CN113186328B - Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof - Google Patents

Abstract

The invention discloses an identification method of a microsatellite DNA marker fingerprint of Flammulina velutipes 18 strains, a construction method and application thereof, including that the fingerprint is composed of 6 pairs of microsatellite DNA markers. The construction method includes: (1) mycelia culture; (2) extraction of genome DNA; (3) detection of microsatellite DNA molecular marker; (4) capillary electrophoresis detection. The application includes: carrying out microsatellite DNA marker amplification on Flammulina velutipes strains, and comparing the obtained band patterns with fingerprints, and if they are consistent with the fingerprints of this group, it is Flammulina velutipes Xujin 18 strains. Compared with conventional morphological detection, antagonism test and fruiting test, the present invention has the advantages of short detection time, high accuracy and good repeatability. Among the 105 main cultivated strains of Flammulina velutipes collected at home and abroad, Flammulina velutipes has Xu Specificity of gold 18 strains.

Description

Identification method of a microsatellite DNA marker fingerprint of Flammulina velutipes Xujin 18 strain method and its construction method and application

technical field

The invention belongs to the technical field of detection of Flammulina velutipes strains, and specifically relates to an identification method of a microsatellite DNA marker fingerprint of Flammulina velutipes 18 strains, a construction method and an application thereof.

Background technique

Flammulina filiformis is a commonly cultivated edible fungus, usually divided into white and yellow varieties. It has a long history of cultivation, and its total production volume has increased year by year. It has become the fastest growing and largest variety among industrialized edible fungus enterprises in my country. The daily output of my country's industrialized cultivation Flammulina velutipes accounts for about 47.12% of the total industrialized output of edible fungi in my country. Flammulina velutipes is rich in nutrients, delicious and has medicinal value. It is not only rich in various nutrients such as protein, minerals and vitamins, but also has anti-tumor, enhanced immune regulation, anti-virus, lowering blood fat, anti-fatigue and liver protection. This kind of medicinal health care effect is deeply loved by consumers.

High-quality strains play an important role in the yield and quality of Flammulina velutipes. The factory-cultivated strains of Flammulina velutipes in my country are dominated by white strains bred abroad with high first tide yield, short growth cycle and storage resistance. The breeding work of Flammulina velutipes is relatively lagging behind, which is also the reason for the small market share of domestic strains. However, compared with the current dominant industrial strains, my country has abundant wild and natural cultivation resources of Flammulina velutipes. Efficient use of these high-quality resources and expansion of the genetic basis of strains are conducive to the breeding of domestic high-yield, high-quality, and characteristic Flammulina velutipes strains.

In order to establish a registration system for new varieties of edible fungi to truly protect the property rights of varieties in our country, we must first establish a mature variety identification technology to lay the foundation for new variety registration. The product homogeneity phenomenon caused by the low diversity of Flammulina velutipes cultivation not only brings economic losses to the production enterprises, but also greatly affects the rapid development of China’s Flammulina velutipes industry; The quality requirements for the cultivated strains of Flammulina velutipes are getting higher and higher, and it is necessary to develop a simpler, faster and more accurate strain identification technology to ensure that each batch uses high-quality and accurate strains.

In view of the above-mentioned development status of Flammulina velutipes industry, it is extremely important to develop an accurate and effective identification system of Flammulina velutipes using modern molecular biology techniques.

Contents of the invention

The technical problem to be solved by the present invention is to provide a microsatellite DNA-marked fingerprint of Flammulina velutipes "Xujin 18" strain and its construction method and application. Compared with conventional morphological detection, antagonism test and fruiting test , has the advantages of short detection time, high accuracy and good repeatability.

Flammulina filiformis (Flammulinafiliformis) Xu Jin 18 was preserved in the Guangdong Provincial Microbial Culture Collection Center on February 8, 2021. The address is 5th Floor, Building 59, Compound, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Institute of Microbiology (Building 59, No. .100 Central Xian Lie Road, Guangzhou, China), the deposit number is GDMCCNo: 61514.

A microsatellite DNA marker fingerprint of Flammulina velutipes mushroom "Xujin 18" bacterial strain of the present invention, the fingerprint is composed of 6 pairs of microsatellite DNA markers, and SSR primers are developed based on simple repeat sequence fragments of Flammulina velutipes genome, and the amplification band pattern is good , SSR primers with high repeatability, the detailed information of the markers is shown in Table 1:

Table 1 Detailed information list of microsatellite DNA markers

A method for constructing a microsatellite DNA marker fingerprint of Flammulina velutipes "Xujin 18" strain of the present invention, comprising:

(1) Mycelia culture: transfer Flammulina velutipes strains to potato dextrose agar solid medium (PDA), collect mycelia after cultivating at 25°C for 8 days;

(2) Extraction of genomic DNA: extract the genomic DNA of the above-mentioned hyphae with the TaqHotStart amplification kit of TAKARA company, detect the concentration and purity of the total genomic DNA by ultraviolet spectrophotometry, and adjust the concentration of the sample DNA to be consistent;

(3) Detection of microsatellite DNA molecular markers: PCR amplification of gene microsatellite DNA markers is carried out to the above-mentioned extracted DNA;

(4) Electrophoresis detection: the product obtained by the above-mentioned PCR amplification is mixed with formamide loading buffer, denatured, and tested on the machine;

(5) GeneMapper data analysis.

The kit method in the described step (2) extracts the genome DNA specific technique of mycelium comprising:

(1) adding liquid nitrogen to the mycelium sample and fully grinding;

(2) Quickly add 360 μL BufferSTE and 40 μL BufferSDS to the ground powder, vortex and mix quickly, then place the centrifuge tube in a 65°C water bath for 15 minutes, and invert the centrifuge tube during the water bath to mix the sample several times;

(3) Add 5 μL RNaseSolution to the lysate, vortex and mix well, and let stand at room temperature for 15-30 minutes;

(4) Add 140 μL BufferPS, vortex for 30 seconds, and place on ice for 10 minutes;

(5) Centrifuge at 13,000 g for 5 min at room temperature, and carefully transfer 400 μL of the supernatant to a new centrifuge tube;

(6) Add 600 μL BufferPBD (diluted with absolute ethanol) to the sample, vortex and mix for 30 seconds;

(7) Put the DNA-binding column in a collection tube, transfer half of the mixture to the column, and centrifuge at 8000 g for 1 min;

(8) Discard the filtrate, put the column back into the collection tube, transfer the remaining mixture to the column, and centrifuge at 8000 g for 1 min;

(9) Discard the filtrate, put the column back into the collection tube, add 600 μL BufferGW2 (diluted with absolute ethanol) to the column, and centrifuge at 8000 g for 1 min;

(10) Repeat step 9;

(11) Discard the filtrate, put the column back into the collection tube, and centrifuge at 10000g for 2min to remove the residual ethanol in the column;

(12) Transfer the column to a new 1.5ml centrifuge tube, add 30 μL of BufferAE preheated to 65°C to the center of the membrane of the column, let it stand at room temperature for 2 minutes, and centrifuge at 10,000 g for 1 minute;

(13) Take 2 μL DNA for detection by 1.2% agarose gel electrophoresis, take 2 μL DNA for NanoDrop spectrophotometer concentration measurement, and store the remaining DNA at -20°C.

The PCR amplification system in the step (3) is: a total volume of 10 μL, including: 10×PCRbuffer 1 μL, 2.5 mmol/LdNTP 0.8 μL, 5U/μL HSTaq DNase 0.1 μL, 5 μmol/L microsatellite DNA labeled forward primer and reverse primer Add 0.6 μL of total primer volume, 1 μL of extracted template DNA at a concentration of 20 ng to 30 ng/μL, and 5.9 μL of ddH ₂ O;

PCR reaction conditions: 95°C for 5 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 35 cycles; 60°C for 30 minutes.

The loading buffer in the step (4) is 9 μL of a mixture of molecular weight internal standard and formamide (0.5:8.5); the loading volume of the PCR amplification product is 1 μL.

The specific process of the denaturation in the step (4) is to denature at 95° C. for 3 minutes, and place it in an ice-water mixture to cool for 3 minutes after completion.

The process parameters of the electrophoresis in the step (4) are: the denatured polyacrylamide gel is a commercial POP7 gel, the electrophoresis buffer is 3730bufferEDTA, the injection voltage is 2000V, the operating voltage is 15000V, the injection time is 10s, the temperature is 60°C, the capillary length 50cm, power 200W, electrophoresis 20min, current and power are dynamic.

The data analysis in the described step (5) is specifically: the original data file that detects is imported in the analysis software genemapperID3.2, uses software such as POPGENE, NTSYS to carry out the analysis of population structure, clustering and heterozygosity, core species Quantitative resource calculation and analysis. The number of alleles (Na, Ne), Nei’s genetic diversity index (He), Shannon’s diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.

Table 2 Summary of allelic fragment information amplified by SSR primers

The application of the microsatellite DNA marker fingerprint of a kind of Flammulina velutipes "Xujin 18" bacterial strain of the present invention is to utilize 6 pairs of SSR primers developed by the simple repeat sequence fragments of the Flammulina velutipes genome. The present invention has screened a large number of SSR primers and passed To the SSR primer band type amplification of 105 pieces of Flammulina velutipes main cultivars collected, the quantity and numbering (table 2) of the amplified allelic fragments amplified by 6 pairs of SSR primers in each Flammulina velutipes cultivars were determined, through different SSR alleles The number combination of loci can effectively identify the "Xu Jin 18" strain among the 105 main cultivars collected. The relative molecular weight of the allelic sites amplified by each SSR primer can be determined by capillary electrophoresis combined with software analysis. The strain with the specific SSR allelic fragment combination of "Xujin 18" strain is the "Xujin 18" strain of Flammulina velutipes. The number combination of the strain is: 6/5/(4+7)/(2+3)/(7+10)/(2+10).

Beneficial effects of the present invention: compared with conventional morphological detection, antagonism test, and fruiting test, the present invention has the advantages of short detection time, high accuracy and good repeatability. The operation time required for the detection is within 24 hours (including extraction of genomic DNA, PCR amplification, electrophoresis analysis, data analysis), while the conventional antagonism test takes at least two weeks, and the fruiting test takes at least 3 months. Time; The present invention method is in collected 105 commercially available Flammulina velutipes main cultivars (comprising Fv-DY, Fv-FY, Fv-SB, Fv-CYS, Fv-YH, Fv-KL, Fv-MG, Fv- MH, Fv-MI, Fv-MJ, Fv-SY, Fv-FM, Fv-WC, Fv-GF, Fv-BY, Fv-HL, Fv-RYJ, Fv-XH, Fv-HTC, Fv-GR, etc. ) has the specificity of "Xu Jin 18" strain and has a good application prospect.

Description of drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the accompanying drawings that need to be used in the description of the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For Those of ordinary skill in the art can also obtain other drawings based on these drawings without any creative effort. in:

Figure 1 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR1 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties;

Figure 2 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR3 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties;

Figure 3 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR10 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties;

Figure 4 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR11 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties;

Figure 5 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR13 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties;

Fig. 6 is the relative molecular weight peak diagram of the allelic sites detected sequentially by the primer FfSSR15 in the selected Flammulina velutipes cultivation material "Xujin 18" and several main commercial varieties.

Detailed ways

In order to make the above objects, features and advantages of the present invention more comprehensible, the specific implementation of the present invention will be described in detail below in conjunction with specific examples.

In the following description, a lot of specific details are set forth in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described here, and those skilled in the art can do it without departing from the meaning of the present invention. By analogy, the present invention is therefore not limited to the specific examples disclosed below.

Second, "one embodiment" or "an embodiment" referred to herein refers to a specific feature, structure or characteristic that may be included in at least one implementation of the present invention. "In one embodiment" appearing in different places in this specification does not all refer to the same embodiment, nor is it a separate or selective embodiment that is mutually exclusive with other embodiments.

Example 1:

(1) Mycelia culture: transfer Flammulina velutipes strains to potato dextrose agar solid medium (PDA), collect mycelia after cultivating at 25°C for 8 days;

(2) Extraction of genomic DNA: extract the genomic DNA of the above-mentioned hyphae with the TaqHotStart amplification kit of TAKARA company, detect the concentration and purity of the total genomic DNA by ultraviolet spectrophotometry, and adjust the concentration of the sample DNA to be consistent;

The CTAB method for extracting the genomic DNA from mycelium includes:

①Add the mycelium sample into liquid nitrogen and grind it thoroughly;

② Quickly add 360 μL BufferSTE and 40 μL BufferSDS to the ground powder, vortex quickly and mix well, then place the centrifuge tube in a 65°C water bath for 15 minutes, invert the centrifuge tube during the water bath to mix the sample several times;

③Add 5 μL RNaseSolution to the lysate, vortex and mix well, and let stand at room temperature for 15-30min;

④ Add 140 μL BufferPS, vortex for 30 seconds, and place on ice for 10 minutes;

⑤Centrifuge at 13000g for 5min at room temperature, carefully transfer 400μL supernatant to a new centrifuge tube;

⑥Add 600μL BufferPBD (diluted with absolute ethanol) to the sample, and vortex for 30s;

⑦Put the DNA binding column in the collection tube, transfer half of the mixture to the column, and centrifuge at 8000g for 1min;

⑧ Discard the filtrate, put the column back into the collection tube, transfer the remaining mixture to the column, and centrifuge at 8000g for 1min;

⑨ Discard the filtrate, put the column back into the collection tube, add 600μL BufferGW2 (diluted with absolute ethanol) to the column, and centrifuge at 8000g for 1min;

⑩Repeat step 9;

倒弃滤液把柱子装回收集管，10000g离心2min去除柱子中残留的乙醇；

Pour off the filtrate, put the column back into the collection tube, and centrifuge at 10000g for 2min to remove the residual ethanol in the column;

将柱子转移至新的1.5ml离心管中，加入30μL预热至65℃的BufferAE至柱子的膜中央，室温静置2min，10000g离心1min；

Transfer the column to a new 1.5ml centrifuge tube, add 30 μL of BufferAE preheated to 65°C to the center of the membrane of the column, let it stand at room temperature for 2 minutes, and centrifuge at 10,000g for 1 minute;

取2μLDNA用于1.2％琼脂糖凝胶电泳检测，取2μLDNA用于NanoDrop分光光度计测浓度，剩余DNA保存于-20℃。

Take 2 μL of DNA for 1.2% agarose gel electrophoresis detection, take 2 μL of DNA for NanoDrop spectrophotometer concentration, and store the remaining DNA at -20°C.

(3) Detection of microsatellite DNA molecular markers: PCR amplification of gene microsatellite DNA markers is carried out to the above-mentioned extracted DNA;

The PCR amplification system is: a total volume of 10 μL, including: 10×PCR buffer 1 μL, 2.5mmol/LdNTP 0.8 μL, 5U/μL HSTaq DNase 0.1 μL, 5 μmol/L microsatellite DNA labeled forward primer and reverse primer total volume 0.6 μL each, Concentration 20ng～30ng/μL extracted template DNA 1μL, ddH ₂ O 5.9μL;

PCR reaction conditions: 95°C for 5 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 35 cycles; 60°C for 30 minutes.

(4) Electrophoresis detection: Mix the product obtained by the above PCR amplification with 1 μL loading buffer, denature at 95°C for 3 minutes, and then place it in ice-water mixture for 3 minutes to cool; spot 3 μL on denatured polyacrylamide gel For electrophoresis, denatured polyacrylamide was coagulated into commercial POP7 gel, the electrophoresis buffer was 3730bufferEDTA, the injection voltage was 2000V, the operating voltage was 15000V, the injection time was 10s, the temperature was 60°C, the capillary length was 50cm, the power was 200W, and the electrophoresis was 20min. dynamic,

(5) Analysis of results

Six pairs of SSR primers were used for PCR amplification and capillary electrophoresis of Flammulina velutipes strains, and the heterozygosity was observed by analyzing the number of alleles (Na, Ne), Nei's genetic diversity index (He), shannon's diversity information index (I) and genes (Ho), combined with the relative molecular weight peak diagram of the allelic site, find the matching number combination: FfSSR1, FfSSR3, FfSSR10, FfSSR11, FfSSR13, FfSSR15, and the corresponding band pattern is: 6/5/(4+7)/(2 +3)/(7+10)/(2+10), it can be determined that the strain is Flammulina velutipes "Xu Jin 18" strain. In order to ensure the accuracy of the identification, three replicate experiments are recommended.

Fv-GR)。Taking several main commercial varieties as examples, the relative molecular weight peaks of allelic sites detected by 6 pairs of primers are given, as shown in Figures 1 to 6 (the order is ①Xujin 18②Fv-SY③Fv-FM④Fv-WC⑤Fv-GF⑥Fv -BY⑦Fv-HL⑧Fv-RYJ⑨Fv-XH⑩Fv-HTC

Fv-GR).

The fingerprint in the present invention refers to the combination of the primers and their band patterns.

It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention without limitation, although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be carried out Modifications or equivalent replacements without departing from the spirit and scope of the technical solution of the present invention shall be covered by the claims of the present invention.

sequence listing

<110> Shanghai Academy of Agricultural Sciences

<120> Identification method, construction method and application of microsatellite DNA marker fingerprint of Flammulina velutipes 18 strains

<130> 2021040905-zf-wjn

<141> 2021-04-09

<160> 12

<170> SIP Sequence Listing 1.0

<210> 1

<211> 19

<212>DNA

<213> Artificial Sequence

<400> 1

tctgaatgtc ccggagcgt 19

<210> 2

<211> 19

<212>DNA

<213> Artificial Sequence

<400> 2

gatacgagca gcactcgcg 19

<210> 3

<211> 19

<212>DNA

<213> Artificial Sequence

<400> 3

cgtgcgcgtt acaatccat 19

<210> 4

<211> 19

<212>DNA

<213> Artificial Sequence

<400> 4

taggcccccc aagaaacat 19

<210> 5

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 5

ggtgcacgct cctaaaccta 20

<210> 6

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 6

cttgtcgagg aagatccatg 20

<210> 7

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 7

agtgatgacg aggacagtga 20

<210> 8

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 8

ccttcctcct ccatagcaaa 20

<210> 9

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 9

atttcttcgg atgctttgga 20

<210> 10

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 10

ttctctttgc acacgtcgaa 20

<210> 11

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 11

agtcgtcgtt caaggtgtcg 20

<210> 12

<211> 20

<212>DNA

<213> Artificial Sequence

<400> 12

cggttgtttg ttccactttt 20

Claims (2)

1. an identification method of the microsatellite DNA marker fingerprint of Flammulina velutipes xujin 18 strains, it is characterized in that: described fingerprint is made up of 6 pairs of microsatellite DNA markers, and the concrete sequence of its corresponding 6 pairs of primers is as follows: FfSSR1 forward primer: TCTGAATGTCCCGGAGCGT; Reverse primer: GATACGAGCAGCACTCGCG; FfSSR3 forward primer: CGTGCGCGTTACAATCCAT; Reverse primer: TAGGCCCCCCAAGAAACAT; FfSSR10 forward primer: GGTGCACGCTCCTAAACCTA; Reverse primer: CTTGTCGAGGAAGATCCATG; FfSSR11 forward primer: AGTGATGACGAGGACAGTGA; Reverse primer: CCTTCCTCCTCCATAGCAAA; FfSSR13 forward primer: ATTTCTTCGGATGCTTTGGA; Reverse primer: TTCTCTTTGCACACGTCGAA; FfSSR15 forward primer: AGTCGTCGTTCAAGGTGTCG; Reverse primer: CGGTTGTTTGTTCCACTTTTT; The corresponding belt type number combination is: 6/5/(4+7)/(2+3)/(7+10)/(2+10); Among them, the band pattern number corresponding to primer FfSSR1 is 6, and the band size of the corresponding allele fragment is 283~283.99bp; the band pattern number corresponding to primer FfSSR3 is 5, and the band size of the corresponding allele fragment is The band pattern number corresponding to primer FfSSR10 is 4+7, wherein the band size of the allele fragment corresponding to number 4 is 278~278.99bp, and the band size of the allele fragment corresponding to number 7 is 284~284.99bp; the band pattern number corresponding to primer FfSSR11 is 2+3, the band size of the allele fragment corresponding to number 2 is 260~260.99bp, and the band size of the allele fragment corresponding to number 3 is 263 ~263.99bp; the band pattern number corresponding to primer FfSSR13 is 7+10, the band size of the allele fragment corresponding to number 7 is 226~226.99bp, and the band size of the allele fragment corresponding to number 10 is 229~ 229.99bp; the band pattern number corresponding to primer FfSSR15 is 2+10, the band size of the allele fragment corresponding to number 2 is 195~195.99bp, and the band size of the allele fragment corresponding to number 10 is 257~257.99 bp; The preservation number of the 18 strains of Flammulina velutipes Xujin is GDMCC No: 61514. 2. the application of the microsatellite DNA marker fingerprint of Flammulina velutipes 18 strains described in claim 1, is characterized in that: the microsatellite DNA marker fingerprint of described Flammulina velutipes 18 strains is used for identifying Flammulina velutipes 18 The specific allelic variation of the strain, and/or the specificity of identifying the strain of Flammulina velutipes Xujin 18.

Images