CN113785741A - Seed production method for pepper breeding - Google Patents

Abstract

The invention relates to a seed production method for pepper breeding, and belongs to the technical field of plant breeding. The invention provides a seed production method for pepper breeding, which is specifically arranged for links of seedling culture, cultivation management, cross pollination, isolation and purity preservation, harvesting and airing and the like. The seed production method is simple to operate, and can obviously improve the purity and quality of the seed reproduction.

Description

Seed production method for pepper breeding

Technical Field

The invention relates to the technical field of plant breeding, in particular to a seed production method for pepper breeding.

Background

Hot pepper (A)Capsicum annuum L.) Is a perennial herb of the magnoliaceae, solanaceae, capsicum genus, or limited. The fruits are long finger-shaped, the top is tapered and often bent, green when immature, red, orange or purplish red after mature, spicy. The seeds are flat kidney-shaped and light yellow. At present, the biotechnology is applied to pepper genetic breeding, and the development of pepper breeding technology is promoted. The pepper breeding technology mainly comprises an original seed breeding technology, a crossbreeding technology, an aerospace mutation breeding technology, a haploid culture technology, a molecular breeding technology and the like, and the technologies respectively have corresponding advantages and have certain defects and shortcomings. Breeders often deploy combinations and small seed loads in pepper breeding efforts, and harvested seeds often have low purity or harvested seeds are too few. The purity and yield of the seeds are improved by improving each link of the seeds.

Disclosure of Invention

The invention aims to provide a seed production method for pepper breeding. The seed production method is simple to operate, and can obviously improve the purity and quality of the seed reproduction.

The invention provides a seed production method for pepper breeding, which comprises the following steps:

1) sowing male parents and female parents of the peppers, and carrying out seedling culture, wherein in the seedling culture stage, leaves are taken for molecular marker detection, and homozygous disease-resistant seedlings are reserved;

2) before field planting, soil preparation, fertilization, ridging and bed making are carried out;

3) when the seedlings grow to six leaves and one core, performing field planting by adopting a double-row staggered field planting method, wherein the row spacing of the same row is 45cm, the plant spacing of male parents is 35cm, the plant spacing of female parents is 40cm, the row spacing is 50cm, and the proportion of the male parents to the female parents is 1: 2;

4) after field planting, controlling the temperature at 24-28 ℃ in the daytime and 13-17 ℃ at night, and performing water and fertilizer management;

5) pruning the hot pepper by adopting a three-rod pruning method; the sweet peppers are trimmed by a double-rod pruning method, all the gate peppers are removed, and fruits are symmetrically left;

6) castration is carried out one day before flowers on the 2 nd-5 th layer of a main branch of a plant bloom, and after castration, the castrated pepper flowers are isolated by using a pollen isolation device;

7) pollen of the male parent is taken, pollination is carried out on the castrated blooming flowers, and after fruit setting, the pollen isolation device is removed;

8) when 80-90% of the fruits turn color, harvesting, and drying the seeds to obtain pepper seeds;

the step 1) and the step 2) are not limited in chronological order.

Preferably, in the step 1), the male parent is sown one week earlier than the female parent.

Preferably, the molecular marker detection of step 1) comprises: cucumber mosaic virus resistance detection, tobacco mosaic virus resistance detection and epidemic disease resistance detection.

Preferably, the method further comprises the steps of dipping roots by propamocarb, hymexazol and a rooting agent before the planting; immediately watering thoroughly after the field planting; planting for 2-4 days, watering and irrigating roots with propamocarb, hymexazol and rooting agent; planting for 12-16 days, watering and applying a water-soluble balance fertilizer.

Preferably, after all the peppers are removed in the step 5), flowers are left on the peppers from the second layer, and branches below the peppers and which are not developed well are removed.

Preferably, the pollen isolation device comprises an isolation net barrel and an isolation cover, wherein the isolation cover is detachably connected to an opening part of the isolation net barrel; the isolating cover comprises two clamping parts which are opened and closed along the radial direction of the isolating net cylinder, and the isolating cover and the isolating net cylinder can be fixed on the flower stalk together after the two clamping parts are closed; the clamping part is provided with a connecting structure matched with the opening of the isolating net cylinder; the two clamping parts can be connected with the isolation net cylinder on the clamping parts after being closed.

Preferably, the pollination time of step 7) is nine to ten am.

Preferably, the step 7) further comprises removing all flowers and buds which are not pollinated; and (3) removing malformed fruits in time in the fruit growing process, reserving 1-2 fruits on the 2 nd layer of flowers, and reserving 3-4 fruits on each layer of the 3-5 th layer.

Preferably, in the step 8), before harvesting, the hybrid plants existing in the female parent are removed, and in the harvesting, the hybrid fruits of the male parent and the female parent are harvested.

Preferably, the drying of step 8) comprises: airing on a gauze in summer, wherein the distance between the gauze and the ground is more than 20cm, and airing for 2-3 days; drying for 45-50 h at 27-32 ℃ in winter or in cloudy days.

The invention provides a seed production method for pepper breeding. According to the method, the links of seedling raising, cultivation management, hybrid pollination, isolation and purity preservation, harvesting and airing and the like are specifically set, so that the purity and the quality of the propagated seeds are obviously improved; the molecular marker is used for removing impurities from plants before field planting, so that heterozygous impure plants and plants without disease-resistant genes are removed, and the purity and quality of a small amount of breeding seeds can be effectively improved; by utilizing the special pollen isolation device for pepper breeding, the pollen isolation device can ensure that flowers are not polluted by non-target pollen after emasculation and before fruit setting, standardizes a pollination procedure, can obviously reduce the cross contamination of pollen between parents and improves the seed purity.

Drawings

FIG. 1 is a top view of an isolation cover structure according to the present invention;

FIG. 2 is a side view of the structure of the isolation cover of the present invention;

FIG. 3 is a top view of the connection of the isolation cover and the isolation mesh cylinder of the present invention;

fig. 4 is a schematic view of the structure of the isolation net cylinder of the present invention.

Wherein, 1-an isolation net cylinder, 11-an outer edge flanging, 12-a plastic frame, and 13-a net cloth B; 2-isolation cover, 21-clamping jaw, 211-clamping head, 212-handle, 22-mesh cloth A, 23-opening ring and 24-semi-ring clamping groove.

Detailed Description

The invention provides a seed production method for pepper breeding, which comprises the following steps:

1) sowing male parents and female parents of the peppers, and carrying out seedling culture, wherein in the seedling culture stage, leaves are taken for molecular marker detection, and homozygous disease-resistant seedlings are reserved;

2) before field planting, soil preparation, fertilization, ridging and bed making are carried out;

3) when the seedlings grow to six leaves and one core, performing field planting by adopting a double-row staggered field planting method, wherein the row spacing of the same row is 45cm, the plant spacing of male parents is 35cm, the plant spacing of female parents is 40cm, the row spacing is 50cm, and the proportion of the male parents to the female parents is 1: 2;

4) after field planting, controlling the temperature at 24-28 ℃ in the daytime and 13-17 ℃ at night, and performing water and fertilizer management;

5) pruning the hot pepper by adopting a three-rod pruning method; the sweet peppers are trimmed by a double-rod pruning method, all the gate peppers are removed, and fruits are symmetrically left;

6) castration is carried out one day before flowers on the 2 nd-5 th layer of a main branch of a plant bloom, and after castration, the castrated pepper flowers are isolated by using a pollen isolation device;

7) pollen of the male parent is taken, pollination is carried out on the castrated blooming flowers, and after fruit setting, the pollen isolation device is removed;

8) when 80-90% of the fruits turn color, harvesting, and drying the seeds to obtain pepper seeds;

the step 1) and the step 2) are not limited in chronological order.

The invention seeds male parent and female parent of pepper, and carries on seedling, in the said seedling stage, take the leaf to carry on the molecular mark detection, keep and pick the homozygous disease-resistant seedling. The method preferably selects proper sowing time according to local meteorological conditions, takes Shandong as an example, the sowing time is preferably selected to be 1 st ten days in the first half year, and the sowing time is preferably selected to be 7 th last ten days in the second half year. In the present invention, the present invention preferably pre-treats the seeds before said sowing. In the present invention, the pre-treatment preferably comprises selecting seeds with plump color for seed soaking with a liquid medicine. Specifically, the seed soaking with the liquid medicine preferably comprises the steps of soaking seeds for 4-5 hours with clear water, and then soaking the seeds for 5 minutes with 1% by mass of copper sulfate aqueous solution. After seed soaking is completed, the seed is preferably washed clean by using clear water. In the present invention, in the seedling stage, it is preferable that pepper seeds are sown in a seedling tray for seedling. In the present invention, the specification of the seedling raising tray is not particularly limited, and a 72-hole seedling raising tray is preferably used. In the present invention, a sterilized substrate is preferably put in the nursery site. The substrate of the present invention is not particularly limited in kind, and a conventional commercial seedling substrate for capsicum, which is well known to those skilled in the art, may be used. In the invention, the male parent is preferably sown one week earlier than the female parent, so as to promote the flowering phase meeting. After sowing and before seed emergence, the seedling raising temperature is preferably kept at 25-30 ℃, and water is preferably sprayed once a day to keep the substrate wet. After seedling emergence, the temperature is preferably controlled to be 20-25 ℃ in the daytime and 15-18 ℃ at night. After the first true leaf appears, the temperature is preferably controlled to be 25-27 ℃ in the daytime and 15-20 ℃ at night, meanwhile, the illumination time is increased, and ventilation is increased to avoid the overhigh humidity of the matrix. One week before field planting, the invention preferably removes the sunshade net, increases the ventilation time, practices the seedling, can avoid vain growth, improves the seedling resistance. In the seedling stage, the invention takes the leaves to carry out molecular marker detection. In the present invention, the molecular marker detection preferably comprises: cucumber mosaic virus resistance detection, tobacco mosaic virus resistance detection and epidemic disease resistance detection. According to the detection result, homozygous disease-resistant seedlings are reserved, namely, homozygous positive single plants are selected for field planting, and homozygous negative and heterozygous seedlings are removed. The invention adopts molecular marker detection before field planting, can effectively identify plants with disease-resistant genes, has high efficiency and short time consumption, and has little damage to seedlings; if a pathogenic bacterium direct inoculation method is adopted before field planting, time and labor are wasted, the operation is complicated, the observation period is long, and the seedling is greatly damaged; if the ecological characters of the pepper in the seedling stage are adopted for observation before field planting, disease-resistant plants cannot be screened, the ecological characters of the pepper in the seedling stage are too few, and the characters are not linked with disease-resistant genes.

Before field planting, the invention prepares soil, fertilizes, forms ridges and beds. The planting of the invention is preferably carried out in a greenhouse. In the present invention, the soil preparation preferably includes removal of diseased fruits, rotten fruits and plants left by tea application. The greenhouse film is preferably replaced periodically in 9 months per year, so that the light transmittance and dysprosium flowing property are ensured. In one month before field planting, the air ports of the greenhouse are preferably closed, the greenhouse is smoked by using a chlorothalonil fumigant, and the greenhouse is subjected to high-temperature greenhouse closing for 14-17 days, more preferably 15 days, so that the diseases in the greenhouse are effectively killed, and the pesticide dosage is reduced. In the present invention, the fertilizing preferably comprises: applying organic fertilizer and compound fertilizer one week before field planting, and preferably deeply ploughing after applying fertilizer. In the invention, the organic fertilizer is preferably applied by 30-square rice hull manure per mu, and the compound fertilizer is preferably applied by 100kg per mu. The deep ploughing is preferably carried out by using a small-sized rotary cultivator, and the deep ploughing frequency is preferably 3-5, more preferably 4. After deep plowing, the present invention preferably removes clean broken bricks and weeds. In the present invention, the ridge is preferably 60cm wide and 20cm high, and the furrow is preferably 70cm wide.

The method is characterized in that when seedlings grow to six leaves and one center, field planting is carried out, a double-row staggered field planting method is adopted for field planting, the plant spacing of the same row is 45cm, the plant spacing of male parents is 35cm, the plant spacing of female parents is 40cm, the row spacing is 50cm, and the proportion of the male parents to the female parents is 1: 2. The invention preferably selects the afternoon planting on a sunny day. In the invention, before planting, the method preferably further comprises the step of dipping roots by using propamocarb, hymexazol and a rooting agent. After field planting, the temperature in the daytime is preferably controlled to be 24-28 ℃, and the temperature in the nighttime is preferably controlled to be 13-17 ℃, and water and fertilizer management is carried out. In the invention, the method also comprises the steps of watering thoroughly immediately after the field planting; planting for 2-4 days, preferably 3 days, preferably watering and irrigating roots with propamocarb, hymexazol and rooting agent; planting for 12-16 d, preferably watering and applying a water-soluble balance fertilizer. In the first watering after planting, the invention preferably adopts a large water flood irrigation mode to thoroughly water. After the soil is dried, intertillage and loosening are preferably carried out, so that the air permeability of the soil is increased to facilitate the growth of root systems, and weeds can be prevented from growing in the soil. In the invention, the watering and root irrigation by using propamocarb, hymexazol and rooting agent have the functions of promoting the pepper to rapidly root, slowing seedling in advance and preventing pepper root diseases. In the invention, the watering and the application of the water-soluble balance fertilizer can supplement nutrition for the plants and promote the growth of the plants. After planting, the invention preferably also comprises the operation of hanging the vines of the peppers. Specifically, the hanging tendrils of the present invention preferably include: 16 steel wires are tensioned between the upright posts and the shed frames of the greenhouse in the east-west direction, the height of the steel wires is 2.2 meters, the position of the steel wires is consistent with the direction of the upright posts, the upper parts of the steel wires are tensioned by 18 steel wires along the planting direction of the furrows, and the north and south sides of the steel wires are connected to the front shed frame and the rear upright posts of the greenhouse; then, a 30-silk nylon rope with the length of 2 meters is tied right above the pepper seedlings, the lower side of the pepper seedlings is tied on the main branches of the peppers, the main branches are wound on the nylon rope, the positions of the nylon ropes are adjusted, the main branches of the peppers are mutually unfolded, and light transmission and air permeability are improved.

The chili is pruned by adopting a three-rod pruning method; the sweet peppers are trimmed by a double-rod pruning method, all the gate peppers are removed, and the fruits are symmetrically remained. The operation is favorable for cultivating strong plants and providing sufficient nutrition for flowers and fruits. In the present invention, after all the peppers are removed, it is preferable to further include a step of reserving flowers from the second layer to the peppers, and a step of breaking off branches below the peppers and which are not developed well. In the invention, when the zanthoxylum bungeanum is removed, the redundant opened flowers are also preferably removed.

In the invention, castration is carried out one day before flowers on 2 nd to 5 th layers of main branches of plants bloom, and the castrated pepper flowers are isolated by using a pollen isolation device after castration. The optimal castration period is when the flower bud is fully expanded, the bud is white, the petal is about to crack, the style is mature, and the anther is not cracked. The emasculation according to the invention preferably starts from the layer 2 flowers, and before the emasculation, the flowers already blooming on the plants are preferably removed. The detasseling operation of the present invention preferably comprises the steps of: slightly clamping the base part of the pepper flower by using the thumb, the index finger and the middle finger of the left hand, slightly poking the petals by using the forceps held by the right hand, then inserting the tip of the forceps deeply into the base part of the anther cartridge, slightly releasing the clamping force on the forceps, spreading the anther, and then removing the anther. The emasculation of the invention is preferably clean and thorough, and meanwhile, bad flowers such as malformed flowers and florets are removed.

The emasculation of the present invention preferably uses an emasculation and pollination tool. In the present invention, the emasculation and pollination tool preferably comprises a pointed forceps, alcohol, absorbent cotton, a culture dish and a pollen isolation device. In the present invention, the pollen isolation device preferably comprises a pollen isolation device special for pepper breeding, and comprises an isolation net cylinder and an isolation cover, wherein the isolation cover is detachably connected to an opening part of the isolation net cylinder; the isolating cover comprises two clamping parts which are opened and closed along the radial direction of the isolating net cylinder, and the isolating cover and the isolating net cylinder can be fixed on the flower stalk together after the two clamping parts are closed; the clamping part is provided with a connecting structure matched with the opening of the isolating net cylinder; the two clamping parts can be connected with the isolation net cylinder on the clamping parts after being closed. The device disclosed by the invention can be conveniently disassembled and assembled on the basis of effectively isolating pollen, the workload is reduced, and the working efficiency is improved. As shown in fig. 1 to 4, the invention provides a pollen isolation device special for pepper breeding, which comprises an isolation net cylinder 1 capable of being sleeved on pepper flowers and an isolation cover 2 capable of being clamped on pepper flower stems, wherein the isolation cover 2 is detachably connected to an opening part of the isolation net cylinder 1; it should be noted that the isolation net cylinder 1 is a net cylinder, and the grid of the isolation net cylinder can be permeable to air and water and isolate pollen and insects; the isolation cover 2 can be a net structure, and can also be other structures capable of isolating pollen and insects. The isolation cover 2 comprises two clamping parts which are opened and closed along the radial direction of the isolation net cylinder 1, and the isolation cover 2 and the isolation net cylinder 1 can be fixed on the pepper flower stalk after the two clamping parts are closed; the clamping part is provided with a connecting structure matched with the opening of the isolation net cylinder 1; the two clamping parts can be closed to connect the isolation net cylinder 1 on the clamping parts.

When the pepper flowers are castrated, firstly sheathing the pepper flowers by using an isolation net cylinder 1, then opening two clamping parts of an isolation cover 2, and then moving the clamping parts to the positions of the pepper flower stalks, wherein the pepper flower stalks are positioned in a gap between the two clamping parts, then aligning a connecting structure arranged on the clamping parts with an opening of the isolation net cylinder 1, and finally closing the two clamping parts, at the moment, the isolation net cylinder 1 is connected with the isolation cover 2 through the connecting structure arranged on the clamping parts, and the pollen isolation device is fixed on the pepper flower stalks through the clamping force of the two clamping parts; by the isolation of the isolation net barrel 1 and the isolation cover 2, pollen and insect infestation is effectively isolated, and pollution of non-target pollen is avoided.

When the pepper flowers are bloomed and need pollination, the two closed clamping parts are opened firstly, the connecting structures arranged on the clamping parts fail, and then the isolating net cylinder 1 is taken down; after the pollination operation is finished, the isolating net cylinder 1 with another color can be replaced, so that the pepper flowers which are emasculated and need to be pollinated are distinguished, the recognition efficiency is accelerated, and the working efficiency is improved.

Compared with the existing isolation device, the pollen isolation device special for pepper breeding has the advantages that the isolation net barrel 1 is matched with the isolation cover 2 with the openable clamping part, the isolation net barrel 1 is sleeved in the whole working process, then the isolation cover 2 is clamped and connected with the isolation net barrel 1, the connection of the isolation net barrel 1 and the clamping of pepper flower stalks are completed by the clamping part in the same action and at the same time, and therefore the installation efficiency of the isolation device is greatly improved, and the working efficiency is improved.

Further, as shown in fig. 1 and 2, the clamping part is a clamping jaw 21, and the two clamping jaws 21 are staggered, arranged in a mirror-image manner and connected in a rotating manner; the clamping jaw 21 comprises a clamping head 211 and a handle 212, a mesh cloth A22 is installed in the clamping head 211, and a clamping net cover matched with an opening of the isolation net cylinder 1 is formed after the two clamping heads 211 are clamped; an elastic part for providing clamping force for the clamping head 211 is arranged between the two clamping jaws 21; the connecting structure is arranged on the clamping jaw 21. Furthermore, the connecting structure is a semi-annular clamping groove 24 arranged on the clamping heads 211, and the two clamping heads 211 are clamped to form an annular clamping groove matched with the outer edge flanging 11 of the opening part of the isolating net cylinder 1.

Therefore, when the isolation device is installed, the isolation net cylinder 1 is sleeved on the outer side of the pepper flowers, the two clamping heads 211 are separated by pressing the two handles 212, the gap between the two separated clamping heads 211 is aligned to the pepper flower stalks, the handles 212 are loosened, the clamping heads 211 are closed under the influence of the elastic parts, and the pepper flower stalks are clamped by the elastic net cloth A22 arranged in the two clamping heads 211; in addition, in the process of combining the two chucks 211, the outer flange 11 of the opening part of the isolation net cylinder 1 is aligned with the semi-annular clamping grooves 24 on the two chucks 211, and the two chucks 211 are combined to complete the connection of the isolation net cylinder 1 and the isolation cover 2. On one hand, the pepper flower stalks are clamped by soft materials, and the pepper flower stalks can be better protected under the condition that the fixing strips allow (namely the gravity of the isolating device is smaller than the clamping friction force), so that the normal growth of the pepper flowers is ensured; on the other hand, the screen cloth A22 enables the isolation cover 2 to be permeable to air and water, so that the normal growth of the pepper flowers is ensured.

Further, the clamping heads 211 are in a semicircular structure, the two clamping heads 211 form a complete circle after being clamped, and the isolation net cylinder 1 is in a cylindrical structure; further, the diameter of the semicircle of the chuck 211 is 2cm, the frame width of the chuck 211 is 1cm, and the thickness is 0.15 cm; the isolation net cylinder 1 comprises a plastic frame 12 and net cloth B13 woven on the plastic frame 12, the diameter of the plastic frame 12 is 1.65cm, the height is 3.5cm, and the outer edge flanging 11 of the opening part of the isolation net cylinder 1 is 0.1cm higher than the opening part of the isolation net cylinder 1; the mesh cloth B13 is provided with small holes which can ventilate and permeate water and isolate pollen and insects. It should be noted that the above description of the shape and size of the isolation device does not mean that the isolation device is necessarily limited to the above shape and size, and can be adjusted according to practical situations, for example: the isolation net barrel 1 can also be in a square barrel-shaped structure, a triangular barrel-shaped structure and the like, and the corresponding clamping heads can also be adjusted.

Furthermore, the elastic part is an opening ring 23 with elasticity, two ends of the opening ring 23 are fixed on the outer wall of the chuck 211, and the ring body penetrates through the two handles 212. It should be noted that the elastic structure similar to the grafting clip is used here, but this does not mean that the isolation device is limited to the above design, and other elastic arrangements can be used, such as: hanger clamps, book clamps, and the like.

Further, the handle 212 is 3cm long, and its surface is provided with the skid resistant coating to operating personnel is stable, and the tail end is provided with the rings that are used for connecting the information hang tag, so that the staff observes.

Further, mesh A22 and mesh B13 are both nylon meshes.

The adaptation according to the actual needs is within the scope of the invention.

The isolation device has the following advantages: (1) compared with the existing isolation device, the isolation device has the advantages that the isolation net barrel is matched with the isolation cover with the openable clamping part, the isolation net barrel is sleeved in the whole working process, then the isolation cover is clamped and connected with the isolation net barrel, and the connection of the isolation net barrel and the clamping of the pepper flower stalks are completed by the clamping part in the same action and at the same time, so that the installation efficiency of the isolation device is greatly improved, and the working efficiency is improved.

(2) According to the invention, the elastic mesh cloth A is adopted to clamp the pepper flower stalks, on one hand, the clamping is realized by using a soft material, and the pepper flower stalks can be better protected under the condition that the fixing strips allow (namely, the gravity of the isolating device is smaller than the clamping friction force), so that the normal growth of pepper flowers is ensured; on the other hand, the screen cloth A enables the isolation cover to be permeable to air and water, and then normal growth of the pepper flowers is guaranteed.

(3) The surface of the handle adopted by the invention is provided with an anti-slip layer so as to facilitate the stable operation of an operator, and the tail end of the handle is provided with a hanging ring for connecting an information tag so as to facilitate the observation of the operator.

Pollen of a male parent is taken, pollination is carried out on castrated blooming flowers, and after fruit setting, a pollen isolation device is removed. In the present invention, the time of pollination is preferably nine to ten am. And preferably selecting the blooming male parent at the pollination time, and collecting pollen. In the invention, the male parents with petals unfolded at 180 degrees and anthers just cracked are preferably selected for division and collection. The collection is preferably carried out by using a culture dish, particularly, the flower is caught by using the culture dish, then the flower is flicked by hand, and milky powder pollen falls into the culture dish. After collection, the present invention is preferably marked on a petri dish. After the pollen is taken out, the invention pollinates. The pollination according to the invention preferably comprises: and selecting the bloomed flowers which are emasculated, confirming that the flowers are emasculated cleanly and the stigma does not have anthers and damage, and preferably slightly putting the stigma of the flowers on the white pollen in the culture dish to ensure that the stigma is full of the white pollen. After pollination, the invention preferably changes to another color of isolating net cylinder to distinguish pollination. After fruit setting, the present invention preferably removes the spacer screen cartridge, leaving only the spacer cap to distinguish the hybrid fruit. The pollination operation is preferably gentle and stable so as not to puncture or break the boll. The pollination of the present invention is preferably sufficient to allow uniform stigma coverage. After pollination of a group of parents, the petri dishes are preferably replaced and the hands are sterilized. Alcohol is preferably used for disinfection in the present invention, and more preferably, alcohol is dipped in absorbent cotton to wipe hands. In the present invention, it is preferred to also include the total elimination of non-pollinated flowers and buds (this step is preferably performed during and after the completion of the hybridization operation); in the fruit growing process, malformed fruits are preferably removed in time, 1-2 fruits are preferably left in the 2 nd layer of flowers, and 3-4 fruits are preferably left in each of the 3 rd-5 th layers. Compared with the prior art, the pollination method has the advantages of simple operation, prevention of pollution of other pollen, improvement of seed purity and suitability for high-purity seed production of medium and small-size pepper seeds. The existing isolation mode has the following disadvantages: other crops are planted in the middle of the male parent and the female parent for isolation, and the two sides are separated by 15m, so that the method occupies more land and is suitable for mass seed reproduction of a plurality of varieties; the male parent and the female parent are separately planted in two nylon net sheds, the method occupies more land and is suitable for mass seed reproduction of a plurality of varieties; after the female parent castration hybridization is picked, the female parent is isolated by covering flowers with parchment paper bags, so that the flowers are easy to fall and go ill, the operation is relatively complicated, and more labor is required; after female parent castration and hybridization, the cotton-padded flowers are used for isolation, the operation is complicated, and the cotton-padded flowers are easy to fall off.

In the invention, watering and fertilizing are preferably carried out in the fruit period: the preference in summer and autumn is as follows: pouring water once within 5-8 days, preferably 6 days; in winter and spring: preferably 10-14 days, more preferably 12 days; before pollination, namely in the full-bloom stage of the capsicum annuum, preferably watering once and applying 18-22 kg, preferably 20kg of balanced water soluble fertilizer per mu, and preferably not watering with large water in the pollination process to prevent flower falling; after the pepper bears fruits, watering and applying high-potassium water soluble fertilizer. In the invention, after thinning fruits of hot peppers (preferably removing malformed fruits in time in the fruit growth process, preferably leaving 1-2 fruits on the 2 nd layer flowers, and preferably leaving 3-4 fruits on each layer of 3-5 th layers), the tops of hot peppers are preferably removed after the hot peppers are seated on the top layer fruits, so that the plants supply nutrition to the fruits as much as possible, and the development of the fruits and seeds is promoted.

When 80-90% of fruits turn color, harvesting and drying seeds to obtain the pepper seeds. In the present invention, before harvesting, it is preferable to extract the hybrid existing in the female parent, and at the time of harvesting, it is preferable to harvest the hybrid fruits of the male parent and the female parent. In the present invention, the identification of the maternal and foreign plant is preferably determined by the properties of the fruit, such as the lateral and longitudinal meridians, color, fruit shape, fruit surface, etc., and the properties are different, i.e., the plant is considered to be a foreign plant, and the foreign plant is found to be removed. In the invention, in the fruit harvesting process, whether the fruits have the isolation cover of the special pollen isolation device for pepper breeding is preferably checked, and the fruits with the isolation cover are hybrid fruits and need to be harvested and taken; if the isolating cover is not arranged, the hybridization is not carried out, and the isolating cover needs to be removed and discarded. After the fruits are harvested, seeds are preferably taken, and impurities are removed. The invention preferably puts the seeds without impurities into the mesh bag, does not need washing and immediately dries. In the present invention, the drying preferably includes: airing on a gauze in summer, wherein the distance between the gauze and the ground is preferably more than 20cm, and airing for 2-3 days; drying for 45-50 h, preferably 48h at 27-32 ℃ in winter or in cloudy days. According to the invention, after the seeds are dried, the seeds are preferably selected to remove impurities. Then bagging, numbering and warehousing are carried out.

The seed production method for pepper breeding according to the present invention is further described in detail with reference to the following specific examples, and the technical solutions of the present invention include, but are not limited to, the following examples.

The molecular marker detection of the invention is carried out by the following method:

epidemic disease of primary and secondary hot pepper

The name of a primer for the pepper phytophthora blight is ZL6726, and the sequence of the primer is as follows:

F：TCCAGCCATCCATTATTTCAT（SEQ ID NO.1）

R：ATCCCGAACTGCCAATAATTA（SEQ ID NO.2）

1 PCR reaction procedure

Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 40 s, annealing at 55 ℃ for 40 s, extension at 72 ℃ for 1min, and 32 cycles; extension at 72 ℃ for 10 min and at 10 ℃ Forever.

2 Polyacrylamide gel electrophoresis

2.1 glue filling

100mL of polyacrylamide gel, 100 mu L of TEMED (tetramethylethylenediamine) and 1000 mu L of APS (ammonium persulfate), and slowly shaking up (avoiding bubbles); clamping two sides of the glass plate by using a clamp, uniformly mixing the prepared gel, quickly pouring the gel into the interlayer of the glass plate, and inserting a comb; after the glass plate is solidified by gelling for 0.5-1 h, fixing the glass plate on a frame; pouring a buffer solution, and pulling out the comb; sucking 3 mu L of PCR product into a new PCR plate, adding 6 mu L of sample buffer solution, and centrifuging; the sample addition well (oil blown off) was pipetted with 0.5. mu.L per well.

2.2 electrophoresis

Conditions are as follows: u (V) 180 constant pressure T (min) 90

2.3 silver staining: (one block of glue)

Measuring AgNO₃1mL of sterile water and 100mL of sterile water are placed on a shaking table, slowly shaken for 8min and then washed with sterile water for at least 3 times.

2.4 developing: (one block of glue)

Weighing 1.5g of NaOH, weighing 500 mu L of formaldehyde and 100mL of sterile water, placing on a shaking bed, slowly shaking, and after 5min, washing with sterile water for at least 3 times.

2.5 results recording

And (4) fishing out the glue, spreading the glue on a film viewing lamp, marking the sample batch and the primer name, and storing the sample batch and the primer name on a film viewing lamp box.

The determination method comprises the following steps: the amplified fragment size of the ZL6726 primer pair is 195bp resistant and 152bp susceptible, and the strip is selected according to the contrast of a 50bp DNA marker, and the brightest strip of the marker is 250 bp. Specifically, when a band of 195bp appears, the sample is judged to be homozygous disease-resistant, and when a band of 152bp appears, the sample is judged to be homozygous susceptible variety. When two bands of 195bp and 152bp appear, the sample is judged to be heterozygous disease-resistant.

Tobacco mosaic virus disease

Name of primer for tobacco mosaic virus L4SC340, primer sequence

F：AAGGGGCGTTCTTGAGCCAA（SEQ ID NO.3）

R：TCCATGGAGTTGTTCTGCAT（SEQ ID NO.4）

1 PCR reaction procedure

Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 40 s, annealing at 55 ℃ for 40 s, extension at 72 ℃ for 1min, and 32 cycles; extension at 72 ℃ for 10 min and at 10 ℃ Forever.

2 Polyacrylamide gel electrophoresis

2.1 glue filling

100mL of polyacrylamide gel, 100 mu L of TEMED (tetramethylethylenediamine) and 1000 mu L of APS (ammonium persulfate), and slowly shaking up (avoiding bubbles); clamping two sides of the glass plate by using a clamp, uniformly mixing the prepared gel, quickly pouring the gel into the interlayer of the glass plate, and inserting a comb; after the glass plate is solidified by gelling for 0.5-1 h, fixing the glass plate on a frame; pouring a buffer solution, and pulling out the comb; sucking 3 mu L of PCR product into a new PCR plate, adding 6 mu L of sample buffer solution, and centrifuging; the sample addition well (oil blown off) was pipetted with 0.5. mu.L per well.

2.2 electrophoresis

Conditions are as follows: u (V) 180 constant pressure T (min) 90

2.3 silver staining: (one block of glue)

Measuring AgNO₃1mL of sterile water and 100mL of sterile water are placed on a shaking table, slowly shaken for 8min and then washed with sterile water for at least 3 times.

2.4 developing: (one block of glue)

Weighing 1.5g of NaOH, weighing 500 mu L of formaldehyde and 100mL of sterile water, placing on a shaking bed, slowly shaking, and after 5min, washing with sterile water for at least 3 times.

2.5 results recording

And (4) fishing out the glue, spreading the glue on a film viewing lamp, marking the sample batch and the primer name, and storing the sample batch and the primer name on a film viewing lamp box.

The determination method comprises the following steps: the L4SC340 primer pair is a dominant marker, the amplified fragment size is disease-resistant 340bp, a strip is selected according to the contrast of a 50bp DNA marker, and the brightest strip of the marker is 250 bp. Specifically, when a 340bp band appears, the sample is judged to be resistant to diseases, but not homozygous, and when a 340bp band does not appear, the sample is judged to be a susceptible variety.

Cucumber mosaic virus disease

The name of the primer of the cucumber mosaic virus disease CaTm-int1 and the sequence of the primer

F：TCAGCAAAGAAAGATTCACGAAC（SEQ ID NO.5）

R：ACGTACACTTGATGATGCCTTGT（SEQ ID NO.6）

1. PCR reaction procedure

Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 40 s, annealing at 45 ℃ for 40 s, extension at 72 ℃ for 1min, 32 cycles; extension at 72 ℃ for 10 min and at 10 ℃ Forever.

2. Enzyme digestion

Enzyme digestion system: 2. mu.L of Buffer, 1. mu.L of endonuclease (Hinf I), 10. mu.L of PCR product, and 7. mu.L of DEPC water.

Enzyme digestion PCR program: 37 ℃ for 120 min.

3. Polyacrylamide gel electrophoresis

3.1 glue filling

100mL of polyacrylamide gel, 100 mu L of TEMED (tetramethylethylenediamine) and 1000 mu L of APS (ammonium persulfate), and slowly shaking up (avoiding bubbles); clamping two sides of the glass plate by using a clamp, uniformly mixing the prepared gel, quickly pouring the gel into the interlayer of the glass plate, and inserting a comb; after the glass plate is solidified by gelling for 0.5-1 h, fixing the glass plate on a frame; pouring a buffer solution, and pulling out the comb; sucking 3 mu L of PCR product into a new PCR plate, adding 6 mu L of sample buffer solution, and centrifuging; the sample addition well (oil blown off) was pipetted with 0.5. mu.L per well.

3.2 electrophoresis

Conditions are as follows: u (V) 180 constant pressure T (min) 90

3.3 silver staining: (one block of glue)

Measuring AgNO₃1mL of sterile water and 100mL of sterile water are placed on a shaking table, slowly shaken for 8min and then washed with sterile water for at least 3 times.

3.4 developing: (one block of glue)

Weighing 1.5g of NaOH, weighing 500 mu L of formaldehyde and 100mL of sterile water, placing on a shaking bed, slowly shaking, and after 5min, washing with sterile water for at least 3 times.

3.5 results recording

And (4) fishing out the glue, spreading the glue on a film viewing lamp, marking the sample batch and the primer name, and storing the sample batch and the primer name on a film viewing lamp box.

The determination method comprises the following steps: the amplified fragment size of the primer pair CaTm-int1 is disease-resistant 300bp/150bp, and is infected by 496bp, a strip is selected according to the contrast of a 50bp DNA marker, and the brightest strip of the marker is 250 bp. Specifically, the sample was judged to be homozygous resistant when two bands of 300bp and 150bp appeared, and the sample was judged to be homozygous susceptible when a band of 496bp appeared. When three bands with the sizes of 300bp, 150bp and 496bp appear, the sample is judged to be heterozygous disease-resistant.

Example 1

Firstly, seedling culture:

1. seedling culture time: in Shandong (shou Guang vegetable town), sowing is carried out in the first ten days of 1 month (3 days) in the first half year and in the last ten days of 7 months (8 days) in the second half year.

2. Seed treatment and sowing: selecting the male parent seeds and the female parent seeds of the hot peppers with corresponding numbers. And (3) selecting seeds with plump colors for soaking the seeds in a liquid medicine, soaking the seeds in clear water for 4-5 h, then soaking the seeds in 1% copper sulfate solution for 5min, taking out the seeds, washing the seeds with clear water, and sowing the seeds. Seeding is carried out by using a seedling raising plate with 72 holes and a sterilized substrate. The male parent is sowed in advance for one week to promote the flower meeting.

The invention takes CSVHPM81746054 as female parent and CSVHPF81690012 as male parent, the F1 generation variety is obtained by hybridization, the female parent is castrated firstly, pollen is obtained from the father after the flower bud of the female parent is full, the pollen is fertilized on the castrated stigma of the female parent, then the fruit grows naturally and matures, the hybrid fruit is picked after color change, the seed in the inside is collected, namely the hybrid seed, namely shengjian 8.

Variety characteristics of saint sword No. 8: the plant is vigorous in growth, high-temperature resistant, good in continuous fruit setting, the fruits are in a claw shape, the fruits are 25-28 cm long, the shoulder width is 3.5-4.5 cm, the young fruits are green, the mature fruits are red, the appearance is bright, the commodity is good, the early ripening is realized, the hardness is good, the storage and transportation are resistant, the weight of each fruit is about 100g, and the peppery taste is strong. Can resist tobacco mosaic virus and epidemic diseases, and is suitable for protected field planting in spring.

The female parent CSVHPM81746054 is a stable inbred line which is formed by 6 generations of inbred separation and directional breeding of a hybrid 'Shannong 12' pepper variety. The inbred line has the main characteristic characteristics that: the plant grows vigorously, the plant is short, the internode is short, the fruit setting is good, the continuous fruit setting capability is strong, the fruit is in a goat horn shape, the fruit is 20-25 cm long, the shoulder width is 4-5 cm, the color of the fruit is light green, the fruit is yellow after being mature, the appearance is bright, smooth and straight, the spicy taste is strong, the plant has certain cold resistance, the tobacco mosaic virus disease resistance and the epidemic disease resistance are achieved, and the weight of a single fruit is about 100 g.

The male parent CSVHPF 816980012 is a stable inbred line which is formed by 8 generations of inbred separation and directional selection of a hybrid 'fast' hot pepper variety. The material has the main characteristic characteristics that: the plant grows vigorously, the internodes are slightly long, the fruits grow in a claw shape, the fruits are 25-28 cm long, the shoulder width is 4-5 cm, the fruit color is green, the fruits are red after being mature, the appearance is bright and straight, the tobacco mosaic virus disease and the epidemic disease are resisted, and the weight of a single fruit is about 100 g.

The invention also uses CSVSPM81870001 as female parent and CSVSPF81770005 as male parent, the F1 generation variety is obtained by hybridization, the female parent is castrated firstly, pollen is obtained from the male parent after the flower bud of the female parent is full, the pollen is fertilized on the castrated stigma of the female parent, then the fruit grows naturally and matures, the hybrid fruit is picked after color change, the seed in the interior is collected, namely the hybrid seed-Huali No. 3.

Gorgeous No. 3 species characteristics: the plant is vigorous in growth, resistant to low temperature, early-maturing in variety, good in continuous fruit setting, in a fruit lantern shape, 10-12cm long in fruit, 8-10cm wide in shoulder, dark green in fruit color, red in mature fruit, bright in appearance, good in marketability, good in hardness, resistant to storage and transportation, and about 230g in weight of a single fruit. Can resist tobacco mosaic virus and epidemic diseases, and is suitable for protected field planting in spring.

The female parent CSVSPM81870001 is a stable inbred line which is bred by a 7-generation inbred system for a hybrid 'Huangma' square pepper variety. The inbred line has the main characteristic characteristics that: the plant grows vigorously, the initial flower and the node are low, the internode is short, the fruit setting is good, the continuous fruit setting capability is strong, the fruit is lantern-shaped, the fruit is 9-11 cm long, the shoulder width is 8-10cm, the mature fruit is yellow, the fruit color is bright, the appearance is bright, the plant has certain cold resistance, and is resistant to tobacco mosaic virus diseases and epidemic diseases, and the weight of a single fruit is about 200 g.

The male parent CSVSPF81770005 is a stable inbred line which is obtained by 7 generations of inbred separation and directional selection of a hybrid Yinong 175 square pepper variety. The material has the main characteristic characteristics that: the fruit setting method has the advantages of short internodes, good fruit setting, strong continuous fruit setting capability, lantern-shaped fruits, high 4-ventricle rate, fruit length of 10-12cm, shoulder width of 9-11 cm, red mature fruits, bright fruit color, bright appearance, rich flavor, certain cold resistance, tobacco mosaic virus resistance, epidemic disease resistance and single fruit weight of about 230 g.

3. Seedling stage management: the temperature in a seedling raising room is kept at 25-30 ℃ before seed emergence, water is sprayed once every day to keep the matrix moist, the temperature is controlled at 20-25 ℃ in the daytime and 15-18 ℃ at night after seedling emergence, the temperature is controlled at 25-27 ℃ in the daytime and 15-20 ℃ at night after the first true leaves appear, meanwhile, the illumination time is increased, and ventilation is increased to avoid overlarge matrix humidity. One week before field planting, the sunshade net is removed, meanwhile, the ventilation time is increased, the seedlings are trained, the vain growth can be avoided, and the seedling resistance is improved.

4. Sampling for molecular marker detection: selecting young leaves with proper size by using tweezers, taking down the young leaves, putting the young leaves into a sampling box, filling a single plant number in a corresponding sampling sequence, directly sending the young leaves to a laboratory for detection after taking a sample, wherein the number is mainly a disease-resistant mark: anti-cucumber mosaic virus, anti-tobacco mosaic virus and anti-epidemic disease marker. According to the detection result, selecting homozygous positive single plants for field planting, and removing homozygous negative and heterozygous seedlings.

Secondly, soil preparation:

1. greenhouse arrangement: the method is characterized in that diseased fruits, rotten fruits and plants left by the previous stubbles are removed, greenhouse film is changed periodically in 9 months every year to guarantee light transmittance and dysprosium flowing property, the air port of the greenhouse is closed in the previous month of field planting, the greenhouse is smoked by using chlorothalonil, and the greenhouse is subjected to high-temperature greenhouse closing for 15 days, so that diseases in the greenhouse can be effectively killed, and the pesticide dosage is reduced.

2. Fertilizing and soil preparation: one week before field planting, 30 parts of rice hull manure is used per mu, and 100kg of compound fertilizer is used per mu. And deeply ploughing by using a small-sized rotary cultivator for 4 times, wherein the depth is about 20 cm. And cleaning broken bricks and weeds.

3. Bed adjustment: ridging and ridging, wherein the width of each ridge is 60cm, the height of each ridge is 20cm, and the width of each ridge is 70 cm.

Third, management of seedling stage

1. Planting: when the seedlings grow to six leaves and one heart, the seedlings are planted in the afternoon of a fine day by adopting a double-row staggered planting method. Reasonably close planting, wherein the plant spacing of the male parent is 35cm, the plant spacing of the female parent is 40cm, the row spacing is 50cm, and the proportion of the male parent to the female parent is reasonably 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. After planting, watering thoroughly in a large water flood irrigation mode for the first time.

2. Managing after planting: and controlling the temperature of the greenhouse at 24-28 ℃ in the daytime and 13-17 ℃ at night, watering for the second time about 3 days, irrigating roots with propamocarb, hymexazol and rooting agent, and intertillage and loosening soil after the soil is dried, wherein the air permeability of the soil is increased to facilitate the growth of roots, and weeds are prevented from growing in the soil. And after about two weeks, third water is poured, and water-soluble balance fertilizer is applied along with the water to supplement nutrition for the plants and promote the growth of the plants. Hanging vines of the peppers: 16 steel wires are tensioned between the upright posts and the shed frames of the greenhouse in the east-west direction, the height of the steel wires is 2.2 meters, the position of the steel wires is consistent with the direction of the upright posts, the steel wires are tensioned by 18 steel wires on the upper parts of the steel wires along the planting direction of the furrows, and the north and south sides of the steel wires are connected to the front shed frame and the rear upright posts of the greenhouse. Then, a 30-silk nylon rope with the length of 2 meters is tied right above the pepper seedlings, the lower side of the pepper seedlings is tied on the main branches of the peppers, the main branches are wound on the nylon rope, the positions of the nylon ropes are adjusted, the main branches of the peppers are mutually unfolded, and light transmission and air permeability are improved.

Fourth, cross pollination

1. Plant arrangement: the hot pepper is pruned by adopting a three-rod pruning method; the sweet pepper is pruned by a double-rod pruning method, all the sweet peppers are removed, and fruits are symmetrically remained, so that strong plants can be cultivated, and sufficient nutrition is provided for flowers and fruits. The second layer begins to leave flowers on the pepper, and is suitably prepared for emasculation (when the petals of the female parent bud are in the green to white state and begin to swell, at which time the anthers do not bloom and are easier to emasculate). Meanwhile, pruning the parent and the parents to remove branches below the capsicum and with poor development, and removing the capsicum and other flowers after the emasculation for the best time.

3. Castration: preparing a emasculation pollination tool: tip tweezers, alcohol, absorbent cotton, culture dish, special pollen isolating device of hot pepper breeding.

When the pepper flowers are castrated, the isolation cover is clamped on the flower stalks like a grafting clamp and connected with the isolation net cylinder, so that pollen and insects can be isolated, pollution of non-target pollen is avoided, and meanwhile, the pepper flowers are breathable and permeable, and the opening and development of the pepper flowers are not influenced. When flowers bloom and need to be pollinated, take off the isolation net section of thick bamboo again, accomplish the pollination operation, change the isolation net section of thick bamboo of another kind of colour, carry out accurate discernment to the flower that has accomplished castration and need the pollination for work efficiency.

The setting rate of the emasculation bud 1 day before blooming is high. And selecting flowers on the 2 nd-5 th layer of the main branches of the plants. The optimal castration period is when the flower bud is fully expanded, the bud is white, the petals are about to crack, the style is mature, and the anthers are not cracked. In the castration, flowers which are already blooming on plants are removed from the second layer of flowers before castration. Slightly clamping the base part of the pepper flower by using the thumb, the index finger and the middle finger of the left hand, slightly poking the petals by using the forceps held by the right hand, then inserting the tip of the forceps deeply into the base part of the anther cartridge, slightly releasing the clamping force on the forceps, spreading the anther, and then removing the anther. Meanwhile, an isolation cover is clamped on the flower stalk, an isolation net cylinder is installed, and the label is marked when the label is carried. Note that the stigma and the ovary of the flower are not hurt in the process, and the whole crown is left. Emasculation must be clean and thorough. At the same time, the bad flowers such as abnormal flowers and florets are removed.

4. Taking powder: the optimal pollination time is nine to ten am, flowers corresponding to the male parent are selected, petals are unfolded 180 degrees, and anthers are just cracked. The flowers were caught in a petri dish and flicked by hand, whereupon milky-white powdered pollen was seen to fall into the petri dish. The plates were marked.

5. Pollination: after the pollen is taken, selecting the castrated blooming flowers corresponding to the female parent number. Before pollination, the flower is determined to be emasculated cleanly, no anther or damage exists on the stigma, and the stigma of the flower is lightly put on the white pollen in a culture dish, so that the stigma is fully stained with the white pollen. After pollination, the isolating net cylinder with another color is used for distinguishing pollination. After fruit setting, the isolating net cylinder is removed, only the isolating cover is left to distinguish the hybrid fruit, and the action of the process needs to be stable so as not to stab or break the flower column. Sufficient pollination is required to ensure that the stigmas are evenly coated. After the powder of a group of parents is given, the culture dish needs to be replaced, and absorbent cotton is dipped in alcohol to wipe hands.

Management of fruit stage

When the hybridization is carried out and after the hybridization is finished, the plant pruning is carried out in time, and the flowers and buds which are not subjected to emasculation and pollination are all removed. Watering and fertilizing: summer and autumn: watering once in 6 days; in winter and spring: watering once in 12 days; before pollination, water is poured once and balanced water soluble fertilizer of 20kg per mu is applied, water cannot be poured greatly in the pollination process to prevent flower falling, and after the pepper bears fruits, water is poured and high-potassium water soluble fertilizer is applied. Thinning the fruits with the peppers: the abnormal fruits are timely removed in the fruit growing process, 1-2 fruits are left in the 2 nd layer of flowers, 3-4 fruits are left in each layer till the 5 th layer, and the tops of the hot peppers are removed after the hot peppers sit on the top layer of fruits, so that the plants supply nutrition to the fruits as much as possible, and the development of the fruits and seeds is promoted.

Sixthly, harvesting and airing

And (4) harvesting 50-80 days after pollination when the fruit is completely changed to eighty-nine percent. Before harvesting, when the fruit begins to turn color, checking whether the female parent has the mixed plant, if the fruit has different properties such as transverse meridian, longitudinal meridian, color, fruit shape, fruit surface and the like, the fruit is considered as the mixed plant, and the mixed plant is found to be required to be pulled out. In the fruit picking process, whether the fruits have the isolating covers or not is checked, the fruits with the isolating covers are hybrid fruits, and seeds need to be picked and taken; if the isolating cover is not arranged, the hybridization is not carried out, and the isolating cover needs to be removed and discarded. Removing impurities from the seeds, putting the seeds into a mesh bag, washing the seeds with water, and immediately drying the seeds. And (3) airing on a gauze in summer, wherein the gauze is 20cm away from the ground, and can be dried after 2-3 days, and the insolation is forbidden. And (3) drying the seeds in a high-temperature drying box at 27-32 ℃ for 48 hours in winter or in cloudy days, and cleaning the seeds to remove impurities after the seeds are dried. Then bagging, numbering and warehousing are carried out.

Comparative example 1

Other conditions were kept unchanged, and only the operation of step 1 of the second part of example 1 was changed:

A. one month before field planting, closing the air port of the greenhouse, and fumigating the greenhouse with chlorothalonil fumigant

B. One month before field planting, closing the air port of the greenhouse, and carrying out high-temperature greenhouse closing for 15 days

The results show that by adopting the method, namely closing the air port of the greenhouse one month before field planting, fumigating the greenhouse by using the chlorothalonil fumigant, and carrying out high-temperature greenhouse closing for 15 days, the diseases in the greenhouse can be effectively killed, and the pesticide dosage is reduced. If the operation is not carried out, a plurality of diseases can occur during later planting management, the planting cost is increased, and the yield of seeds is reduced. The invention can avoid many diseases and relatively improve the yield and quality of seeds.

Comparative example 2

Keeping the other process conditions the same as in example 1, only the conditions of step 1 of the third part of example 1 are set differently:

a. the row spacing of the peppers is 50, the plant spacing of male parents is 35cm, the plant spacing of female parents is 30cm, and the ratio of the male parents to the female parents is 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. Average seed yield of 31.9g/m²The average purity of the seeds is 98.31 percent.

b. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 35cm, the plant spacing of the female parents is 50cm, and the ratio of the male parents to the female parents is 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. Average seed yield of 30.7g/m²And the average purity of the seeds is 99.15 percent.

c. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 25cm, the plant spacing of the female parents is 40cm, and the ratio of the male parents to the female parents is 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. Average seed yield of 30.5g/m²The average purity of the seeds is 98.91 percent.

d. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 45cm, the plant spacing of the female parents is 40cm, and the ratio of the male parents to the female parents is 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. Average seed yield of 30.7g/m²Average seed purity 99.07%.

e. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 35cm, the plant spacing of the female parents is 40cm, the ratio of the male parents to the female parents is 1:4, and roots are dipped by propamocarb, hymexazol and rooting agent before planting. Average seed yield of 31.6g/m²And the average purity of the seeds is 99.12 percent.

f. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 35cm, the plant spacing of the female parents is 40cm, the ratio of the male parents to the female parents is 1:3, and the roots of the peppers are dipped by propamocarb, hymexazol and rooting agent before the planting. Average seed yield of 31.4g/m²And the average purity of the seeds is 99.13 percent.

g. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 35cm, the plant spacing of the female parents is 40cm, the ratio of the male parents to the female parents is 1:2, and the roots of the peppers are dipped by propamocarb, hymexazol and rooting agent before the planting. Seed flatAverage yield 32.1g/m²The average purity of the seeds is 99.21 percent.

h. The row spacing of the peppers is 50cm, the plant spacing of the male parents is 35cm, the plant spacing of the female parents is 40cm, the ratio of the male parents to the female parents is 1:2, and roots are dipped without medicaments before planting. Average seed yield of 30.1g/m²And the average purity of the seeds is 99.17 percent.

The results show that the row spacing of the pepper is 50cm, the plant spacing of the male parent is 35cm, the plant spacing of the female parent is 40cm, and the ratio of the male parent to the female parent is 1: 2. Before planting, the propamocarb, the hymexazol and the rooting agent are dipped in roots. Thus, the field planting is carried out, the seedlings are quick to recover, root diseases cannot be infected (the probability of occurrence of the root diseases is reduced), the plants are vigorous after growth, the male parents blossom more, sufficient pollen can be provided, the flowers of the female parents grow well, small flowers and abnormal flowers cannot appear, and the yield and the quality of seeds are the best.

Comparative example 3

The other conditions and methods are the same as in example 1, and the conditions in step 1 of the fourth section of example 1 are set differently:

a. the hot pepper is pruned by adopting a three-stem pruning method, only three main branches and first-level lateral branches are left, the rest branches are removed, the second layer is used for carrying out emasculation and pollination on the flowers of the hot pepper, the average seed yield of a single plant is 1556, and the average germination rate of the seeds is 95%.

b. The pepper is pruned by a four-rod pruning method, only four main branches and first-level side branches are left, the rest branches are removed, flowers of the third layer of the pepper are left for emasculation and pollination, the average seed yield of a single plant is 1426 seeds, and the average germination rate of the seeds is 90%.

c. The hot pepper is pruned by adopting a three-stem pruning method, only three main branches and first-level lateral branches are left, the rest branches are removed, flowers of the first layer of the gate pepper are left for castration and pollination, the average seed yield of a single plant is 1468 grains, and the average germination rate of the seeds is 89%.

d. The sweet pepper is pruned by adopting a two-stem pruning method, only two main branches and one-level lateral branch are left, the rest branches are removed, the second layer is used for carrying out emasculation and pollination on the flowers of the sweet pepper, the average seed yield of a single plant is 2207, and the average germination rate of the seeds is 93%.

e. The sweet pepper is trimmed by adopting a two-rod pruning method, only two main branches and one-level lateral branch are left, the rest branches are removed, flowers of the third layer of the pepper bucket are left for emasculation and pollination, the average seed yield of a single plant is 2056 grains, and the average germination rate of the seeds is 92%.

f. The sweet pepper is pruned by adopting a three-stem pruning method, only three main branches and first-level lateral branches are left, the rest branches are removed, flowers of the first layer of the capsicum frutescens are left for castration and pollination, the average seed yield of a single plant is 2137, and the average germination rate of the seeds is 87%.

The results show that the hot pepper pruning adopts a three-rod pruning method, only three main branches and one-level lateral branches are left, the rest are removed, the second layer performs castration and pollination on the flowers of the hot pepper, the sweet pepper pruning adopts a two-rod pruning method, only two main branches and one-level lateral branches are left, the rest are removed, and the second layer performs castration and pollination on the flowers of the hot pepper.

Comparative example 4

Other methods and conditions were as in example 1, with the following different settings being made in the fifth part of example 1:

a. when the hybridization is carried out and after the hybridization is finished, the plant pruning is carried out in time, and the flowers and buds which are not subjected to emasculation and pollination are all removed. Average seed yield of 32.2g/m²Average purity of seeds is 99.2%

b. When the hybridization work is carried out and after the hybridization work is finished, the plant pruning is not carried out, and the flowers and buds which are not subjected to emasculation and pollination are not removed. Average seed yield of 29.6g/m²Average purity of seeds is 82.1%

c. Before pollination, in the full-bloom stage of the capsicum annuum, water is poured once and 20kg of balanced water soluble fertilizer is applied to each mu, a small amount of water is poured by adopting a drip irrigation zone in the pollination process, large amount of water is not poured to prevent flower falling, and after the capsicum annuum bears fruits, water is poured and high-potassium water soluble fertilizer is applied. Average seed yield of 32.2g/m²。

d. Before pollination, watering once and applying 20kg of balanced water soluble fertilizer per mu in the full bloom stage of the capsicum annuum, and watering with big water in the pollination process. After the pepper bears fruits, watering and applying high-potassium water soluble fertilizer. Average seed yield of 26.5g/m²。

e. The first pepper is full of flowers before pollinationIn the period, water is poured once and 20kg of balanced water soluble fertilizer is applied to each mu, a drip irrigation zone is adopted to pour a small amount of water in the pollination process, large water irrigation is not carried out, and high-potassium water soluble fertilizer is not applied in the watering process after the pepper bears fruits. Average seed yield of 28.3g/m²。

The results show that when the hybridization work is carried out and after the hybridization work is finished, the plant pruning is carried out in time, and the flowers and buds which are not subjected to emasculation and pollination are all removed. By the operation, the seeds can obtain sufficient nutrition to develop, the pollution of other adjacent pollen is avoided, and the purity and the quality of the seeds can be obviously improved. Before pollination, in the full-bloom stage of the capsicum annuum, water is poured once and 20kg of balanced water-soluble fertilizer is applied in each mu, a drip irrigation zone is adopted to pour a small amount of water in the pollination process, and large water is not poured, so that flower falling can be prevented, the pollination and fruit setting rate of the capsicum annuum is improved, the seed yield is improved, and after watering in the later stage, high-potassium water-soluble fertilizer is applied, so that the fruits can obtain sufficient nutrition, and the seed yield is improved.

Comparative example 5

Other methods and conditions were the same as in example 1, and the sixth part of example 1 was subjected to setting of different conditions:

a. and (3) airing on a gauze in summer, wherein the gauze is 20cm away from the ground, and the gauze can be dried after being aired for 2-3 days, and the insolation is strictly prohibited. The average germination rate of the seeds is 95 percent.

b. And (3) airing on a gauze in summer, wherein the gauze is 20cm away from the ground, and the gauze can be dried after being aired for 1 day and is not exposed to the sun strictly. The average germination rate of the seeds is 88 percent.

c. And (3) airing on a gauze in summer, wherein the gauze is 10cm away from the ground, and the gauze can be dried after being aired for 2-3 days, and the insolation is strictly prohibited. The average germination rate of the seeds is 92 percent.

d. In winter or in cloudy days, the seeds can be dried in a high-temperature drying oven at the temperature of between 27 and 32 ℃ for about 48 hours, and the average germination rate of the seeds is 94 percent

e. In winter or in cloudy days, the seeds can be dried in a high-temperature drying oven at 25 ℃ for about 48 hours, and the average germination rate of the seeds is 91 percent.

f. In winter or in cloudy days, the seeds can be dried for 36 hours in a high-temperature drying oven at the temperature of 27-32 ℃, and the average germination rate of the seeds is 86 percent.

The result shows that in summer, the seeds are better aired on a gauze 20cm away from the ground for 2-3 days, the germination rate of the seeds is highest, when the ground is too close to the ground, the temperature of the sun irradiation ground is too high, the seeds are dried excessively, the germination rate of the seeds is reduced, and the airing is better after 2-3 days. In winter, the seeds are dried in a high-temperature drying oven at 27-32 ℃ for 48 hours, the germination rate of the seeds is highest, the seeds cannot be sufficiently dried due to too low temperature or too short drying time, and the germination rate of the seeds is influenced. Therefore, the gauze is placed on a gauze for airing in summer, the gauze is more than 20cm away from the ground, and the gauze can be aired for 2-3 days; in winter or in cloudy days, the seeds can be dried in a high-temperature drying oven at the temperature of 27-32 ℃ for about 48 hours, so that the germination rate of the seeds is the highest, and the quality of the seeds is the best.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Shandong Shouguang vegetable species group Co Ltd

SHANDONG SHOUGUANG VEGETABLE INDUSTRY GROUP Co.,Ltd.

<120> seed production method for pepper breeding

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tccagccatc cattatttca t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atcccgaact gccaataatt a 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaggggcgtt cttgagccaa 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tccatggagt tgttctgcat 20

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcagcaaaga aagattcacg aac 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acgtacactt gatgatgcct tgt 23

Claims (10)

1. A seed production method for pepper breeding comprises the following steps:

1) sowing male parents and female parents of the peppers, and carrying out seedling culture, wherein in the seedling culture stage, leaves are taken for molecular marker detection, and homozygous disease-resistant seedlings are reserved;

2) before field planting, soil preparation, fertilization, ridging and bed making are carried out;

3) when the seedlings grow to six leaves and one core, performing field planting by adopting a double-row staggered field planting method, wherein the row spacing of the same row is 45cm, the plant spacing of male parents is 35cm, the plant spacing of female parents is 40cm, the row spacing is 50cm, and the proportion of the male parents to the female parents is 1: 2;

4) after field planting, controlling the temperature at 24-28 ℃ in the daytime and 13-17 ℃ at night, and performing water and fertilizer management;

5) pruning the hot pepper by adopting a three-rod pruning method; the sweet peppers are trimmed by a double-rod pruning method, all the gate peppers are removed, and fruits are symmetrically left;

6) castration is carried out one day before flowers on the 2 nd-5 th layer of a main branch of a plant bloom, and after castration, the castrated pepper flowers are isolated by using a pollen isolation device;

7) pollen of the male parent is taken, pollination is carried out on the castrated blooming flowers, and after fruit setting, the pollen isolation device is removed;

8) when 80-90% of the fruits turn color, harvesting, and drying the seeds to obtain pepper seeds;

the step 1) and the step 2) are not limited in chronological order.

2. The method for producing seed according to claim 1, wherein in the step 1), the male parent is sowed one week earlier than the female parent.

3. The method for producing seeds of claim 1, wherein the step 1) of detecting the molecular marker comprises: cucumber mosaic virus resistance detection, tobacco mosaic virus resistance detection and epidemic disease resistance detection.

4. The method for seed production according to claim 1, characterized in that the method further comprises dipping roots with propamocarb, hymexazol and rooting agent before the permanent planting; immediately watering thoroughly after the field planting; planting for 2-4 days, watering and irrigating roots with propamocarb, hymexazol and rooting agent; planting for 12-16 days, watering and applying a water-soluble balance fertilizer.

5. The seed production method according to claim 1, characterized in that after all the capsicum annuum in the step 5) is removed, the method further comprises the step of reserving flowers on the capsicum annuum from the second layer and breaking off branches below the capsicum annuum and with poor development.

6. The method for producing seeds of claim 1, wherein the pollen isolation device comprises an isolation net cylinder and an isolation cover, and the isolation cover is detachably connected to an opening part of the isolation net cylinder; the isolating cover comprises two clamping parts which are opened and closed along the radial direction of the isolating net cylinder, and the isolating cover and the isolating net cylinder can be fixed on the flower stalk together after the two clamping parts are closed; the clamping part is provided with a connecting structure matched with the opening of the isolating net cylinder; the two clamping parts can be connected with the isolation net cylinder on the clamping parts after being closed.

7. The method for producing seeds of claim 1, wherein the pollination time in step 7) is nine to ten am.

8. The method for producing seeds of claim 1, wherein the step 7) further comprises removing all of the flowers and buds which are not pollinated; and (3) removing malformed fruits in time in the fruit growing process, reserving 1-2 fruits on the 2 nd layer of flowers, and reserving 3-4 fruits on each layer of the 3-5 th layer.

9. The method for producing seed as claimed in claim 1, wherein in step 8), before harvesting, the hybrid plants existing in the female parent are removed, and in harvesting, the hybrid fruits of the male parent and the female parent are harvested.

10. The method for producing seeds of claim 1, wherein the drying of step 8) comprises: airing on a gauze in summer, wherein the distance between the gauze and the ground is more than 20cm, and airing for 2-3 days; drying for 45-50 h at 27-32 ℃ in winter or in cloudy days.

Images