CN113186328B - Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof - Google Patents
Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof Download PDFInfo
- Publication number
- CN113186328B CN113186328B CN202110383020.1A CN202110383020A CN113186328B CN 113186328 B CN113186328 B CN 113186328B CN 202110383020 A CN202110383020 A CN 202110383020A CN 113186328 B CN113186328 B CN 113186328B
- Authority
- CN
- China
- Prior art keywords
- flammulina velutipes
- strain
- xujin
- primer
- size
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method of a microsatellite DNA marker fingerprint of a flammulina velutipes xujin 18 strain and a construction method and application thereof, wherein the fingerprint consists of 6 pairs of microsatellite DNA markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting microsatellite DNA molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: performing microsatellite DNA marker amplification on the flammulina velutipes strains, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the flammulina velutipes xujin 18 strains when the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the flammulina velutipes xujin 18 strain in 105 collected flammulina velutipes cultivation main culture strains at home and abroad.
Description
Technical Field
The invention belongs to the technical field of detection of flammulina velutipes strains, and particularly relates to an identification method of a microsatellite DNA marker fingerprint of a flammulina velutipes xujin 18 strain, and a construction method and application thereof.
Background
Flammulina velutipes (Flammulinaafiliformis) is a commonly cultivated edible fungus, and is generally classified into white and yellow varieties. The cultivation history is long, the total production amount is promoted year by year, and the strain is the fastest-developing and largest-scale strain in industrialized edible fungus enterprises in China at present. The daily yield of the industrial cultivation of the flammulina velutipes in China approximately accounts for 47.12 percent of the total industrial yield of the edible fungi in China. The needle mushroom is rich in nutrition, delicious in taste and high in medicinal value, is rich in various nutritional ingredients such as proteins, minerals and vitamins, has various medicinal health-care effects of resisting tumors, enhancing immunity regulation, resisting viruses, reducing blood fat, resisting fatigue, protecting liver and the like, and is popular with consumers.
The contribution rate of high-quality strains in the yield per unit and the quality of the flammulina velutipes is important. The industrialized flammulina velutipes cultivation strain in China is mainly white strain which is bred abroad and has high first tide yield, short growth period and storage durability. The breeding work of the flammulina velutipes is relatively lagged, which is also the reason of small market share of the domestic strains at present. But compared with the current leading industrialized strains, china has rich wild and natural flammulina velutipes cultivation resources, the high-quality resources are efficiently utilized, the genetic basis of the strains is expanded, and the breeding of the domestic high-yield, high-quality and characteristic flammulina velutipes strains is facilitated.
In order to establish a new species registration system of edible fungi to really protect the property rights of species in China, a mature species identification technology must be established at first to lay a foundation for registering the new species. The phenomenon of product homogenization caused by low diversity of needle mushroom culture strains not only brings economic loss to production enterprises, but also greatly influences the rapid development of the needle mushroom industry in China; on the other hand, the requirements of industrial cultivation modes and strain degeneration phenomena on the quality of flammulina velutipes cultivation strains are higher and higher, and a simpler, quicker and more accurate strain identification technology needs to be developed so as to ensure that each batch of strains used is high-quality and accurate.
Aiming at the current development situation of the flammulina velutipes industry, the development of an accurate and effective flammulina velutipes strain identification system by utilizing the modern molecular biology technology is an extremely important work.
Disclosure of Invention
The invention aims to solve the technical problem of providing a microsatellite DNA marker fingerprint of a flammulina velutipes Xujin 18 strain and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonistic test and fruiting test.
Flammulina velutipes (Flammulinaafiliformis) Xujin 18, which was deposited at the Guangdong province center for microorganism culture Collection at 2021, 2, 8, with the address of Guangzhou city, mieli Zhou No.100, building No. 59, building No. 5, guangdong institute for microorganisms (Building 59, no.100 Central Xiao Lie Road, guangzhou, china), and with the deposit number GDMCCNo:61514.
The invention relates to a microsatellite DNA marker fingerprint of a flammulina velutipes Xujin 18 strain, which consists of 6 pairs of microsatellite DNA markers, is an SSR primer developed based on simple repetitive sequence fragments of flammulina velutipes genome, has good amplification band type and high repeatability, and has detailed marking information shown in a table 1:
TABLE 1 microsatellite DNA marker details List
The invention relates to a method for constructing a microsatellite DNA marker fingerprint of a flammulina velutipes Xujin 18 strain, which comprises the following steps:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 8d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) Detection of microsatellite DNA molecular markers: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(5) GeneMapper data analysis.
The specific process for extracting the genome DNA of the hyphae by the kit method in the step (2) comprises the following steps:
(1) Adding liquid nitrogen into the hypha sample, and fully grinding;
(2) Adding 360 mu LBuffersT and 40 mu LBuffersDS into the ground powder rapidly, mixing the mixture by vortex rapidly, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) Adding 5 mu LRNasesolution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) Adding 140 mu LBuffERPS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Add 600 u LBufferPBD (has been diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring off the filtrate, putting the column back into the collecting pipe, adding 600 mu LBufferGW2 (diluted by absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging at 10000g for 2min to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) Taking 2 mu LDNA for detecting by 1.2% agarose gel electrophoresis, taking 2 mu LDNA for measuring the concentration by a NanoDrop spectrophotometer, and storing the residual DNA at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/LdNTP0.8 uL, 5U/uLHSTaqDNase 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume 0.6 uL respectively, template DNA1 uL, ddH extracted with concentration of 20 ng-30 ng/uL 2 O5.9μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃ for 35 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (4) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (4) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (4) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730bufferEDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample introduction time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is 20min, and the current and the power are dynamic.
The data analysis in the step (5) specifically comprises the following steps: and (3) importing the detected original data file into analysis software genemapperID3.2, performing group structure analysis, clustering and heterozygosity analysis by using POPGENE, NTSYS and other software, and performing core germplasm resource calculation analysis. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention discloses application of a microsatellite DNA marker fingerprint of a flammulina velutipes Xujin 18 strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence fragments of flammulina velutipes genomes are utilized, a large number of SSR primers are screened, the number of allelic fragments amplified by the 6 pairs of SSR primers in each flammulina velutipes culture is determined and numbered (table 2) by performing banding amplification on 105 collected SSR primers of main flammulina velutipes cultures, and the Xujin 18 strain can be effectively identified in 105 collected main flammulina velutipes cultures through the combination of the numbers of different SSR allelic sites. The relative molecular weight of the allelic locus amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined with software, the strain with the specific SSR allelic fragment combination of the strain Xujin 18 is the strain Xujin 18 of the flammulina velutipes, and the number combination of the strain is as follows: 6/5/(4+7)/(2+3)/(7+10)/(2+10).
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for a conventional antagonism test is at least two weeks, and the time required for a fruiting test is at least 3 months; the method has specificity of 'creep gold 18' strains in 105 collected main cultivation strains of commercially available flammulina velutipes (including Fv-DY, fv-FY, fv-SB, fv-CYS, fv-YH, fv-KL, fv-MG, fv-MH, fv-MI, fv-MJ, fv-SY, fv-FM, fv-WC, fv-GF, fv-BY, fv-HL, fv-RYJ, fv-XH, fv-HTC, fv-GR and the like), and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a peak diagram of the relative molecular weight of allelic loci obtained by sequentially detecting a primer FfSSR1 in a selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively;
FIG. 2 is a peak diagram of the relative molecular weight of the allelic locus obtained by sequentially detecting the primer FfSSR3 in the selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively;
FIG. 3 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of the primers FfSSR10 in selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively;
FIG. 4 is a peak diagram of the relative molecular weights of the allelic sites obtained by sequentially detecting the primers FfSSR11 in the selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively;
FIG. 5 is a peak diagram of the relative molecular weight of the allelic site obtained by sequentially detecting the primer FfSSR13 in the selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively;
FIG. 6 is a diagram of allelic site relative molecular weight peaks obtained by sequential detection of the primer FfSSR15 in selected flammulina velutipes cultivation material Xujin 18 and several main cultivation commercial varieties respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention more comprehensible, embodiments accompanying specific embodiments of the present invention are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced otherwise than as specifically described herein, and it will be appreciated by those skilled in the art that the present invention may be practiced without departing from the spirit and scope of the present invention and that the present invention is not limited by the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating needle mushroom strain to potato glucose agar solid culture medium (PDA), culturing at 25 deg.C for 8d, and collecting mycelium;
(2) Extraction of genomic DNA: extracting the genome DNA of the hyphae by using a TaqHotStart amplification kit of TAKARA, detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the CTAB method for extracting genome DNA of hyphae comprises the following steps:
(1) adding liquid nitrogen into the hypha sample, and fully grinding;
(2) rapidly adding 360 mu LBuffersT and 40 mu LBuffersDS into the ground powder, rapidly vortexing and uniformly mixing, placing the centrifugal tube in a water bath at 65 ℃ for 15min, and reversing the centrifugal tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 mu LRNasesolution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) adding 140 mu LBuffERPS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600 μ LBufferPBD (diluted with absolute ethanol) to the sample, vortex mix for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;
(9) the filtrate was decanted and the column was returned to the collection tube, 600. Mu.L of LBufferGW2 (diluted with absolute ethanol) was added to the column, 8000g was centrifuged for 1min;
r repeats step 9;
(3) Detecting the microsatellite DNA molecular marker: carrying out PCR amplification of gene microsatellite DNA markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/LdNTP0.8 uL, 5U/uLHSTaqDNase 0.1 uL, 5 umol/L microsatellite DNA mark forward primer and reverse primer total volume each 0.6 uL, template DNA1 uL, ddH extracted with the concentration of 20 ng-30 ng/uL 2 O5.9μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second at 95 ℃, 30second at 60 ℃, 30second at 72 ℃ for 35 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with 1 μ L sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730bufferEDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
Performing PCR amplification and capillary electrophoresis on needle mushroom strains by adopting 6 pairs of SSR primers, and finding a matched code combination by analyzing allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) in combination with a relative molecular weight peak diagram of an allele: ffSSR1, ffSSR3, ffSSR10, ffSSR11, ffSSR13 and FfSSR15, and the corresponding band types are as follows: 6/5/(4 + 7)/(2 + 3)/(7 + 10)/(2 + 10) to determine the strain as the Jinzhen mushroom Xujin 18 strain. To ensure the accuracy of the identification, three replicates were recommended.
By taking several main commercial varieties as examples, peak maps of the relative molecular weights of the allelic sites obtained by sequential detection of 6 pairs of primers are shown in FIGS. 1-6 (sequential (1) Xujin 18 (2))v-GF⑥Fv-BY⑦Fv-HL⑧Fv-RYJ⑨Fv-XH⑩Fv-HTC
Fv-GR)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> identification method of microsatellite DNA marker fingerprint of flammulina velutipes Xujin 18 strain, construction method and application thereof
<130> 2021040905-zf-wjn
<141> 2021-04-09
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tctgaatgtc ccggagcgt 19
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gatacgagca gcactcgcg 19
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgtgcgcgtt acaatccat 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taggcccccc aagaaacat 19
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggtgcacgct cctaaaccta 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cttgtcgagg aagatccatg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agtgatgacg aggacagtga 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccttcctcct ccatagcaaa 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
atttcttcgg atgctttgga 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ttctctttgc acacgtcgaa 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
agtcgtcgtt caaggtgtcg 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cggttgtttg ttccactttt 20
Claims (2)
1. A method for identifying a microsatellite DNA marker fingerprint of a flammulina velutipes Xujin 18 strain is characterized by comprising the following steps: the fingerprint consists of 6 pairs of microsatellite DNA markers, and the specific sequences of 6 pairs of corresponding primers are as follows:
FfSSR1 forward primer: TCTGAATGTCCCCGGAGCGT;
reverse primer: gatacgagcaggccgcg;
FfSSR3 forward primer: CGTGCGCGTTACATCCAT;
reverse primer: TAGGCCCCCCCAAGAACAT;
FfSSR10 forward primer: ggtgcacgctcctaaactca;
reverse primer: CTTGTCGAGGAAGATCCATG;
FfSSR11 forward primer: AGTGATGACGAGGACAGTGA;
reverse primer: ccttcctctccctcaatagcaa;
FfSSR13 forward primer: atttccttcggatgctttgga;
reverse primer: TTCTCTTTGCACGTTCGAA;
FfSSR15 forward primer: AGTCGTCGTTCAAGGTGTCG;
reverse primer: CGGTTGTTTGTTCCACTTTT;
the corresponding combination of the belt type numbers is as follows: 6/5/(4 + 7)/(2 + 3)/(7 + 10)/(2 + 10);
the corresponding band type number of the primer FfSSR1 is 6, and the band size of the corresponding allele fragment is 283 to 283.99bp; the corresponding band type number of the primer FfSSR3 is 5, and the corresponding allelic gene fragment has the strip size of 345 to 345.99bp; the band type number corresponding to the primer FfSSR10 is 4+7, wherein the size of the strip of the allele segment corresponding to the number 4 is 278 to 278.99bp, and the size of the strip of the allele segment corresponding to the number 7 is 284 to 284.99bp; the band type number corresponding to the primer FfSSR11 is 2+3, wherein the size of the strip of the allele segment corresponding to the number 2 is 260 to 260.99bp, and the size of the strip of the allele segment corresponding to the number 3 is 263 to 263.99bp; the band type number corresponding to the primer FfSSR13 is 7+10, wherein the size of the strip of the allele segment corresponding to the number 7 is 226 to 226.99bp, and the size of the strip of the allele segment corresponding to the number 10 is 229 to 229.99bp; the band type number corresponding to the primer FfSSR15 is 2+10, wherein the band size of the allele segment corresponding to the number 2 is 195 to 195.99bp, and the band size of the allele segment corresponding to the number 10 is 257 to 257.99bp;
the preservation number of the flammulina velutipes xujin 18 strain is GDMCC No. 61514.
2. The use of a microsatellite DNA marker fingerprint of a strain of Flammulina velutipes (Fr.) Sing 18 as set forth in claim 1, wherein: the microsatellite DNA marker fingerprint of the flammulina velutipes Xujin 18 strain is used for identifying the specific allelic variation of the flammulina velutipes Xujin 18 strain and/or identifying the specificity of the flammulina velutipes Xujin 18 strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110383020.1A CN113186328B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110383020.1A CN113186328B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113186328A CN113186328A (en) | 2021-07-30 |
| CN113186328B true CN113186328B (en) | 2023-02-28 |
Family
ID=76975330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110383020.1A Active CN113186328B (en) | 2021-04-09 | 2021-04-09 | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113186328B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131085A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR marker fingerprint spectrum of golden mushroom Sanming BX3 bacterial classification and application thereof |
| CN104131007A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR labeled fingerprint of flammulina velutipes "chuanhuang" strain and applications thereof |
| CN105506124A (en) * | 2016-01-12 | 2016-04-20 | 浙江省农业科学院 | SSR labeling primer of flammulina velutipes F101 culture and fingerprint application thereof |
-
2021
- 2021-04-09 CN CN202110383020.1A patent/CN113186328B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131085A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR marker fingerprint spectrum of golden mushroom Sanming BX3 bacterial classification and application thereof |
| CN104131007A (en) * | 2014-07-04 | 2014-11-05 | 上海市农业科学院 | SSR labeled fingerprint of flammulina velutipes "chuanhuang" strain and applications thereof |
| CN105506124A (en) * | 2016-01-12 | 2016-04-20 | 浙江省农业科学院 | SSR labeling primer of flammulina velutipes F101 culture and fingerprint application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Development and characterization of simple sequence repeat (SSR) markers for the mushroom Flammulina velutipes;Ruiying Zhang等;《Journal of Bioscience and Bioengineering》;20101231;第110卷(第3期);第274页右栏第2-3段-第275页左栏第1-2段、表1-2、图1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113186328A (en) | 2021-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
| CN112941224A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of golden 6046 strain of flammulina velutipes, construction method and application thereof | |
| CN112795690A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of flammulina velutipes J3931 strain as well as construction method and application of identification method | |
| CN113186328B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes xujin 18 strain and construction method and application thereof | |
| CN112725522A (en) | Golden needle mushroom 1767 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
| CN112941223A (en) | Golden needle mushroom 6168 strain and identification method and construction method and application of SSR marker fingerprint spectrum thereof | |
| CN112980992B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FW178 strain, construction method and application thereof | |
| CN113151548B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FV1923 strain and construction method and application thereof | |
| CN112980994B (en) | Identification method of SSR marker fingerprint of needle mushroom strain and construction method and application thereof | |
| CN112980995B (en) | Identification method of microsatellite DNA marker fingerprint of golden needle mushroom 1754 strain and construction method and application thereof | |
| CN112961933B (en) | Identification method of microsatellite DNA marker fingerprint spectrum of flammulina velutipes FL159 strain and construction method and application thereof | |
| CN112961934B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes SCY12 strain and construction method and application thereof | |
| CN112813193B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes X995 strain and construction method and application thereof | |
| CN113005220B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes J1011 strain, construction method and application thereof | |
| CN113151547B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FL1980 strain, construction method and application thereof | |
| CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
| CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
| CN112760411A (en) | Identification method of SSR marker fingerprint of flammulina velutipes J4137 strain and construction method and application thereof | |
| CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
| CN112831591A (en) | Identification method of SSR marker fingerprint of flammulina velutipes J3673 strain, construction method and application thereof | |
| CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
| CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
| CN112813183B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |