CN107090447A - Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant - Google Patents

Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant Download PDF

Info

Publication number
CN107090447A
CN107090447A CN201710486852.XA CN201710486852A CN107090447A CN 107090447 A CN107090447 A CN 107090447A CN 201710486852 A CN201710486852 A CN 201710486852A CN 107090447 A CN107090447 A CN 107090447A
Authority
CN
China
Prior art keywords
ala
leu
val
gly
pro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710486852.XA
Other languages
Chinese (zh)
Inventor
张保龙
凌溪铁
王金彦
陈天子
邓惠清
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Academy of Agricultural Sciences
Original Assignee
Jiangsu Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Academy of Agricultural Sciences filed Critical Jiangsu Academy of Agricultural Sciences
Priority to CN201710486852.XA priority Critical patent/CN107090447A/en
Publication of CN107090447A publication Critical patent/CN107090447A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the paddy rice ALS muteins for making plant have Herbicid resistant.The invention also discloses the nucleic acid for encoding above-mentioned albumen.The albumen source is in the rice mutant plant of anti-ALS inhibitor class herbicide, compared with the ALS sequences in wild rice genome, and its protein sequence is undergone mutation or only undergone mutation in Gly628 sites simultaneously in Ser627 and Gly628 sites.Plant, which expresses the protein sequence, to be resisted（It is resistance to）Inhibitor of acetolactate synthetase class herbicide, particularly imidazolinone herbicide, the antiweed ability for the mutant plants that the mutant antiweed effect ratio that Ser627 and Gly628 sites of the invention are undergone mutation simultaneously comprises only Ser627 sites or comprises only Gly628 site mutations is high by 30% or so.

Description

Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant
Technical field
The invention belongs to vegetable protein and plant antiweed field, it is related to the paddy rice for making plant that there is Herbicid resistant ALS muteins, gene and its application；Specifically, it is mutated egg the present invention relates to the acetolactate synthestase of paddy rice (ALS) In vain, the albumen can assign the characteristic of plant especially Rice Resistance inhibitor of acetolactate synthetase class herbicide.The invention discloses The sequence of the albumen, and their applications in plant antiweed field.
Background technology
Weeds are the unfavorable factors for restricting agricultural production high and stable yields.With tradition by cultivation step, artificial weeding and machine The methods such as tool weeding are compared, and the use of chemical herbicide is a kind of efficient, easy and economic improvement weeds method.
Acetolactate synthestase (ALS) (is also referred to as acetohydroxy acid synthetase, AHAS；EC 4.1.3.18) inhibitor class weeding Agent causes weeds dead using ALS as target, mainly including sulfonylurea (Sulfonylureas, SU), imidazolone type (Imidazolinones, IMI), triazolo pyrimidine class (Triazolopyrimidines, TP), pyrimidine oxygen (sulphur) benzoic acids [Pyrimidinylthio(or oxy)–benzoates,PTB；pyrimidinyl-carboxyherbicides；PCs] and sulphur The class compound of amide groups carbonyltriazolinone (Sulfonylamino-carbonyltriazolinones, SCT) etc. 13.Second Acyl lactic acid synzyme, is present in growing process, and it can be catalyzed pyruvic acid with high specificity and high catalytic efficiency For acetolactic acid, so as to cause the biosynthesis of branched-chain amino acid.ALS inhibitor is that herbicide destroys plant by suppressing ALS The synthesis of valine, leucine and isoleucine in object.And leucine, isoleucine, valine be in plant 3 kinds it is required Branched-chain amino acid.ALS is to be catalyzed the key enzyme that the first step is reacted in valine and isoleucine biosynthetic process, bright The building-up process of propylhomoserin is then more complicated, wherein the building-up process from pyruvic acid to α-ketoisovaleric acid and valine are completely the same, so Leucine is just formed afterwards, so, the biosynthesis incipient stage of this 3 kinds of amino acid is both needed to ALS catalysis.ALS is also plant side chain 3 adjust one of enzyme in amino acid bio building-up process, the feedback regulation of its activity by product valine and isoleucine.ALS Inhibitor can reduce ALS vigor in plant, cause this 3 kinds of branched-chain amino acid biosynthesis blocks, influence the synthesis of protein, enter One step suppresses cell division, causes plant tissue chlorosis, yellow, plant strain growth is suppressed, finally gradually dead.
The features such as ALS inhibitor classes herbicide has strong selectivity, broad weed-killing spectrum, efficient low toxicity, large area is pushed away at present Extensively use.But these herbicides also produce poisoning in itself to the general crops without anti-(resistance to) herbicidal properties, greatly limit Its use time is made and has used space, crops are just avoided that using herbicide for the previous period if desired in crop seeding By poisoning.Chemical injury of crops can be reduced, widen the use scope of herbicide by cultivating anti-(resistance to) herbicide crop varieties.
Ripe ALS albumen is about made up of 670 amino acid, and its sequence is highly conserved between different plant species.ALS albumen In Gly 95, Ala 96, Ala 122, Pro 171, Pro 196, Pro 197, Ala 205, Asp 376, Trp 537, Trp 548、Trp 552、Trp 557、Trp 563、Trp 574、Ser 621、Ser 627、Ser 638、Ser 653、Gly 654、 The grades of Val 669 amino acid sites (the ALS amino acid positions of plant Arabidopsis thaliana are calculated in mode) are undergone mutation and can produce ALS suppressions Preparation class Herbicid resistant, this intends in multiple kinds of crops (including corn, paddy rice, paddy rice, rape, sunflower etc.), model plant Had been reported that in southern mustard and hundreds of weeds.
Wherein, anti-ALS inhibitor mutational site known to paddy rice include Gly 95, Ala 96, Ala 122, Trp 548, Ser 627, Ser 653 and Gly 654.ALS mutant antiweed levels are relevant with the position of ALS amino acid mutations, also with The number of amino acid classes and mutating acid after mutation is relevant.
At present, the mechanism of action of ALS inhibitor class herbicide is not yet determined, it is difficult to the other amino of look-ahead ALS albumen Whether the mutation in sour site can produce Herbicid resistant, rely only on long-term, the arduous practical exploration of scientific research personnel, and rely on Some fortune are only possible to find the Herbicid resistant site that ALS albumen is new.
The content of the invention
Goal of the invention：First technical problem to be solved by this invention is to provide the egg for making plant have Herbicid resistant In vain.
The technical problem of the invention also to be solved there is provided the nucleic acid and expression cassette, carrier and cell for encoding the albumen Deng.
The technical problem of the invention also to be solved there is provided the methods and applications for obtaining the plant with Herbicid resistant.
The technical problem of the invention also to be solved there is provided the identification for judging whether plant uses the inventive method to obtain Method.
The present inventor is carried out for a long time, no by long-term, arduous research to the EMS mutant plants of long-grained nonglutinous rice Yangzhou restorer Screen disconnectedly, it was found that a series of ALS mutains, including previously described some known ALS mutains and new ALS mutation Albumen, it is insensitive to ALS inhibitor class herbicides, so that plant has ALS inhibitor class Herbicid resistants.The present invention Application in plant breeding, available for the plant with Herbicid resistant, especially crops are cultivated, also developed these eggs Application of its encoding gene of bletilla in transgenosis or non-transgenic such as paddy rice crop.
Technical scheme：In order to solve the above technical problems, the technical solution adopted by the present invention is as follows：The invention provides cause Plant has the ALS albumen of Herbicid resistant, its amino acid sequence the 627th amino acids by mutant serine be asparagus fern acyl Amine, and/or amino acid sequence the 628th amino acids by glycine mutation be glutamic acid.Show there is presently no report, The mutant strain of Ser627 and Gly628 sites simultaneous mutation from rice varieties Yangzhou restorer ALS albumen and at Gly628 The mutant strain of point mutation.
It is preferred that the albumen of the first aspect of the present invention with the simultaneous mutation of Ser627 and Gly628 sites mutant strain and The mutant strain of Gly628 site mutations, except the mutant plant screening described in the embodiment that has of the present invention or amplification method it Outside, in the case of known to protein sequence, those skilled in the art have the ability by the encoding gene for changing known protein Sequence is simultaneously conducted into carrier, it is possible to prepares substitution, add or lacked the protein of amino acid residue, these methods are equal For conventional meanses.In the embodiment of the present invention, the amino acid sequence of the ALS albumen with Herbicid resistant of the invention Row such as SEQ ID NO:2 or SEQ ID NO:Shown in 6.The albumen is by the confirmation acetyl insensitive to imidazolinone herbicide Lactic acid synzyme.
The second aspect of the present invention provides nucleic acid, and it encodes the protein of first aspect present invention.In the present invention, core Acid can be DNA, RNA, wherein preferably DNA.On the premise of coded protein sequence or nucleotide sequence is known, pass through routine Codon corresponding relation and host expresses frequency, with PCR method, DNA recombination methods or artificial synthesized method, this area skill Art personnel have the ability to obtain the nucleic acid of the simultaneously protein of Optimized Coding Based first aspect present invention.Once obtain the nucleic acid, it is possible to Carrier is cloned into, then converts or be transfected into corresponding cell, is then bred by conventional host cell, Cong Zhongfen From obtaining substantial amounts of nucleic acid.It is preferred that the nucleotide sequence of the nucleic acid of second aspect of the present invention such as SEQ ID NO：1 or SEQ ID NO:Shown in 5.Specifically, the DNA sequence dna of the present invention, be wild type rice varieties Yangzhou restorer als gene sequence the 1880 nucleotides become nucleotides A by G, and/or the 1883rd nucleotides becomes nucleotides A by G.
In addition, the present invention have also obtained the antiweed mutant 2 for only including Ser627 site mutations and only include The antiweed mutant 3 of Gly628 site mutations, by experiment it was found that, contain Ser627 and Gly628 site mutations Mutant is more anti-than the mutant 2 only containing Ser627 sites or the antiweed mutant 3 only containing Gly628 site mutations Herbicid resistant is eager to excel.Wherein, the ALS nucleotide sequences such as SEQ of the antiweed mutant 2 only containing Ser627 site mutations Shown in ID NO.3, amino acid is as shown in SEQ ID NO.4.Antiweed mutant 3 only containing Gly628 site mutations ALS nucleotide sequences are as shown in SEQ ID NO.5, and amino acid is as shown in SEQ ID NO.6.
In addition, the wild rice before present invention mutation is indica type conventional rice seed Yangzhou restorer, the ALS inhibitor The wild type Yangzhou restorer paddy rice ALS of class herbicide sensitive nucleotide sequence is as shown in SEQ ID NO.7, and amino acid is such as Shown in SEQ ID NO.8.
The content of the third aspect of the present invention includes expression cassette, recombinant vector or cell, and it contains above-mentioned second aspect Nucleic acid.
Fourth aspect present invention content also includes the above-mentioned ALS albumen with Herbicid resistant, nucleic acid, expression cassette, again The application of group carrier or cell in terms of green plants antiweed.
Wherein, above-mentioned green plants is paddy rice, tobacco, arabidopsis, cotton etc..
The content of fifth aspect present invention also includes the method for obtaining the plant with Herbicid resistant, including following step Suddenly：
1) plant is made to include nucleic acid of the present invention；Or
2) albumen for making plant expression described.
Wherein, above-mentioned method, including transgenosis, hybridization, backcrossing or vegetative propagation step.
The content of sixth aspect present invention includes the method for plant identification, and wherein plant is the plant for including described nucleic acid The plant that the plant of the described albumen of thing, expression or described method are obtained, specifically includes following steps：
1) determine whether the plant includes described nucleic acid；Or,
2) determine whether the plant expresses described albumen.
Beneficial effect：
1) from the point of view of the present invention is by the ALS enzyme activity determination results to mutant strain, Yangzhou restorer antiweed mutant 1 ALS activity is higher by 30% than the ALS activity of Yangzhou restorer antiweed mutant 2, than Yangzhou restorer antiweed mutant 3 ALS activity it is high by 31%.
2) present invention by field spray ALS inhibitor classes herbicide " hundred ridges lead to " test result indicates that, contain this hair The paddy rice 3-4 leaves seedling of the bright ALS albumen with Herbicid resistant apply 3mL hundred ridges it is logical/L water (9 times recommend it is dense Degree) after, plant still normal growth and development and solid, and wild rice 3-4 leaves seedling apply the ridges of 1mL hundred it is logical/3L water (1 Concentration is recommended again) that whole strain is shown as after 30 days is dead.
Brief description of the drawings
The ridges of Fig. 1 hundred lead to the resistant rice mutant 1 that herbicide screening is obtained；
Fig. 2 PCR expand als gene result figure；1st swimming lane is Marker；Marker molecular weight is followed successively by from top to bottom 3kb, 2kb, 1kb, 750bp, 500bp, 250bp, the 2nd swimming lane are Yangzhou restorer wild rice DNA, and the 3rd swimming lane removes to be anti- The DNA of careless agent mutant 1, the 4th swimming lane is the DNA of antiweed mutant 2, and the 5th swimming lane is the DNA of antiweed mutant 3； Purpose fragment length 2091bp；
The ridges of Fig. 3 hundred lead to herbicide to wild type and Herbicide Resistant Rice antiweed mutant 1, antiweed mutant 2 Determined with the light absorption value of the ALS inhibition of enzyme activity of antiweed mutant 3；
The Overexpression vector BamHI/SacI double digestion proof diagrams of the als gene of Fig. 4 antiweeds mutant 1；1st swimming Road is Marker；Marker molecular weight is followed successively by 3kb, 2kb, 1kb, 750bp, 500bp, 250bp from top to bottom；2nd swimming lane is Recombinant vector without digestion, the 3rd swimming lane is the genetic fragment and plasmid that recombinant vector is produced after BamHI/SacI double digestions Piece segment DNA, genetic fragment size meets expection, it was demonstrated that vector construction success；
Fig. 5 saltant type als gene paddy rice PCR detection figures；A total of 8 swimming lanes, the 1st swimming lane is Marker；Marker points Son amount is followed successively by 3kb, 2kb, 1kb, 750bp, 500bp, 250bp from top to bottom；2nd swimming lane is non-transgenic wild type DNA, is made For negative control, the 3rd swimming lane is DNA, as positive control, and the 4th swimming lane is conversion antiweed mutant 1ALS genes Transfer-gen plant DNA, the 5th swimming lane is the transfer-gen plant DNA of conversion antiweed mutant 2ALS genes, and the 6th swimming lane is Convert the transfer-gen plant DNA of antiweed mutant 3ALS genes.
Transgenic paddy rice of the logical herbicide in the ridges of Fig. 6 hundred to wild rice and containing antiweed mutant 1ALS genes, Transgenic paddy rice containing antiweed mutant 2ALS genes and the transgenosis water containing antiweed mutant 3ALS genes The light absorption value of the ALS inhibition of enzyme activity of rice is determined；
Transgene tobacco of the logical herbicide in the ridges of Fig. 7 hundred to wild-type tobacco and containing antiweed mutant 1ALS genes, Transgene tobacco containing antiweed mutant 2ALS genes and the transgenosis water containing antiweed mutant 3ALS genes The light absorption value of the ALS inhibition of enzyme activity of rice is determined；
The ridges of Fig. 8 hundred lead to herbicide to the heterozygous plant in filial generation, antiweed mutant 2 and antiweed mutant The light absorption value of 3 ALS inhibition of enzyme activity is determined.
Embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will Understand, the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is unreceipted specific in embodiment Condition person, the condition advised according to normal condition or manufacturer is carried out.Agents useful for same or the unreceipted production firm person of instrument, be Can be by the conventional products of acquisition purchased in market.
Embodiment 1：Rice Resistance imidazolinone herbicide mutant acquisition process (hundred ridges lead to)
By indica type conventional rice seed Yangzhou restorer (purchased from the agriculture plasm resource protection in Jiangsu Province and utilizing platform) (this For M0, being soaked 2 hours with clear water) 150kg points to soak 6-9 at room temperature with 0.5-1.0% (w/w) ethyl methane sulfonate (EMS) 6 times small When, shake a seed within during which every 1 hour；EMS solution is discarded, running water stirs immersion seed 5 times, every time 5 minutes, Ran Houyong Running water rinses seed and stayed overnight, and next day carries out field sowing, and carries out conventional fertilizer water management (this is M1).After plant is ripe, plant Son is mixed to be received, dries, preservation of passing the winter.Next year sows field.When paddy rice (this is M2) seedling length to the 3-4 leaf phases, spray as 3mL hundred Ridge is logical/and (" hundred ridges lead to " is that BASF Aktiengesellschaft produces a kind of water aqua type imidazolinone herbicide to L water, recommends minimum uses Concentration is that the ridges of 1mL hundred lead to/1.5~3L water), also in normal green plant it is the paddy rice of anti-imidazolinone herbicide after 30 days Mutant (Fig. 1).211 plants of the M2 individual plants of antiweed are obtained altogether, and these resistance individual plants carry out conventional rich water quality management, there is 198 Individual M2 individual plants can be normally solid, after seed maturity, individual plant sowing, dries, preservation of passing the winter.
Embodiment 2：Anti- imidazolinone herbicide rice mutant mutational site analysis
The Herbicide Resistant Rice mutant plant for taking above-described embodiment 1 to obtain chooses multiple mutant blades, and base is extracted respectively Because of a group DNA, one of Nanjing bio tech ltd is sent to carry out gene order-checking.Sequencing result and Yangzhou restorer wild type Als gene compares, and finds there is three groups of mutant plants, i.e. Herbicide Resistant Rice mutant 1, anti-weeding in above-mentioned paddy rice mutant plant Agent rice mutant 2 and Herbicide Resistant Rice mutant 3, wherein, Herbicide Resistant Rice mutant 1 there occurs 2 on als gene The mutation in individual site, the 1880th, 1883 site bases are undergone mutation, and becoming A, G by G respectively becomes A, causes its corresponding encoded Amino acid sequence the 627th, 628 sites asparagine, glycine are changed into from serine and are changed into glutamic acid, i.e., antiweed is mutated The nucleotide sequence of the als gene of body 1 is as shown in SEQ ID NO.1, the amino acid sequence such as SEQ ID of its ALS albumen encoded Shown in NO.2；Antiweed mutant 2 is only undergone mutation als gene in the 1880th site base, is become A by G respectively, is led The 627th site of the amino acid sequence of its corresponding encoded is caused to be changed into asparagine, i.e. antiweed mutant 2 from serine respectively Als gene nucleotide sequence as shown in SEQ ID NO.3, its encode ALS albumen amino acid sequence such as SEQ ID Shown in NO.4；Antiweed mutant 3 is only undergone mutation als gene in the 1883rd site base, is become A by G, is caused it 628th site of the amino acid sequence of corresponding encoded is changed into the ALS of glutamic acid, i.e. antiweed mutant 3 from glycine respectively The nucleotide sequence of gene is as shown in SEQ ID NO.5, the amino acid sequence such as SEQ ID NO.6 institutes of its ALS albumen encoded Show.
Its Classification And Nomenclature of the Herbicide Resistant Rice mutant 1 of the present invention is rice paddy seed YXL-25 (Oryza sativa Indica Group YXL-25), the bacterial strain is preserved in China typical culture collection center on June 2nd, 2017 (CCTCC), address：Wuhan City, Hubei Province Wuchang District Wuhan University collection (the first affiliated primary school of Wuhan University opposite), postal Compile：430072, deposit number is CCTCC No：P201713.
Its Classification And Nomenclature of the Herbicide Resistant Rice mutant 3 of the present invention is rice paddy seed YXL-63 (Oryza sativa Indica Group YXL-63), the bacterial strain is preserved in China typical culture collection center on June 2nd, 2017 (CCTCC), address：Wuhan City, Hubei Province Wuchang District Wuhan University collection (the first affiliated primary school of Wuhan University opposite), postal Compile：430072, deposit number is CCTCC No：P201712.
Embodiment 3：Anti- imidazolinone herbicide rice mutant als gene clone
Take above-mentioned Herbicide Resistant Rice mutant 1, Herbicide Resistant Rice mutant 2 and Herbicide Resistant Rice mutant 3 Blade, extracts genomic DNA respectively.The spy of als gene total length is expanded according to Yangzhou restorer wild type als gene sequences Design Different primer is：Forward primer F5 '-TCGCCCAAACCCAGAAACCC-3 ', reverse primer R 5 '- CTCTTTATGGGTCATTCAGGTC-3’。
Using Takara PrimerSTAR Max DNA Polymerase polymerases (being purchased from Takara companies) amplification ALS Gene, its reaction system is as follows：
Pcr amplification reaction program uses two-step method, and annealing and extension are combined into together, using 68 degree.
Program is as follows：Pre-degeneration：98℃3min；35 circulations：It is denatured 98 DEG C of 10sec；Extend 68 DEG C of 1min；Insulation：72 ℃10min。
2 μ l PCR primers are taken to be detected through 1% agarose gel electrophoresis, discovery has after the fragment of expected size (Fig. 2), it is remaining PCR primer reclaimed through PCR cleaning agents box (be purchased from Axygen companies) cleaning after, be cloned into pMD19-T carriers and (be purchased from Takara companies), then convert Escherichia coli.Each convert random 12 Escherichia coli clones of picking and enter performing PCR detection, take 6 monoclonals that PCR results are positive, send Nanjing one of bio tech ltd's sequencing, obtain mutation als gene sequence, The genetic fragment length is 2091bp, and the sequencing result of Herbicide Resistant Rice mutant 1ALS genetic fragments is as follows：
CTGCATCGCGTGTCGCCCTTTCGCCCAAACCCAGAAACCCTCGCCGCCGCCGCCGCCGCCATCACCCAC CATGGCTACGACCGCCGCGGCCGCGGCCGCCACCTTGTCCGCCGCCGCGACGGCCAAGACCGGCCGTAAGAACCACC AGCGACACCACGTCCTTCCCGCTCGAGGCCGGGTGGGGGCGGCGGCGGTCAGGTGCTCGGCGGTGTCCCCGGTCACC CCGCCGTCCCCGGCGCCGCCGGCCACGCCGCTCCGGCCGTGGGGGACGGCCGAGCCCCGCAAGGGCGCGGACATCCT CGTGGAGGCGCTGGAGCGGTGCGGCGTCAGCGACGTGTTCGCCTACCCGGGCGGCGCGTCCATGGAGATCCACCAGG CGCTGACGCGCTCCCCGGTCATCACCAACCACCTCTTCCGCCACGAGCAGGGCGAGGCGTTCGCGGCGTCCGGGTAC GCGCGCGCGTCCGGCCGCGTCGGGGTCTGCGTCGCCACCTCCGGCCCCGGGGCAACCAACCTCGTGTCCGCGCTCGC CGACGCGCTGCTCGACTCCGTCCCGATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACCGACGCCT TCCAGGAGACGCCCATAGTCGAGGTCACCCGCTCCATCACCAAGCACAATTACCTTGTCCTTGATGTGGAGGACATC CCCCGCGTCATACAGGAAGCCTTCTTCCTCGCGTCCTCGGGCCGTCCTGGCCCGGTGCTGGTCGACATCCCCAAGGA CATCCAGCAGCAGATGGCTGTGCCAGTCTGGGACACCTCGATGAATCTACCGGGGTACATTGCACGCCTGCCCAAGC CACCCGCGACAGAATTGCTTGAGCAGGTCTTGCGTCTGGTTGGCGAGTCACGGCGCCCGATTCTCTATGTCGGTGGT GGCTGCTCTGCATCTGGTGATGAATTGCGCCGGTTTGTTGAGCTGACCGGCATCCCAGTTACAACCACTCTGATGGG CCTCGGCAATTTCCCCAGTGATGATCCGTTGTCCCTGCGCATGCTTGGGATGCATGGCACGGTGTACGCAAATTATG CGGTGGATAAGGCTGACCTGTTGCTTGCATTTGGCGTGCGGTTTGATGATCGTGTGACAGGGAAAATTGAGGCTTTT GCAAGCAGGGCCAAGATTGTGCACATTGACATTGATCCAGCGGAGATTGGAAAGAACAAGCAACCACATGTGTCAAT TTGCGCAGATGTTAAGCTTGCTTTACAGGGCTTGAATGCTCTGCTAGACCAGAGCACAACAAAGACAAGTTCTGATT TTAGTGCATGGCACAATGAGTTGGACCAGCAGAAGAGGGAGTTTCCTCTGGGGTACAAGACTTTTGGTGAAGAGATC CCACCGCAATATGCTATTCAGGTGCTGGATGAGCTGACGAAAGGGGAGGCAATCATCGCTACTGGTGTTGGACAGCA CCAGATGTGGGCGGCACAATATTACACCTACAAGCGGCCACGGCAGTGGCTGTCTTCGGCTGGTCTGGGCGCAATGG GATTTGGGCTGCCTGCTGCAGCTGGTGCTTCTGTGGCTAACCCAGGTGTCACAGTTGTTGATATTGATGGGGATGGT AGCTTCCTCATGAACATTCAGGAGTTGGCATTGATCCGCATTGAGAACCTCCCGGTGAAGGTGATGGTGTTGAACAA CCAACATTTGGGTATGGTTGTGCAATGGGAGGATAGGTTTTACAAGGCAAATAGGGCGCATACATACTTGGGCAACC CAGAATGTGAGAGCGAGATATATCCAGATTTTGTGACTATTGCTAAAGGGTTCAATATTCCTGCAGTCCGTGTAACA AAGAAGAGTGAAGTCCGTGCCGCCATCAAGAAGATGCTCGAGACCCCAGGGCCATACTTGTTGGATATCATCGTCCC ACACCAGGAGCATGTGCTGCCTATGATCCCAAATGAGGGCGCATTCAAGGACATGATCCTGGATGGTGATGGCAGGA CTATGTATTAATCTATAATCTGTATGTTGGCAAAGCACCAGCCCGGCCTATGTTTGACCTGAATGACCCATAAAGAG AAGGGCGACACGCGATGCAG
Embodiment 4：The anti-imidazolinone herbicide of paddy rice M3 mutant (hundred ridges lead to)
Yangzhou restorer antiweed mutant 1 and Yangzhou restorer antiweed mutant 2 and Yangzhou restorer are resisted The seed insemination and emergence (this is M3) that herbicide mutant 3 is harvested, when M3 rice seedlings length to the 3-4 leaf phases, sprays the ridges of 3mL hundred Logical/L water (recommends minimum concentration to lead to/3L water, equivalent to 9 times concentration for the ridges of 1mL hundred).After herbicide spraying 15 days, resistance Seedling M3 is in normal green, can continue long up to 20-30cm, and non-resistance seedling leaf loses green or even part is withered and yellow, and plant is not Grow tall, only 5-9cm.After 30 days, M3 resistant strains are in normal green plant, and spray the wild type water of same concentration herbicidal agent Rice is all withered, shows that being mutated paddy rice at least resists hundred ridges of 9 times of concentration to lead to herbicide.We are again anti-to Yangzhou restorer to remove Careless agent mutant 1 and Yangzhou restorer antiweed mutant 2 and Yangzhou restorer antiweed mutant 3 spray the ridges of 4mL hundred Logical/L water (equivalent to 12 times concentration) is identified, finds antiweed mutant 1 or normal green is presented, and antiweed Mutant 2 and the plant part of antiweed mutant 3 are withered and yellow.Show containing simultaneously contain Ser627 sites and Gly628 The antiweed ability of the antiweed mutant 1 of point mutation will than antiweed mutant 2 and antiweed mutant 3 It is good.
Embodiment 5：The ALS enzyme activity determinations of paddy rice M3 antiweed mutant
In order to verify rice mutant Herbicid resistant whether by ALS be mutated caused by, present inventor has performed ALS enzyme activity Property determine.Method (Singh B.K., Stidham M.A., Shaner D.L.Assay of of the assay method with reference to Singh etc. acetohydroxyacid synthase.Analytical Biochemistry,1988,171:173-179.).Specifically, Wild type, Yangzhou restorer antiweed mutant 1, Yangzhou restorer antiweed mutant 2 and Yangzhou restorer are taken respectively The M3 plant leaf 0.2g of antiweed mutant 3, are crushed in mortar with liquid nitrogen grinding, add 2mL extract solutions (100mM K2HPO4, pH 7.5,10mM Sodium Pyruvates, 5mM EDTA, 1mM valine, 1mM leucines, 10mM cysteines, 0.1mM are yellow Plain adenine-dinucleotide, 5mM magnesium chlorides, 10% (V/V) glycerine, 1% (w/v) polyvinylpyrrolidone), lyolysis to be extracted is frozen Continue to grind 1min or so afterwards.12000rpm, 4 DEG C of centrifugation 30min, Aspirate supernatant, addition ammonium sulfate make up to 50% and satisfied And degree, in placing on ice half an hour, 12000rpm, 4 DEG C of centrifugation 30min abandon supernatant, will be precipitated and dissolved in 0.2mL reaction bufferings Liquid (100mM K2HPO4, pH 7.0,1mM EDTA, 10mM magnesium chloride, 100mM Sodium Pyruvates, 1mM diphosphothiamines, 0.1mM flavin adenine dinucleotide (FAD)s), respectively each plant ALS extract solutions.
10 μ L herbicides " hundred ridges lead to " (aqua, active ingredient 240g/L) are separately added into ALS extract solutions are obtained, are mixed It is even, 37 DEG C of incubation 1h, plus 0.1ml 3M sulfuric acid terminating reactions, reactant mixture is incubated in 60 DEG C of reactions is easy to decarboxylation in 30 minutes. Plus 0.4mL nitrite ions (0.09g/L 1- naphthols and 0.009g/L creatines, with 2.5M NaOH dissolve) then.Mixed liquor is at 37 DEG C Incubation developed the color within 30 minutes (ALS is catalyzed 2 pyruvic acid formation acetolactic acids, acetolactic acid decarboxylation formation 3-Hydroxybutanone, then Pink compound is formed with creatine and 1- naphthols, the compound has obtained the maximum absorption at 530nm), then determine its 530nm Absorbance, ALS activity represents with A530 light absorption values, the height of the height of A530 light absorption values reflection ALS activity.Experiment using water as Control, wild type, Yangzhou restorer antiweed mutant 1 and Yangzhou antiweed mutant 2 and the anti-weeding of Yangzhou restorer Agent mutant 3 all respectively surveys 5 individual plants.
A530 light absorption values measurement result is found, when wild type, Yangzhou restorer antiweed mutant 1, Yangzhou restorer When there is no the ridge of ALS inhibitor hundred to lead in the ALS extract solutions of antiweed mutant 2 and Yangzhou restorer antiweed mutant 3, Their A530 light absorption values are between 1.2-1.4, and showing the ALS enzymatic activitys of wild type and mutant, there was no significant difference (Fig. 3)； And add the ridge of ALS inhibitor hundred it is logical after, the A530 light absorption values of wild type are only 0.2, Yangzhou restorer antiweed mutant 1 A530 light absorption values are 1.28, and the A530 light absorption values of Yangzhou restorer antiweed mutant 2 are 0.98, the anti-weeding of Yangzhou restorer The A530 light absorption values of agent mutant 3 are only the 16.4% of control for the ALS enzymatic activitys of 0.97, i.e. wild type, and Yangzhou restorer The ALS enzymatic activitys of antiweed mutant 1, antiweed mutant 2 and antiweed mutant 3 still have more than 75% (Fig. 3), Show that Yangzhou restorer antiweed mutant 1, Yangzhou restorer antiweed mutant 2 and Yangzhou restorer antiweed are prominent The ALS of variant 3 leads to insensitive to hundred ridges, so as to impart resistance.From the point of view of the effect of antiweed, the anti-weeding of Yangzhou restorer The ALS activity of agent mutant 1 is higher by 30% than Yangzhou restorer antiweed mutant 2, than the mutation of Yangzhou restorer antiweed Body 3 high 31%.Therefore the antiweed effect of Yangzhou restorer antiweed mutant 1 is mutated than Yangzhou restorer antiweed Body 2 and Yangzhou restorer antiweed mutant 3 will get well.
Embodiment 6：The ridge of transgenosis ALS Rice Resistances hundred leads to
Design special primer 5 '-CGCGGATCCATCCGAGCCACACATCGCCTC-3 ' and 5 '- TCCCCGCGGCCTACGGAAAACAACACAC-3 ', it 5 ' is separately added into BamHI and SacI digestion decorating sites.Reference implementation The method of example 3, by PCR from above-mentioned rice mutant Yangzhou restorer antiweed mutant 1, Yangzhou restorer antiweed Mutation als gene is amplified in the genomic DNA of mutant 2 and Yangzhou restorer antiweed mutant 3, after sequencing is correct, (it is purchased from BamHI and SacI difference double digestion mutation als gene fragments and plant expression vector pCAMBIA1301 plasmids Pcambia companies), digestion products T4-DNA enzymes (being purchased from TaKaRa companies) connection, connection product conversion Escherichia coli.Restructuring Plasmid extraction DNA, is verified with BamHI and SacI double digestions, can produce big plasmid fragments and small genetic fragment (Fig. 4), Als gene of the nucleotide sequence as shown in SEQ ID NO.1 or 3 or 5 is cloned into plant expression vector by proof In pCAMBIA1301 plasmids (being purchased from pcambia companies).The plasmid vector built is converted into Agrobacterium EHA105, bacterium is cultivated Body.Using conventional Agrobacterium-mediated transformation Japonica rice Nipponbare (purchased from the agriculture plasm resource protection in Jiangsu Province with utilizing Platform), obtain after transfer-gen plant sowing, during Progeny plants length to the 3-4 leaf phases, PCR detection transfer-gen plants (Fig. 5).PCR is examined Survey primer be forward primer 35SF 5 '-ATGGTTAGAGAGGCTTACGC-3 ', reverse primer 5R 5 '- AGCAACAGGTCAGCCTTATCCAC-3 ', amplified fragments include 5 ' terminal sequences of CaMV35S promoters and als gene, size About 2kb.Pcr amplification reaction system reference implementation example 3, pcr amplification reaction program uses two-step method, and annealing and extension are combined into one Rise, using 68 degree.Amplification program is as follows：Pre-degeneration：98℃3min；30 circulations：It is denatured 98 DEG C of 10sec；Extend 68 DEG C of 2min； Insulation：72℃10min.After being positive through PCR identifications, spray the ridges of 3mL hundred and lead to/L water (9 times recommend concentration), after 7 days, ginseng ALS enzymatic activitys are determined according to the methods described of embodiment 6, it is found that the ALS enzymatic activitys of transgenic paddy rice are significantly higher than non-transgenic paddy rice； Find that transgenic paddy rice growth conditions are good after 30 days, and non-transgenic Nipponbare paddy rice is then all withered.Compare conversion Yangzhou Restorer antiweed mutant 1, Yangzhou restorer antiweed mutant 2 and Yangzhou restorer antiweed mutant 3 The ALS enzymatic activitys of the Transgenic Rice plant of als gene, find the ALS containing Yangzhou restorer antiweed mutant 1 The transfer-gen plant ALS activity ratios of gene contain the transfer-gen plant of the als gene of Yangzhou restorer antiweed mutant 2 ALS enzyme activity it is high by 32%, than the ALS enzyme activity of the transfer-gen plant of the als gene containing Yangzhou restorer antiweed mutant 3 High by 34% (Fig. 6).
Embodiment 7：Transgenosis ALS tobaccos resist hundred ridges to lead to
Design special primer 5 '-CGCGGATCCATCCGAGCCACACATCGCCTC-3 ' and 5 '- TCCCCGCGGCCTACGGAAAACAACACAC-3 ', it 5 ' is separately added into BamHI and SacI digestion decorating sites.By PCR from Yangzhou restorer antiweed mutant 1, Yangzhou restorer antiweed mutant 2 and Yangzhou restorer antiweed mutant Mutation als gene is amplified in 3 genomic DNA, after sequencing is correct, with reference to the method for embodiment 7 by nucleotide sequence such as SEQ Als gene shown in ID NO.1 or 3 or 5 is cloned into plant expression vector pCAMBIA2301 plasmids (being purchased from pcambia companies) In.Positive colony conversion Agrobacterium EHA105 is selected, using conventional Agrobacterium-mediated transformation Ben Shi cigarette leaf dish, acquisition turns base After plant sowing, during Progeny plants length to the 3-4 leaf phases, after being positive through PCR identifications, spray the ridges of 3mL hundred it is logical/(9 times push away L water Recommend concentration), after 7 days, ALS enzymatic activitys are determined with reference to the methods described of embodiment 6, the ALS enzymatic activitys of transgene tobacco are found It is significantly higher than non-transgenic tobacco；Find that transgene tobacco growth conditions are good after 30 days, and non-transgenic tobacco is then all withered Extremely.Compare the ALS bases of conversion Yangzhou restorer antiweed mutant 1, antiweed mutant 2 and antiweed mutant 3 The ALS enzymatic activitys of the transgene tobacco Progeny plants of cause, find the als gene containing Yangzhou restorer antiweed mutant 1 Transfer-gen plant ALS activity ratios contain Yangzhou restorer antiweed mutant 2 als gene transfer-gen plant height 31%, than high by 27% (Fig. 7) of the transfer-gen plant of the als gene containing Yangzhou restorer antiweed mutant 3.
Embodiment 8：The hybridization and identification of resistant material
In order to detect whether the resistant plant with 2 mutational sites than the resistant plant with Single locus catastrophe point Weeding tolerance is stronger, and we are hybridized the Single locus mutation in embodiment 2, and selection only contains the single positions of Ser627 The Yangzhou restorer antiweed mutant 2 of the point mutation and Yangzhou restorer being only mutated containing Gly628 Single locus is anti-removes Careless agent mutant 3 dashes forward Yangzhou restorer antiweed mutant 2 and Yangzhou restorer antiweed in chamber planting, florescence Variant 3 is hybridized.Specific method is that, by the artificial emasculation of Yangzhou restorer mutant 2 and bagging, Yangzhou restorer mutant 3 is planted When strain is bloomed, glume is cut, is placed 10 minutes under light, paternal pollen is trembled into the column cap to Yangzhou restorer mutant 2 On, it is repeated 2 times, after sowing after seed maturity, as F1 generation hybrid plant.In the F1 generation hybridization of harvest after a breeding generation, harvest F2 is for colony, and identification carries the individual of Ser627 and Gly628 site mutations simultaneously in the colony.With herbicide to heterozygosis Plant and antiweed mutant 2 and the parent of antiweed mutant 3 carry out spraying experiment simultaneously, as a result show, contain simultaneously There is the plant of 2 site mutations relative to the plant for comprising only Single locus mutation, the resistance to herbicide is significantly improved.We The ALS enzyme activity to heterozygous plant, antiweed mutant 2 and antiweed mutant 3 is measured again, finds heterozygous plant ALS activity ratio's antiweeds mutant 2 is high by 31%, than antiweed mutant 3 high 25% (Fig. 8).
Although the embodiment of the present invention has been described in detail, it will be understood to those of skill in the art that.According to Those details can be carried out various modifications and replacement, these are in protection scope of the present invention by disclosed all teachings It is interior.The four corner of the present invention is provided by extremely any equivalent of appended patent requirements.
SEQUENCE LISTING
<110>Jiangsu Province Agriculture Science Institute
<120>Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant
<130> SG20170620001
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 1935
<212> DNA
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 1
<220>
<221> CDS
<222> (1)..(1935)
<400> 1
atg gct acg acc gcc gcg gcc gcg gcc gcc acc ttg tcc gcc gcc gcg 48
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
acg gcc aag acc ggc cgt aag aac cac cag cga cac cac gtc ctt ccc 96
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
gct cga ggc cgg gtg ggg gcg gcg gcg gtc agg tgc tcg gcg gtg tcc 144
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
ccg gtc acc ccg ccg tcc ccg gcg ccg ccg gcc acg ccg ctc cgg ccg 192
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
tgg ggg acg gcc gag ccc cgc aag ggc gcg gac atc ctc gtg gag gcg 240
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
ctg gag cgg tgc ggc gtc agc gac gtg ttc gcc tac ccg ggc ggc gcg 288
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
tcc atg gag atc cac cag gcg ctg acg cgc tcc ccg gtc atc acc aac 336
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
cac ctc ttc cgc cac gag cag ggc gag gcg ttc gcg gcg tcc ggg tac 384
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
gcg cgc gcg tcc ggc cgc gtc ggg gtc tgc gtc gcc acc tcc ggc ccc 432
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
ggg gca acc aac ctc gtg tcc gcg ctc gcc gac gcg ctg ctc gac tcc 480
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
gtc ccg atg gtc gcc atc acg ggc cag gtc ccc cgc cgc atg atc ggc 528
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
acc gac gcc ttc cag gag acg ccc ata gtc gag gtc acc cgc tcc atc 576
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
acc aag cac aat tac ctt gtc ctt gat gtg gag gac atc ccc cgc gtc 624
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
ata cag gaa gcc ttc ttc ctc gcg tcc tcg ggc cgt cct ggc ccg gtg 672
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
ctg gtc gac atc ccc aag gac atc cag cag cag atg gct gtg cca gtc 720
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
tgg gac acc tcg atg aat cta ccg ggg tac att gca cgc ctg ccc aag 768
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
cca ccc gcg aca gaa ttg ctt gag cag gtc ttg cgt ctg gtt ggc gag 816
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
tca cgg cgc ccg att ctc tat gtc ggt ggt ggc tgc tct gca tct ggt 864
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
gat gaa ttg cgc cgg ttt gtt gag ctg acc ggc atc cca gtt aca acc 912
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
act ctg atg ggc ctc ggc aat ttc ccc agt gat gat ccg ttg tcc ctg 960
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
cgc atg ctt ggg atg cat ggc acg gtg tac gca aat tat gcg gtg gat 1008
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
aag gct gac ctg ttg ctt gca ttt ggc gtg cgg ttt gat gat cgt gtg 1056
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
aca ggg aaa att gag gct ttt gca agc agg gcc aag att gtg cac att 1104
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
gac att gat cca gcg gag att gga aag aac aag caa cca cat gtg tca 1152
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
att tgc gca gat gtt aag ctt gct tta cag ggc ttg aat gct ctg cta 1200
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
gac cag agc aca aca aag aca agt tct gat ttt agt gca tgg cac aat 1248
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
gag ttg gac cag cag aag agg gag ttt cct ctg ggg tac aag act ttt 1296
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
ggt gaa gag atc cca ccg caa tat gct att cag gtg ctg gat gag ctg 1344
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
acg aaa ggg gag gca atc atc gct act ggt gtt gga cag cac cag atg 1392
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
tgg gcg gca caa tat tac acc tac aag cgg cca cgg cag tgg ctg tct 1440
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
tcg gct ggt ctg ggc gca atg gga ttt ggg ctg cct gct gca gct ggt 1488
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
gct tct gtg gct aac cca ggt gtc aca gtt gtt gat att gat ggg gat 1536
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
ggt agc ttc ctc atg aac att cag gag ttg gca ttg atc cgc att gag 1584
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
aac ctc ccg gtg aag gtg atg gtg ttg aac aac caa cat ttg ggt atg 1632
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
gtt gtg caa tgg gag gat agg ttt tac aag gca aat agg gcg cat aca 1680
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
tac ttg ggc aac cca gaa tgt gag agc gag ata tat cca gat ttt gtg 1728
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
act att gct aaa ggg ttc aat att cct gca gtc cgt gta aca aag aag 1776
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
agt gaa gtc cgt gcc gcc atc aag aag atg ctc gag acc cca ggg cca 1824
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
tac ttg ttg gat atc atc gtc cca cac cag gag cat gtg ctg cct atg 1872
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
atc cca aat gag ggc gca ttc aag gac atg atc ctg gat ggt gat ggc 1920
Ile Pro Asn Glu Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
agg act atg tat taa 1935
Arg Thr Met Tyr
<210> 2
<211> 644
<212> PRT
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 1
<400> 2
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Asn Glu Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 3
<211> 1935
<212> DNA
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 2
<220>
<221> CDS
<222> (1)..(1935)
<400> 3
atg gct acg acc gcc gcg gcc gcg gcc gcc acc ttg tcc gcc gcc gcg 48
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
acg gcc aag acc ggc cgt aag aac cac cag cga cac cac gtc ctt ccc 96
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
gct cga ggc cgg gtg ggg gcg gcg gcg gtc agg tgc tcg gcg gtg tcc 144
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
ccg gtc acc ccg ccg tcc ccg gcg ccg ccg gcc acg ccg ctc cgg ccg 192
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
tgg ggg acg gcc gag ccc cgc aag ggc gcg gac atc ctc gtg gag gcg 240
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
ctg gag cgg tgc ggc gtc agc gac gtg ttc gcc tac ccg ggc ggc gcg 288
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
tcc atg gag atc cac cag gcg ctg acg cgc tcc ccg gtc atc acc aac 336
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
cac ctc ttc cgc cac gag cag ggc gag gcg ttc gcg gcg tcc ggg tac 384
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
gcg cgc gcg tcc ggc cgc gtc ggg gtc tgc gtc gcc acc tcc ggc ccc 432
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
ggg gca acc aac ctc gtg tcc gcg ctc gcc gac gcg ctg ctc gac tcc 480
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
gtc ccg atg gtc gcc atc acg ggc cag gtc ccc cgc cgc atg atc ggc 528
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
acc gac gcc ttc cag gag acg ccc ata gtc gag gtc acc cgc tcc atc 576
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
acc aag cac aat tac ctt gtc ctt gat gtg gag gac atc ccc cgc gtc 624
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
ata cag gaa gcc ttc ttc ctc gcg tcc tcg ggc cgt cct ggc ccg gtg 672
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
ctg gtc gac atc ccc aag gac atc cag cag cag atg gct gtg cca gtc 720
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
tgg gac acc tcg atg aat cta ccg ggg tac att gca cgc ctg ccc aag 768
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
cca ccc gcg aca gaa ttg ctt gag cag gtc ttg cgt ctg gtt ggc gag 816
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
tca cgg cgc ccg att ctc tat gtc ggt ggt ggc tgc tct gca tct ggt 864
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
gat gaa ttg cgc cgg ttt gtt gag ctg acc ggc atc cca gtt aca acc 912
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
act ctg atg ggc ctc ggc aat ttc ccc agt gat gat ccg ttg tcc ctg 960
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
cgc atg ctt ggg atg cat ggc acg gtg tac gca aat tat gcg gtg gat 1008
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
aag gct gac ctg ttg ctt gca ttt ggc gtg cgg ttt gat gat cgt gtg 1056
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
aca ggg aaa att gag gct ttt gca agc agg gcc aag att gtg cac att 1104
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
gac att gat cca gcg gag att gga aag aac aag caa cca cat gtg tca 1152
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
att tgc gca gat gtt aag ctt gct tta cag ggc ttg aat gct ctg cta 1200
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
gac cag agc aca aca aag aca agt tct gat ttt agt gca tgg cac aat 1248
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
gag ttg gac cag cag aag agg gag ttt cct ctg ggg tac aag act ttt 1296
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
ggt gaa gag atc cca ccg caa tat gct att cag gtg ctg gat gag ctg 1344
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
acg aaa ggg gag gca atc atc gct act ggt gtt gga cag cac cag atg 1392
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
tgg gcg gca caa tat tac acc tac aag cgg cca cgg cag tgg ctg tct 1440
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
tcg gct ggt ctg ggc gca atg gga ttt ggg ctg cct gct gca gct ggt 1488
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
gct tct gtg gct aac cca ggt gtc aca gtt gtt gat att gat ggg gat 1536
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
ggt agc ttc ctc atg aac att cag gag ttg gca ttg atc cgc att gag 1584
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
aac ctc ccg gtg aag gtg atg gtg ttg aac aac caa cat ttg ggt atg 1632
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
gtt gtg caa tgg gag gat agg ttt tac aag gca aat agg gcg cat aca 1680
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
tac ttg ggc aac cca gaa tgt gag agc gag ata tat cca gat ttt gtg 1728
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
act att gct aaa ggg ttc aat att cct gca gtc cgt gta aca aag aag 1776
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
agt gaa gtc cgt gcc gcc atc aag aag atg ctc gag acc cca ggg cca 1824
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
tac ttg ttg gat atc atc gtc cca cac cag gag cat gtg ctg cct atg 1872
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
atc cca aat ggg ggc gca ttc aag gac atg atc ctg gat ggt gat ggc 1920
Ile Pro Asn Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
agg act atg tat taa 1935
Arg Thr Met Tyr
<210> 4
<211> 644
<212> PRT
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 2
<400> 4
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Asn Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 5
<211> 1935
<212> DNA
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 3
<220>
<221> CDS
<222> (1)..(1935)
<400> 5
atg gct acg acc gcc gcg gcc gcg gcc gcc acc ttg tcc gcc gcc gcg 48
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
acg gcc aag acc ggc cgt aag aac cac cag cga cac cac gtc ctt ccc 96
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
gct cga ggc cgg gtg ggg gcg gcg gcg gtc agg tgc tcg gcg gtg tcc 144
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
ccg gtc acc ccg ccg tcc ccg gcg ccg ccg gcc acg ccg ctc cgg ccg 192
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
tgg ggg acg gcc gag ccc cgc aag ggc gcg gac atc ctc gtg gag gcg 240
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
ctg gag cgg tgc ggc gtc agc gac gtg ttc gcc tac ccg ggc ggc gcg 288
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
tcc atg gag atc cac cag gcg ctg acg cgc tcc ccg gtc atc acc aac 336
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
cac ctc ttc cgc cac gag cag ggc gag gcg ttc gcg gcg tcc ggg tac 384
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
gcg cgc gcg tcc ggc cgc gtc ggg gtc tgc gtc gcc acc tcc ggc ccc 432
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
ggg gca acc aac ctc gtg tcc gcg ctc gcc gac gcg ctg ctc gac tcc 480
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
gtc ccg atg gtc gcc atc acg ggc cag gtc ccc cgc cgc atg atc ggc 528
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
acc gac gcc ttc cag gag acg ccc ata gtc gag gtc acc cgc tcc atc 576
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
acc aag cac aat tac ctt gtc ctt gat gtg gag gac atc ccc cgc gtc 624
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
ata cag gaa gcc ttc ttc ctc gcg tcc tcg ggc cgt cct ggc ccg gtg 672
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
ctg gtc gac atc ccc aag gac atc cag cag cag atg gct gtg cca gtc 720
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
tgg gac acc tcg atg aat cta ccg ggg tac att gca cgc ctg ccc aag 768
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
cca ccc gcg aca gaa ttg ctt gag cag gtc ttg cgt ctg gtt ggc gag 816
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
tca cgg cgc ccg att ctc tat gtc ggt ggt ggc tgc tct gca tct ggt 864
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
gat gaa ttg cgc cgg ttt gtt gag ctg acc ggc atc cca gtt aca acc 912
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
act ctg atg ggc ctc ggc aat ttc ccc agt gat gat ccg ttg tcc ctg 960
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
cgc atg ctt ggg atg cat ggc acg gtg tac gca aat tat gcg gtg gat 1008
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
aag gct gac ctg ttg ctt gca ttt ggc gtg cgg ttt gat gat cgt gtg 1056
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
aca ggg aaa att gag gct ttt gca agc agg gcc aag att gtg cac att 1104
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
gac att gat cca gcg gag att gga aag aac aag caa cca cat gtg tca 1152
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
att tgc gca gat gtt aag ctt gct tta cag ggc ttg aat gct ctg cta 1200
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
gac cag agc aca aca aag aca agt tct gat ttt agt gca tgg cac aat 1248
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
gag ttg gac cag cag aag agg gag ttt cct ctg ggg tac aag act ttt 1296
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
ggt gaa gag atc cca ccg caa tat gct att cag gtg ctg gat gag ctg 1344
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
acg aaa ggg gag gca atc atc gct act ggt gtt gga cag cac cag atg 1392
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
tgg gcg gca caa tat tac acc tac aag cgg cca cgg cag tgg ctg tct 1440
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
tcg gct ggt ctg ggc gca atg gga ttt ggg ctg cct gct gca gct ggt 1488
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
gct tct gtg gct aac cca ggt gtc aca gtt gtt gat att gat ggg gat 1536
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
ggt agc ttc ctc atg aac att cag gag ttg gca ttg atc cgc att gag 1584
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
aac ctc ccg gtg aag gtg atg gtg ttg aac aac caa cat ttg ggt atg 1632
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
gtt gtg caa tgg gag gat agg ttt tac aag gca aat agg gcg cat aca 1680
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
tac ttg ggc aac cca gaa tgt gag agc gag ata tat cca gat ttt gtg 1728
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
act att gct aaa ggg ttc aat att cct gca gtc cgt gta aca aag aag 1776
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
agt gaa gtc cgt gcc gcc atc aag aag atg ctc gag acc cca ggg cca 1824
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
tac ttg ttg gat atc atc gtc cca cac cag gag cat gtg ctg cct atg 1872
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
atc cca agt gag ggc gca ttc aag gac atg atc ctg gat ggt gat ggc 1920
Ile Pro Ser Glu Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
agg act atg tat taa 1935
Arg Thr Met Tyr
<210> 6
<211> 644
<212> PRT
<213>The als gene of rice paddy seed Yangzhou restorer antiweed mutant 3
<400> 6
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Glu Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 7
<211> 1935
<212> DNA
<213>Rice paddy seed Yangzhou restorer wild type als gene
<220>
<221> CDS
<222> (1)..(1935)
<400> 7
atg gct acg acc gcc gcg gcc gcg gcc gcc acc ttg tcc gcc gcc gcg 48
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
acg gcc aag acc ggc cgt aag aac cac cag cga cac cac gtc ctt ccc 96
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
gct cga ggc cgg gtg ggg gcg gcg gcg gtc agg tgc tcg gcg gtg tcc 144
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
ccg gtc acc ccg ccg tcc ccg gcg ccg ccg gcc acg ccg ctc cgg ccg 192
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
tgg ggg acg gcc gag ccc cgc aag ggc gcg gac atc ctc gtg gag gcg 240
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
ctg gag cgg tgc ggc gtc agc gac gtg ttc gcc tac ccg ggc ggc gcg 288
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
tcc atg gag atc cac cag gcg ctg acg cgc tcc ccg gtc atc acc aac 336
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
cac ctc ttc cgc cac gag cag ggc gag gcg ttc gcg gcg tcc ggg tac 384
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
gcg cgc gcg tcc ggc cgc gtc ggg gtc tgc gtc gcc acc tcc ggc ccc 432
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
ggg gca acc aac ctc gtg tcc gcg ctc gcc gac gcg ctg ctc gac tcc 480
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
gtc ccg atg gtc gcc atc acg ggc cag gtc ccc cgc cgc atg atc ggc 528
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
acc gac gcc ttc cag gag acg ccc ata gtc gag gtc acc cgc tcc atc 576
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
acc aag cac aat tac ctt gtc ctt gat gtg gag gac atc ccc cgc gtc 624
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
ata cag gaa gcc ttc ttc ctc gcg tcc tcg ggc cgt cct ggc ccg gtg 672
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
ctg gtc gac atc ccc aag gac atc cag cag cag atg gct gtg cca gtc 720
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
tgg gac acc tcg atg aat cta ccg ggg tac att gca cgc ctg ccc aag 768
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
cca ccc gcg aca gaa ttg ctt gag cag gtc ttg cgt ctg gtt ggc gag 816
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
tca cgg cgc ccg att ctc tat gtc ggt ggt ggc tgc tct gca tct ggt 864
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
gat gaa ttg cgc cgg ttt gtt gag ctg acc ggc atc cca gtt aca acc 912
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
act ctg atg ggc ctc ggc aat ttc ccc agt gat gat ccg ttg tcc ctg 960
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
cgc atg ctt ggg atg cat ggc acg gtg tac gca aat tat gcg gtg gat 1008
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
aag gct gac ctg ttg ctt gca ttt ggc gtg cgg ttt gat gat cgt gtg 1056
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
aca ggg aaa att gag gct ttt gca agc agg gcc aag att gtg cac att 1104
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
gac att gat cca gcg gag att gga aag aac aag caa cca cat gtg tca 1152
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
att tgc gca gat gtt aag ctt gct tta cag ggc ttg aat gct ctg cta 1200
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
gac cag agc aca aca aag aca agt tct gat ttt agt gca tgg cac aat 1248
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
gag ttg gac cag cag aag agg gag ttt cct ctg ggg tac aag act ttt 1296
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
ggt gaa gag atc cca ccg caa tat gct att cag gtg ctg gat gag ctg 1344
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
acg aaa ggg gag gca atc atc gct act ggt gtt gga cag cac cag atg 1392
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
tgg gcg gca caa tat tac acc tac aag cgg cca cgg cag tgg ctg tct 1440
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
tcg gct ggt ctg ggc gca atg gga ttt ggg ctg cct gct gca gct ggt 1488
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
gct tct gtg gct aac cca ggt gtc aca gtt gtt gat att gat ggg gat 1536
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
ggt agc ttc ctc atg aac att cag gag ttg gca ttg atc cgc att gag 1584
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
aac ctc ccg gtg aag gtg atg gtg ttg aac aac caa cat ttg ggt atg 1632
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
gtt gtg caa tgg gag gat agg ttt tac aag gca aat agg gcg cat aca 1680
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
tac ttg ggc aac cca gaa tgt gag agc gag ata tat cca gat ttt gtg 1728
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
act att gct aaa ggg ttc aat att cct gca gtc cgt gta aca aag aag 1776
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
agt gaa gtc cgt gcc gcc atc aag aag atg ctc gag acc cca ggg cca 1824
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
tac ttg ttg gat atc atc gtc cca cac cag gag cat gtg ctg cct atg 1872
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
atc cca agt ggg ggc gca ttc aag gac atg atc ctg gat ggt gat ggc 1920
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
agg act atg tat taa 1935
Arg Thr Met Tyr
<210> 8
<211> 644
<212> PRT
<213>Rice paddy seed Yangzhou restorer wild type als gene
<400> 8
Met Ala Thr Thr Ala Ala Ala Ala Ala Ala Thr Leu Ser Ala Ala Ala
1 5 10 15
Thr Ala Lys Thr Gly Arg Lys Asn His Gln Arg His His Val Leu Pro
20 25 30
Ala Arg Gly Arg Val Gly Ala Ala Ala Val Arg Cys Ser Ala Val Ser
35 40 45
Pro Val Thr Pro Pro Ser Pro Ala Pro Pro Ala Thr Pro Leu Arg Pro
50 55 60
Trp Gly Thr Ala Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala
65 70 75 80
Leu Glu Arg Cys Gly Val Ser Asp Val Phe Ala Tyr Pro Gly Gly Ala
85 90 95
Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn
100 105 110
His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr
115 120 125
Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro
130 135 140
Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser
145 150 155 160
Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly
165 170 175
Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile
180 185 190
Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val
195 200 205
Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val
210 215 220
Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val
225 230 235 240
Trp Asp Thr Ser Met Asn Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys
245 250 255
Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu Val Gly Glu
260 265 270
Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ser Ala Ser Gly
275 280 285
Asp Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr
290 295 300
Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu
305 310 315 320
Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp
325 330 335
Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val
340 345 350
Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile
355 360 365
Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser
370 375 380
Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala Leu Leu
385 390 395 400
Asp Gln Ser Thr Thr Lys Thr Ser Ser Asp Phe Ser Ala Trp His Asn
405 410 415
Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr Lys Thr Phe
420 425 430
Gly Glu Glu Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu
435 440 445
Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met
450 455 460
Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser
465 470 475 480
Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly
485 490 495
Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp
500 505 510
Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu
515 520 525
Asn Leu Pro Val Lys Val Met Val Leu Asn Asn Gln His Leu Gly Met
530 535 540
Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr
545 550 555 560
Tyr Leu Gly Asn Pro Glu Cys Glu Ser Glu Ile Tyr Pro Asp Phe Val
565 570 575
Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr Lys Lys
580 585 590
Ser Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro
595 600 605
Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met
610 615 620
Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly Asp Gly
625 630 635 640
Arg Thr Met Tyr
<210> 9
<211> 30
<212> DNA
<213>Sense primer
<400> 9
cgcggatcca tccgagccac acatcgcctc 30
<210> 10
<211> 28
<212> DNA
<213>Anti-sense primer
<400> 10
tccccgcggc ctacggaaaa caacacac 28

Claims (11)

1. make plant that there is the paddy rice ALS muteins of Herbicid resistant, its amino acid sequence such as SEQ ID NO：2 or SEQ ID NO：Shown in 6.
2. the albumen described in claim 1, wherein herbicide are imidazolinone herbicides.
Lead to 3. the albumen described in claim 2, wherein imidazolinone herbicide are hundred ridges.
4. nucleic acid, it encodes the albumen described in any one of claim 1 ~ 3.
5. nucleic acid according to claim 4, its nucleotide sequence such as SEQ ID NO:1 or SEQ ID NO:Shown in 5.
6. expression cassette, recombinant vector or cell, it contains the nucleic acid described in claim 4 or 5.
7. the albumen described in any one of claim 1 ~ 3, the nucleic acid described in claim 4 or 5, the expression described in claim 6 The application of box, recombinant vector or cell in terms of plant antiweed.
8. application according to claim 7, it is characterised in that the plant is paddy rice, tobacco, arabidopsis or cotton.
9. obtain the method for the plant with Herbicid resistant, it is characterised in that comprise the following steps：
1）Plant is set to include the nucleic acid described in claim 4 or 5；Or
2）Plant is set to express any described albumen of claim 1 ~ 3.
10. method according to claim 9, it is characterised in that it includes transgenosis, hybridization, backcrossing or vegetative propagation step Suddenly.
11. the method for plant identification, wherein plant are the plant comprising the nucleic acid described in claim 4 or 5, expression claim The plant that the plant of 1 ~ 3 any described albumen or any described method of claim 9 ~ 10 are obtained, it is characterised in that Comprise the following steps：
1) whether the plant is determined comprising the nucleic acid described in claim 4 or 5；Or,
2) any described the albumen whether plant expresses claim 1 ~ 3 is determined.
CN201710486852.XA 2017-06-23 2017-06-23 Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant Pending CN107090447A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710486852.XA CN107090447A (en) 2017-06-23 2017-06-23 Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710486852.XA CN107090447A (en) 2017-06-23 2017-06-23 Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant

Publications (1)

Publication Number Publication Date
CN107090447A true CN107090447A (en) 2017-08-25

Family

ID=59641001

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710486852.XA Pending CN107090447A (en) 2017-06-23 2017-06-23 Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant

Country Status (1)

Country Link
CN (1) CN107090447A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107964543A (en) * 2017-12-25 2018-04-27 江苏省农业科学院 Rice herbicide resistance ALS muteins, nucleic acid and its application
CN109097346A (en) * 2018-09-06 2018-12-28 江苏省农业科学院 Application based on the ALS mutein and its gene of gene editing technology in plant breeding
CN111411098A (en) * 2020-05-07 2020-07-14 海南波莲水稻基因科技有限公司 Rice A L S mutant gene, plant transgenic screening vector pCA L Sm2 containing gene and application thereof
WO2021155753A1 (en) * 2020-02-07 2021-08-12 山东舜丰生物科技有限公司 Herbicide-resistant gene, polypeptide, and application thereof in plant breeding
CN114317481A (en) * 2022-02-08 2022-04-12 宁夏农林科学院农作物研究所（宁夏回族自治区农作物育种中心） ALS mutant gene of rice and application of protein thereof in herbicide resistance

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586215A (en) * 2011-09-06 2012-07-18 深圳兴旺生物种业有限公司 Rice herbicide resistant protein and application thereof in plant bleeding
CN105755024A (en) * 2016-04-12 2016-07-13 江苏省农业科学院 ALS mutation gene as well as protein and application thereof
CN106867977A (en) * 2017-01-20 2017-06-20 湖南杂交水稻研究中心 A kind of rice herbicide resistant protein and gene and its application
CN106868028A (en) * 2017-03-02 2017-06-20 江苏省农业科学院 The ALS mutated genes and its albumen of japonica rice and application
CN106868027A (en) * 2017-03-02 2017-06-20 江苏省农业科学院 The application of japonica rice ALS mutated genes and its albumen in terms of antiweed

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102586215A (en) * 2011-09-06 2012-07-18 深圳兴旺生物种业有限公司 Rice herbicide resistant protein and application thereof in plant bleeding
CN105755024A (en) * 2016-04-12 2016-07-13 江苏省农业科学院 ALS mutation gene as well as protein and application thereof
CN106867977A (en) * 2017-01-20 2017-06-20 湖南杂交水稻研究中心 A kind of rice herbicide resistant protein and gene and its application
CN106868028A (en) * 2017-03-02 2017-06-20 江苏省农业科学院 The ALS mutated genes and its albumen of japonica rice and application
CN106868027A (en) * 2017-03-02 2017-06-20 江苏省农业科学院 The application of japonica rice ALS mutated genes and its albumen in terms of antiweed

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107964543A (en) * 2017-12-25 2018-04-27 江苏省农业科学院 Rice herbicide resistance ALS muteins, nucleic acid and its application
CN109097346A (en) * 2018-09-06 2018-12-28 江苏省农业科学院 Application based on the ALS mutein and its gene of gene editing technology in plant breeding
WO2020048135A1 (en) * 2018-09-06 2020-03-12 江苏省农业科学院 Use of als mutant-type protein and gene thereof based on gene editing technology in plant breeding
CN109097346B (en) * 2018-09-06 2021-07-13 江苏省农业科学院 ALS mutant protein based on gene editing technology and application of ALS mutant protein gene in plant breeding
WO2021155753A1 (en) * 2020-02-07 2021-08-12 山东舜丰生物科技有限公司 Herbicide-resistant gene, polypeptide, and application thereof in plant breeding
CN111411098A (en) * 2020-05-07 2020-07-14 海南波莲水稻基因科技有限公司 Rice A L S mutant gene, plant transgenic screening vector pCA L Sm2 containing gene and application thereof
CN111411098B (en) * 2020-05-07 2022-03-04 海南波莲水稻基因科技有限公司 Rice ALS mutant gene, plant transgenic screening vector pCALSm2 containing gene and application thereof
CN114317481A (en) * 2022-02-08 2022-04-12 宁夏农林科学院农作物研究所（宁夏回族自治区农作物育种中心） ALS mutant gene of rice and application of protein thereof in herbicide resistance
CN114317481B (en) * 2022-02-08 2023-10-27 宁夏农林科学院农作物研究所（宁夏回族自治区农作物育种中心） Application of ALS mutant gene and protein thereof in herbicide resistance

Similar Documents

Publication Publication Date Title
CN105755024B (en) ALS mutated genes and its albumen and application
CN107217044A (en) Make plant that there is paddy rice ALS muteins and its application of Herbicid resistant
CA2074854C (en) Imidazolinone resistant ahas mutants
CN107090447A (en) Make plant that there is paddy rice ALS muteins, gene and its application of Herbicid resistant
CN105779479B (en) A kind of ALS mutated genes and its application in terms of antiweed
CN107245480B (en) Acetolactate synthase mutant protein with herbicide resistance and application thereof
CN107964543B (en) Rice herbicide resistance ALS mutein, nucleic acid and its application
CN108486070B (en) Herbicide resistant mutants and uses thereof
CN105695493A (en) Application of ALS mutant type genes in aspect of herbicide resistance
CN105734071A (en) ALS mutant gene and application of protein thereof to herbicide resistance
CN109234310A (en) It is quickly obtained the recombinant vector and application method of no transgene gene editor plant
CN109912702B (en) Application of protein OsARE1 in regulation and control of low nitrogen resistance of plants
CN106755019B (en) A kind of application of wheat ALS mutated genes and its albumen in terms of antiweed
WO2007034953A1 (en) Protoporphyrinogen oxidase having activity of imparting resistance against acifluorfen and gene thereof
CN107022540B (en) Wheat ALS mutant protein and gene for endowing plants with herbicide resistance and application thereof
CN112410308B (en) Rice ACCase mutant gene and application of rice ACCase mutant gene protein in herbicide resistance of plants
CN111154738A (en) ALS mutant gene, protein and application thereof
CN113265401A (en) Method for improving resistance of rice to HPPD inhibitor herbicide through gene editing and special sgRNA thereof
CN106868027B (en) Japonica rice ALS mutant gene and application of protein thereof in herbicide resistance
CN107354139B (en) ALS mutant protein of wheat, nucleic acid and application thereof
CN106591334B (en) A kind of wheat ALS mutated genes and its application in terms of antiweed
CN106868028B (en) ALS mutant gene of japonica rice, protein and application thereof
CN106434714B (en) A kind of wheat ALS mutated genes and its albumen and application
CN114790230B (en) Application of protein TaARE1 in regulation of low nitrogen tolerance of plants
CN114480485B (en) Genetic engineering application of paddy rice glutamine aminotransferase gene OsGAT2

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination