 69 th site of the reference sequence, namely the nth site, is mutated into A, G, M, N, Q, S, T, V or deleted, and the obtained glutamine synthetase mutant has the glufosinate resistance and can keep the own biological enzyme catalytic activity, thereby meeting the normal nitrogen metabolism of plants and maintaining the normal growth and development of the plants.
The plant or recombinant bacteria for transforming the plant glutamine synthetase mutant provided by the invention can normally grow and develop in the presence of glufosinate-ammonium, the plant glutamine synthetase mutant is not only used for cultivating transgenic crops, but also can be used for cultivating glufosinate-ammonium-resistant non-transgenic plants or transgenic plants such as rice, tobacco, soybean, corn, wheat, rape, cotton, sorghum and the like, and has wide application prospect.
The above-mentioned reference sequence is a rice-derived wild-type glutamine synthetase.
Sequence alignment methods the Protein Blast alignment can be performed using the Blast website (https:// blast.ncbi.nlm.nih.gov/blast.cgi); similar results can be obtained using other sequence alignment methods or tools well known in the art.
It should be noted that the n-th position of the wild-type glutamine synthetase may also be69 th position (for example, corn, wheat, soybean, rape, etc.) in its own sequence, but may not be69 th position (for example, peanut corresponds to 70 th position), and the specific position of the n-th position is determined by the aforementioned sequence alignment, as long as the position corresponding to 69 th position of the reference sequence is the n-th position of the present invention, that is, the mutation position, after the alignment with the reference sequence.
All plants share homology with wild-type glutamine synthetases, and have essentially the same function and domain in plants. Therefore, the glutamine synthetase mutant obtained by the above mutation at position 69 of wild type glutamine synthetase of any plant origin has glufosinate resistance. Therefore, the glutamine synthetase mutants obtained by the above mutation of wild-type glutamine synthetase derived from any plant source fall within the scope of the present invention.
Furthermore, it is known and easily realized by those skilled in the art that the glutamine synthetase mutant obtained by further mutation has at least 85% (for example, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identity with the glutamine synthetase mutant shown in (1) while performing a simple operation such as amino acid substitution, deletion, or addition in a non-conserved region of the glutamine synthetase mutant shown in (1) and maintaining the amino acid at the n-th position after the mutation, and that the functions thereof, including the enzyme catalytic activity and the glufosinate-ammonium resistance, are equivalent to, slightly decreased, slightly increased, or greatly increased from those of the glutamine synthetase mutant shown in (1). Therefore, such glutamine synthetase enzymes should also fall within the scope of the present invention.
In a preferred embodiment of the invention, the plant includes, but is not limited to, wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, canola, sesame, peanut, sunflower, radish, carrot, cauliflower, tomato, eggplant, pepper, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, crowndaisy chrysanthemum, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbits, legumes, pasture grass, tea, or cassava.
In an alternative embodiment, the pasture includes, but is not limited to, grassy pasture or legume pasture. The grass of Gramineae is selected from timothy grass, Dactylis glomerata, Juniperus gramineus, Amylum Tritici testa, Festuca arundinacea, palm leaf, and Setaria viridis; the leguminous forage is selected from herba Medicaginis, herba Trifolii Pratentis, semen Trigonellae, nidus Vespae, and herba Evervae Cristatae. In addition, in other embodiments, the pasture grass may also be selected from turf grass.
In an alternative embodiment, the brassica vegetable includes, but is not limited to, turnip, cabbage, mustard, cabbage, moss, bitter mustard, bluish, canola, cabbage, or beet.
In an alternative embodiment, the cucurbitaceae plant includes, but is not limited to, cucumber, pumpkin, squash, white gourd, bitter gourd, luffa, snake gourd, watermelon, or melon.
In an alternative embodiment, the legume includes, but is not limited to, mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea, or green soy bean.
In the preferred embodiment of the present invention, the inventors also found that, in addition to mutation of the n-position to A, G, M, N, Q, S, T, V or deletion, mutation of the n-position to another amino acid can also make glutamine synthetase glufosinate-resistant for glutamine synthetase of different plant sources.
For example, in a preferred embodiment of the present invention, when the plant is rice, X is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or deleted.
When the plant is soybean, X is A, G, L, M, N, Q, S, T, V or deleted.
When the plant is maize, X is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or deleted.
When the plant is wheat, X is A, C, D, F, G, H, I, M, N, Q, R, S, T, V, Y or deleted.
When the plant is canola, X is A, C, D, F, G, H, I, K, L, M, N, Q, R, S, T, V, W, Y or deleted.
Alternatively, in some embodiments of the invention, when the plant is rice, the rice wild-type glutamine synthetase is SEQ ID No. 1:
MASLTDLVNLNLSDTTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGEPIPTNKRHNAAKIFSSPEVASEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCGIGADKSFGRDIVDSHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDQVWVARYILERITEIAGVVVSFDPKPIPGDWNGAGAHTNYSTKSMRNDGGYEIIKSAIEKLKLRHKEHISAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYIVTSMIAETTIIWKP。
alternatively, in some embodiments of the invention, when the plant is maize, the maize wild-type glutamine synthetase is SEQ ID No. 2:
MACLTDLVNLNLSDNTEKIIAEYIWIGGSGMDLRSKARTLSGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDCYTPAGEPIPTNKRYNAAKIFSSPEVAAEEPWYGIEQEYTLLQKDTNWPLGWPIGGFPGPQGPYYCGIGAEKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISSGDQVWVARYILERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKEGGYEVIKAAIEKLKLRHREHIAAYGEGNERRLTGRHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTIIWKP。
alternatively, in some embodiments of the invention, when the plant is soybean, the soybean wild-type glutamine synthetase is SEQ ID No. 3:
MSLLSDLINLNLSDTTEKVIAEYIWIGGSGMDLRSKARTLPGPVSDPSKLPKWNYDGSSTGQAPGEDSEVIIYPQAIFRDPFRRGNNILVICDTYTPAGEPIPTNKRHDAAKVFSHPDVVAEETWYGIEQEYTLLQKDIQWPLGWPVGGFPGPQGPYYCGVGADKAFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPSVGISAGDEVWAARYILERITEIAGVVVSFDPKPIQGDWNGAGAHTNYSTKSMRNDGGYEVIKTAIEKLGKRHKEHIAAYGEGNERRLTGRHETADINTFLWGVANRGASVRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIADTTILWKP。
alternatively, in some embodiments of the invention, when the plant is wheat, the wheat wild-type glutamine synthetase is SEQ ID No. 4:
MALLTDLLNLDLTDSTEKIIAEYIWIGGSGMDLRSKARTLPGPVTDPSKLPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRKGNNILVMCDCYTPAGVPIPTNKRYNAAKIFSNPDVAKEEPWYGIEQEYTLLQKDINWPLGWPVGGFPGPQGPYYCSIGADKSFGRDIVDSHYKACLFAGVNISGINGEVMPGQWEFQVGPTVGISAGDQVWVARYLLERITEIAGVVVTFDPKPIPGDWNGAGAHTNYSTESMRKDGGFKVIVDAVEKLKLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRETEQNGKGYFEDRRPASNMDPYVVTSMIAETTILWKP。
alternatively, in some embodiments of the invention, when the plant is oilseed rape, the oilseed rape wild-type glutamine synthetase is SEQ ID No. 5:
MSLLTDLVNLNLSETTDKIIAEYIWVGGSGMDMRSKARTLPGPVSDPSELPKWNYDGSSTGQAPGEDSEVILYPQAIFKDPFRRGNNILVMCDAYTPAGEPIPTNKRHAAAKVFSHPDVVAEVPWYGIEQEYTLLQKDVNWPLGWPIGGFPGPQGPYYCSVGADKSFGRDIVDAHYKACLYAGINISGINGEVMPGQWEFQVGPAVGISAGDEIWVARFILERITEIAGVVVSFDPKPIPGDWNGAGAHCNYSTKSMREDGGYEIIKKAIDKLGLRHKEHIAAYGEGNERRLTGHHETADINTFLWGVANRGASIRVGRDTEKEGKGYFEDRRPASNMDPYIVTSMIAETTILWKP。
the Similarity (Similarity) and Identity (Identity) of wild-type glutamine synthetases derived from a part of plants to each other are shown in the following table, and the results of the sequence alignment are shown in FIG. 13 and indicated by an arrow indicating amino acid 69.
Figure BDA0003264374910000031
The above comparison method of Similarity (Similarity) and Identity (Identity) is as follows: the amino acid sequence of a species is imported into the Blast website (https:// Blast. ncbi. nlm. nih. gov/Blast. cgi) for Protein Blast alignment, and the Similarity (Similarity) and Identity (Identity) of the species to other species to be aligned are found from the alignment.
The invention also provides an isolated nucleic acid molecule encoding the glutamine synthetase mutant.
In the case where the present invention provides the above amino acid sequence, a nucleic acid sequence encoding the above glutamine synthetase mutant can be easily obtained by those skilled in the art based on the degeneracy of codons. For example, a nucleic acid sequence encoding the above-described glutamine synthetase mutant can be obtained by making corresponding nucleotide mutations in a nucleic acid sequence encoding a wild-type glutamine synthetase. This is readily accomplished by those skilled in the art.
For example, the nucleic acid sequence encoding the wild-type glutamine synthetase of rice is SEQ ID No. 6:
atggcttctctcaccgatctcgtcaacctcaacctctccgacaccacggagaagatcatcgccgagtacatatggatcggtggatctggcatggatctcaggagcaaggctaggactctctccggccctgtgactgatcccagcaagctgcccaagtggaactacgatggctccagcaccggccaggcccccggcgaggacagtgaggtcatcctgtacccacaggctatcttcaaggacccattcaggaagggaaacaacatccttgtcatgtgcgattgctacacgccagccggagaaccgatccccaccaacaagaggcacaatgctgccaagatcttcagctcccctgaggttgcttctgaggagccctggtacggtattgagcaagagtacaccctcctccagaaggacatcaactggccccttggctggcctgttggtggcttccctggtcctcagggtccttactactgtggtatcggtgctgacaagtcttttgggcgtgatattgttgactcccactacaaggcttgcctctatgccggcatcaacatcagtggaatcaacggcgaggtcatgccaggacagtgggagttccaagttggcccgtctgtcggcatttctgccggtgatcaggtgtgggttgctcgctacattcttgagaggatcaccgagatcgccggagtcgtcgtctcatttgaccccaagcccatcccgggagactggaacggtgctggtgctcacaccaactacagcaccaagtcgatgaggaacgatggtggctacgagatcatcaagtccgccattgagaagctcaagctcaggcacaaggagcacatctccgcctacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacaccttcagctggggagttgccaaccgcggcgcctcggtccgcgtcggccgggagacggagcagaacggcaagggctacttcgaggatcgccggccggcgtccaacatggacccttacatcgtcacctccatgatcgccgagaccaccatcatctggaagccctga。
thus, on the basis of the sequence, the corresponding nucleotide mutation is carried out on the codon corresponding to the 69 th position of the coded amino acid sequence, and the rice glutamine synthetase mutant coded as above can be obtained.
The coding nucleic acid sequence of the corn wild type glutamine synthetase is SEQ ID NO. 7:
atggcctgcctcaccgacctcgtcaacctcaacctctcggacaacaccgagaagatcatcgcggaatacatatggatcggtggatctggcatggatctcaggagcaaagcaaggaccctctccggcccggtgaccgatcccagcaagctgcccaagtggaactacgacggctccagcacgggccaggcccccggcgaggacagcgaggtcatcctgtacccgcaggccatcttcaaggacccattcaggaggggcaacaacatccttgtgatgtgcgattgctacaccccagccggcgagccaatccccaccaacaagaggtacaacgccgccaagatcttcagcagccctgaggtcgccgccgaggagccgtggtatggtattgagcaggagtacaccctcctccagaaggacaccaactggccccttgggtggcccatcggtggcttccccggccctcagggtccttactactgtggaatcggcgccgaaaagtcgttcggccgcgacatcgtggacgcccactacaaggcctgcttgtatgcgggcatcaacatcagtggcatcaacggggaggtgatgccagggcagtgggagttccaagtcgggccttccgtgggtatatcttcaggcgaccaggtctgggtcgctcgctacattcttgagaggatcacggagatcgccggtgtggtggtgacgttcgacccgaagccgatcccgggcgactggaacggcgccggcgcgcacaccaactacagcacggagtcgatgaggaaggagggcgggtacgaggtgatcaaggcggccatcgagaagctgaagctgcggcacagggagcacatcgcggcatacggcgagggcaacgagcgccggctcaccggcaggcacgagaccgccgacatcaacacgttcagctggggcgtggccaaccgcggcgcgtcggtgcgcgtgggccgggagacggagcagaacggcaagggctacttcgaggaccgccgcccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcatctggaagccctga。
the encoding nucleic acid sequence of the soybean wild type glutamine synthetase is SEQ ID NO. 8:
atgtcgctgctctcagatctcatcaaccttaacctctcagacactactgagaaggtgatcgcagagtacatatggatcggtggatcaggaatggacctgaggagcaaagcaaggactctcccaggaccagttagcgacccttcaaagcttcccaagtggaactatgatggttccagcacaggccaagctcctggagaagacagtgaagtgattatatacccacaagccattttcagggatccattcagaaggggcaacaatatcttggttatctgtgatacttacactccagctggagaacccattcccactaacaagaggcacgatgctgccaaggttttcagccatcctgatgttgttgctgaagagacatggtatggtattgagcaggaatacaccttgttgcagaaagatatccaatggcctcttgggtggcctgttggtggtttccctggaccacagggtccatactactgtggtgttggcgctgacaaggcttttggccgtgacattgttgacgcacattacaaagcctgtctttatgctggcatcaacatcagtggaattaatggagaagtgatgcccggtcagtgggaattccaagttggaccttcagttggaatctcagctggtgacgaggtgtgggcagctcgttacatcttggagaggatcactgagattgctggtgtggtggtttcctttgatcccaagccaattcagggtgattggaatggtgctggtgctcacacaaactacagcactaagtccatgagaaatgatggtggctatgaagtgatcaaaaccgccattgagaagttggggaagagacacaaggagcacattgctgcttatggagaaggcaacgagcgtcgtttaacagggcgccacgaaaccgctgacatcaacaccttcttatggggagttgcaaaccgtggagcttcagttagggttgggagggacacagagaaagcagggaagggatattttgaggacagaaggccagcttctaacatggacccatatgtggttacttccatgattgcagacacaaccattctgtggaagccatga。
the encoding nucleic acid sequence of the wheat wild type glutamine synthetase is SEQ ID NO. 9:
atggcgctcctcaccgatctcctcaacctcgacctcaccgactccacggagaagatcatcgccgagtacatatggatcggcggatctggcatggatctcaggagcaaagccaggaccctccccggcccggtcaccgaccccagcaagctgcccaagtggaactacgacggctccagcaccggccaggcccccggcgaggacagcgaggtcatcctgtacccacaggccatcttcaaggacccgttcaggaagggcaacaacatccttgtcatgtgcgattgctacaccccagctggagtgccaatccccaccaacaagagatacaacgctgccaagatctttagcaaccctgatgttgccaaggaggagccatggtacggtatcgagcaggagtacaccctcctacagaaggacatcaactggcctctcggctggcctgttggtggattccctggtcctcagggtccttactactgtagtattggtgctgacaagtcgtttgggcgtgacatagttgactcccactacaaggcctgcctctttgccggcgtcaacatcagtggcatcaacggcgaggtcatgcccggacagtgggagttccaagttggcccgactgtcggcatctctgctggtgaccaagtgtgggttgctcgctaccttcttgagaggatcactgagatcgccggagttgtcgtcacatttgaccccaagcccatcccaggcgactggaacggtgctggtgctcacacaaactacagtaccgagtcgatgaggaaggacggcgggttcaaggtcatcgtggacgctgtcgagaagctcaagctgaagcacaaggagcacatcgccgcctacggcgagggcaacgagcgccgtctcaccggcaagcacgaaaccgccgacatcaacaccttcagctggggtgtcgcgaaccgtggcgcgtcggtgcgcgtgggacgggagacggagcagaacggcaagggctacttcgaggaccgccggccggcgtccaacatggacccctacgtggtcacctccatgatcgccgagaccaccatcctgtggaagccctga。
the encoding nucleic acid sequence of the rape wild type glutamine synthetase is SEQ ID NO. 10:
atgagtcttcttacagatctcgttaaccttaacctctcagagaccactgacaaaatcattgcggaatacatatgggttggaggttcaggaatggatatgagaagcaaagccaggactcttcctggaccagtgagtgacccttcggagctaccaaagtggaactatgatggctcaagcacaggccaagctcctggtgaagacagtgaagtcatcttataccctcaagccatattcaaagatcctttccgtagaggcaacaacattcttgtcatgtgcgatgcttacactccagcgggcgaaccgatcccaacaaacaaaagacacgctgcggctaaggtctttagccaccccgatgttgtagctgaagtgccatggtatggtattgagcaagagtatactttacttcagaaagatgtgaactggcctcttggttggcctattggcggcttccccggtcctcagggaccatactattgtagtgttggagcagataaatcttttggtagagacatcgttgatgctcactacaaggcctgcttatacgctggcatcaatattagtggcatcaacggagaagtcatgcctggtcagtgggagttccaagttggtccagctgttggtatctcggccggtgatgaaatttgggtcgcacgtttcattttggagaggatcacagagattgctggtgtggtggtatcttttgacccaaaaccgattcccggtgactggaatggtgctggtgctcactgcaactatagtaccaagtcaatgagggaagatggtggttacgagattattaagaaggcaatcgataaactgggactgagacacaaagaacacattgcagcttacggtgaaggcaatgagcgccgtctcacgggtcaccacgagactgctgacatcaacactttcctctggggtgttgcgaaccgtggagcatcaatccgtgtaggacgtgacacagagaaagaagggaaaggatactttgaggataggaggccagcttcgaacatggatccttacattgtgacttccatgattgcagagaccacaatcctctggaaaccttga。
the invention also provides a vector comprising the nucleic acid molecule described above.
The invention also provides a recombinant bacterium or a recombinant cell, which contains the nucleic acid molecule or the vector.
The recombinant bacteria can be selected from agrobacterium; the recombinant cell may be a competent cell.
The invention also provides application of the glutamine synthetase mutant, the nucleic acid molecule, the vector, the recombinant bacterium or the recombinant cell with the glufosinate-ammonium resistance in cultivation of plant varieties with the glufosinate-ammonium resistance.
In a preferred embodiment of the present invention, the application includes at least one of the following application modes:
delivering an isolated nucleic acid molecule into a plant cell of interest, the isolated nucleic acid molecule comprising a gene encoding a glutamine synthetase mutant;
transforming a target plant with a vector containing a coding gene encoding a glutamine synthetase mutant;
the recombinant bacterium or the recombinant cell is introduced into a target plant, and the recombinant bacterium or the recombinant cell contains a coding gene for coding a glutamine synthetase mutant.
The isolated nucleic acid molecule may be a plasmid or DNA fragment, and in alternative embodiments, the isolated nucleic acid molecule may be delivered to the plant cell of interest by particle gun methods.
Transformation methods include, but are not limited to, Agrobacterium-mediated gene transformation, particle gun transformation, pollen tube channel.
The recombinant bacteria or recombinant cells can be introduced into a target plant body by an infection mode.
In a preferred embodiment of the present invention, the application includes: an endogenous glutamine synthetase gene of a target plant is modified to encode a glutamine synthetase mutant.
Based on the glutamine synthetase mutants provided by the present invention, those skilled in the art can easily think that the target plant can be modified by the conventional transgenic technology in the field, gene editing technology (such as by zinc-finger endonucleases (ZFNs), transcription activator-like effector nucleases (TALENs) or CRISPR/Cas9), mutation breeding technology (such as chemical, radiation mutagenesis, etc.), etc. to have the gene encoding the glutamine synthetase mutant, thereby obtaining a new plant variety with glufosinate resistance and capable of normal growth and development. Therefore, any technique that can be used to confer glufosinate-resistance to plants using the glutamine synthetase mutant provided by the present invention is within the scope of the present invention.
In a preferred embodiment of the present invention, the application includes: plant cells, tissues, individuals or populations are mutagenized and screened to encode glutamine synthetase mutants.
In an alternative embodiment, the plant is mutagenized by physicochemical mutagenesis in a non-lethal dose to obtain plant material.
The non-lethal dose mentioned above refers to a dose controlled within a range of 20% of the semi-lethal dose.
The physical and chemical mutagenesis mode comprises one or more of the following physical mutagenesis and chemical mutagenesis modes in combination: physical mutagenesis includes ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, beta-ray mutagenesis, alpha-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, microgravity mutagenesis; chemical mutagenesis including alkylating agent mutagenesis, azide mutagenesis, base analog mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis, intercalating dye mutagenesis; alkylating agent mutagenesis includes ethyl methylcyclooate mutagenesis, diethyl sulfate mutagenesis, and ethyleneimine mutagenesis.
Plants include, but are not limited to, wheat, rice, barley, oats, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, oilseed rape, sesame, peanut, sunflower, radish, carrot, cauliflower, tomato, eggplant, capsicum, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, legumes, pasture grass, tea, or cassava.
In an alternative embodiment, the pasture includes, but is not limited to, grassy pasture or legume pasture.
In an alternative embodiment, brassica vegetables include, but are not limited to, turnips, bok choy, mustard, cabbage, moss, bitter mustard, bluish, brassica, broccoli, or sugar beet.
In an alternative embodiment, the cucurbitaceae plant includes, but is not limited to, cucumber, zucchini, pumpkin, wax gourd, balsam pear, towel gourd, snake gourd, watermelon, or melon.
In an alternative embodiment, the leguminous plant includes, but is not limited to, mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea or green soy bean.
The invention has the following beneficial effects:
the glutamine synthetase mutant provided by the invention has application potentials for constructing an expression vector for transforming plants and cultivating glufosinate-resistant crops. The glutamine synthetase mutant provided by the invention is originally derived from plants and is more easily accepted by consumers. The mutant has the glufosinate-ammonium resistance after mutation, and the plant for transforming the glutamine synthetase mutant not only has the glufosinate-ammonium resistance suitable for commercial application, but also can keep the normal enzyme catalytic activity of the glutamine synthetase and meet the normal growth and development of the plant.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 shows the partial alignment of the amino acid sequences of rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X provided in example 1 of the present invention and wild-type rice GS1 OWT;
FIG. 2 shows the partial alignment of the amino acid sequences of the soybean GS1 mutant GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X provided in example 2 of the present invention and the GWT of wild-type soybean GS 1;
FIG. 3 shows the results of partial alignment of amino acid sequences of maize GS1 mutants ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X and wild type maize GS1 ZWT;
FIG. 4 shows the partial alignment of the amino acid sequences of wheat GS1 mutant TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X provided in example 4 of the present invention with wild-type wheat GS1 TWT;
FIG. 5 shows the results of the partial alignment of the amino acid sequences of mutants BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69X of rape GS1 BWT of rape GS1 provided in example 5 of the present invention and wild type rape GS1 BWT;
FIG. 6 is a schematic structural diagram of pADV7 vector provided in Experimental example 1 of the present invention;
FIG. 7 shows the growth results of rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69 GS 69X provided in Experimental example 1 of the present invention and wild-type rice GS1 OWT-containing medium;
FIG. 8 shows the growth results of E.coli strains of the transformed soybean GS1 mutant GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X provided in Experimental example 2 of the present invention and the wild-type soybean GS1GWT on media containing glufosinate ammonium at different concentrations;
FIG. 9 shows the growth results of E.coli cells of corn GS1 mutant ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X provided in Experimental example 3 of the present invention and wild type corn GS1 ZWT on culture media containing glufosinate ammonium at different concentrations;
FIG. 10 shows the growth results of wheat GS1 mutant TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X provided in the transformation example 4 of the present invention and wild-type wheat GS1TWT E.coli in culture media containing glufosinate ammonium at different concentrations;
FIG. 11 shows the growth results of E.coli mutants of GS1 from Brassica campestris, BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69 GS 69X provided in Experimental example 5 of the present invention and wild-type Brassica campestris 1 BWT on culture media containing glufosinate ammonium of various concentrations;
FIG. 12 shows the examples 6 of the present invention including rice GS1 mutant OE69M, soybean GS1 mutant GE69M, corn GS1 mutant ZE69M, wheat GS1 mutant TE69M, rape GS1 mutant BE69M, wild-type rice GS1 OWT, wild-type soybean GS1GWT, wild-type corn GS1 ZWT, wild-type wheat GS1TWT, and wild-type oilGlufosinate resistance parameter IC of vegetable GS1 BWT50；
FIG. 13 shows the alignment of amino acid sequences of wild-type glutamine synthetases of different plants; in the figure: TWT: wild-type glutamine synthetase body of wheat; OWT: rice wild-type glutamine synthetase; ZWT: corn wild-type glutamine synthetase; GWT: soybean wild-type glutamine synthetase; BWT: rape wild-type glutamine synthetase.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the formulations or unit dosages herein, some are now described. Unless otherwise indicated, the techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not intended to be limiting.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are well explained in the literature, e.g. "molecular cloning: a Laboratory Manual, second edition (Sambrook et al, 1989); oligonucleotide Synthesis (oligo Synthesis) (eds. m.j. goal, 1984); plant physiology (Cangjing et al, 2017); methods in Enzymology (Methods in Enzymology), Academic Press Inc. (Academic Press, Inc.), "Handbook of Experimental Immunology" ("D.M.Weir and C.C.Black well)," Current Protocols in Molecular Biology "(F.M.Ausubel et al, 1987)," plant Molecular genetics "(Monica A.Hughes et al)," PCR: Polymerase Chain Reaction (PCR: The Polymer Chain Reaction) (Mullis et al, 1994), each of which is expressly incorporated herein by reference.
The features and properties of the present invention are described in further detail below with reference to examples.
In the present examples and experimental examples, deletion of X means deletion of the n-th amino acid of the wild-type glutamine synthetase, that is, deletion mutation.
Example 1
The rice (Oryza sativa) glutamine synthetase (GS1) mutant provided by the embodiment is obtained by mutating or deleting the 69 th amino acid residue E of wild rice glutamine synthetase (named as OWT, the amino acid sequence is shown as SEQ ID NO.1, and the coding nucleotide sequence is SEQ ID NO.6) to A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y, and the obtained rice GS1 mutant is named as OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE 69X.
The alignment of the amino acid sequences of rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X and wild-type rice GS1 OWT is shown in FIG. 1, wherein: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rice GS1 mutant is shown in the following table at the position of coding amino acid 69, the codon used for the corresponding amino acid is shown in the table, and the nucleotide at the other positions is the corresponding wild type coding sequence.
Figure BDA0003264374910000061
The rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X provided by the embodiment and nucleic acid molecules encoding the above can be obtained by chemical synthesis.
Example 2
The soybean (Glycine max) GS1 mutant provided in this example is obtained by mutating amino acid residue E to A, G, L, M, N, Q, S, T, V or deleting 69 th position (corresponding to 69 th position of reference sequence (SEQ ID No. 1)) of wild type soybean GS1 (named as GWT, amino acid sequence shown in SEQ ID No.3, and encoding nucleotide sequence SEQ ID No. 8). The resulting soybean GS1 mutants were designated GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V, and GE69X, respectively.
The amino acid sequence alignment of soybean GS1 mutant GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X and wild-type soybean GS1GWT is shown in figure 2, in which: the position indicated by the arrow is the mutation site.
The coding sequences of soybean GS1 mutants GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X provided in this example correspond to SEQ ID No. 3.
In this example, the coding sequence of each soybean GS1 mutant is shown in the following table at the position encoding amino acid 69, the codon for the corresponding amino acid is shown in the table, and the nucleotides at the other positions are the same as the corresponding wild-type coding sequence.
Amino acids A G L M N
Codons GCC GGT CTC ATG AAC
Amino acids Q S T V Deleting
Codons CAG TCC ACC GTT Is free of
The soybean GS1 mutant GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X provided by the embodiment and nucleic acid molecules for coding the mutants can be obtained by a chemical synthesis method.
Example 3
The corn (Zea mays) GS1 mutant provided in this example is obtained by mutating or deleting amino acid residue E to A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y from position 69 (position 69 corresponding to the reference sequence (SEQ ID No. 1)) of wild-type corn GS1 itself (named as ZWT, amino acid sequence shown in SEQ ID No.2, and encoding nucleotide sequence shown in SEQ ID No. 7). The resulting maize GS1 mutants were designated ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X, respectively.
The amino acid sequence alignment of maize GS1 mutant ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X and wild type maize GS1 ZWT is shown in figure 3: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each maize GS1 mutant is at the position encoding amino acid 69, the codon for the corresponding amino acid is shown in the table below, and the remaining nucleotides are identical to the corresponding wild-type coding sequence.
Figure BDA0003264374910000071
The maize GS1 mutants ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X provided in this example and the nucleic acid molecules encoding them can all be obtained by chemical synthesis.
Example 4
The wheat (Triticum aestivum) GS1 mutant provided by the embodiment is obtained by mutating or deleting the 69 th site (the 69 th site corresponding to the reference sequence (SEQ ID No. 1)) of the 69 th site (which is named as TWT, the amino acid sequence is shown as SEQ ID No.4 and the coding nucleotide sequence is SEQ ID No.9) of the wild type wheat GS1 by using the amino acid residue E to A, C, D, F, G, H, I, M, N, Q, R, S, T, V, Y. The obtained wheat GS1 mutants are named as TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X respectively.
The alignment of the amino acid sequences of wheat GS1 mutant TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X and wild-type wheat GS1TWT is shown in FIG. 4, wherein: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each wheat GS1 mutant is at the position encoding amino acid 69, the codon for the corresponding amino acid is shown in the table below, and the nucleotides at the remaining positions are identical to the corresponding wild-type coding sequence.
Figure BDA0003264374910000072
The wheat GS1 mutant TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X provided by the embodiment and nucleic acid molecules for encoding the same can be obtained by a chemical synthesis method.
Example 5
The rape (Brassica napus) GS1 mutant provided by the embodiment is obtained by mutating or deleting amino acid residue E from position 69 (corresponding to position 69 of a reference sequence (SEQ ID NO. 1)) of wild type rape GS1 (named as BWT, and the amino acid sequence is shown as SEQ ID NO.5 and the coding nucleotide sequence is SEQ ID NO.10) to A, C, D, F, G, H, I, K, L, M, N, Q, R, S, T, V, W, Y. The obtained rape GS1 mutants are named as BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69X respectively.
The amino acid sequence alignment of rape GS1 mutant BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69X and wild type rape GS1 BWT is shown in FIG. 5, in which: the position indicated by the arrow is the mutation site.
In this example, the coding sequence of each rape GS1 mutant is shown in the following table at the position of coding amino acid 69, the codon used for the corresponding amino acid is shown in the table, and the nucleotide at the other positions is the same as the corresponding wild type coding sequence.
Figure BDA0003264374910000081
The rape GS1 mutant BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69X provided in the embodiment and nucleic acid molecules for coding the same can BE obtained by a chemical synthesis method.
Experimental example 1
The resistance of rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X provided in example 1 to glufosinate was tested by the following method:
according to the sequence of the nucleic acid molecule provided in example 1, the coding genes encoding the GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X are synthesized by a chemical synthesis method, enzyme cutting sites (Pac1 and Sbf1) are introduced at both ends, after enzyme cutting, the coding genes are connected to an expression vector (such as pADV7 vector, the structure of which is shown in FIG. 6) subjected to the same enzyme cutting treatment, glutamine synthetase deficient type Escherichia coli is transformed respectively, after verification, a positive clone is taken out, inoculated to M9 culture medium containing glufosinate at different concentrations, and growth deficiency type Escherichia coli is observed. A wild-type rice GS1 mutant is used as a negative control, and the resistance of an ammonium phosphate-containing mutant GS1 OE69A (E69A, wherein the amino acid E at the 69 th position of the rice GS1 is mutated into A), OE69C (E69C), OE69D (E69D), OE69F (E69F), OE69G (E69G), OE69H (E69H), OE69I (E69I), OE69I (E3669I), OE69 3669 (E3669I), OE 3669I (E I) and a wild-type rice GS I Δ E Δ for the deletion of the amino acid E69, E I at the E I, wherein the amino acid E3669 is used as a herbicide. The results are shown in FIG. 7.
On a culture medium containing 0mM glufosinate ammonium (KP0), defective strains of coding genes of wild-type rice GS1(OWT) and rice GS1 mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N and OE69N can grow normally, indicating that the genes coded by OE69N, OE69 3669, OE69N, OE N and OE69N with normal enzyme activity;
coli transformed with wild type rice GS1 OWT could not grow on medium containing 10mM glufosinate ammonium (KP10), but escherichia coli transformed with rice mutant OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69Y were significantly better than negative controls, indicating that escherichia coli with OE69Y, OE69Y, OE 3669Y, OE69Y, OE 72 and OE Y were significantly better than wild type glufosinate ammonium; coli transformed with the rice GS1 mutant OE69A, OE69C, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69Q, OE69R, OE69S, OE69T, OE69Y and OE69X all grew significantly on medium with better glufosinate ammonium concentration (20mM, KP 20).
These results indicate that single mutants of OE69A, OE69C, OE69D, OE69F, OE69G, OE69H, OE69I, OE69K, OE69L, OE69M, OE69N, OE69P, OE69Q, OE69R, OE69S, OE69T, OE69V, OE69Y and OE69X all have resistance to glufosinate.
Experimental example 2
With reference to the detection method of experimental example 1, the glufosinate resistance of the soybean GS1 mutant GE69A (E69A, amino acid E at position 69 of soybean GS1 was mutated to a), GE69G (E69G), GE69L (E69L), GE69M (E69M), GE69N (E69N), GE69Q (E69Q), GE69S (E69S), GE69T (E69T), GE69V (E69V), and GE69X (E69 Δ, amino acid E deletion at position 69 of soybean GS1) provided in example 2 was verified. The results are shown in FIG. 8.
From the results of fig. 8, it can be seen that:
on a culture medium containing 0mM glufosinate ammonium (KP0), defective strains transformed with coding genes encoding wild-type soybean GS1(GWT) and soybean GS1 mutant GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X all grew normally, indicating that GS1 encoded by GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE 59669 69V and GE69X all have normal 1 enzyme activity;
coli transformed with wild-type soybean GS1 was substantially unable to grow on medium containing 1mM glufosinate (KP1), but coli transformed with soybean mutants GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X were significantly better than the negative control, indicating that single mutants containing GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X had significantly better glufosinate resistance than the wild-type; coli transformed with the soybean GS1 mutants GE69M and GE69T also showed significant growth on medium with higher glufosinate concentrations (10mM, KP 10).
These results indicate that the single mutants of GE69A, GE69G, GE69L, GE69M, GE69N, GE69Q, GE69S, GE69T, GE69V and GE69X all have resistance to glufosinate, and the soybean GS1 mutants, GE69M and GE69T, have stronger resistance to glufosinate.
Experimental example 3
Referring to the test method of experimental example 1, it was verified that the maize GS1 mutant ZE69A (E69A, amino acid E at position 69 of maize GS1 was mutated to a), ZE69C (E69C), ZE69D (E69D), ZE69F (E69F), ZE69G (E69G), ZE69H (E69H), ZE69I (E69I), ZE69K (E69K), ZE69K (E69K), ZE69 3669 (E3669), ZE 3669 (E K), zee 3669), zea 3669 (E3669), zea Δ 3669 resistant to amino acid E at positions Δ K, and amino acid E Δ 3669 of maize Δ 3669 provided in example 3 were deleted. The results are shown in FIG. 9.
From the results of fig. 9, it can be seen that:
transformation of defective strains encoding genes encoding wild type corn GS (ZWT) and corn GS mutants ZE69, ZE69 and ZE69 all grew normally on medium containing 0mM glufosinate ammonium (KP), indicating that the GS encoded by ZE69, ZE69 and ZE69 all had normal enzyme activity;
coli transformed with wild type maize GS1 ZWT did not grow on medium containing 2mM glufosinate ammonium (KP2), but escherichia coli transformed with maize mutants ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69Y were significantly better than the negative control, indicating that anti-zifosinate ammonium, ZE 3669, ZE Y, ZE 3669, ZE Y, ZE 3669, and ZE Y; coli transformed with maize GS1 mutants ZE69K, ZE69L, ZE69M, ZE69N, ZE69R, ZE69S, ZE69T all also showed significant growth on medium at higher glufosinate concentrations (20mM, KP 20).
These results demonstrate that the single mutants of ZE69A, ZE69C, ZE69D, ZE69F, ZE69G, ZE69H, ZE69I, ZE69K, ZE69L, ZE69M, ZE69N, ZE69P, ZE69Q, ZE69R, ZE69S, ZE69T, ZE69V, ZE69Y and ZE69X all have glufosinate resistance, and the corn GS1 mutant ZE 6369 69K, ZE69L, ZE69M 96, ZE69N, ZE69R, ZE69S, ZE69T has stronger glufosinate resistance.
Experimental example 4
With reference to the detection method of experimental example 1, the resistance of wheat GS1 mutant TE69A (E69A, where amino acid E at position 69 of wheat GS1 was mutated to a), TE69C (E69C), TE69D (E69D), TE69F (E69F), TE69G (E69G), TE69H (E69H), TE69I (E69I), TE69M (E69M), TE69N (E69N), TE69Q (E69Q), TE69R (E69R), TE69S (E69S), TE69T (E69T), TE69V (E69V), TE V (E V Δ), and glufosinate ammonium at position 69E of wheat GS V were detected by deletion) provided in example 4 was verified. The results are shown in FIG. 10.
From the results of fig. 10, it can be seen that:
on a culture medium containing 0mM glufosinate ammonium (KP0), defective strains of coding genes for wild-type wheat GS1(TWT) and wheat GS1 mutants TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X are transformed to grow normally, which indicates that GS 69I coded by TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE 3669I, TE 3669I, TE I and TE I have normal enzyme activity;
on a culture medium containing 1mM glufosinate ammonium (KP1), Escherichia coli transformed with wild-type wheat GS1TWT can not grow basically, but Escherichia coli transformed with wheat mutants TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X have obviously better growth than negative control, which shows that single mutants containing TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE 3669V and TE V have obviously better resistance to wild-type glufosinate ammonium; coli transformed with the wheat GS1 mutants TE69M, TE69N, TE69Q, TE69R, TE69S, TE69Y and TE69X all showed significant growth on medium with higher glufosinate concentration (20mM, KP 20).
These results indicate that single mutants of TE69A, TE69C, TE69D, TE69F, TE69G, TE69H, TE69I, TE69M, TE69N, TE69Q, TE69R, TE69S, TE69T, TE69V, TE69Y and TE69X all have resistance to glufosinate-ammonium.
Experimental example 5
With reference to the detection method of experimental example 1, it was verified that the mutant BE69A of rapeseed GS1 (E69A, amino acid E at position 69 of rapeseed GS1 was mutated to A), BE69C (E69C), BE69D (E69D), BE69F (E69F), BE69G (E69G), BE69H (E69H), BE69I (E69I), BE69K (E69K), BE69K (E K), BE69 3669K (E K) and BE 72 provided in example 5, the resistance of amino acid E Δ 3669 at the position was deleted. The results are shown in FIG. 11.
From the results of fig. 11, it can be seen that:
on a culture medium containing 0mM glufosinate ammonium (KP0), defective strains of coding genes encoding wild type rape GS1(BWT) and rape GS1 mutant BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N and BE69N can grow normally, indicating that the genes encoding BE69N, BE69 GS N, BE69N, BE 3669N, BE69N, BE 3669N, BE69 3669N, BE 3669N and BE N have normal enzyme activity;
coli transformed with wild type oilseed rape GS1 was substantially unable to grow on a medium containing 1mM glufosinate ammonium (KP1), but the ability of the E.coli transformed with oilseed rape mutants BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69Y was significantly better than that of the negative control, indicating that the ability of the E.coli transformed with BE69Y, BE69 3669Y, BE69 3669Y, BE69 3669Y and BE69Y was significantly better than that of the wild type glufosinate ammonium resistant mutants; coli transformed with the oilseed rape GS1 mutant BE69K also showed significant growth on medium with higher glufosinate concentrations (20mM, KP 20).
These results indicate that the single mutants of BE69A, BE69C, BE69D, BE69F, BE69G, BE69H, BE69I, BE69K, BE69L, BE69M, BE69N, BE69Q, BE69R, BE69S, BE69T, BE69V, BE69W, BE69Y and BE69X all have glufosinate resistance, and that the rape GS1 mutant BE 49369 69K has stronger glufosinate resistance.
Experimental example 6
The enzyme kinetic parameters of OE69M provided in example 1, GE69M provided in example 2, ZE69M provided in example 3, TE69M provided in example 4 and BE69M mutant provided in example 5 were examined in the presence of glufosinate, with wild-type rice GS1 OWT, wild-type soybean GS1GWT, wild-type corn GS1 ZWT, wild-type wheat 1TWT and wild-type rape GS1 BWT as controls, as follows:
vector construction:
the nucleic acid sequence encoding the mutant is cloned into a prokaryotic expression vector pET32a, and the clone is verified through sequencing.
6His protein purification:
the mutant enzyme protein was purified by 6His and by standard methods, and the concentration was determined by the Bradford method protein concentration determination kit, and the protein was stored in a protein stock solution.
And (3) enzyme activity determination:
1. instruments and reagents: microplate reader (DeFei: HBS-1096A), glufosinate-ammonium (Rier chemical Co., Ltd.), substrate L-sodium glutamate (CAS: 6106-04-3).
2. The method comprises the following operation steps:
the components of the reaction liquid for measuring the enzyme activity of the glutamine synthetase are as follows: 100mM Tris-HCl (pH7.5), 5mM ATP, 10mM sodium L-glutamate, 30mM hydroxyethylamine, 20mM MgCl2. Mixing 100 μ L reaction solution, preheating at 35 deg.C for 5min, adding 1 μ L mutant protein solution (protein concentration of 200ug/ml) to start reaction, reacting at 35 deg.C for 60min, adding 110 μ L reaction termination solution (55g/L FeCl)3·6H2O, 20g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid) and left to stand for 10 min. Centrifugation at 5000 Xg for 10min, and measurement of light absorption at 500nm using 200. mu.l.
The results are shown in FIG. 12.
From the results of fig. 12, it can be seen that:
wild type controls OWT, GWT, ZWT, TWT, BWT are sensitive to glufosinate-ammonium, IC50IC of mutants OE69M, GE69M, ZE69M, TE69M, BE69M at 7.93. mu.M, 13.55. mu.M, 8.92. mu.M, 7.22. mu.M and 1.53. mu.M, respectively50Both are much higher than the wild type control, indicating that the mutant is less sensitive to glufosinate-ammonium. From mutant IC50And wild type IC50It can also BE seen from the multiple relationship that the ICs of OE69M, GE69M, ZE69M, TE69M and BE69M50Respectively corresponding to wild type GS1 IC5033.45 times, 12.97 times, 64.25 times, 17.98 times and 165.23 times of the mutant, and the data show the anti-glufosinate mechanism of the mutant from the enzyme dynamics and also show that the activity of the glutamine synthetase of the mutant keeps a higher level.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Sichuan Yu Xing He Biotech Co., Ltd
<120> application of glutamine synthetase mutant in cultivating glufosinate-resistant plant variety
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 356
<212> PRT
<213> Artificial sequence
<400> 1
Met Ala Ser Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ser Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Ile Ile Lys Ser Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Lys Glu His Ile Ser Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 2
<211> 356
<212> PRT
<213> Artificial sequence
<400> 2
Met Ala Cys Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Asp Asn Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Ser Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Ser Pro Glu Val Ala Ala Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Thr Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Ile Gly Ala Glu Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ser Gly Asp Gln Val Trp Val Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Glu Gly Gly Tyr Glu Val Ile Lys Ala Ala Ile Glu Lys
260 265 270
Leu Lys Leu Arg His Arg Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Ile Trp Lys Pro
355
<210> 3
<211> 356
<212> PRT
<213> Artificial sequence
<400> 3
Met Ser Leu Leu Ser Asp Leu Ile Asn Leu Asn Leu Ser Asp Thr Thr
1 5 10 15
Glu Lys Val Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Ile Tyr Pro Gln Ala Ile Phe Arg Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Ile Cys Asp Thr Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Asp Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Glu Thr Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Gln Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Gly
145 150 155 160
Val Gly Ala Asp Lys Ala Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ser Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Val Trp Ala Ala Arg Tyr Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Gln
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Asn Asp Gly Gly Tyr Glu Val Ile Lys Thr Ala Ile Glu Lys
260 265 270
Leu Gly Lys Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Arg His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Ala Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Asp Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 4
<211> 356
<212> PRT
<213> Artificial sequence
<400> 4
Met Ala Leu Leu Thr Asp Leu Leu Asn Leu Asp Leu Thr Asp Ser Thr
1 5 10 15
Glu Lys Ile Ile Ala Glu Tyr Ile Trp Ile Gly Gly Ser Gly Met Asp
20 25 30
Leu Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Thr Asp Pro Ser
35 40 45
Lys Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Lys Gly Asn Asn Ile Leu Val Met Cys Asp Cys Tyr Thr
85 90 95
Pro Ala Gly Val Pro Ile Pro Thr Asn Lys Arg Tyr Asn Ala Ala Lys
100 105 110
Ile Phe Ser Asn Pro Asp Val Ala Lys Glu Glu Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Ile Asn Trp Pro Leu Gly
130 135 140
Trp Pro Val Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Ile Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ser His Tyr
165 170 175
Lys Ala Cys Leu Phe Ala Gly Val Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Thr Val Gly Ile
195 200 205
Ser Ala Gly Asp Gln Val Trp Val Ala Arg Tyr Leu Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Thr Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Thr Asn Tyr Ser Thr Glu Ser
245 250 255
Met Arg Lys Asp Gly Gly Phe Lys Val Ile Val Asp Ala Val Glu Lys
260 265 270
Leu Lys Leu Lys His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly Lys His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Ser Trp Gly Val Ala Asn Arg Gly Ala Ser Val Arg Val Gly Arg Glu
305 310 315 320
Thr Glu Gln Asn Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Val Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 5
<211> 356
<212> PRT
<213> Artificial sequence
<400> 5
Met Ser Leu Leu Thr Asp Leu Val Asn Leu Asn Leu Ser Glu Thr Thr
1 5 10 15
Asp Lys Ile Ile Ala Glu Tyr Ile Trp Val Gly Gly Ser Gly Met Asp
20 25 30
Met Arg Ser Lys Ala Arg Thr Leu Pro Gly Pro Val Ser Asp Pro Ser
35 40 45
Glu Leu Pro Lys Trp Asn Tyr Asp Gly Ser Ser Thr Gly Gln Ala Pro
50 55 60
Gly Glu Asp Ser Glu Val Ile Leu Tyr Pro Gln Ala Ile Phe Lys Asp
65 70 75 80
Pro Phe Arg Arg Gly Asn Asn Ile Leu Val Met Cys Asp Ala Tyr Thr
85 90 95
Pro Ala Gly Glu Pro Ile Pro Thr Asn Lys Arg His Ala Ala Ala Lys
100 105 110
Val Phe Ser His Pro Asp Val Val Ala Glu Val Pro Trp Tyr Gly Ile
115 120 125
Glu Gln Glu Tyr Thr Leu Leu Gln Lys Asp Val Asn Trp Pro Leu Gly
130 135 140
Trp Pro Ile Gly Gly Phe Pro Gly Pro Gln Gly Pro Tyr Tyr Cys Ser
145 150 155 160
Val Gly Ala Asp Lys Ser Phe Gly Arg Asp Ile Val Asp Ala His Tyr
165 170 175
Lys Ala Cys Leu Tyr Ala Gly Ile Asn Ile Ser Gly Ile Asn Gly Glu
180 185 190
Val Met Pro Gly Gln Trp Glu Phe Gln Val Gly Pro Ala Val Gly Ile
195 200 205
Ser Ala Gly Asp Glu Ile Trp Val Ala Arg Phe Ile Leu Glu Arg Ile
210 215 220
Thr Glu Ile Ala Gly Val Val Val Ser Phe Asp Pro Lys Pro Ile Pro
225 230 235 240
Gly Asp Trp Asn Gly Ala Gly Ala His Cys Asn Tyr Ser Thr Lys Ser
245 250 255
Met Arg Glu Asp Gly Gly Tyr Glu Ile Ile Lys Lys Ala Ile Asp Lys
260 265 270
Leu Gly Leu Arg His Lys Glu His Ile Ala Ala Tyr Gly Glu Gly Asn
275 280 285
Glu Arg Arg Leu Thr Gly His His Glu Thr Ala Asp Ile Asn Thr Phe
290 295 300
Leu Trp Gly Val Ala Asn Arg Gly Ala Ser Ile Arg Val Gly Arg Asp
305 310 315 320
Thr Glu Lys Glu Gly Lys Gly Tyr Phe Glu Asp Arg Arg Pro Ala Ser
325 330 335
Asn Met Asp Pro Tyr Ile Val Thr Ser Met Ile Ala Glu Thr Thr Ile
340 345 350
Leu Trp Lys Pro
355
<210> 6
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 6
atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120
tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180
ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240
ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300
ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360
tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420
tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480
atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540
tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600
caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660
cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720
ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780
ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840
atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960
acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020
tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 7
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 7
atggcctgcc tcaccgacct cgtcaacctc aacctctcgg acaacaccga gaagatcatc 60
gcggaataca tatggatcgg tggatctggc atggatctca ggagcaaagc aaggaccctc 120
tccggcccgg tgaccgatcc cagcaagctg cccaagtgga actacgacgg ctccagcacg 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cgcaggccat cttcaaggac 240
ccattcagga ggggcaacaa catccttgtg atgtgcgatt gctacacccc agccggcgag 300
ccaatcccca ccaacaagag gtacaacgcc gccaagatct tcagcagccc tgaggtcgcc 360
gccgaggagc cgtggtatgg tattgagcag gagtacaccc tcctccagaa ggacaccaac 420
tggccccttg ggtggcccat cggtggcttc cccggccctc agggtcctta ctactgtgga 480
atcggcgccg aaaagtcgtt cggccgcgac atcgtggacg cccactacaa ggcctgcttg 540
tatgcgggca tcaacatcag tggcatcaac ggggaggtga tgccagggca gtgggagttc 600
caagtcgggc cttccgtggg tatatcttca ggcgaccagg tctgggtcgc tcgctacatt 660
cttgagagga tcacggagat cgccggtgtg gtggtgacgt tcgacccgaa gccgatcccg 720
ggcgactgga acggcgccgg cgcgcacacc aactacagca cggagtcgat gaggaaggag 780
ggcgggtacg aggtgatcaa ggcggccatc gagaagctga agctgcggca cagggagcac 840
atcgcggcat acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacgt tcagctgggg cgtggccaac cgcggcgcgt cggtgcgcgt gggccgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccgcc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 8
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 8
atgtcgctgc tctcagatct catcaacctt aacctctcag acactactga gaaggtgatc 60
gcagagtaca tatggatcgg tggatcagga atggacctga ggagcaaagc aaggactctc 120
ccaggaccag ttagcgaccc ttcaaagctt cccaagtgga actatgatgg ttccagcaca 180
ggccaagctc ctggagaaga cagtgaagtg attatatacc cacaagccat tttcagggat 240
ccattcagaa ggggcaacaa tatcttggtt atctgtgata cttacactcc agctggagaa 300
cccattccca ctaacaagag gcacgatgct gccaaggttt tcagccatcc tgatgttgtt 360
gctgaagaga catggtatgg tattgagcag gaatacacct tgttgcagaa agatatccaa 420
tggcctcttg ggtggcctgt tggtggtttc cctggaccac agggtccata ctactgtggt 480
gttggcgctg acaaggcttt tggccgtgac attgttgacg cacattacaa agcctgtctt 540
tatgctggca tcaacatcag tggaattaat ggagaagtga tgcccggtca gtgggaattc 600
caagttggac cttcagttgg aatctcagct ggtgacgagg tgtgggcagc tcgttacatc 660
ttggagagga tcactgagat tgctggtgtg gtggtttcct ttgatcccaa gccaattcag 720
ggtgattgga atggtgctgg tgctcacaca aactacagca ctaagtccat gagaaatgat 780
ggtggctatg aagtgatcaa aaccgccatt gagaagttgg ggaagagaca caaggagcac 840
attgctgctt atggagaagg caacgagcgt cgtttaacag ggcgccacga aaccgctgac 900
atcaacacct tcttatgggg agttgcaaac cgtggagctt cagttagggt tgggagggac 960
acagagaaag cagggaaggg atattttgag gacagaaggc cagcttctaa catggaccca 1020
tatgtggtta cttccatgat tgcagacaca accattctgt ggaagccatg a 1071
<210> 9
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 9
atggcgctcc tcaccgatct cctcaacctc gacctcaccg actccacgga gaagatcatc 60
gccgagtaca tatggatcgg cggatctggc atggatctca ggagcaaagc caggaccctc 120
cccggcccgg tcaccgaccc cagcaagctg cccaagtgga actacgacgg ctccagcacc 180
ggccaggccc ccggcgagga cagcgaggtc atcctgtacc cacaggccat cttcaaggac 240
ccgttcagga agggcaacaa catccttgtc atgtgcgatt gctacacccc agctggagtg 300
ccaatcccca ccaacaagag atacaacgct gccaagatct ttagcaaccc tgatgttgcc 360
aaggaggagc catggtacgg tatcgagcag gagtacaccc tcctacagaa ggacatcaac 420
tggcctctcg gctggcctgt tggtggattc cctggtcctc agggtcctta ctactgtagt 480
attggtgctg acaagtcgtt tgggcgtgac atagttgact cccactacaa ggcctgcctc 540
tttgccggcg tcaacatcag tggcatcaac ggcgaggtca tgcccggaca gtgggagttc 600
caagttggcc cgactgtcgg catctctgct ggtgaccaag tgtgggttgc tcgctacctt 660
cttgagagga tcactgagat cgccggagtt gtcgtcacat ttgaccccaa gcccatccca 720
ggcgactgga acggtgctgg tgctcacaca aactacagta ccgagtcgat gaggaaggac 780
ggcgggttca aggtcatcgt ggacgctgtc gagaagctca agctgaagca caaggagcac 840
atcgccgcct acggcgaggg caacgagcgc cgtctcaccg gcaagcacga aaccgccgac 900
atcaacacct tcagctgggg tgtcgcgaac cgtggcgcgt cggtgcgcgt gggacgggag 960
acggagcaga acggcaaggg ctacttcgag gaccgccggc cggcgtccaa catggacccc 1020
tacgtggtca cctccatgat cgccgagacc accatcctgt ggaagccctg a 1071
<210> 10
<211> 1071
<212> DNA
<213> Artificial sequence
<400> 10
atgagtcttc ttacagatct cgttaacctt aacctctcag agaccactga caaaatcatt 60
gcggaataca tatgggttgg aggttcagga atggatatga gaagcaaagc caggactctt 120
cctggaccag tgagtgaccc ttcggagcta ccaaagtgga actatgatgg ctcaagcaca 180
ggccaagctc ctggtgaaga cagtgaagtc atcttatacc ctcaagccat attcaaagat 240
cctttccgta gaggcaacaa cattcttgtc atgtgcgatg cttacactcc agcgggcgaa 300
ccgatcccaa caaacaaaag acacgctgcg gctaaggtct ttagccaccc cgatgttgta 360
gctgaagtgc catggtatgg tattgagcaa gagtatactt tacttcagaa agatgtgaac 420
tggcctcttg gttggcctat tggcggcttc cccggtcctc agggaccata ctattgtagt 480
gttggagcag ataaatcttt tggtagagac atcgttgatg ctcactacaa ggcctgctta 540
tacgctggca tcaatattag tggcatcaac ggagaagtca tgcctggtca gtgggagttc 600
caagttggtc cagctgttgg tatctcggcc ggtgatgaaa tttgggtcgc acgtttcatt 660
ttggagagga tcacagagat tgctggtgtg gtggtatctt ttgacccaaa accgattccc 720
ggtgactgga atggtgctgg tgctcactgc aactatagta ccaagtcaat gagggaagat 780
ggtggttacg agattattaa gaaggcaatc gataaactgg gactgagaca caaagaacac 840
attgcagctt acggtgaagg caatgagcgc cgtctcacgg gtcaccacga gactgctgac 900
atcaacactt tcctctgggg tgttgcgaac cgtggagcat caatccgtgt aggacgtgac 960
acagagaaag aagggaaagg atactttgag gataggaggc cagcttcgaa catggatcct 1020
tacattgtga cttccatgat tgcagagacc acaatcctct ggaaaccttg a 1071

Claims (10)

1. A glutamine synthetase mutant having glufosinate-resistance, characterized in that it is represented by the following (1) or (2):
(1): it is obtained by mutating the n-th amino acid of wild glutamine synthetase derived from plants; the position of the nth bit is determined as follows: the wild-type glutamine synthetase is aligned with a reference sequence, the nth position of the wild-type glutamine synthetase corresponds to the 69 th position of the reference sequence, wherein the amino acid sequence of the reference sequence is shown as SEQ ID NO. 1;
the amino acid at position n of the glutamine synthetase mutant is X, which comprises A, G, M, N, Q, S, T, V or a deletion;
(2): the mutant has at least 85% identity to the glutamine synthetase mutant shown in (1), has the same amino acid as the glutamine synthetase mutant shown in (1) at the n-th position, and has glufosinate-ammonium resistance.
2. The glutamine synthetase mutant according to claim 1, characterized in that the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, rape, sesame, peanut, sunflower, radish, carrot, cauliflower, tomato, eggplant, pepper, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetable, cucurbitaceae, leguminous plant, pasture grass, tea or cassava;
preferably, the pasture is selected from grassy pasture or leguminous pasture;
preferably, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage, moss, bitter mustard, cabbage, brassica, green vegetables or beet;
preferably, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, balsam pear, towel gourd, snake melon, watermelon or melon;
preferably, the leguminous plant is selected from mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea or green soy bean.
3. The glutamine synthetase mutant according to claim 1 or 2, characterized in that, when the plant is rice, X is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or deleted;
when the plant is soybean, X is A, G, L, M, N, Q, S, T, V or deleted;
when the plant is maize, X is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or deleted;
when the plant is wheat, X is A, C, D, F, G, H, I, M, N, Q, R, S, T, V, Y or deleted;
when the plant is canola, X is A, C, D, F, G, H, I, K, L, M, N, Q, R, S, T, V, W, Y or deleted.
4. An isolated nucleic acid molecule encoding the glutamine synthetase mutant according to any of claims 1 to 3.
5. A vector comprising the nucleic acid molecule of claim 4.
6. A recombinant bacterium or a recombinant cell comprising the nucleic acid molecule according to claim 4 or the vector according to claim 5.
7. Use of the glutamine synthetase mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the vector according to claim 5 or the recombinant bacterium or recombinant cell according to claim 6 for breeding of a plant variety with glufosinate-ammonium resistance.
8. The use according to claim 7, characterized in that it comprises at least one of the following modes of application:
delivering an isolated nucleic acid molecule comprising a gene encoding said glutamine synthetase mutant into a plant cell of interest;
transforming a plant of interest with the vector, the vector containing a coding gene encoding the glutamine synthetase mutant;
and introducing the recombinant bacterium or the recombinant cell into a target plant, wherein the recombinant bacterium or the recombinant cell contains a coding gene for coding the glutamine synthetase mutant.
9. Use according to claim 7, characterized in that it comprises: modifying an endogenous glutamine synthetase gene of a plant of interest to encode the glutamine synthetase mutant.
10. Use according to claim 8 or 9, characterized in that it comprises: mutagenizing and screening a plant cell, tissue, individual or population to encode said glutamine synthetase mutant;
the plant is selected from wheat, rice, barley, oat, corn, sorghum, millet, buckwheat, millet, sweet potato, cotton, oilseed rape, sesame, peanut, sunflower, radish, carrot, cauliflower, tomato, eggplant, pepper, leek, welsh onion, leek, spinach, celery, amaranth, lettuce, garland chrysanthemum, day lily, grape, strawberry, sugarcane, tobacco, brassica vegetables, cucurbitaceae, legumes, pasture, tea, or cassava;
preferably, the pasture is selected from grassy pasture or leguminous pasture;
preferably, the brassica vegetable is selected from turnip, cabbage, mustard, cabbage, moss, bitter mustard, cabbage, brassica, green vegetables or beet;
preferably, the cucurbitaceae plant is selected from cucumber, pumpkin, wax gourd, balsam pear, towel gourd, snake melon, watermelon or melon;
preferably, the leguminous plant is selected from mung bean, broad bean, pea, lentil, soybean, kidney bean, cowpea or green soy bean;
preferably, the mutagenizing is a non-lethal dose of a physicochemical mutagenesis modality to mutagenize the plant.
CN202111083960.5A 2021-09-15 2021-09-15 Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety Active CN113604443B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111083960.5A CN113604443B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety
PCT/CN2022/113146 WO2023040564A1 (en) 2021-09-15 2022-08-17 Glutamine synthetase mutant and application thereof in breeding of glufosinate-ammonium-resistant plant varieties

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111083960.5A CN113604443B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety

Publications (2)

Publication Number Publication Date
CN113604443A true CN113604443A (en) 2021-11-05
CN113604443B CN113604443B (en) 2024-04-26

Family

ID=78343036

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111083960.5A Active CN113604443B (en) 2021-09-15 2021-09-15 Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety

Country Status (2)

Country Link
CN (1) CN113604443B (en)
WO (1) WO2023040564A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113073088A (en) * 2021-03-31 2021-07-06 四川天豫兴禾生物科技有限公司 HIR mutant with triketone herbicide resistance and application thereof in plant breeding
CN113564184A (en) * 2021-07-16 2021-10-29 昆明理工大学 Gastrodia elata glutamine synthetase gene and application thereof
CN114058600A (en) * 2021-11-16 2022-02-18 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN114774375A (en) * 2022-04-25 2022-07-22 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate-ammonium resistance and glutamine synthetase mutant
CN114807064A (en) * 2022-06-06 2022-07-29 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate-ammonium resistance and mutant thereof
WO2023040564A1 (en) * 2021-09-15 2023-03-23 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof in breeding of glufosinate-ammonium-resistant plant varieties
CN116970577A (en) * 2023-09-20 2023-10-31 中国科学院遗传与发育生物学研究所 Glutamine synthetase mutant and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111635892A (en) * 2020-06-29 2020-09-08 合肥戬谷生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
WO2021000870A1 (en) * 2019-07-01 2021-01-07 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant having glufosinate ammonium resistance and application thereof and cultivation method therefor
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103757033B (en) * 2013-12-25 2015-08-19 上海市农业科学院 A kind ofly improve paddy rice glutamine synthetase mutator gene of plant plait ammonium phosphine resistance and its preparation method and application
CN113604443B (en) * 2021-09-15 2024-04-26 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof in cultivation of glufosinate-resistant plant variety

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021000870A1 (en) * 2019-07-01 2021-01-07 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant having glufosinate ammonium resistance and application thereof and cultivation method therefor
CN111635892A (en) * 2020-06-29 2020-09-08 合肥戬谷生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN112574967A (en) * 2020-12-31 2021-03-30 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance from plant, nucleic acid molecule and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
TOSAPON PORNPROM 等: "Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections", 《PEST MANAG SCI》 *
WILSON V AVILA-GARCIA 等: "Target-site mutation associated with glufosinate resistance in Italian ryegrass (Lolium perenne L. ssp. multiflorum)", 《PEST MANAG SCI》 *
任艳 等人: "水稻草铵膦耐性突变体的筛选及其耐性机制", 《生物学杂志》 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113073088A (en) * 2021-03-31 2021-07-06 四川天豫兴禾生物科技有限公司 HIR mutant with triketone herbicide resistance and application thereof in plant breeding
CN113564184A (en) * 2021-07-16 2021-10-29 昆明理工大学 Gastrodia elata glutamine synthetase gene and application thereof
CN113564184B (en) * 2021-07-16 2023-04-18 昆明理工大学 Gastrodia elata glutamine synthetase gene and application thereof
WO2023040564A1 (en) * 2021-09-15 2023-03-23 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant and application thereof in breeding of glufosinate-ammonium-resistant plant varieties
WO2023087812A1 (en) * 2021-11-16 2023-05-25 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant having glufosinate-ammonium resistance and application thereof
CN114058600A (en) * 2021-11-16 2022-02-18 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof
CN114058600B (en) * 2021-11-16 2023-12-08 四川天豫兴禾生物科技有限公司 Glutamine synthetase mutant with glufosinate resistance and application thereof
CN114774375A (en) * 2022-04-25 2022-07-22 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate-ammonium resistance and glutamine synthetase mutant
WO2023207669A1 (en) * 2022-04-25 2023-11-02 四川天豫兴禾生物科技有限公司 Method for acquiring protein with glufosinate resistance and glutamine synthetase mutant
CN114774375B (en) * 2022-04-25 2024-04-19 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate resistance and glutamine synthetase mutant
CN114807064A (en) * 2022-06-06 2022-07-29 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate-ammonium resistance and mutant thereof
CN114807064B (en) * 2022-06-06 2024-04-19 四川天豫兴禾生物科技有限公司 Method for obtaining protein with glufosinate resistance and mutant thereof
CN116970577A (en) * 2023-09-20 2023-10-31 中国科学院遗传与发育生物学研究所 Glutamine synthetase mutant and application thereof
CN116970577B (en) * 2023-09-20 2023-12-29 中国科学院遗传与发育生物学研究所 Glutamine synthetase mutant and application thereof

Also Published As

Publication number Publication date
CN113604443B (en) 2024-04-26
WO2023040564A1 (en) 2023-03-23

Similar Documents

Publication Publication Date Title
CN113604443A (en) Glutamine synthetase mutant and application thereof in cultivating glufosinate-resistant plant variety
CN112574967B (en) Glutamine synthetase mutant with glufosinate resistance of plant origin, nucleic acid molecule and application
CN110229794B (en) Glutamine synthetase mutant with glufosinate-ammonium resistance and application and cultivation method thereof
US6483011B1 (en) Modified ADP-glucose pyrophosphorylase for improvement and optimization of plant phenotypes
EP2465340B1 (en) EPSPS mutants
WO2023040565A1 (en) Glutamine synthetase mutant having glufosinate-ammonium resistance, nucleic acid molecule and use
US20030097692A1 (en) Plants with imidazolinone-resistant ALS
WO2023207669A1 (en) Method for acquiring protein with glufosinate resistance and glutamine synthetase mutant
CN114058600B (en) Glutamine synthetase mutant with glufosinate resistance and application thereof
WO2023071438A1 (en) Glutamine synthetase mutant and application
CN114107234B (en) Glutamine synthetase mutant with glufosinate resistance, recombinant gene, recombinant vector and application thereof
CN102775484B (en) Gene improving cadmium tolerance of plant and application thereof
US10590397B2 (en) Mutant UDP-glycosyltransferase variants of Os79 or homologs thereof for T-2 toxin inactivation
Ives et al. Life on the Salvage Path: The Deoxynucleoside Kinases of Lactobacillus acidophilus R-26
CN114807064B (en) Method for obtaining protein with glufosinate resistance and mutant thereof
Ren et al. Overexpression of a modified AM79 aroA gene in transgenic maize confers high tolerance to glyphosate
CN117363633A (en) Nucleic acid molecule, vector, recombinant bacterium, GS mutant and application thereof
CN116875568A (en) G61 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
CN116769739A (en) G294 mutation-containing plant glutamine synthetase mutant and encoding gene and application thereof
US9650616B2 (en) Methods for increasing grain yield
Zhu et al. Identification and characterization of a phosphinothricin N-acetyltransferase from Enterobacter LSJC7
CN111197052B (en) Cold-adapted I-type 5-enol pyruvoyl shikimic acid-3-phosphate synthase gene
CN109554357A (en) One kind containing A138X1And L195X2The plant EPSPS mutant and its encoding gene of mutation and application
US20230127011A1 (en) Methods and compositions for herbicide tolerance in plants
Salmanian et al. Site-directed mutagenesis, expression and biological activity of E. coli 5-enolpyruvylshikimate 3-phosphate synthase gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant