CN112795686B - SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof - Google Patents
SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof Download PDFInfo
- Publication number
- CN112795686B CN112795686B CN202110164016.6A CN202110164016A CN112795686B CN 112795686 B CN112795686 B CN 112795686B CN 202110164016 A CN202110164016 A CN 202110164016A CN 112795686 B CN112795686 B CN 112795686B
- Authority
- CN
- China
- Prior art keywords
- strain
- primer
- size
- belt
- ssr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SSR marker fingerprint of hypsizigus marmoreus Huyan No. 18 strain and a construction method and application thereof, wherein the fingerprint consists of 6 pairs of SSR markers. The construction method comprises the following steps: (1) hypha culture; (2) extracting genome DNA; (3) detecting SSR molecular markers; and (4) detecting by capillary electrophoresis. The application comprises the following steps: and performing SSR marker amplification on the hypsizigus marmoreus strain, comparing the obtained banding pattern with the fingerprint spectrum, and obtaining the hypsizigus marmoreus strain Hu Zhen 18 strain if the banding pattern is consistent with the fingerprint spectrum. Compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability, and has the specificity of the Huzhen No. 18 hypsizygus marmoreus in the collected 56 hypsizygus marmoreus cultivation main culture strains at home and abroad.
Description
Technical Field
The invention belongs to the technical field of detection of hypsizigus marmoreus strains, and particularly relates to an SSR marker fingerprint of hypsizigus marmoreus Huyan No. 18 strain, and a construction method and application thereof.
Background
Hypsizigus marmoreus (Peck) H.E.Bigelow, a species of Basidiomycota, agaricales, lyophyllaceae, is named due to marble patches on the surface of its pileus. The seafood soup is attractive in appearance, crisp and tender in texture, unique in seafood flavor and economical in price, and is popular with consumers. The hypsizigus marmoreus not only contains abundant vitamins and 18 amino acids, but also has the functions of hemolysis, antioxidation, leukemia and lymphoma cell inhibition, blood fat reduction, inflammation resistance, antioxidation and the like in components such as micromolecular compounds, polysaccharide, polypeptide and the like contained in the hypsizigus marmoreus through recent research, and is edible and medicinal fungi with high economic value. Since the first industrialized culture enterprise of hypsizygus marmoreus in China established in 2001, hypsizygus marmoreus becomes one of novel edible fungi which are developed in markets of China quickly. The industrialized total yield of the hypsizigus marmoreus in 2019 is 32.8 ten thousand tons, the yield is increased by 58.63% in comparison with the yield increased by 2018, the yield accounts for 9.6% of the industrialized total yield of the edible fungi, and the rate is the third in the industrialized edible fungi production amount in China.
The high-quality strain plays a very important role in the industrial cultivation of hypsizigus marmoreus. At present, hypsizigus marmoreus strains used by industrialized production enterprises in China are mainly introduced into Japan or further hybridized and bred on the basis of the introduced strains, the cultured hypsizigus marmoreus fruiting bodies are brown and are called as hypsizigus marmoreus, and the fruiting bodies are white and are also called as white hypsizigus marmoreus or hypsizigus marmoreus. Although the yield of factory production is improved year by year, partial strains still have the problems of long cultivation period, low yield per unit, poor appearance uniformity of single fruiting body, easy occurrence of cap formation and the like, and the defects can cause the increase of production cost and reduce the market competitiveness of products. On the other hand, the industrialized production strains of the hypsizigus marmoreus are not high in diversity and similar in product appearance, so that the diversified requirements of market consumers cannot be met. The method has rich wild and natural culture resources of the hypsizigus marmoreus, efficiently utilizes the high-quality resources, expands the genetic basis of the strains, and is beneficial to breeding the high-yield, high-quality and special hypsizigus marmoreus strains in China.
With the promulgation and implementation of the protection law of new species of international plants, the establishment of a mature, rapid and accurate molecular biology identification technical system becomes a powerful means for protecting the intellectual property rights of edible fungus varieties.
Disclosure of Invention
The invention aims to solve the technical problem of providing an SSR marker fingerprint of a hypsizygus marmoreus strain Huzhen No. 18 and a construction method and application thereof, wherein the fingerprint has the advantages of short detection time, high accuracy and good repeatability compared with conventional morphological detection, antagonism test and fruiting test.
Hypsizygus marmoreus (Hypsizygus marmoreus) Huzhen No. 18 was deposited in China general microbiological culture Collection center at 13.06.2019 with the address of Beijing university Hokko No.1, shih West Lu No. 3, the rising area of Beijing, and the number of deposits at the institute of microbiology, china academy of sciences, CGMCC No.17796.
The SSR marker fingerprint of the hypsizigus marmoreus strain Huzhen No. 18 consists of 6 pairs of SSR markers, is an SSR primer developed based on simple repetitive sequence fragments of hypsizigus marmoreus genome, has good amplification band type and high repeatability, and has detailed marker information shown in a table 1:
TABLE 1 SSR tag detailed information List
The invention relates to a method for constructing an SSR marker fingerprint of a hypsizygus marmoreus 'Huzhen No. 18' strain, which comprises the following steps:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10-14d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
(3) SSR molecular marker primer development: selecting a polymorphic sequence to design an SSR primer and synthesizing according to the genome re-sequencing result of the hypsizigus marmoreus strain;
(4) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
(5) And (3) electrophoresis detection: mixing the product obtained by PCR amplification with formamide sample adding buffer solution, denaturing, and detecting on a computer;
(6) GeneMapper data analysis.
The method for constructing the SSR marker fingerprint of the hypsizigus marmoreus hunger No. 18 strain is characterized by comprising the following steps of: the step (2) of extracting the genome DNA comprises the following specific steps:
(1) Adding a fungus sample into liquid nitrogen for fully grinding;
(2) Adding 360 μ l of Buffer STE and 40 μ l of Buffer SDS into the ground powder rapidly, quickly whirling and mixing uniformly, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for several times;
(3) Adding 5 mu L of RNase Solution into the lysate, uniformly mixing by vortex, and standing for 15-30min at room temperature;
(4) Adding 140 μ L Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) Adding 600 mu.L Buffer PBD into the sample, and uniformly mixing for 30s by vortex;
(7) Loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) Pouring off the filtrate, putting the column back into the collecting pipe, transferring the residual mixed solution into the column, and centrifuging for 1min at 8000 g;
(9) Pouring the filtrate and putting the column back into the collecting pipe, adding 600 mu L of Buffer GW2 into the column, and centrifuging for 1min at 8000 g;
(10) Repeating the step 9;
(11) Pouring off the filtrate, putting the column back into the collecting pipe, centrifuging for 2min at 10000g to remove the residual ethanol in the column;
(12) Transferring the column to a new 1.5ml centrifuge tube, adding 30 μ L of Buffer AE preheated to 65 deg.C to the center of the membrane of the column, standing at room temperature for 2min, and centrifuging at 10000g for 1min;
(13) mu.L of DNA was subjected to 1.2% agarose gel electrophoresis, 2. Mu.L of DNA was subjected to NanoDrop spectrophotometry, and the remaining DNA was stored at-20 ℃.
The PCR amplification system in the step (3) is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 59 ℃, 30second, at 72 ℃, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.
The sample adding buffer solution in the step (5) is 9 mu L of a molecular weight internal standard and formamide mixed solution (0.5; the amount of the PCR amplification product added was 1. Mu.L.
The specific process of denaturation in the step (5) is to denature at 95 ℃ for 3min, and then to cool in an ice-water mixture for 3min.
The electrophoresis in the step (5) has the following process parameters: the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the capillary length is 50cm, the power is 200W, the electrophoresis is performed for 20min, and the current and the power are dynamic.
The data analysis in the step (6) is specifically as follows: and (3) importing the detected original data file into analysis software GeneMapper ID3.2, and performing group structure analysis, clustering and heterozygosity analysis and core germplasm resource calculation analysis by using software such as POPGENE, NTSYS and the like. Allele factors (Na, ne), nei's genetic diversity index (He), shannon's diversity information index (I) and gene observation heterozygosity (Ho) were analyzed.
TABLE 2 summary of allelic fragment information from SSR primer amplification
The invention relates to an application of SSR marker fingerprint of hypsizygus marmoreus "Huzhen No. 18" strain, which is characterized in that 6 pairs of SSR primers developed by simple repetitive sequence fragments of hypsizygus marmoreus genome are utilized, a large number of SSR primers are screened, the number of allelic fragments amplified by the 6 pairs of SSR primers in each hypsizygus marmoreus cultivated variety is determined and numbered (table 2) by performing banding amplification on the SSR primers of 56 collected hypsizygus marmoreus main cultivated varieties, and the "Huzhen No. 18" strain can be effectively identified in the 56 collected main cultivated varieties by the combination of the numbers of different SSR allelic sites. The relative molecular weight of the allelic locus amplified by each SSR primer can be determined by analyzing capillary electrophoresis combined with software, the strain with the Huzhen No. 18 strain specific SSR allelic fragment combination is the Hypsizygus marmoreus Huzhen No. 18 strain, and the serial number combination of the strain is as follows: (4+9)/(1+2)/(3+7)/(4+8)/(1+3)/(4+7).
The invention has the beneficial effects that: compared with conventional morphological detection, antagonism test and fruiting test, the method has the advantages of short detection time, high accuracy and good repeatability. The operation time required for detection is within 24h (including genome DNA extraction, PCR amplification, electrophoresis analysis and data analysis), while the time required for a conventional antagonism test is at least two weeks, and the time required for a fruiting test is at least 3 months; the method has the specificity of the Huzhen No. 18 strain in the collected 56 commercial hypsizygus marmoreus main culture strains, and has good application prospect.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR11 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively;
FIG. 2 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR12 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively;
FIG. 3 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR32 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively;
FIG. 4 is a diagram of the allelic site relative molecular weight peaks obtained by sequential detection of the primer HMSSR35 in the selected hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively;
FIG. 5 is a diagram of the allelic site relative molecular weight peaks obtained by sequential detection of the primer HMSSR36 in the selected hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively;
FIG. 6 is a diagram showing the relative molecular weight peaks of the allelic sites of the primer HMSSR38 detected in sequence in the selected Hypsizygus marmoreus cultivation material "Huzhen No. 18" and several main cultivation commercial varieties, respectively.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
Example 1:
(1) Hypha culture: inoculating Hypsizigus marmoreus strain to potato glucose agar solid culture medium, culturing at 22 deg.C for 10d, and collecting mycelium;
(2) Extraction of genomic DNA: the fungal DNA extraction kit is used, the genomic DNA is extracted according to the kit experimental steps, and 2 mu L of DNA is taken for carrying out 1.2% agarose gel electrophoresis detection. Detecting the concentration and purity of the total genome DNA by an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to be consistent;
the process for extracting the genome DNA of hyphae by the CTAB method comprises the following steps:
(1) adding a fungus sample into liquid nitrogen for fully grinding;
(2) adding 360 mu L of Buffer STE and 40 mu L of Buffer SDS into the ground powder quickly, quickly whirling and uniformly mixing, placing the centrifuge tube in a water bath at 65 ℃ for 15min, and reversing the centrifuge tube in the water bath process to mix the sample for a plurality of times;
(3) adding 5 μ L RNase Solution into the lysate, mixing by vortex, and standing at room temperature for 15-30min;
(4) adding 140 mu L of Buffer PS, vortexing and shaking for 30s, and standing on ice for 10min;
(5) 13000g was centrifuged for 5min at room temperature, and 400. Mu.L of the supernatant was carefully transferred to a new centrifuge tube;
(6) add 600. Mu.L Buffer PBD (diluted with absolute ethanol) to the sample, vortex and mix for 30s;
(7) loading the DNA binding column in a collecting tube, transferring half of the mixed solution to the column, and centrifuging at 8000g for 1min;
(8) pouring off the filtrate, loading the column back into the collecting pipe, transferring the rest mixed solution into the column, and centrifuging at 8000g for 1min;
(9) pouring the filtrate and putting the column back into the collecting pipe, adding 600 μ L Buffer GW2 (diluted with absolute ethyl alcohol) into the column, and centrifuging at 8000g for 1min;
r repeats step 9;
(3) Detection of SSR molecular markers: carrying out PCR amplification of gene SSR markers on the extracted DNA;
the PCR amplification system is as follows: total volume 10 μ L, including: 10 XPCR buffer1 uL, 2.5mmol/L dNTP 0.8 uL, 5U/uL TAKARA HSTaq enzyme 0.1 uL, 5 umol/L TP-M130.5 uL, 5 umol/L SSR mark specific primer total volume 0.6 uL respectively, concentration 20 ng-30 ng/uL extracted template DNA 1.2 uL, ddH 2 O 5.2μL；
And (3) PCR reaction conditions: 5min at 95 ℃; 30second, at 95 ℃, 30second, at 59 ℃, 30second, at 72 ℃, for 30 cycles; 5min at 95 ℃; 30second at 95 ℃, 30second at 53 ℃, 30second at 72 ℃,10 cycles; 30min at 60 ℃.
(4) And (3) electrophoresis detection: mixing 1 μ L of the product obtained by PCR amplification with 9 μ L of sample buffer solution, denaturing at 95 deg.C for 3min, and cooling in ice water mixture for 3min; 3 mu L of sample is applied to a modified polyacrylamide gel for electrophoresis, the modified polyacrylamide gel is commercial POP7 gel, the electrophoresis buffer solution is 3730buffer EDTA, the injection voltage is 2000V, the operation voltage is 15000V, the sample injection time is 10s, the temperature is 60 ℃, the length of a capillary is 50cm, the power is 200W, the electrophoresis is 20min, the current and the power are dynamic,
(5) Analysis of results
PCR amplification and capillary electrophoresis are carried out on the hypsizigus marmoreus strain by adopting 6 pairs of SSR primers, and the combination of Fu Gebian is found by analyzing the allelic gene factors (Na, ne), the Nei's genetic diversity index (He), the shannon's diversity information index (I) and the gene observation heterozygosity (Ho) and combining the peak diagram of the relative molecular weight of the allelic site: HMSSR11, HMSSR12, HMSSR32, HMSSR35, HMSSR36, HMSSR38, the corresponding banding patterns being: (4+9)/(1+2)/(3+7)/(4+8)/(1+3)/(4+7), and the strain was identified as "Huzhen 18" of Hypsizygus marmoreus. To ensure the accuracy of the identification, three replicates were recommended.
In the case of several main commercial varieties, the peak patterns of the relative molecular weights of the allelic sites obtained by sequential detection of 6 pairs of primers are shown in FIGS. 1 to 6 (sequentially (1) Huzhen No. 18 (2; K (3))
B4)。
The fingerprint spectrum of the invention refers to the combination of the primer and the band type thereof.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> SSR marker fingerprint of hypsizigus marmoreus hunger No. 18 strain and construction method and application thereof
<130> 2021020504-zf-wjn
<141> 2021-02-05
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggagtttgag ttgaggcagc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgaaccaga ccaaagaccg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggcacggaca tagacctcat 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtggtggtgt gacgacgtat 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aacctccagt cacaacctgc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccttgcttct tgtcggatgt 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tccgtgagag gacggagtag 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctcagcaacg acgaacaacc 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcttcttgta gagcgcctcg 20
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tcttcttgtt cggcggtatc 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atccggcaca ggtaaagatg 20
Claims (2)
1. A fingerprint identification method of SSR markers of hypsizigus marmoreus Huzhen No. 18 strain is characterized by comprising the following steps: the fingerprint consists of 6 SSR marker loci, and the specific sequences of 6 pairs of corresponding primers are as follows:
HMSSR11 forward primer: GGAGTTTGAGTTGAGGCAGC;
reverse primer: ATGAACCAGACCAAAGACCG;
HMSSR12 forward primer: GGCACGGACATAGACCTCAT;
reverse primer: GTGGTGGTGTGACGACGTAT;
HMSSR32 forward primer: AACCTCCAGTCACAACCTGC;
reverse primer: CCTTGCTTCTTGTCGGATGT;
HMSSR35 forward primer: TCCGTGAGAGGACGGAGTAG;
reverse primer: CTCAGCAACGACGAACAACC;
HMSSR36 forward primer: TCTTCTTGTAGAGCGCCTCG;
reverse primer: CTCTCGACGCGTGTTCCT;
HMSSR38 forward primer: TCTTCTTGTTCGGCGGTATC;
reverse primer: ATCCGGCACAGGTAAAGATG;
the corresponding combination of the belt type numbers is as follows: (4+9)/(1+2)/(3+7)/(4+8)/(1+3)/(4+7); the belt type number corresponding to the primer HMSSR11 is 4+9, the size of the belt of the allele segment corresponding to the number 4 is 275-275.99bp, and the size of the belt of the allele segment corresponding to the number 9 is 291-291.99bp;
the belt type number corresponding to the primer HMSSR12 is 1+2, wherein the size of the belt of the allele segment corresponding to the number 1 is 215 to 215.99bp, and the size of the belt of the allele segment corresponding to the number 2 is 225 to 225.99bp;
the corresponding band type number of the primer HMSSR32 is 3+7, wherein the band size of the allelic gene fragment corresponding to the number 3 is 227 to 227.99bp, and the band size of the allelic gene fragment corresponding to the number 7 is 236 to 236.99bp;
the belt type number corresponding to the primer HMSSR35 is 4+8, wherein the size of the belt of the allele segment corresponding to the number 4 is 127 to 127.99bp, and the size of the belt of the allele segment corresponding to the number 8 is 132 to 132.99bp;
the belt type number corresponding to the primer HMSSR36 is 1+3, wherein the size of the belt of the allele fragment corresponding to the number 1 is 152 to 152.99bp, and the size of the belt of the allele fragment corresponding to the number 3 is 155 to 155.99bp;
the band type number corresponding to the primer HMSSR38 is 4+7, wherein the size of the band of the allele segment corresponding to the number 4 is 177 to 177.99bp, and the size of the band of the allele segment corresponding to the number 7 is 189 to 189.99bp;
the preservation number of the hypsizigus marmoreus Huyan No. 18 strain is CGMCC No.17796.
2. The use of the SSR-labeled fingerprint of hypsizygus marmoreus hunger No. 18 strain according to claim 1, wherein the SSR-labeled fingerprint comprises the following components: the SSR-labeled fingerprint of the hypsizygus marmoreus Huzhen 18 strain is used for identifying the specific allelic variation of the hypsizygus marmoreus Huzhen 18 strain and/or identifying the specificity of the hypsizygus marmoreus Huzhen 18 strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110164016.6A CN112795686B (en) | 2021-02-05 | 2021-02-05 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110164016.6A CN112795686B (en) | 2021-02-05 | 2021-02-05 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112795686A CN112795686A (en) | 2021-05-14 |
| CN112795686B true CN112795686B (en) | 2023-02-28 |
Family
ID=75814644
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110164016.6A Active CN112795686B (en) | 2021-02-05 | 2021-02-05 | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112795686B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112126702A (en) * | 2020-09-21 | 2020-12-25 | 东营市菇健生物科技有限公司 | White beech mushroom GJ7 strain and SSR marker primer and application thereof |
| CN112280687A (en) * | 2020-09-21 | 2021-01-29 | 东营市菇健生物科技有限公司 | Mushroom-Jian-Hypsizygus marmoreus GJ5 strain, SSR marker primer and application thereof |
-
2021
- 2021-02-05 CN CN202110164016.6A patent/CN112795686B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112126702A (en) * | 2020-09-21 | 2020-12-25 | 东营市菇健生物科技有限公司 | White beech mushroom GJ7 strain and SSR marker primer and application thereof |
| CN112280687A (en) * | 2020-09-21 | 2021-01-29 | 东营市菇健生物科技有限公司 | Mushroom-Jian-Hypsizygus marmoreus GJ5 strain, SSR marker primer and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| SSR特异标记在真姬菇中的可传递性;许占伍等;《上海农业学报》;20100515;第26卷(第02期);第42-45页 * |
| 真姬菇微卫星分子标记的开发及其种质资源分析;董岩;《中国优秀硕士学位论文全文数据库 农业科技辑》;20111215(第S1期);摘要、第二-三章材料部分、第四章、表4.1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112795686A (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112746125A (en) | SSR marker fingerprint of hypsizigus marmoreus hunhua No. 8 strain and construction method and application thereof | |
| CN113005219A (en) | SSR marker fingerprint identification method of hypsizigus marmoreus Rongbai 001(F) strain, construction method and application thereof | |
| CN112795686B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof | |
| CN112695130B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof | |
| CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
| CN112813183B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-6 strain and construction method and application thereof | |
| CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112695129B (en) | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof | |
| CN112760406B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM22 strain as well as construction method and application thereof | |
| CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112813182B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 23 strain as well as construction method and application thereof | |
| CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
| CN112746126B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-7 strain as well as construction method and application thereof | |
| CN112877458B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM36 strain as well as construction method and application thereof | |
| CN112795687B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM21 strain as well as construction method and application thereof | |
| CN112795688B (en) | SSR (simple sequence repeat) marker fingerprint spectrum of hypsizigus marmoreus HM13 strain as well as construction method and application thereof | |
| CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof | |
| CN112708695B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-W-247 strain and construction method and application thereof | |
| CN112695131B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 29 strain of hypsizigus marmoreus, construction method and application thereof | |
| CN112980991B (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 30 strain of hypsizigus marmoreus, construction method and application thereof | |
| CN112795682B (en) | SSR (simple sequence repeat) marker fingerprint of Shanghai Zhen 6 strain of hypsizigus marmoreus, construction method and application thereof | |
| CN112760407B (en) | SSR (simple sequence repeat) marker fingerprint of hypsizigus marmoreus HM37 strain, and construction method and application thereof | |
| CN112795683A (en) | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 20 strain and construction method and application thereof | |
| CN112795685A (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 11 strain and construction method and application thereof | |
| CN112760404A (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-5 strain and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |