CN116970577B

CN116970577B - Glutamine synthetase mutant and application thereof

Info

Publication number: CN116970577B
Application number: CN202311219706.2A
Authority: CN
Inventors: 马宇欣; 李轲; 王炜光; 钱文峰
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2023-09-20
Filing date: 2023-09-20
Publication date: 2023-12-29
Anticipated expiration: 2043-09-20
Also published as: CN116970577A

Abstract

The invention relates to the field of plant genetic engineering. In particular, the present invention relates to glutamine synthetase mutants capable of conferring herbicide resistance in plants and uses thereof, and methods of producing herbicide resistant plants comprising said Glutamine Synthetase (GS) mutants.

Description

Glutamine synthetase mutant and application thereof

Technical Field

Background

Weed damage is an important stress factor that severely affects crop growth, limiting crop growth and development by competing with the crop for survival resources. Meanwhile, weeds are shelters for pathogens and pests, which cause frequent diseases and pests on crops, and further directly affect the yield and quality of the crops. In this case, how to effectively manage and control weeds becomes an important issue to be solved in scientific research and practical production.

The herbicide has the characteristics of broad spectrum, high efficiency, convenience in operation and the like, and has become a weeding means widely applied at present.

Glufosinate (Glufosinate ammonium), also known as glufosinate, is a broad-spectrum, quick-acting, low-toxicity and environmentally-compatible non-selective herbicide, and has a broad application prospect. Glufosinate interferes with normal growth of plants by inhibiting the activity of a key enzyme in the plant ammonium assimilation process, glutamine synthetase (Glutamine synthetase, GS), ultimately leading to death of the plants, thereby achieving herbicidal effects. However, since most common cultivated crops are not glufosinate resistant, the use of glufosinate herbicides often miskills the crop. Therefore, cultivation of glufosinate-ammonium resistant crops has important significance for guaranteeing the grain yield and quality of China and promoting the development of modern agriculture of China.

In the field, crop glutamine synthetase is modified from the directed evolution angle to obtain crops with resistance to herbicides such as glufosinate-ammonium and the like taking glufosinate-ammonium as active ingredients.

Disclosure of Invention

The present invention provides at least the following items:

item 1. A Glutamine Synthetase (GS) mutant or functional fragment thereof having an amino acid mutation, such as an amino acid substitution, at position 309 relative to a wild-type Glutamine Synthetase (GS), said amino acid position being referred to as SEQ ID NO. 1.

The glutamine synthetase mutant of item 1 or a functional fragment thereof, wherein said wild-type glutamine synthetase comprises an amino acid sequence of one of SEQ ID NO 1, 5, 9, 13, 33-42 or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to an amino acid sequence of one of SEQ ID NO 1, 5, 9, 13, 33-42.

Item 3. The glutamine synthetase mutant of item 1 or 2, or a functional fragment thereof, wherein said glutamine synthetase mutant or functional fragment thereof has been substituted with alanine (A) at position 309 relative to a wild-type glutamine synthetase, said amino acid position being referred to SEQ ID NO. 1.

Item 4. The glutamine synthetase mutant of item 3 or a functional fragment thereof, wherein the glutamine synthetase mutant or functional fragment thereof has alanine (A) at position 309 replaced with aspartic acid (D), threonine (T) or valine (V) relative to a wild-type glutamine synthetase, said amino acid position being referred to SEQ ID NO. 1.

Item 5. The glutamine synthetase mutant of item 3 or a functional fragment thereof, wherein said glutamine synthetase mutant or functional fragment thereof comprises at least an amino acid substitution A309D, A T or A309V relative to a wild type glutamine synthetase, said amino acid position being referred to SEQ ID NO. 1.

The glutamine synthetase mutant of any one of items 1-5, or a functional fragment thereof, wherein the glutamine synthetase mutant comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to any one of SEQ ID NO 2-4, 6-8, 10-12, and 14-16, or the glutamine synthetase mutant comprises an amino acid sequence as set forth in any one of SEQ ID NO 2-4, 6-8, 10-12, and 14-16.

Item 7 the glutamine synthetase mutant or functional fragment thereof of any one of items 1-6, wherein said glutamine synthetase mutant or functional fragment thereof is capable of conferring resistance to a herbicide, e.g., a glutamine synthetase inhibiting herbicide, to a eukaryotic organism, e.g., a yeast or plant, when expressed in said eukaryotic organism, e.g., a yeast or plant, preferably said glutamine synthetase inhibiting herbicide is glufosinate.

Item 8. A nucleic acid comprising a nucleotide sequence encoding the glutamine synthetase mutant of any one of items 1 to 7 or a functional fragment thereof.

The nucleic acid of item 9, wherein the nucleotide sequence encoding the glutamine synthetase mutant or a functional fragment thereof is shown in any one of SEQ ID NO. 18-20, 22-24, 26-28, 30-32.

Item 10. An expression cassette comprising a nucleotide sequence encoding the mutant glutamine synthetase of any one of items 1 to 7 or a functional fragment thereof operably linked to a regulatory sequence.

The expression cassette of item 11. Item 10, wherein the nucleotide sequence encoding the glutamine synthetase mutant or a functional fragment thereof is as shown in any one of SEQ ID NO:18-20, 22-24, 26-28, 30-32.

Item 12. An expression construct comprising the expression cassette of item 10 or 11.

Use of the glutamine synthetase mutant of any one of items 1-7 or a functional fragment thereof, the nucleic acid of item 8 or 9, the expression cassette of item 10 or 11 or the expression construct of item 12 in the production of a herbicide resistant plant.

The use of item 14, item 13, wherein the plant is selected from the group consisting of rice (Oryza sativa), wheat (Triticum aestivum), brachypodium distachyon (Brachypodium distachyon), corn (Zea mays), oryza sativa var granola, wild rice (Oryza barthii), oryza sativa (Oryza glabra), panice halima, millet (Panicum miliaceum), millet (Setaria algorithm), sorghum (Sorghum bicolor), false rice (rice perrie), uralensis wheat (Triticum uronium), barley (Hordeum vulgare).

Item 15. A herbicide resistant plant comprising or expressing the glutamine synthetase mutant of any one of items 1-7 or a functional fragment thereof.

The herbicide resistant plant of item 16, item 15, wherein the plant is selected from the group consisting of rice (Oryza sativa), wheat (Triticum aestivum), brachypodium distachyon (Brachypodium distachyon), corn (Zea mays), verruca verrucosa (Oryza maytana var. Granola), wild rice (Oryza barthii), oryza sativa (Oryza glaberrima), panicum halima, millet (Panicum miliaceum), millet (Setaria sativa), sorghum (Sorghum bicolor), false rice (leaved perrie), uralensis wheat (Triticum urin), barley (Hordeum vulgare).

Item 17. A method of producing a herbicide resistant plant by transgenesis comprising introducing the nucleic acid of item 8 or 9, the expression cassette of item 10 or 11 and/or the expression construct of item 12 into a plant, preferably, said introducing results in the plant comprising or expressing the glutamine synthetase mutant of any one of items 1-7 or a functional fragment thereof.

Item 18. A method of producing a herbicide resistant plant, the method comprising modifying (e.g., targeting) the endogenous glutamine synthetase coding sequence of a plant, thereby causing an amino acid mutation, such as an amino acid substitution, at position 309 of the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase), said amino acid position being referred to as SEQ ID NO. 1.

The method of item 19, item 18, wherein the plant's endogenous glutamine synthetase comprises, for example, an amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42 or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to an amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42.

The method of item 20, item 18 or 19, wherein the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) being substituted with alanine (a) at position 309, the amino acid position being referenced to SEQ ID No. 1.

The method of item 21, item 20, wherein the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) having an alanine (a) at position 309 substituted with an aspartic acid (D), threonine (T), or valine (V), the amino acid position referred to SEQ ID No. 1.

The method of item 20 or 21, wherein the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) comprising an amino acid substitution a309D, A T or a309V, said amino acid position being referenced to SEQ ID No. 1.

The method of any one of items 18-22, wherein the modification results in the glutamine synthetase mutant of any one of items 1-7, e.g., results in the plant expressing the glutamine synthetase mutant of any one of items 1-7.

The method of any one of items 18-23, wherein the endogenous glutamine synthetase coding sequence of the modified plant is targeted by homologous recombination or gene editing.

The method of item 25, wherein said gene editing comprises introducing into the plant a gene editing system that targets an endogenous glutamine synthetase coding region in the genome of said plant.

The method of item 25, wherein the gene editing system is a CRISPR, ZFN, or TALEN-based gene editing system, preferably the gene editing system is a CRISPR-based gene editing system.

The method of item 27, item 25 or 26, wherein the gene editing system is a base editing system or a guided editing (priority) system.

A method of producing a herbicide resistant plant comprising subjecting a population of said plants to physical or chemical mutagenesis and selecting from the mutagenized plants a plant comprising an endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) comprising an amino acid mutation, such as an amino acid substitution, at least at position 309, wherein said amino acid position is referred to SEQ ID No. 1.

The method of item 29, item 28, wherein plants are screened for substitution of alanine (A) at position 309 with an endogenous glutamine synthetase (e.g., an expressed endogenous glutamine synthetase), the amino acid position being referred to as SEQ ID NO. 1.

The method of item 30, item 29, wherein plants are selected in which an endogenous glutamine synthetase (e.g., an expressed endogenous glutamine synthetase) has alanine (A) at position 309 replaced with aspartic acid (D), threonine (T), or valine (V), the amino acid position referred to as SEQ ID NO:1.

The method of any one of items 28-30, wherein the plant is selected for a mutation of an endogenous glutamine synthetase (e.g., an expressed endogenous glutamine synthetase) to a glutamine synthetase mutant of any one of items 1-7.

Item 32A method of identifying a herbicide resistant plant comprising detecting in the plant

i) Glutamine synthetase having an aspartic acid (D), threonine (T), or valine (V) amino acid at position 309, said amino acid position being referred to as SEQ ID No. 1, or a functional fragment thereof; or (b)

ii) the presence and/or expression of a nucleotide sequence encoding a glutamine synthetase or a functional fragment thereof having an aspartic acid (D), threonine (T) or valine (V) at amino acid position 309, said amino acid position being referred to in SEQ ID NO 1,

Wherein the presence or increased amount of said glutamine synthetase or the presence and/or increased expression of said nucleotide sequence indicates that said plant has resistance to a glutamine synthetase inhibiting herbicide and/or increased resistance to a glutamine synthetase inhibiting herbicide, in particular relative to a plant that does not comprise said glutamine synthetase or a coding nucleotide sequence.

The method of item 33, item 32, wherein the glutamine synthetase comprises an amino acid sequence set forth in any one of SEQ ID NOs 2-4, 6-8, 10-12, and 14-16 or comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to any one of SEQ ID NOs 2-4, 6-8, 10-12, and 14-16; or the coding nucleotide sequence of the amino acid amide synthetase mutant or the functional fragment thereof is shown as any one of SEQ ID NO 18-20, 22-24, 26-28 and 30-32.

Item 34. A plant breeding method comprising crossing the herbicide resistant plant of item 15 or 16 or the first herbicide resistant plant obtained by the method of any one of items 17-32 with a second plant that does not contain the herbicide resistance, thereby introducing the herbicide resistance into the second plant.

The method of any one of items 17-34, wherein the plant is selected from the group consisting of rice (Oryza sativa), wheat (Triticum aestivum), brachypodium distachyon (Brachypodium distachyon), corn (Zea mays), verruca verrucosa (Oryza meyeriana var. Granola), wild rice (Oryza barthii), african cultivated rice (Oryza glaberrima), panicum galli, millet (Panicum miliaceum), millet (Setaria grade), sorghum (Sorghum bicolor), false rice (leaved perrier), uralensis wheat (Triticum urin), barley (Hordeum vulgare).

Drawings

FIG. 1A 309D, A309T, A V of amino acid mutation at 309 th position and multiple mutant S29P/T104I/V172I/A309V show stronger growth advantage compared with wild type OsGS1-WT (Ref) through sequencing and analysis screening in competitive growth experiments of rice glutamine synthetase OsGS1 mutant yeast library under glufosinate screening environment. The larger the abscissa value of the data points in the graph, the greater the growth advantage thereof in the glufosinate screening environment, i.e. the greater the resistance to glufosinate.

A309D, A309T, A V Yeast mutant mutated at amino acid 309 of Rice glutamine synthetase OsGS1 was subjected to a competitive growth test with wild type OsGS1-WT in YPD medium containing 10g/L glufosinate (Glufosinate ammonium, PPT). The abscissa is time, in hours, and the ordinate is log2 (mutant/wild type). The linear fit equation is shown in the graph, the larger the slope, the greater the growth advantage of its mutant over the wild-type under glufosinate culture conditions.

FIG. 2A 309D, A309T, A V Yeast mutant mutated at amino acid 309 of Rice glutamine synthetase OsGS1 and wild-type OsGS1-WT in a strain containing 0.05g/L (NH) ₄ ) ₂ SO ₄ Competitive growth experiments were performed in medium. The abscissa is time, in hours, and the ordinate is log2 (mutant/wild type). The linear fit equation is shown in the graph with a slope less than 0, indicating that the growth advantage of the wild type over the mutant is greater under low ammonium culture conditions, whereas a slope greater than 0 indicates that the mutant has greater growth advantage than the wild type under low ammonium culture conditions.

FIG. 3 ratio of enzyme activities of A309D, A309T, A V mutant of rice glutamine synthetase OsGS1 to wild type OsGS 1.

FIG. 4 growth rates of three mutants and wild type of three species in YPD medium containing 10g/L glufosinate. The abscissa is time, in hours, and the ordinate is algebra of propagation.

FIG. 5 glufosinate resistance phenotype of glutamine synthetase mutant transgenic plants.

Detailed Description

1. Definition of the definition

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and laboratory procedures as used herein are terms and conventional procedures that are widely used in the corresponding arts. For example, standard recombinant DNA and molecular cloning techniques for use in the present invention are well known to those skilled in the art and are more fully described in the following documents: sambrook, j., fritsch, e.f., and Maniatis, t., molecular Cloning: a Laboratory Manual; cold Spring Harbor Laboratory Press: cold Spring Harbor,1989 (hereinafter "Sambrook"). Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

As used herein, the term "and/or" encompasses all combinations of items connected by the term, and should be viewed as having been individually listed herein. For example, "a and/or B" encompasses "a", "a and B", and "B". For example, "A, B and/or C" encompasses "a", "B", "C", "a and B", "a and C", "B and C" and "a and B and C".

The term "comprising" is used herein to describe a sequence of a protein or nucleic acid, which may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described herein. Furthermore, it will be clear to those skilled in the art that the methionine encoded by the start codon at the N-terminus of a polypeptide may be retained in some practical situations (e.g., when expressed in a particular expression system) without substantially affecting the function of the polypeptide. Thus, in describing a particular polypeptide amino acid sequence in the specification and claims, although it may not comprise a methionine encoded at the N-terminus by the initiation codon, a sequence comprising such methionine is also contemplated at this time, and accordingly, the encoding nucleotide sequence may also comprise the initiation codon; and vice versa.

"exogenous" with respect to a sequence means a sequence from a foreign species, or if from the same species, a sequence that has undergone significant alteration in composition and/or locus from its native form by deliberate human intervention.

"Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid" are used interchangeably and are a single-or double-stranded RNA or DNA polymer, optionally containing synthetic, unnatural or altered nucleotide bases. Nucleotides are referred to by their single letter designations as follows: "A" is adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "D" represents A, T or G, "I" represents inosine, and "N" represents any nucleotide.

Codon optimization refers to a method of modifying a nucleic acid sequence to enhance expression in a host cell of interest by replacing at least one codon of the native sequence with a more or most frequently used codon in the gene of the host cell (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons while maintaining the native amino acid sequence).

"polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

Sequence "identity" has art-recognized meanings and the percent sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using the disclosed techniques. Sequence identity may be measured along the full length of a polynucleotide or polypeptide or along a region of the molecule. (see, e.g., computational Molecular Biology, lesk, A.M., ed., oxford University Press, new York, 1988; biocomputing: informatics and Genome Projects, smith, D.W., ed., academic Press, new York, 1993; computer Analysis of Sequence Data, part I, griffin, A.M., and Griffin, H.G., eds., humana Press, new Jersey, 1994; sequence Analysis in Molecular Biology, von Heinje, G., academic Press, 1987; and Sequence Analysis Primer, grib skov, M.and Devereux, J., eds., M Stockton Press, new York, 1991). Although there are many methods of measuring identity between two polynucleotides or polypeptides, the term "identity" is well known to the skilled artisan (carrello, h. & Lipman, d.,. SIAM J Applied Math 48:1073 (1988)).

In peptides or proteins, suitable conservative amino acid substitutions are known to those skilled in the art, and can generally be made without altering the biological activity of the resulting molecule. In general, one skilled in The art recognizes that single amino acid substitutions in The non-essential region of a polypeptide do not substantially alter biological activity (see, e.g., watson et al, molecular Biology of The Gene, 4th Edition, 1987, the Benjamin/Cummings pub. Co., p. 224).

As used herein, an "expression construct" refers to a vector, such as a recombinant vector, suitable for expression of a nucleotide sequence of interest in an organism. "expression" refers to the production of a functional product. For example, expression of a nucleotide sequence may refer to transcription of the nucleotide sequence (e.g., transcription into mRNA or functional RNA) and/or translation of RNA into a precursor or mature protein.

The "expression construct" of the invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, may be an RNA (e.g., mRNA) that is capable of translation, such as RNA produced by in vitro transcription.

The "expression construct" of the invention may comprise regulatory sequences of different origin and nucleotide sequences of interest, or regulatory sequences and nucleotide sequences of interest of the same origin but arranged in a manner different from that normally found in nature.

"regulatory sequence" and "regulatory element" are used interchangeably and refer to a nucleotide sequence that is located upstream (5 'non-coding sequence), intermediate or downstream (3' non-coding sequence) of a coding sequence and affects transcription, RNA processing or stability, or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

"promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment. In some embodiments of the invention, the promoter is a promoter capable of controlling transcription of a gene in a cell, whether or not it is derived from the cell. The promoter may be a constitutive or tissue specific or developmentally regulated or inducible promoter.

"constitutive promoter" refers to a promoter that will generally cause a gene to be expressed in most cases in most cell types. "tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to promoters that are expressed primarily, but not necessarily exclusively, in one tissue or organ, but also in one particular cell or cell type. "developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. An "inducible promoter" selectively expresses an operably linked DNA sequence in response to an endogenous or exogenous stimulus (environmental, hormonal, chemical signal, etc.).

Examples of promoters include, but are not limited to, polymerase (pol) I, pol II, or pol III promoters. When used in plants, the promoter may be the cauliflower mosaic virus 35S promoter, the maize Ubi-1 promoter, the wheat U6 promoter, the rice U3 promoter, the maize U3 promoter, the rice actin promoter.

As used herein, the term "operably linked" refers to a regulatory element (e.g., without limitation, a promoter sequence, a transcription termination sequence, etc.) linked to a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking a regulatory element region to a nucleic acid molecule are known in the art.

"introducing" a nucleic acid molecule (e.g., plasmid, linear nucleic acid fragment, RNA, etc.) or protein into an organism refers to transforming a cell of the organism with the nucleic acid or protein such that the nucleic acid or protein is capable of functioning in the cell. "transformation" as used herein includes both stable transformation and transient transformation. "Stable transformation" refers to the introduction of an exogenous nucleotide sequence into the genome, resulting in stable inheritance of an exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the organism and any successive generation thereof. "transient transformation" refers to the introduction of a nucleic acid molecule or protein into a cell to perform a function without stable inheritance of an exogenous gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the genome.

As used herein, the term "plant" includes whole plants and any progeny, cells, tissues, or parts of plants. The term "plant part" includes any part of a plant, including, for example, but not limited to: seeds (including mature seeds, immature embryos without seed coats, and immature seeds); plant cutting (plant cutting); a plant cell; plant cell cultures; plant organs (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and related explants). The plant tissue or plant organ may be a seed, a callus, or any other population of plant cells organized into structural or functional units. Plant cells or tissue cultures are capable of regenerating plants having the physiological and morphological characteristics of the plant from which the cells or tissue are derived, and of regenerating plants having substantially the same genotype as the plant. In contrast, some plant cells are not capable of regenerating to produce plants. The regenerable cells in the plant cells or tissue culture may be embryos, protoplasts, meristematic cells, callus tissue, pollen, leaves, anthers, roots, root tips, filaments, flowers, kernels, ears, cobs, husks, or stems.

Plant "progeny" includes any subsequent generation of a plant.

2. Glutamine Synthetase (GS) mutants

Glutamine synthetase (GS, glutamine synthetase; EC 6.3.1.2) is an enzyme that is widely found in organisms, is involved in nitrogen and carbon metabolism in many organisms, and is one of the key enzymes for nitrogen metabolism in organisms. Glutamine synthetase is an important detoxification enzyme for plants, which detoxifies ammonium released by nitrate reduction, amino acid degradation and photo-respiration.

The herbicide resistance described in the aspects of the present invention preferably refers to resistance to Glutamine Synthetase (GS) inhibiting herbicides. Glutamine Synthetase (GS) inhibiting herbicides include, but are not limited to, glufosinate (Glufosinate ammonium), bialaphos-sodium, or other herbicides having glufosinate (phosphinotricin) as the major active ingredient. For example, glufosinate inhibits wild-type GS, resulting in intracellular ammonia accumulation, inhibition of amino acid synthesis and photosynthesis, chlorophyll destruction; and the death of plants is caused by rapid inhibition of the action of RuBp carboxylase/light respiration.

In the present invention, the inventors created and identified new GS mutants that are resistant to GS-inhibiting herbicides by screening in yeast.

In one aspect, the invention provides a Glutamine Synthetase (GS) or a functional fragment thereof having an amino acid mutation at position 309 relative to a wild type Glutamine Synthetase (GS), said amino acid position being referred to in SEQ ID No. 1.

As used herein, "amino acid position reference SEQ ID NO: x" (SEQ ID NO: x is a particular sequence set forth herein) refers to the position number of a particular amino acid described as the position number of the amino acid corresponding to that amino acid on SEQ ID NO: x. The correspondence of amino acids in different sequences can be determined according to sequence alignment methods well known in the art. For example, amino acid correspondence may be determined by an on-line alignment tool of EMBL-EBI (https:// www.ebi.ac.uk/Tools/psa /), where the two sequences may be aligned using the Needleman-Wunsch algorithm using default parameters. For example, an alanine at position 310 of polypeptide X from its N-terminus is aligned in sequence alignment with an amino acid at position 309 of SEQ ID NO. 1, then that alanine in polypeptide X may also be described herein as "an alanine at position 309 of that polypeptide X, said amino acid position referring to SEQ ID NO. 1".

In some embodiments, the glutamine synthetase mutant or functional fragment thereof is capable of conferring resistance to a herbicide, such as a glutamine synthetase inhibiting herbicide, on a eukaryotic organism, such as a yeast or plant, when expressed in the eukaryotic organism. "conferring resistance to a herbicide, e.g., a glutamine synthetase inhibiting herbicide, to said eukaryotic organism, e.g., yeast or plant" means that the resistance to a herbicide, e.g., a glutamine synthetase inhibiting herbicide, of a eukaryotic organism, e.g., yeast or plant, comprising or expressing said glutamine synthetase mutant or functional fragment thereof is enhanced, e.g., enhanced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more relative to a eukaryotic organism, e.g., yeast or plant, comprising or expressing only (an equivalent amount of) wild-type glutamine synthetase, without or expressing said glutamine synthetase mutant or functional fragment thereof. Methods for determining resistance to glutamine synthetase inhibiting herbicides are known in the art. Resistance can be readily determined by one skilled in the art based on the particular eukaryote such as yeast or plants and the particular herbicide.

Furthermore, the resistance of the glutamine synthetase mutants of the present invention or functional fragments thereof to a glutamine synthetase inhibitory herbicide can be determined by detecting the growth status of eukaryotic/eukaryotic cells, such as yeast cells or plant/plant cells, comprising said mutants or functional fragments thereof in the presence of a glutamine synthetase inhibitory herbicide, for example, see the methods described in examples 2, 3 or 5. The better a eukaryotic/eukaryotic cell, such as a yeast cell or a plant/plant cell, grows in the presence of a glutamine synthetase inhibiting herbicide, representing the more resistant it is.

The enzyme activity characteristics of the glufosinate-resistant glutamine synthetase mutants of the invention or functional fragments thereof can be determined in vitro. In particular, by combining ATP and Mg ²⁺ The mutant or functional fragment thereof is assayed for the enzymatic activity of catalyzing the synthesis of glutamine from ammonium ions and glutamate in the presence of the mutant or functional fragment thereof. For example, see the method described in example 2; the enzyme activity may also be measured using a commercially available glutamine synthetase activity measurement kit. The stronger the measured glutamine synthetase activity, the more resistant the glutamine synthetase mutant or its functional fragment to glufosinate, the enzyme activity and function of the mutant or its functional fragment are not affected or even enhanced.

In some embodiments, the wild-type glutamine synthetase comprises an amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42. In some embodiments, the amino acid sequence of the wild-type glutamine synthetase is, for example, one of SEQ ID NOs 1, 5, 9, 13, 33-42. In some embodiments, the wild-type glutamine synthetase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to the amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42, and is alanine (A) at position 309 or is not aspartic acid (D), threonine (T), or valine (V) at position 309, said amino acid position referring to SEQ ID NO 1.

In some embodiments, the glutamine synthetase mutant is derived from rice (Oryza sativa) wild type glutamine synthetase. An exemplary rice wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 1.

In some embodiments, the glutamine synthetase mutant is derived from wheat (Triticum aestivum) wild-type glutamine synthetase. An exemplary wheat wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 5.

In some embodiments, the glutamine synthetase mutant is derived from brachypodium distachyon (Brachypodium distachyon) wild-type glutamine synthetase. An exemplary Brevibacterium distachum wild type glutamine synthetase comprises an amino acid sequence shown as SEQ ID NO. 9.

In some embodiments, the glutamine synthetase mutant is derived from corn (Zea mays) wild-type glutamine synthetase. An exemplary maize wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 13.

In some embodiments, the glutamine synthetase mutant is derived from Oryza sativa (Oryza sativa var. Granula) wild type glutamine synthetase. An exemplary oryza verrucosa wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 33.

In some embodiments, the glutamine synthetase mutant is derived from wild type rice (Oryza barthii) wild type glutamine synthetase. An exemplary wild-type rice wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 34.

In some embodiments, the glutamine synthetase mutant is derived from Oryza sativa (Oryza glaberrima) wild-type glutamine synthetase. An exemplary oryza sativa wild type glutamine synthetase comprises the amino acid sequence shown in SEQ ID No. 35.

In some embodiments, the glutamine synthetase mutant is derived from a Panicum gallii wild type glutamine synthetase. An exemplary Paniculi wild-type glutamine synthetase comprises the amino acid sequence shown as SEQ ID NO. 36.

In some embodiments, the glutamine synthetase mutant is derived from millet (Panicum miliaceum) wild-type glutamine synthetase. An exemplary wild-type millet glutamine synthetase comprises the amino acid sequence shown in SEQ ID No. 37.

In some embodiments, the glutamine synthetase mutant is derived from millet (millet) wild-type glutamine synthetase. An exemplary maize wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 38.

In some embodiments, the glutamine synthetase mutant is derived from Sorghum (Sorghum bicolor) wild type glutamine synthetase. An exemplary sorghum wild type glutamine synthetase comprises the amino acid sequence shown in SEQ ID No. 39.

In some embodiments, the glutamine synthetase mutant is derived from a false rice (left-intermediate) wild-type glutamine synthetase. An exemplary oryza sativa wild type glutamine synthetase comprises the amino acid sequence shown in SEQ ID No. 40.

In some embodiments, the glutamine synthetase mutant is derived from a wild-type glutamine synthetase of Triticum aestivum (Triticum uratu). An exemplary urapidated wheat wild-type glutamine synthetase comprises the amino acid sequence shown in SEQ ID NO. 41.

In some embodiments, the glutamine synthetase mutant is derived from barley (Hordeum vulgare) wild type glutamine synthetase. An exemplary barley wild type glutamine synthetase comprises the amino acid sequence shown as SEQ ID NO. 42.

In some embodiments, the amino acid mutation is an amino acid substitution.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof has an amino acid substitution at position 309 relative to a wild-type glutamine synthetase with aspartic acid (D), said amino acid position being referred to as SEQ ID NO. 1. In some embodiments, the glutamine synthetase mutant or functional fragment thereof has a threonine (T) substitution of the amino acid at position 309 relative to a wild type glutamine synthetase, said amino acid position being referred to as SEQ ID NO. 1. In some embodiments, the glutamine synthetase mutant or functional fragment thereof has a valine (V) substitution at amino acid position 309 relative to a wild-type glutamine synthetase, said amino acid position being referred to as SEQ ID NO. 1.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof has an alanine (A) substitution at position 309 relative to a wild-type glutamine synthetase, the amino acid position referred to as SEQ ID NO. 1.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof has an alanine (A) at position 309 substituted with an aspartic acid (D) relative to a wild-type glutamine synthetase, the amino acid position being referred to as SEQ ID NO. 1. In some embodiments, the glutamine synthetase mutant or functional fragment thereof has alanine (A) at position 309 replaced with threonine (T) relative to a wild type glutamine synthetase, the amino acid position is referred to as SEQ ID NO. 1. In some embodiments, the glutamine synthetase mutant or functional fragment thereof has alanine (A) at position 309 replaced with valine (V) relative to a wild-type glutamine synthetase, the amino acid position referred to as SEQ ID NO. 1.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof comprises at least an amino acid substitution a309D, A309T or a309V relative to a wild type glutamine synthetase, said amino acid position being referred to in SEQ ID No. 1.

The expression amino acid substitution is well known in the art. For example, amino acid substitution A309D refers to the substitution of amino acid A at position 309 of the wild-type glutamine synthetase by D in the glutamine synthetase mutant, said amino acid position being referred to as SEQ ID NO. 1.

As used herein, a "functional fragment" refers to a fragment that retains, at least in part or in whole, the function of the full-length glutamine synthetase mutant from which it is derived.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof further comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) additional amino acid mutations, such as conservative amino acid substitutions, relative to the wild-type glutamine synthetase. Furthermore, it will be appreciated by those skilled in the art that small amino acid insertions, deletions or additions at the terminus (C-terminus and/or N-terminus) of a protein typically do not significantly alter the function of the protein. For example, tags may be added at the ends of the protein to facilitate protein purification and/or detection, such as histidine tags.

In some embodiments, the glutamine synthetase mutant or functional fragment thereof further comprises one or more or all amino acid substitutions selected from S29P, T104I, V172I relative to a wild-type glutamine synthetase.

In some embodiments, the glutamine synthetase mutants comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to any of SEQ ID NOs 2-4, 6-8, 10-12, and 14-16. In some embodiments, the glutamine synthetase mutants comprise an amino acid sequence set forth in any of SEQ ID NO:2-4, 6-8, 10-12, and 14-16.

In another aspect, the invention also provides a nucleic acid comprising a nucleotide sequence encoding a glutamine synthetase mutant of the invention or a functional fragment thereof. In some embodiments, the nucleic acid is an isolated nucleic acid or a recombinant nucleic acid. In some embodiments, the nucleotide sequence encoding the glutamine synthetase mutants of the present invention or functional fragments thereof is shown in any of SEQ ID NOs 18-20, 22-24, 26-28, 30-32.

In some embodiments, the nucleotide sequence encoding the glutamine synthetase mutants of the present invention or functional fragments thereof can be codon optimized for a eukaryotic organism of interest, such as a yeast or plant.

In another aspect, the invention also provides an expression cassette comprising a nucleotide sequence encoding a glutamine synthetase mutant or a functional fragment thereof operably linked to a regulatory sequence.

In another aspect, the invention also provides an expression construct comprising an expression cassette of the invention.

In a further aspect, the invention also provides the use of a glutamine synthetase mutant of the invention or a functional fragment thereof, a nucleic acid of the invention, an expression cassette of the invention or an expression construct of the invention for producing a herbicide resistant plant.

In another aspect, the invention also provides a herbicide resistant plant comprising or expressing a glutamine synthetase mutant of the invention or a functional fragment thereof.

The plant in the various aspects of the invention may be a monocotyledonous plant or a dicotyledonous plant, preferably a plant susceptible to glutamine synthetase inhibitors. Preferably, the plant is a crop plant. Examples of suitable plants include, but are not limited to, rice (Oryza sativa), wheat (Triticum aestivum), brachypodium distachyon (Brachypodium distachyon), corn (Zea mays), oryza verrucosa (Oryza meyeriana var. Granola), wild rice (Oryza barthii), oryza glaberrima (Oryza glaberma), panicum halima, millet (Panicum miliaceum), millet (serial allia), sorghum (Sorghum bicolor), false rice (Leersia perrie), uralensis wheat (Triticum durum), barley (Hordeum vulgare), and the like. In some preferred embodiments, the plant is rice. In other preferred embodiments, the plant is wheat. In other preferred embodiments, the plant is maize. In other preferred embodiments, the plant is brachypodium distachyon.

3. Method for producing herbicide resistant plants by transgenesis

In another aspect, the invention also provides a method of producing a herbicide resistant plant by transgenesis comprising introducing into a plant a nucleic acid of the invention, an expression cassette of the invention and/or an expression construct of the invention. In some embodiments, the introduction of a nucleic acid of the invention, an expression cassette of the invention and/or an expression construct of the invention results in the plant comprising or expressing a glutamine synthetase mutant of the invention or a functional fragment thereof.

The nucleic acids of the invention, the expression cassettes of the invention and/or the expression constructs of the invention can be introduced into the plants using various methods known in the art. Suitable methods of introduction include, but are not limited to, gene gun methods, PEG-mediated protoplast transformation, agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube channeling methods, and ovary injection methods.

In some embodiments, the nucleic acids of the invention, the expression cassettes of the invention, and/or the expression constructs of the invention are integrated into the genome of the plant. The isolated nucleic acids of the invention, the expression cassettes of the invention and/or the expression constructs of the invention will confer on the plant resistance to herbicides capable of inhibiting glutamine synthetase activity.

In another aspect, the invention also provides a herbicide resistant plant comprising or transformed with the expression cassette of the invention, the nucleic acid of the invention or the expression construct of the invention. The invention also encompasses the progeny of the herbicide resistant plants.

4. Methods for producing herbicide resistant plants by targeted modification of plant endogenous glutamine synthetase

Based on the herbicide resistance conferring glutamine synthetase mutants identified in the present invention and the corresponding mutation sites, the endogenous glutamine synthetase of the plant can be engineered by means of targeted mutation, thereby producing herbicide resistant plants.

Thus, in one aspect, the invention also provides a method of producing a herbicide resistant plant, the method comprising modifying, for example targeting, an endogenous glutamine synthetase coding sequence of a modified plant, thereby causing an amino acid mutation at position 309 of said endogenous glutamine synthetase (e.g. expressed endogenous glutamine synthetase), said amino acid position being referred to SEQ ID No. 1.

The plant's endogenous glutamine synthetase comprises, for example, an amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42 or an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to an amino acid sequence of one of SEQ ID NOs 1, 5, 9, 13, 33-42. In some embodiments, the endogenous glutamine synthetase is alanine (a) at position 309 or is not aspartic acid (D), threonine (T), or valine (V) at position 309, which amino acid position is referred to as SEQ ID No. 1.

In some embodiments, the amino acid mutation is an amino acid substitution.

In some embodiments, the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) being substituted with alanine (a) at position 309, the amino acid position being referenced to SEQ ID No. 1.

In some embodiments, the modification results in substitution of alanine (a) at position 309 with aspartic acid (D) for the endogenous glutamine synthetase (e.g., the expressed endogenous glutamine synthetase), the amino acid position being referenced to SEQ ID No. 1. In some embodiments, the modification results in substitution of alanine (a) at position 309 with threonine (T) for the endogenous glutamine synthetase (e.g., the expressed endogenous glutamine synthetase), the amino acid position being referenced to SEQ ID No. 1. In some embodiments, the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) having a substitution of alanine (a) at position 309 with valine (V), the amino acid position being referenced to SEQ ID No. 1.

In some embodiments, the modification results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) comprising an amino acid substitution a309D, A309T or a309V, said amino acid position being referenced to SEQ ID No. 1.

In some embodiments, the modification results in a glutamine synthetase mutant of the invention described above, e.g., results in the plant expressing a glutamine synthetase mutant of the invention described above.

Thus, the present invention also provides a method of producing a herbicide resistant plant, the method comprising modifying, for example targeting, an endogenous glutamine synthetase coding sequence of a modified plant, thereby resulting in a glutamine synthetase mutant of the invention described above, for example resulting in the plant expressing a glutamine synthetase mutant of the invention described above.

"herbicide resistant plants" may refer to plants having enhanced resistance, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more, to a glutamine synthetase-inhibiting herbicide of a plant of the invention that has been targeted modified relative to a plant that has not been targeted modified. Methods for determining resistance to glutamine synthetase inhibiting herbicides are known in the art. Resistance can be readily determined by one skilled in the art depending on the particular plant and the particular herbicide.

In some embodiments, the endogenous glutamine synthetase coding sequence of the modified plant is targeted by homologous recombination. Methods for achieving modification of plant endogenous genes by homologous recombination are well known to those skilled in the art.

In some embodiments, the endogenous glutamine synthetase coding sequence of the modified plant is targeted by gene editing. In some embodiments, the endogenous glutamine synthetase coding sequence of the plant is targeted modified by introducing into the plant a gene editing system that targets an endogenous glutamine synthetase coding region in the genome of the plant.

In some embodiments, the introduction of the gene editing system results in a mutation of the endogenous glutamine synthetase at amino acid position 309, said amino acid position being referred to in SEQ ID NO. 1.

In some embodiments, the introduction of the gene editing system results in the substitution of the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) with alanine (a) at position 309, the amino acid position referenced to SEQ ID No. 1.

In some embodiments, the introduction of the gene editing system results in the substitution of alanine (a) at position 309 with aspartic acid (D) of the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase), the amino acid position referenced to SEQ ID No. 1. In some embodiments, the introduction of the gene editing system results in the substitution of alanine (a) at position 309 of the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) with threonine (T), the amino acid position referenced to SEQ ID No. 1. In some embodiments, the introduction of the gene editing system results in the substitution of alanine (a) at position 309 of the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) with valine (V), the amino acid position referred to as SEQ ID No. 1.

In some embodiments, the introduction of the gene editing system results in the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) comprising the amino acid substitution a309D, A T or a309V, said amino acid position being referenced to SEQ ID No. 1.

In some embodiments, the introduction of the gene editing system results in the glutamine synthetase mutants of the invention described above, e.g., results in the plants expressing the glutamine synthetase mutants of the invention described above.

The gene editing system useful in the present invention may be various gene editing systems known in the art as long as they can perform targeted genome editing in plants. The gene editing system may be a CRISPR, ZFN or TALEN based gene editing system. Preferably, the gene editing system is a CRISPR-based gene editing system.

In some preferred embodiments, the gene editing system is a base editing system. The base editing system useful in the present invention may be various base editing systems known in the art as long as they can perform targeted genomic base editing in plants. For example, the base editing systems include, but are not limited to, those described in WO 2018/056623, WO 2019/120283, WO 2019/120310.

In some embodiments, the base editing system comprises a base editing fusion protein or an expression construct comprising a nucleotide sequence encoding the same, and at least one guide RNA or an expression construct comprising a nucleotide sequence encoding the same, e.g., the system comprises at least one of the following i) to v):

i) A base editing fusion protein, and at least one guide RNA;

ii) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and at least one guide RNA;

iii) A base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

iv) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding at least one guide RNA;

v) an expression construct comprising a nucleotide sequence encoding a base editing fusion protein and a nucleotide sequence encoding at least one guide RNA;

wherein the base editing fusion protein comprises a CRISPR effector protein and a deaminase domain, the at least one guide RNA being capable of targeting the base editing fusion protein to an endogenous glutamine synthetase coding sequence in a plant genome.

In embodiments herein, "base editing fusion protein" and "base editor" are used interchangeably to refer to a protein that can mediate one or more nucleotide substitutions of a target sequence in the genome in a sequence-specific manner.

As used herein, the term "CRISPR effector protein" generally refers to a nuclease (CRISPR nuclease) or a functional variant thereof that is present in a naturally occurring CRISPR system. The term encompasses any effector protein based on a CRISPR system that is capable of achieving sequence specific targeting within a cell.

As used herein, a "functional variant" with respect to a CRISPR nuclease means that it retains at least the guide RNA-mediated sequence-specific targeting ability. Preferably, the functional variant is a nuclease-inactivated variant, i.e. it lacks double-stranded nucleic acid cleavage activity. However, CRISPR nucleases lacking double-stranded nucleic acid cleavage activity also encompass nickases (nickases) that form nicks (nicks) in double-stranded nucleic acid molecules, but do not completely cleave double-stranded nucleic acids. In some preferred embodiments of the invention, the CRISPR effector proteins of the invention have nicking enzyme activity. In some embodiments, the functional variant recognizes a different PAM (prosomain sequence adjacent motif) sequence relative to the wild-type nuclease.

The "CRISPR effector protein" may be derived from a Cas9 nuclease, including a Cas9 nuclease or a functional variant thereof. The Cas9 nuclease may be a Cas9 nuclease from a different species, such as spCas9 from streptococcus pyogenes(s) or SaCas9 derived from staphylococcus aureus (s. Aureus). "Cas9 nuclease" and "Cas9" are used interchangeably herein to refer to an RNA-guided nuclease comprising a Cas9 protein or fragment thereof (e.g., a protein comprising the active DNA cleavage domain of Cas9 and/or the gRNA binding domain of Cas 9). Cas9 is a component of a CRISPR/Cas (clustered regularly interspaced short palindromic repeats and related systems) genome editing system that can target and cleave DNA target sequences to form DNA Double Strand Breaks (DSBs) under the direction of guide RNAs.

The "CRISPR effector protein" may also be derived from a Cpf1 nuclease, including a Cpf1 nuclease or a functional variant thereof. The Cpf1 nucleases may be Cpf1 nucleases from different species, for example Cpf1 nucleases from Francisella novicida U, acidoaerococcus sp.BV 3L6 and Lachnospiraceae bacterium ND 2006.

Useful "CRISPR effector proteins" may also be derived from Cas3, cas8a, cas5, cas8b, cas8C, cas10d, cse1, cse2, csy1, csy2, csy3, GSU0054, cas10, csm2, cmr5, cas10, csx11, csx10, csf1, csn2, cas4, C2C1, C2C3, or C2 nucleases, including for example these nucleases or functional variants thereof.

In some embodiments, the CRISPR effector protein is nuclease-inactivated Cas9. The DNA cleavage domain of Cas9 nuclease is known to comprise two subdomains: HNH nuclease subdomain and RuvC subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC subdomain cleaves the non-complementary strand. Mutations in these subdomains can inactivate the nuclease activity of Cas9, forming "nuclease-inactivated Cas9". The nuclease-inactivated Cas9 still retains the gRNA-directed DNA-binding ability.

The nuclease-inactivated Cas9 of the invention may be derived from Cas9 of different species, for example, from streptococcus pyogenes(s) Cas9 (SpCas 9), or from staphylococcus aureus (s. Aureus) Cas9 (SaCas 9). Simultaneously mutating the HNH nuclease subdomain and RuvC subdomain of Cas9 (e.g., comprising mutations D10A and H840A) deactivates the nuclease of Cas9, becoming nuclease dead Cas9 (dCas 9). Mutation inactivation of one of the subdomains can result in Cas9 having nickase activity, i.e., obtaining Cas9 nickase (nCas 9), e.g., nCas9 with only mutation D10A.

Cas9 nucleases, when used in gene editing, typically require a target sequence with a PAM (prosomain sequence proximity motif) sequence of 5' -NGG-3' at the 3' end. However, this PAM sequence occurs very infrequently in certain species, such as rice, greatly limiting gene editing in these species, such as rice. For this purpose, CRISPR effector proteins recognizing different PAM sequences, such as Cas9 nuclease functional variants with different PAM sequences, are preferably used in the present invention.

In some preferred embodiments, the CRISPR effector protein is a Cas9 variant that recognizes the PAM sequence 5 '-NG-3'. In some preferred embodiments, the CRISPR effector protein is nuclease-inactivated and recognizes Cas9 variants of PAM sequence 5 '-NG-3'.

The deaminase domain described herein may be a cytosine deamination domain or an adenine deamination domain.

As used herein, a "cytosine deamination domain" refers to a domain capable of accepting single-stranded DNA as a substrate, catalyzing deamination of cytidine or deoxycytidine to uracil or deoxyuracil, respectively.

Examples of cytosine deaminase that may be used in the present invention include, but are not limited to, for example, apodec 1 deaminase, activation-induced cytidine deaminase (AID), apodec 3G, CDA1, human apodec 3A deaminase, or functional variants thereof. In some embodiments, the cytosine deaminase is a human apodec 3A deaminase or a functional variant thereof.

As used herein, an "adenine deamination domain" refers to a domain capable of accepting single stranded DNA as a substrate, catalyzing the formation of inosine (I) from adenosine or deoxyadenosine (a). In some embodiments, the adenine deaminase is a variant of escherichia coli tRNA adenine deaminase TadA (ecTadA).

As used herein, "guide RNA" and "gRNA" are used interchangeably to refer to an RNA molecule that is capable of forming a complex with a CRISPR effector protein and of targeting the complex to a target sequence due to having a identity to the target sequence. The guide RNA targets the target sequence by base pairing with the complementary strand of the target sequence. For example, the grnas employed by Cas9 nucleases or functional variants thereof are typically composed of crrnas and tracrRNA molecules that are partially complementary to form a complex, wherein the crrnas comprise a guide sequence (also known as a seed sequence) that has sufficient identity to a target sequence to hybridize to the complementary strand of the target sequence and direct the CRISPR complex (Cas 9+ crRNA + tracrRNA) to specifically bind to the target sequence. However, it is known in the art that one-way guide RNAs (sgrnas) can be designed which contain both the features of crrnas and tracrrnas. Whereas the grnas employed for Cpf1 nucleases or functional variants thereof typically consist of only mature crRNA molecules, which may also be referred to as sgrnas. It is within the ability of those skilled in the art to design a suitable gRNA based on the CRISPR nuclease used and the target sequence to be edited.

In some embodiments, the at least one gRNA of the invention comprises a target sequence in the endogenous glutamine synthetase coding region that encodes an amino acid sequence comprising an amino acid at positions 365, 309 of the endogenous glutamine synthetase, the amino acid position referring to SEQ ID No. 1.

In some embodiments, the gene editing system is a so-called guided editing (prime) system. The system includes a fusion of a Cas nuclease (e.g., cas 9-H840A) with a reverse transcriptase (e.g., M-MLV reverse transcriptase) with target strand nick activity, and a pegRNA (prime editing gRNA) with a repair template (RT template) at the 3' end and a free single-stranded binding region (PBS), leading to editing of the gRNA. The system can realize random change of DNA sequence positioned downstream of PAM sequence-3 in genome through PBS combined with free single strand generated by Cas nickase (such as Cas 9-H840A) and transcription of single strand DNA sequence according to given RT template and cell repair. For example, a guided editing (priority) system may be described with reference to Anzalone, A.et al, search-and-replace genome editing without double-strand breaks or donor DNA, nature https:// doi.org/10.1038/s41586-019-1711-4 (2019).

In the method of the present invention, the gene editing system may be introduced into plants by various methods well known to those skilled in the art. Methods useful for introducing the gene editing systems of the present invention into plants include, but are not limited to: gene gun method, PEG-mediated protoplast transformation, agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube channel method, and ovary injection method.

In the method of the present invention, modification of a target sequence can be achieved by introducing or producing the gene editing system in a plant cell, and the modification can be stably inherited without stably transforming the plant with the gene editing system. Thus avoiding the potential off-target effect of the stably existing gene editing system and also avoiding the integration of the exogenous nucleotide sequence in the plant genome, thereby having higher biosafety.

In some preferred embodiments, the introducing is performed in the absence of selection pressure, thereby avoiding integration of the exogenous nucleotide sequence in the plant genome.

In some embodiments, the introducing comprises transforming the gene editing system of the invention into an isolated plant cell or tissue, and then regenerating the transformed plant cell or tissue into a whole plant. Preferably, the regeneration is performed in the absence of selection pressure, i.e., without the use of any selection agent for the selection gene carried on the expression vector during tissue culture. The regeneration efficiency of plants can be improved without the use of a selection agent, and herbicide-resistant plants free of exogenous nucleotide sequences can be obtained.

In other embodiments, the gene editing system of the invention may be transformed into a specific location on an intact plant, such as a leaf, shoot tip, pollen tube, young ear, or hypocotyl. This is particularly suitable for transformation of plants which are difficult to regenerate by tissue culture.

In some embodiments of the invention, the in vitro expressed protein and/or the in vitro transcribed RNA molecule is directly transformed into the plant. The protein and/or RNA molecules enable gene editing in plant cells, which are subsequently degraded by the cells, avoiding integration of the exogenous nucleotide sequence in the plant genome.

In another aspect, the invention also provides a herbicide resistant plant produced by the methods of the invention for targeted modification of a plant's endogenous glutamine synthetase. The invention also encompasses the progeny of the herbicide resistant plants.

In some embodiments of the invention, the herbicide resistant plant is non-transgenic.

5. Method for producing herbicide resistant plants by physical or chemical mutagenesis

In another aspect, the invention also provides a method of producing a herbicide resistant plant comprising subjecting a population of said plants to physical or chemical mutagenesis and screening for plants comprising an amino acid mutation at least at position 309 of an endogenous glutamine synthetase (e.g., an expressed endogenous glutamine synthetase), wherein the amino acid position is referred to SEQ ID No. 1.

In some embodiments, plants are selected in which the alanine (A) at position 309 of an endogenous glutamine synthetase (e.g., an expressed endogenous glutamine synthetase) is substituted, the amino acid position being referred to as SEQ ID NO:1.

In some embodiments, plants are selected in which the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) has alanine (a) at position 309 replaced with aspartic acid (D), the amino acid position referred to in SEQ ID No. 1. In some embodiments, plants are selected for substitution of alanine (A) at position 309 with threonine (T) for the endogenous glutamine synthetase (e.g., the expressed endogenous glutamine synthetase), the amino acid position being referenced to SEQ ID NO:1. In some embodiments plants are selected for substitution of alanine (a) at position 309 with valine (V) of the endogenous glutamine synthetase (e.g., the expressed endogenous glutamine synthetase), the amino acid position being referenced to SEQ ID No. 1.

In some embodiments, plants are screened for the endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) comprising the amino acid substitution a309D, A309T or a309V, the amino acid position being referenced to SEQ ID No. 1.

In some embodiments, plants are selected in which an endogenous glutamine synthetase (e.g., expressed endogenous glutamine synthetase) is mutated to a glutamine synthetase mutant described herein above.

Accordingly, the present invention also provides a method of producing a herbicide resistant plant comprising subjecting a population of said plants to physical or chemical mutagenesis and screening for plants comprising or expressing a glutamine synthetase mutant as described herein above.

"herbicide resistant plant" may refer to a plant that has been mutagenized to have increased resistance to a glutamine synthetase inhibitory herbicide, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more, relative to a plant that does not comprise a mutation of the endogenous glutamine synthetase. Methods for determining resistance to glutamine synthetase inhibiting herbicides are known in the art. Resistance can be readily determined by one skilled in the art depending on the particular plant and the particular herbicide.

In some embodiments, the physical mutagenesis may be achieved by radioactive irradiation of the plant population (e.g., irradiation of plant seeds). In some embodiments, the chemical mutagenesis may be achieved by treating the plant population (e.g., treating plant seeds) with Ethyl Methylsulfonate (EMS).

In some embodiments, the screening may be accomplished by sequencing the coding sequence of the endogenous glutamine synthetase.

In another aspect, the invention also provides a herbicide resistant plant produced by the physical or chemical mutagenesis method of the invention. The invention also encompasses the progeny of the herbicide resistant plants.

6. Plant breeding method

In another aspect, the present invention provides a plant breeding method comprising crossing a first plant having herbicide resistance obtained by the above-described method of the present invention with a second plant not containing the herbicide resistance, thereby introducing the herbicide resistance into the second plant.

7. Method for identifying herbicide resistant plants

In another aspect, the invention provides a method of identifying herbicide resistant plants comprising detecting in a plant

ii) the presence and/or expression of a nucleotide sequence encoding a glutamine synthetase or a functional fragment thereof having an aspartic acid (D), threonine (T) or valine (V) at amino acid position 309, said amino acid position being referred to in SEQ ID NO. 1.

In some embodiments, the glutamine synthetase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% sequence identity to any one of SEQ ID NOS.2-4, 6-8, 10-12, and 14-16. In some embodiments, the glutamine synthetase comprises an amino acid sequence set forth in any one of SEQ ID NO's 2-4, 6-8, 10-12, and 14-16.

In some embodiments, the nucleotide sequence encoding the glutamine synthetase or a functional fragment thereof is set forth in any one of SEQ ID NOs 18-20, 22-24, 26-28, 30-32.

In some embodiments, the presence or increased amount of the glutamine synthetase or the presence and/or increased expression of the nucleotide sequence is indicative of the presence of and/or increased resistance to a glutamine synthetase inhibiting herbicide in the plant, particularly relative to a plant that does not comprise the glutamine synthetase or encoding nucleotide sequence.

Examples

Example 1 screening of Rice glutamine synthetase OsGS1 glufosinate resistant mutant

Taking out the yeast mutant library of the OsGS1 from the refrigerator at the temperature of-80 ℃, recovering yeast cells overnight in an SC culture medium, transferring to an SD-Leu-Ura culture medium (namely a leucine and uracil deficient liquid culture medium), and continuously recovering and culturing to ensure that the yeast cells are in a good logarithmic growth phase. The pool of yeast mutants at this time was sampled and cells were collected as a sample at time 0. Meanwhile, transferring 0.128 x 10 times 7 yeast cells into an SD-Leu-Ura liquid medium containing 0.5g/L glufosinate-ammonium for resistance screening, and repeating the two groups simultaneously. Cell collection was performed once every 8 hours of culture, as a sample at this time; meanwhile, transferring 0.128 x 10 x 7 yeast cells to a new screening culture medium for continuous screening culture. After 68 hours of screening culture, 9 time points were collected, two replicates for each time point, and 18 samples total.

DNA from these 18 yeast samples was extracted by 2 cycles of PCR plus the corresponding time-point barcode and UMI for the different mutants; then, 24 cycles of PCR are added with a homologous arm connected with Gibson, and the PCR is cloned to a pUC19 vector through Gibson connection; e.coli DH5 alpha is transformed, 20000-30000 clones on the plate are collected, plasmids are extracted, restriction enzyme digestion is carried out, and the product is subjected to three-generation sequencing.

UMIC-seq sequencing and analysis results show that: both the single mutant a309D, A309V, A T and the multiple mutant S29P/T104I/V172I/a309V showed significant resistance to glufosinate and the results are shown in figure 1. Therefore, primers with base mutation are designed, corresponding mutation is introduced by means of PCR, and yeast mutants with different OsGS1 mutants are obtained by converting the PCR products, so that 3 mutants (A309D, A309V, A309T) are constructed.

Summary of mutation sites and types of OsGS1 glufosinate resistant mutants in Table 1

TABLE 2 primer information for construction of mutants

Primer_name	Sequence(s)	SEQ ID NO：	Coordinates of
				A309D_for	GCTGGGGAGTTGACAACCGCGGCGC	43	914 -> 938
A309D_rev	GCGCCGCGGTTGTCAACTCCCCAGC	44	914 <- 938
				A309T_for	AGCTGGGGAGTTACCAACCGCGGCG	45	913 -> 937
A309T_rev	CGCCGCGGTTGGTAACTCCCCAGCT	46	913 <- 937
				A309V_for	GCTGGGGAGTTGTCAACCGCGGCGC	47	914 -> 938
A309V_rev	GCGCCGCGGTTGACAACTCCCCAGC	48	914 <- 938

Example 2 characterization of OsGS1 mutant

2.1 competitive growth experiments under glufosinate conditions

To verify the glufosinate resistance of the above mutants, they were each individually subjected to competitive growth experiments with yeasts carrying the wild-type OsGS1 sequence and GFP. The competitive growth experiments were performed in YPD liquid medium containing 10g/L glufosinate. Each yeast mutant was arranged with 3 biological replicates and 2 technical replicates. After resuscitating to log phase, 0.128 x 10≡7 cells of yeast mutant and wild type respectively are added into YPD liquid culture medium containing 10g/L glufosinate to start competition growth, and the moment is marked as 0 moment. Quantitative analysis is carried out on a flow cytometer, the proportion of fluorescent cells and non-fluorescent cells is counted, the initial proportion of mutants and wild type is obtained, then samples are taken every 1 hour, the quantitative analysis is carried out, the competitive experiment lasts for 5-7 hours, data of 5-7 time points are measured, and the difference of growth rates of mutant yeast and wild type yeast under the condition of glufosinate can be obtained, namely the sensitivity of the mutants to glufosinate is reflected.

As shown in FIG. 1, the A309D, A309T, A V yeast mutant with the mutation constructed at the 309 th amino acid of the rice glutamine synthetase OsGS1 shows strong growth advantages compared with the wild type in the YPD culture medium containing 10g/L glufosinate, and the resistance to glufosinate is greatly improved compared with the wild type.

2.2 verification of ammonium assimilation efficiency-competitive growth experiments under Low ammonium conditions

To verify the ammonium assimilation efficiency of the above mutants, they were each individually subjected to a competitive growth experiment with yeast harboring the wild-type OsGS1 sequence and GFP in competition with each other at a concentration of 0.5g/L (NH) ₄ ) ₂ SO ₄ Is carried out in YNB liquid medium. Each mutant was arranged with 3 biological replicates and 2 technical replicates. After resuscitating to the logarithmic phase, 0.128 x 10≡7 cells of each of the yeast mutant and the wild type are respectively taken and added into YNB liquid culture medium of 0.5g/L ammonium sulfate to start competing growth, and the moment is marked as 0 moment. In a flow cytometerAnd (3) carrying out quantitative analysis, and counting the proportion of the cells with fluorescence to the cells without fluorescence to obtain the initial proportion of the mutant and the wild type. Samples were taken at 8-12 hours intervals afterwards and quantitatively analyzed as above. The competition experiment lasts about 60 hours, data of 6-7 time points are measured, and the difference of growth rates of the mutant and the wild type yeast under the condition of low ammonium salt is obtained and reflects the ammonium assimilation efficiency of the mutant.

As a result, as shown in FIG. 2, the rice glutamine synthetase OsGS1 was mutated in the 309 th amino acid A309D, A309T, A V yeast mutant, which contained 0.05g/L (NH) ₄ ) ₂ SO ₄ In YNB medium, the growth rate of the mutant was slightly or not significantly reduced compared with that of the wild type, and it was reflected that the ammonium assimilation efficiency of the mutant was not significantly affected to some extent.

2.3 Glutamine synthetase Activity detection-ferric chloride colorimetric method for mutants

Reagent preparation:

extraction buffer:

reagent(s)	Molecular weight	100 mL
			50mM Tris	121.14	0.6057g
2mM EDTA	292.24	0.0584g
			10 % glycerol (V/V)		10 mL
10 mM 2-mercaptoethanol	78.14	0.0704ml

The pH was adjusted to 8.0.

Reaction buffer:

reagent(s)	Molecular weight	100 ml
			70 mM MOPS	209.263	1.4648g
100 mM glutamate (sodium glutamate)	169.1	1.691g
			50 mM MgSO ₄	120.3687	0.6018g

Hydroxylamine hydrochloride (h 3No. hcl, molecular weight 69.49) and ATP (molecular weight 507.18) were added prior to the assay; hydroxylamine hydrochloride was added at a concentration of 15mM, i.e., 100 ml to 0.1042g; ATP concentration was 15mM, i.e., 100. 100 ml g was added. Control reaction buffer was not added with ATP. The pH was adjusted to 6.8 with 1M Tris.

Stop buffer:

since addition of TCA dilutes the stop buffer concentration, the stop buffer mother liquor concentration should be 10/9X:

reagent(s)	Molecular weight	100 ml
			88 mM FeCl ₃ 6H ₂ O	270.29	2.64g
670 mM HCl	12M	6.2ml

10X TCA (molecular weight 163.3797): 1.6338g TCA is fixed to a volume of 5ml ddH ₂ O, preserved in dark at-20deg.C, and added to a final buffer solution at a final concentration of 200 mM.

Enzyme activity determination:

1: enzyme liquid extraction

Grinding a sample to be tested into powder by liquid nitrogen, taking 200mg into a centrifuge tube, adding 900 mul of extraction buffer solution, carrying out vortex oscillation for 1 min, placing on ice for 10 min, >13500rpm, centrifuging at 4 ℃ for 3-5 min, taking the supernatant into a new centrifuge tube, and taking the supernatant again after repeated centrifugation if the supernatant contains impurities.

2: reaction

Experimental group: mu.l of the enzyme solution was added to 500. Mu.l of the reaction buffer (containing ATP), and mixed well,

control group: mu.l of the enzyme solution was added to 500. Mu.l of the reaction buffer (containing no ATP), and mixed well,

the reaction is carried out for 30min at 37 ℃,

after the reaction, 250. Mu.l of the prepared stop buffer was added and mixed well,

the supernatant was centrifuged at 4000rpm for 5 min and absorbance was measured at 498nm in an ELISA plate (250. Mu.l per well, 3 replicates).

3: protein concentration detection

Protein concentration determination was performed using the Braford method.

BSA was prepared as solutions of different concentrations (0.0625 mg/ml-1 mg/ml), 3. Mu.l each was taken, the blank was taken 3. Mu.l of extraction buffer, 300. Mu.l of Coomassie Brilliant blue G-250 was added, two replicates were measured per sample, mixed well, 250. Mu.l was taken in an ELISA plate at 595nm, and absorbance was measured. And drawing a standard curve by taking absorbance as an ordinate and BSA concentration as an abscissa.

Mu.l of the enzyme solution was taken, 300. Mu.l of Coomassie brilliant blue G-250 was added thereto, absorbance was measured at 595nm, and the protein concentration was calculated.

4: calculation of

The absorbance of the reaction solution was measured at 498nm, and GS activity was indirectly reflected by the absorbance:

GS Activity (A mg) ^-1 -h ^-1 )=A/(PVT)

A is absorbance measured at 498nm, P is the concentration of the protein measured, V is the volume of the sample added to the reaction system, and T is the reaction time.

As shown in FIG. 3, the enzyme activity of the A309D, A T mutant of the rice glutamine synthetase OsGS1 measured by ferric chloride colorimetry is improved compared with that of the wild type, wherein the enzyme activity of the A309D mutant is improved to 2.5 times, and the enzyme activity of the A309T mutant is improved to 2 times. The A309V mutant has similar enzyme activity to the wild type.

Example 3, experiment of glufosinate resistance of GS1 mutants of maize, wheat, brevibacterium distach

Mutants of homologous glutamine synthetase of maize (Zea mays), wheat (Triticum aestivum) and brachypodium distachyon (Brachypodium distachyon) were constructed, respectively, with mutation sites of A309D, A V and A309T. By designing a primer with base mutation, introducing corresponding mutation in a PCR mode, and transforming yeast by a PCR product, the yeast mutant with different mutation is obtained.

Two replicates were selected for each mutant and growth competition experiments were performed in YPD medium at 10g/L glufosinate. OD values were measured at 660nm every 1-2 hours, and after 5-6 hours of continuous measurement, the increase in the number of yeast cells compared to time zero was counted.

As shown in FIG. 4, the A309D, A309T, A V yeast mutant with the 309 th amino acid mutation of the glutamine synthetase of corn, wheat and brachypodium distachyon showed strong growth advantage compared with the wild type in YPD medium containing 10g/L glufosinate, and the resistance to glufosinate was greatly improved compared with the wild type.

Example 4 glufosinate resistance experiments of transgenic plants

The experimental procedure was as follows:

connecting the 35S promoter sequence and the target gene CDS sequence through fusion PCR to obtain 35S-OsGS1-WT and 35S-OsGS1-A309D;

and (3) carrier enzyme cutting: extracting plasmid from empty vector XF675 to be constructed, performing double enzyme digestion, and recovering gel;

and (3) constructing a carrier: connecting the fragments with a carrier by utilizing a homologous recombination mode, transforming escherichia coli competence, and coating on a LB culture medium with carrier resistance;

selecting single colony, culturing and carrying out PCR identification, sequencing PCR products with correct sizes, and comparing sequencing results;

transforming agrobacterium: single colony culture with correct sequencing, plasmid extraction and agrobacterium transformation;

infection: agrobacterium is transformed and then coated on an LB plate containing hygromycin resistance, and monoclonal is selected for bacterial liquid identification, and after identification, the arabidopsis is cultivated and used for infection (inflorescence dip-dyeing method);

Screening positive seedlings: obtaining T0 generation seeds from infected arabidopsis thaliana, paving the T0 generation seeds on an MS culture medium containing antibiotics, screening out transgenic T1 generation seedlings containing hygromycin resistance, and transplanting the seedlings to a plug tray;

and (3) identification: the positive seedlings of the T1 generation are obtained by utilizing the PCR identification of the primers on the carrier and the fragments, and the seedlings growing for about 2-3 weeks are selected for the glufosinate-ammonium spraying experiment;

the spraying conditions are as follows: 150 About 1.5mL of the glufosinate solution per liter and about 0.225mg of the active ingredient per 10-basin spray;

the plants were then tracked for phenotypic changes.

The results are shown in FIG. 5, and on day 2 after the glufosinate was sprayed, all wild-type plants (35S-OsGS 1-WT) and part of the smaller mutant plants (35S-OsGS 1-A309D) began to show symptoms of leaf yellowing; on day 13 after spraying, the wild type seedlings had all died, while most of the leaves of the mutant seedlings appeared green, did not yellow, and remained alive even on day 16 after spraying.

It can be seen that Arabidopsis transformed with the rice glutamine synthetase A309D mutant is more resistant to glufosinate compared to Arabidopsis transformed with the rice glutamine synthetase wild-type.

Description of sequences to which the present application relates:

>SEQ ID NO:1 NM 001401969.1:242-1312 Oryza sativa Japonica Group glutamine synthetase cytosolic isozyme 1-1-like (LOC4330649)

>SEQ ID NO:2 Oryza sativa-GS1-A309D

>SEQ ID NO:3 Oryza sativa-GS1-A309T

>SEQ ID NO:4 Oryza sativa-GS1-A309V

>SEQ ID NO:5 ENA|AAZ30057|AAZ30057.1 Triticum aestivum (bread wheat) glutamine synthetase isoform GS1a

>SEQ ID NO:6 Triticum aestivum-GS1a-A309D

>SEQ ID NO:7 Triticum aestivum-GS1a-A309T

>SEQ ID NO:8 Triticum aestivum-GS1a-A309V

>SEQ ID NO:9 XM 010237849.3:97-1167 PREDICTED: Brachypodium distachyon glutamine synthetase cytosolic isozyme 1-1 (LOC100845598)

>SEQ ID NO:10 Brachypodium distachyo-GS1-A309D

>SEQ ID NO:11 Brachypodium distachyo-GS1-A309T

>SEQ ID NO:12 Brachypodium distachyo-GS1-A309V

>SEQ ID NO:13 NM 001111826.1:28-1098 Zea mays glutamine synthetase 4 (LOC542214)

>SEQ ID NO:14 Zea mays-GS1-A309D

>SEQ ID NO:15 Zea mays-GS1-A309T

>SEQ ID NO:16 Zea mays-GS1-A309V

17 Oryza sativa-GS1-WT coding sequence of SEQ ID NO

SEQ ID NO. 18 Oryza sativa-GS1-A309D coding sequence

SEQ ID NO. 19 Oryza sativa-GS1-A309T coding sequence

SEQ ID NO. 20 Oryza sativa-GS1-A309V coding sequence

SEQ ID NO. 21 Triticum aestivum-GS1-WT coding sequence

SEQ ID NO. 22 Triticum aestivum-GS1-A309D coding sequence

SEQ ID NO. 23 Triticum aestivum-GS1-A309T coding sequence

SEQ ID NO. 24 Triticum aestivum-GS1-A309V coding sequence

SEQ ID NO 25 Brachypodium distachyon-GS1-WT coding sequence

SEQ ID NO. 26 Brachypodium distachyon-GS1-A309D coding sequence

SEQ ID NO 27 Brachypodium distachyon-GS1-A309T coding sequence

28 Brachypodium distachyon-GS1-A309V coding sequence of SEQ ID NO

SEQ ID NO. 29 Zea mays-GS1-WT coding sequence

SEQ ID NO. 30 Zea mays-GS1-A309D coding sequence

SEQ ID NO. 31 Zea mays-GS1-A309T coding sequence

SEQ ID NO. 32 Zea mays-GS1-A309V coding sequence

SEQ ID NO. 33 Oryza meyeriana var granula verrucosa

>tr|A0A6G1F6W2|A0A6G1F6W2_9ORYZ Glutamine synthetase OS=Oryza meyeriana var. granulata OX=110450 GN=E2562_010434 PE=3 SV=1

34 Oryza barthii wild rice with SEQ ID NO

>tr|A0A0D3FA68|A0A0D3FA68_9ORYZ Glutamine synthetase OS=Oryza barthii OX=65489 PE=3 SV=1

35 Oryza glaberrima African cultivated rice with SEQ ID NO

>XP_052142623.1 glutamine synthetase cytosolic isozyme 1-1 [Oryza glaberrima]

>SEQ ID NO:36 Panicum hallii

>tr|A0A2T7FBU0|A0A2T7FBU0_9POAL Glutamine synthetase OS=Panicum hallii var. hallii OX=1504633 GN=GQ55_1G380900 PE=3 SV=1

37-Panicum miliaceum Pang of SEQ ID NO

>tr|A0A3L6QI78|A0A3L6QI78_PANMI Glutamine synthetase OS=Panicum miliaceum OX=4540 GN=C2845_PM12G26540 PE=3 SV=1

38 Seria Alica millet of SEQ ID NO

>tr|K3YTN2|K3YTN2_SETIT Glutamine synthetase OS=Setaria italica OX=4555 GN=101772334 PE=3 SV=1

SEQ ID NO 39 Sorgum bicolor Sorghum

>tr|A0A194YRE9|A0A194YRE9_SORBI Glutamine synthetase OS=Sorghum bicolor OX=4558 GN=SORBI_3004G247000 PE=3 SV=1

SEQ ID NO. 40 Leersia perrieri false rice

>tr|A0A0D9VKQ2|A0A0D9VKQ2_9ORYZ Glutamine synthetase OS=Leersia perrieri OX=77586 PE=3 SV=1

SEQ ID NO 41 Triticum urartu Ula map wheat

>tr|M7YLX8|M7YLX8_TRIUA Glutamine synthetase OS=Triticum urartu OX=4572 GN=TRIUR3_15479 PE=3 SV=1

SEQ ID NO. 42 Hordeum vulgare barley

>XP_044951282.1 glutamine synthetase [Hordeum vulgare subsp. vulgare]。

Claims

1. A glutamine synthetase mutant characterized in that alanine (a) at position 309 is substituted with threonine (T) or valine (V) relative to a wild type glutamine synthetase shown in SEQ ID No. 1; or alternatively

Characterized in that alanine (A) at position 309 is substituted with aspartic acid (D), threonine (T) or valine (V) relative to the wild-type glutamine synthetase shown in SEQ ID NO. 5, 9 or 13.

2. The glutamine synthetase mutant according to claim 1, characterized in that the glutamine synthetase mutant consists of an amino acid sequence shown in any one of SEQ ID NOs 3 to 4, 6 to 8, 10 to 12, and 14 to 16.

3. A nucleic acid consisting of a nucleotide sequence encoding a glutamine synthetase mutant according to any one of claims 1-2.

4. The nucleic acid according to claim 3, wherein the nucleotide sequence encoding the glutamine synthetase mutant is as shown in any one of SEQ ID NO. 19-20, 22-24, 26-28, 30-32.

5. An expression cassette comprising a nucleotide sequence encoding a glutamine synthetase mutant of any one of claims 1-2 operably linked to a regulatory sequence.

6. The expression cassette of claim 5, wherein the nucleotide sequence encoding the glutamine synthetase mutant is set forth in any one of SEQ ID NO. 19-20, 22-24, 26-28, 30-32.

7. An expression construct comprising the expression cassette of claim 5 or 6.

8. Use of a glutamine synthetase mutant, a nucleic acid consisting of a nucleotide sequence encoding said glutamine synthetase mutant, an expression cassette comprising a nucleotide sequence encoding said glutamine synthetase mutant operably linked to a regulatory sequence or an expression construct comprising said expression cassette for producing a glufosinate-resistant plant,

wherein the glutamine synthetase mutant is characterized in that alanine (a) at position 309 relative to a wild-type glutamine synthetase is substituted with aspartic acid (D), threonine (T), or valine (V);

when the sequence of the wild type glutamine synthetase is shown as SEQ ID NO. 1, the plant is rice (Oryza sativa);

when the wild type glutamine synthetase sequence is shown as SEQ ID NO. 5, the plant is wheat (Triticum aestivum);

when the sequence of the wild glutamine synthetase is shown as SEQ ID NO. 9, the plant is Brevibacterium distachum (Brachypodium distachyon);

When the wild type glutamine synthetase sequence is shown as SEQ ID NO. 13, the plant is maize (Zea mays).

9. The use according to claim 8, characterized in that the glutamine synthetase mutant consists of an amino acid sequence shown in any one of SEQ ID NO 2-4, 6-8, 10-12, and 14-16.

10. The use according to claim 8, characterized in that the nucleotide sequence encoding the glutamine synthetase mutant is shown in any one of SEQ ID NO:18-20, 22-24, 26-28, 30-32.

11. A method for producing a glufosinate-resistant plant by transgenesis, characterized in that the method comprises introducing into a plant a nucleic acid consisting of a nucleotide sequence encoding a glutamine synthetase mutant, an expression cassette comprising a nucleotide sequence encoding a glutamine synthetase mutant operably linked to a regulatory sequence or an expression construct comprising said expression cassette, said introducing resulting in expression of said glutamine synthetase mutant by said plant,

12. The method according to claim 11, characterized in that the glutamine synthetase mutant consists of an amino acid sequence shown in any one of SEQ ID NOs 2 to 4, 6 to 8, 10 to 12, and 14 to 16.

13. The method according to claim 11, characterized in that the nucleotide sequence encoding the glutamine synthetase mutant is shown in any one of SEQ ID NO:18-20, 22-24, 26-28, 30-32.

14. A method for producing a glufosinate-resistant plant, characterized in that the method comprises modifying the coding sequence of an endogenous glutamine synthetase of a plant, thereby causing the endogenous glutamine synthetase to be substituted with aspartic acid (D), threonine (T) or valine (V) at alanine (A) at position 309,

Wherein the method targets the endogenous glutamine synthetase coding sequence of the modified plant by homologous recombination or gene editing, and

when the sequence of the endogenous glutamine synthetase is shown as SEQ ID NO. 1, the plant is rice (Oryza sativa);

when the endogenous glutamine synthetase sequence is shown as SEQ ID NO. 5, the plant is wheat (Triticum aestivum);

when the endogenous glutamine synthetase sequence is shown as SEQ ID NO. 9, the plant is Brevibacterium distachrum (Brachypodium distachyon);

when the endogenous glutamine synthetase sequence is shown in SEQ ID NO. 13, the plant is maize (Zea mays).

15. The method of claim 14, wherein the modification results in the plant expressing a glutamine synthetase mutant that has an alanine (a) at position 309 replaced with an aspartic acid (D), threonine (T), or valine (V) relative to a wild type glutamine synthetase as set forth in SEQ ID No. 1, 5, 9, or 13.

16. The method of claim 14, wherein the modification results in the plant expressing a glutamine synthetase mutant consisting of an amino acid sequence set forth in any one of SEQ ID NOs 2-4, 6-8, 10-12, and 14-16.

17. The method of claim 14, wherein said gene editing comprises introducing into the plant a gene editing system that targets an endogenous glutamine synthetase coding region in the genome of said plant.

18. The method of claim 17, wherein the gene editing system is a CRISPR, ZFN, or TALEN based gene editing system.

19. The method of claim 17, wherein the gene editing system is a base editing system or a guided editing (prime) system.

20. A method for identifying a glufosinate-resistant plant, comprising detecting the expression of a glutamine synthetase having the sequence aspartic acid (D), threonine (T) or valine (V) at amino acid 309 in the plant,

wherein an increase in the expression or expression of the glutamine synthetase relative to a plant that does not express the glutamine synthetase indicates that the plant has resistance to glufosinate or has increased resistance to glufosinate,

wherein the method comprises the steps of

When the sequence is shown as SEQ ID NO. 1, the plant is rice (Oryza sativa);

when the sequence is shown as SEQ ID NO. 5, the plant is wheat (Triticum aestivum);

when the sequence is shown as SEQ ID NO. 9, the plant is brachypodium distachyon (Brachypodium distachyon);

When the sequence is shown in SEQ ID NO. 13, the plant is maize (Zea mays).

21. The method of claim 20, wherein the glutamine synthetase consists of an amino acid sequence set forth in any one of SEQ ID NOs 2-4, 6-8, 10-12, and 14-16.